- Email: [email protected]
Maternal antibody induced by recombinant gp85 protein vaccine adjuvanted with CpG-ODN protects against ALV-J early infection in chickens
Vaccine 31 (2013) 6144–6149
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Maternal antibody induced by recombinant gp85 protein vaccine adjuvanted with CpG-ODN protects against ALV-J early infection in chickens Wenwen Dou 1 , Hongmei Li 1 , Ziqiang Cheng, Peng Zhao, Jianzhu Liu, Zhizhong Cui, Haigang Liu, Weifang Jing, Huijun Guo ∗ Key Laboratory of Animal Biotechnology and Disease Control and Prevention, College of Animal Science and Veterinary Medicine, Shandong Agricultural University, Tai’an 271018, PR China
a r t i c l e
i n f o
Article history: Received 21 March 2013 Received in revised form 8 June 2013 Accepted 19 June 2013 Available online 2 July 2013 Keywords: Subgroup J avian leukosis virus (ALV-J) Recombinant gp85 protein CpG-ODN Maternal antibody Immunoprotection
a b s t r a c t In this study, the efficacy of a recombinant protein vaccine encoding the gp85 gene from the subgroup J avian leukosis virus (ALV-J) co-administered with cytosine-phosphate-guanine oligodeoxynucleotide (CpG-ODN) or Freund’s adjuvants was investigated for the protection against early ALV-J infection in chickens. The gp85 gene from ALV-J was amplified using polymerase chain reaction (PCR), and the recombinant protein was expressed in Escherichia coli. The purified recombinant protein was injected intramuscularly into the breeder hens along with CpG-ODN or Freund’s adjuvants, and the antibodies in the serum were assayed regularly post inoculation. The fertilized eggs from the vaccinated hens were hatched, the hatched chickens were challenged with 102.2 50% tissue culture infective dose (TCID50) ALVJ on 1 day, and the maternal antibodies in the hatched chickens were examined regularly before and after the challenge. The viremia was determined weekly, and a histopathological analysis of the immunosuppressive lesions was performed. The results suggest that the gp85 recombinant protein was successfully prepared and was inoculated with CpG-ODN adjuvant into breeder hens to induce serological antibody against ALV-J in the hens and in the hatched chickens. The positive maternal antibodies in the hatched chickens provided effective protection for most chickens against viremia and dramatically decreased the number of immunosuppressive lesions; these protective effects were better than those of the gp85 recombinant protein plus Freund’s adjuvant. The data will provide a scientific basis for the application of the ALV-J subunit vaccine to control ALV-J infection in chicken flocks. © 2013 Elsevier Ltd. All rights reserved.
1. Introduction Subgroup J avian leukosis virus (ALV-J) can induce predominantly myeloid leukosis (ML) and immunosuppression effects, such as growth retardation, the abnormal development of immune organs, decreased immune responses, etc., in both naturally and experimentally infected flocks [1,2] and has caused severe economic losses worldwide since the 1990s [3]. In China, the infection of broilers with ALV-J was first detected and officially recognized in 1999 [4], followed by some reports of the infection of meat-type and local chickens in a number of areas in China [5,6]. Interestingly, since 2008, the ALV-J infection in Chinese layer flocks has become widespread and cases of ALV-J infection and tumors in commercial
∗ Corresponding author at: Shandong Agricultural University, 61 Daizong Street, Tai’an 271018, PR China. Tel.: +86 538 8249222-8208; fax: +86 538 8241419. E-mail address: [email protected] (H. Guo). 1 Authors contributed equally. 0264-410X/$ – see front matter © 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.vaccine.2013.06.058
layer chickens and breeders of egg-type chickens have continued to emerge in China [7–9]. It is necessary and imperative to take measures to prevent and control ALV-J infection in chicken flocks; however, vaccines that are effective in protecting against ALV-J infection have not been reported until now. Because ALV-J is an RNA virus and the attenuated vaccine poses high risk for reactivation and infection, the inactivated vaccine cannot produce enough antibodies to protect against ALV-J infection (unpublished data). A number of studies have suggested that cytosine-phosphate-guanine oligodeoxynucleotide (CpG-ODN) enhances the immune response and protection induced by several recombinant protein and DNA vaccines against certain pathogens [10–13]; however, it is unclear whether CpG-ODN can enhance the immune responses and protection afforded by recombinant protein vaccines containing ALV-J gp85 protein. In this study, the enhancing effects of CpG-ODN on the immune protection of a prepared subunit vaccine containing ALV-J gp85 protein were compared with those of Freund’s adjuvants.
W. Dou et al. / Vaccine 31 (2013) 6144–6149
It is known that ALV-J causes losses of chicken flocks mainly due to vertical and early horizontal infections, where the latter in particular is the most important infection pathway of ALV-J among chicken flocks [14]. This study shows that the maternal antibodies from breeder hens vaccinated with a prepared subunit vaccine containing gp85 protein with adjuvants effectively protected hatched chickens against early infection by ALV-J. 2. Materials and methods 2.1. Virus, plasmids, antibodies, and adjuvants The ALV-J-NX0101 strain was isolated from a commercial broiler chicken house in the Ningxia Province of China [15]. The pMD18-T simple vector was purchased from Dalian Takara Biotechnology Co., Ltd. (Dalian, China) and was used for plasmid-cloning experiments. The pET32a expression vector was obtained commercially (Invitrogen, Shanghai, China) and was used for gp85 gene expression. Prof. Zhizhong Cui donated the gp85-specific mouse monoclonal antibody (MAb JE9). The CpG sequence TCGTCGTTTTGTCGTTTTGTCGTT was synthesized using a phosphorothioate backbone at Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). Each CpG-ODN was diluted appropriately and emulsified. The Freund’s adjuvant used in this study included complete Freund’s adjuvant and incomplete Freund’s adjuvant, both purchased from the Sigma Company (Beijing, China). 2.2. Chickens Hy-Line Brown layer breeder hens were purchased from Shandong Yisheng Livestock & Poultry Breeding Co., Ltd. (Shandong Province, China) and housed in a clean and comfortable room. Before the start of the experiment, ALV-J-antibody ELISA (IDEXX USA Inc., Beijing, China) and ALV-J viremia assays were performed to confirm that each hen was negative for the ALV-J antibody and virus. The Animal Ethics Committee at the Shangdong Province Animal Protection and Welfare Institute approved the animal experiments. 2.3. Expression and purification of recombinant fusion proteins The primers were designed according to the ALV-J-NX0101 gp85 gene sequence published in GenBank (Number AY897227) and synthesized. The gp85 gene was amplified using the forward primer (5 -CGCG GATCCGGAGTTCATCTGTTGCAACAACCA-3 ) and the reverse primer (5 -CCCAAGCTTGGC GCCTGCTACGGCGGTG-3 ) with proviral cDNA extracted from ALV-J infected cells as the template. The PCR product was cloned into the pMD18T vector to generate the recombinant clone vector pMD18T-gp85, which was then amplified in E. coli (DH5␣). The construct was confirmed by DNA sequencing. The recombinant ALV-J gp85 gene was expressed in BL21 (DE3) cells (Invitrogen, Carlsbad, CA, USA). The cells were transformed with the pET32a(+)-gp85 DNA and were grown at 37 ◦ C in Luria broth (LB) medium containing 0.5% glucose and carbenicillin (50 g/mL). Protein expression was induced using 1 mM IPTG. The cells were harvested at 3 h post induction and were lysed in lysis buffer (150 mM NaCl, 100 mM Tris–Cl, 1 mM phenylmethanesulfonyl fluoride (PMSF), 1 mg/mL lysozyme, and 1% glycerol; pH 8.0). The soluble fraction was harvested and applied to a high-affinity Ni-NTA column (GenScript USA Inc., Nanjing, China). The eluted proteins were further purified by running the eluate through an SD200 gel filtration column (GenScript USA Inc., Nanjing, China) twice, with and without 1% nadeoxycholate, to remove the endotoxins. The purity of the proteins was evaluated by SDS-PAGE in 12% polyacrylamide gels, and the proteins were identified by western
6145
blot analysis using the gp85-specific mouse monoclonal antibody JE9. 2.4. Protein concentration assay The protein concentration was determined by performing thinlayer chromatography scanning and the Bradford total protein content assay using the Bio-Rad Protein Assay kit (Bio-Rad); bovine serum albumin (BSA) was used as the standard. 2.5. Immunization of chickens The layer breeder hens (aged 30 weeks, 30 in total) were randomly divided into three groups: control group, gp85 + F group, and gp85 + C group. Each group contained 10 hens, and each group was maintained in a clean and comfortable room. The chickens in each group were immunized twice at 2-week intervals. The chickens in the control group were inoculated with PBS and used as the negative control. The vaccines applied to each hen were prepared as Freund’s adjuvant emulsions containing 600 g recombinant gp85 protein for the gp85 + F group and as CpG-ODN adjuvant emulsions containing 600 g recombinant gp85 protein plus 300 g CpG-ODN for the gp85 + C group. The vaccines were injected intramuscularly into each hen in the three groups. After the first vaccination, the serum samples were collected from each hen at weekly intervals for up to 11 weeks. The fertilized eggs were collected from each hen at 3 weeks after the booster vaccination and were hatched in a dedicated chicken incubator. 2.6. Evaluation of maternal antibody protection against ALV-J challenge in the hatched chickens The 10 hatched chickens from each group were challenged intraperitoneally with 102.2 TCID50 of the ALV-JNX0101 strain at 1 day of age, and the chickens were monitored daily for signs of illness. ALV-J and the serological antibody in the blood of hatched chickens were detected at weekly intervals. ALV-J in the spleens and immunosuppressive lesions were examined at the end of the breeding experiment. 2.7. Investigation of serological antibody To determine the anti-ALV-J antibody titers in the sera, a commercial ALV-J antibody test kit (IDEXX USA Inc., Beijing, China) was used in accordance with the manufacturer’s protocol. The relative antibody titer level in the serum was determined by calculating the sample to positive (S/P) ratio [(mean of sample optical density) − (mean of negative control optical density)]/[(mean of positive control optical density) − (mean of negative control optical density)]. The sera from each group were tested in triplicate, and the serum samples with a sample to positive (S/P) ratio higher than 0.6 were considered ALV-J antibody positive. 2.8. ALV viremia detection The DF1 cells were inoculated with the plasma samples from the hens and hatched chickens, and following incubation at 38.5 ◦ C and 5% CO2 for 7 days, the cells were checked for the presence of the virus using ALV P27 antigen ELISA test kits (IDEXX USA Inc., Beijing, China). The relative antigen titer level was determined by calculating the sample to positive (S/P) ratio using the formula shown in Section 2.7. The samples from each group were tested in triplicate, and the plasma samples with a sample to positive (S/P) ratio higher than 0.2 were considered virus positive.
6146
W. Dou et al. / Vaccine 31 (2013) 6144–6149
Fig. 1. PCR amplification of the recombinant plasmid containing the gp85 gene (A), recombinant plasmid identification using double enzyme digestion (B), purification of the expressed products (C), and western blot analysis of the recombinant protein (D). Note. (A) M, DNA markers; 1, positive recombinant plasmid; (B) M, DNA markers; 1, fragments after digestion of the recombinant plasmid with restriction enzymes EcoR I and HindIII; (C) M, protein markers; 1, before purification; 2, after purification; (D) M, protein marker ladder with two colors; 1, western blot using MAb JE9. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
2.9. ALV-J detection in the spleen using IFA The spleens from the dead or killed chickens in the three groups were prepared and each was tested for ALV-J using IFA mediated by ALV-J gp85 monoclonal antibody. Briefly, the slices of tissue were dipped into a confining liquid for 30 min. The confining liquid was discarded, and the ALV-J monoclonal antibody JE9 (diluted 1:20 in PBS) was added directly to the samples, without washing, for 1 h at 37 ◦ C. The tissue samples were washed three times with PBS, and the FITC-labeled anti-mouse antibody (dilution 1:200) (Sigma) was added. The samples were placed in a wet box for 1 h at 37 ◦ C and washed three times with PBS, and a small amount of 50% PBS glycerol mounting solution was added. The samples were viewed under a fluorescence microscope. The samples exhibiting green fluorescence in the cytoplasm were considered positive for ALV-J.
digestion and sequencing results confirmed that the recombinant plasmid was constructed successfully.
3.2. Expression, purification and western blot analysis of recombinant gp85 gene in E. coli The recombinant gene was expressed in E. coli, and the Histagged proteins were purified using high-affinity chromatography followed by gel filtration chromatography. The expression and purity of the recombinant protein was confirmed by SDS-PAGE (Fig. 1C) and western blot analysis using the gp85-specific MAb (Fig. 1D). The purity of the recombinant fusion protein was not less than 95%, and the protein concentration was determined using thin-layer chromatography scanning and the Bradford total protein content assay.
2.10. Detection of immunosuppressive lesions in chickens The chickens were weighed at 45 days post challenge, the spleen and bursa were weighed, and the development indices of the spleen and bursa were calculated using the following equation: (spleen weight)/(body weight) or (bursa weight)/(body weight) × 100, respectively. 2.11. Data analysis The data are represented by the means ± standard deviation (X¯ ± SD). The inter-group differences were analyzed using ANOVA software followed by Student–Newman–Keuls tests of multiple comparisons. Values of P < 0.05 were considered statistically significant. 3. Results 3.1. Construction of recombinant plasmids Fig. 1A shows the PCR amplification of the ALV-J-NX0101 gp85 gene (expected size 909 bp). The cloning of the segment into the plasmid was confirmed using restriction endonuclease digestion and gel electrophoresis (Fig. 1B). Both the restriction endonuclease
3.3. Antibody responses to ALV-J in breeder hens immunized with gp85 recombinant protein plus CpG-ODN or Freund’s adjuvants In our previous studies, double inoculations of the ALV-J gp85 recombinant protein induced chickens to produce specific antibodies against ALV-J; however, the titer was low and the antibodies persisted for less than 1 week (unpublished data). The results in Fig. 2 shows that, in this study, the gp85 recombinant protein plus CpG-ODN adjuvant stimulated the breeder hens to rapidly produce antibodies against ALV-J, and the antibody titers increased significantly following the booster vaccination at 2 weeks. The highest antibody titers were observed at week 2 after the booster vaccination, and the average S/P value of antibody titers were 1.66 ± 0.70 (n = 10). The antibody positive ratio was 10/10 in the gp85 + C group, and according to the positive critical value obtained using the ALVJ antibody ELISA kit (IDEXX), the positive antibodies persisted for more than 5 weeks. In contrast, in the gp85 + F group, the highest antibody titers were 1.10 ± 0.58 (n = 10) and the antibody positive ratio was 8/10 at 4 weeks post booster vaccination and the positive antibodies lasted only 3 weeks, values that were dramatically lower than those of the gp85 + C group. The results suggest that the CpGODN enhanced the humoral responses of the gp85 recombinant protein more than Freund’s adjuvants.
W. Dou et al. / Vaccine 31 (2013) 6144–6149
6147
Table 1 The positive viremia ratios (P.V.R.) and protection ratios (P.R.) in the hatched chickens from 7 to 28 d after challenge with ALV-J. 7 dpi
Control gp85 + F gp85 + C
14 dpi
28 dpi
P.R. (%)
P.V.R.
P.R. (%)
P.V.R.
P.R. (%)
9/10 4/10 3/10
10% 60% 70%
5/10 3/10 3/10
50% 70% 70%
7/9 3/10 2/9
22.2% 70% 77.8%
control
S/P value
21 dpi
P.V.R.
gp85+F
P.V.R. 6/8 4/9 2/9
P.R. (%) 25% 55.6% 77.8%
positive rate is 3/10); however, the titers were lower than those produced by the recombinant protein plus CpG-ODN vaccine.
gp85+C
1.8 1.5
3.5. Maternal antibodies protection against ALV-J early infection
1.2
The viremias were determined weekly starting on day 7 after the challenge until day 28, and the results are shown in Table 1. The results suggest that the positive ratio of viremias was 90% in the control chickens at 7 days post infection (dpi), 40% in the gp85 + F group chickens, and 30% in the gp85 + C group chickens. The positive ratio of viremias in the control group remained greater than that in the other vaccinated groups until the end of the experiment. Of the 10 chickens in the control group, 2 died from the ALV-J challenge during the 28-day experiment, and in each vaccinated group, 1 chicken died; all of the dead chickens tested positive for viremias and for ALV-J in the spleen (detected using IFA, Fig. 4A). The results suggest that the maternal antibody induced by the gp85 recombinant protein plus adjuvants protected most chickens against ALV-J early infection.
0.9 0.6 0.3 0.0
w.p.f.i
Booster inoculation
1 w 2w
3w
4w
5w
6w
7w
8w
9w 1 0w 1 1 w
Fig. 2. Serum antibody against ALV-J detected weekly in breeder hens vaccinated with gp85 recombinant protein vaccines plus CpG-ODN or Freund’s adjuvants post the first inoculation. Note. w.p.f.i., weeks post first inoculation; the line with the red arrow indicates the positive critical value determined using the IDEXX ELISA test kit; serum antibody was detected from 1 week to 11 weeks post the first inoculation with IDEXX ELISA test kit, and booster inoculation was conducted at the 2nd w.p.f.i.; the serum samples with a sample to positive (S/P) ratio higher than 0.6 were considered ALV-J antibody positive. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.6. Maternal antibody protects against immunosuppressive lesions caused by ALV-J infection
3.4. Detection of maternal antibodies against ALV-J To determine whether the gp85 recombinant protein plus the adjuvants stimulated the breeder hens to produce maternal antibodies in their offspring, the fertilized eggs at the 3rd week post the booster vaccination were hatched, and the serum samples from 10 hatched chickens in each group were tested for antibodies against ALV-J weekly starting at age 1 day to age 35 days. The results shown in Fig. 3 suggest that the gp85 recombinant protein plus the CpG-ODN adjuvant induced the breeder hens to produce maternal antibodies in the hatched chickens (the antibody positive rate is 7/10). Based on the results in Fig. 3, we deduced that the positive maternal antibody in the serum of the hatched chickens persisted for approximately 3 days and decreased rapidly to levels similar to those of the control chickens. The recombinant protein plus Freund’s adjuvant also produced maternal antibodies (the antibody
S/P value
control
gp85+F
gp85+C
1.0
As shown in Table 2, the average body weights of the chickens in the gp85 + C and gp85 + F groups were significantly greater than the average body weight of those in the control group (P < 0.05). The average weights and development indices of the spleen and bursa in the vaccinated groups were higher than those in the control group; however, the differences were not statistically significant (P > 0.05). In the vaccinated groups, the average weights and development indices were higher in the gp85 + C group than in the gp85 + F group, which may be related to the higher maternal antibody titer in the gp85 + C group. 3.7. Safety evaluation of vaccine The emulsifier (0.2 mL) containing the gp85 recombinant protein plus the CpG-ODN or Freund’s adjuvants was injected into the leg muscle of the breeder hens. Mortality, signs of disease, and effects on egg-laying were not observed during the 11 weeks of the investigation. 4. Discussion
0.8 0.6 0.4 0.2 0.0
Days age
1d
7d
14d
21d
28d
35d
Fig. 3. Serum antibodies against ALV-J in the hatched chickens assayed weekly from age 1 to 25 d. Note. The fertilized eggs for hatching were collected from the hens at 3 weeks post booster vaccination; the serum antibody in hatched chickens was determined using the IDEXX ELISA test kit; the line with the red arrow indicates the positive critical value determined using the IDEXX ELISA test kit. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
In China, ALV-J is present in many chicken species, such as meattype chickens, layer chickens, and local breeder flocks [4–9], and has become a serious threat to the preservation of local breeder flocks. Studies indicate that the extensive spread of ALV-J among chicken flocks is mainly due to vertical and early horizontal infections [14]. Breeder hens or cocks with ALV-J can infect offspring via the reproductive tract or eggs, and hatched chickens with ALVJ can infect other non-infected chickens via their dung or cloacal secretions. In contrast, the probability of ALV-J infection between adult chickens is rather low [14,16]. This study focused mainly on the protective effects of the maternal antibody, induced by the gp85 recombinant protein, against ALV-J early infection in hatched chickens.
6148
W. Dou et al. / Vaccine 31 (2013) 6144–6149
Fig. 4. The distribution of the virus in the spleen slices detected using IFA mediated by MAb JE9 ((A) positive sample from control group chickens for ALV-J indicated with green fluorescence; (B) negative sample from gp85 + C group chickens for ALV-J; magnification 400×). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Table 2 Maternal antibody protects against immunosuppressive lesions in hatched chickens on 45 days after ALV-J challenge (X¯ ± SD). N
Control gp85 + F gp85 + C
8 9 9
Body weight (g)
348 ± 112 428 ± 183* 560 ± 159*
Spleen
Bursa
Weight (g)
Indices (%)
Weight (g)
Indices (%)
0.76 ± 0.22 1.21 ± 0.72 1.51 ± 0.65
0.22 ± 0.02 0.27 ± 0.09 0.27 ± 0.09
0.80 ± 0.52 1.14 ± 1.00 1.72 ± 0.84
0.21 ± 0.09 0.23 ± 0.12 0.30 ± 0.10
N, numbers of chickens; spleen (bursa) indices were calculated using the equation: spleen (bursa) weight/body weight × 100. * P < 0.05 compared with control group.
The gp85 protein, the main viral envelope protein, is the most variable of the structural proteins in the genome of ALV-J [17–19]. The protein is also associated with virus neutralization [20,21]. We used the gp85 gene sequence published in GenBank to design a pair of primers and amplified the target gene from the cDNA of ALV-JNX0101 strain, which is widespread in local chicken flocks in China [15,21]. The target gene was stably expressed in E. coli, and the expressed recombinant protein was recognized by the ALV-J gp85specific MAb JE9 (Fig. 1), confirming the successful construction of the gp85 recombinant protein. We have previously demonstrated that this recombinant protein induces vaccinated chickens to produce antibody with low titers and does not produce sufficient quantities of serum antibody (unpublished data). Therefore, it was important to enhance the immunogenicity of the gp85 recombinant protein and produce maternal antibody at high titers. Freund’s adjuvants and CpG-ODN adjuvant are both effective immunoadjuvants that enhance cellular and humoral immune responses [22,23]. CpG-ODNs have been shown to be very strong adjuvants in mice and promote Th1-type immune responses, often performing better than Freund’s adjuvant, which is the gold standard for inducing cell-mediated immune responses in rodents [24–26]. This study is the first to demonstrate that recombinant proteins containing gp85 protein plus CpG-ODN adjuvant can induce breeder hens not only to produce higher amounts of serum antibody against ALV-J – the positive antibody persisted for a longer period (Fig. 2) – but also to produce protective maternal antibody in hatched chickens’ sera (Fig. 3). Moreover, compared with the Freund’s adjuvants, the CpG-ODN adjuvant induced higher antibody titers. The average maternal antibody titers induced by gp85 recombinant protein plus CpG-ODN in the hatched chickens was 0.98 ± 0.22 and lasted for approximately three days; however, the antibodies induced significant protection against early ALV-J infection. The
positive viremia ratio in the absence of the maternal antibody was 90% and the mortality ratio was 20%, whereas the positive viremia ratio in the presence of the maternal antibody was 30% and the mortality ratio was 10% (Table 1). The chickens without the maternal antibody were challenged and demonstrated growth retardation and abnormal development of the immune organs, whereas the chickens with the maternal antibody demonstrated normal growth and development after being challenged with ALV-J (Table 2), which suggests that the maternal antibody reduced the immunosuppressive lesions caused by the ALV-J infection to a degree. Compared with the gp85 recombinant protein plus Freund’s adjuvants, the gp85 recombinant protein plus CpG-ODN could induce better immunoprotection. These results indicate that 70% of the hatched chickens were successfully protected against ALV-J early infection by immunizing breeder hens with recombinant protein vaccines plus CpG-ODN adjuvant. In summary, the gp85 recombinant protein was successfully generated and, when adjuvanted with CpG-ODN, induced breeder hens to produce effective maternal antibody that protected the hatched chickens against early ALV-J infection. This recombinant protein represents the first commercially effective subunit vaccine for the control of early infection of ALV-J in chickens. Conflict of interest statement The authors declare that they have no competing interests. Acknowledgments The study was supported by the earmarked fund Special Fund for Agro-scientific Research in the Public Interest (No. 201203055). We would like to thank Prof. Zhizhong Cui for his support.
W. Dou et al. / Vaccine 31 (2013) 6144–6149
References [1] Payne LN, Gillespie AM, Howes K. Recovery of acutely transforming viruses from myeloid leukosis induced by the HPRS-103 strain of avian leukosis virus. Avian Dis 1993;37:438–50. [2] Witter R. Avian tumor viruses: persistent and evolving pathogens. Acta Vet Hung 1997;45:261–6. [3] Fadly AM, Smith EJ. Isolation and some characteristics of an isolate associated with myeloid leukosis in meat-type chickens in the United States. Avian Dis 1999;43:391–400. [4] Du Y, Cui ZZ, Qin AJ. Subgroup J of avian leukosis viruses in China. China Poult Sci 1999;3:1–4. [5] Chen Z, Zhang L, Liu S, Zhang L, Cui Z. Emerging of avian leukosis virus subgroup J in a flock of Chinese local breed. Acta Microbiol Sin 2005;45: 584–7. [6] Sun SH, Cui ZZ. Epidemiological and pathological studies of subgroup J avian leukosis virus infections in Chinese local “yellow” chickens. Avian Pathol 2007;36:221–6. [7] Cheng Z, Liu J, Cui Z, Zhang L. Tumors associated with avian leukosis virus subgroup J in layer hens during 2007 to 2009 in China. J Vet Med Sci 2010;72:1027–33. [8] Gao YL, Qin LT, Pan W, Wang YQ, Qi XL, Gao HL, et al. Subgroup J avian leukosis virus in layer flocks in China. Emerg Infect Dis 2010;16:1637–8. [9] Lai HZ, Zhang HN, Ning ZY, Chen RA, Zhang WZ, Qin AJ, et al. Isolation and characterization of emerging subgroup J avian leukosis virus associated with hemangioma in egg-type chickens. Vet Microbiol 2011;3:1–9. [10] Vleugels B, Ververken C, Goddeeris BM. Stimulatory effect of CpG sequences on humoral response in chickens. Poult Sci 2002;81:1317–21. [11] Wang X, Jiang P, Deen S, Wu J, Liu X, Xu J. Efficacy of DNA vaccines against infectious bursal disease virus in chickens enhanced by coadministration with CpG oligodeoxynucleotide. Avian Dis 2003;47:1305–12. [12] Dalloul RA, Lillehoj HS, Klinman DM, Ding X, Min W, Heckert RA, et al. In ovo administration of CpG oligodeoxynucleotides and the recombinant microneme protein MIC2 protects against Eimeria infections. Vaccine 2005;23: 3108–13. [13] Mahmood MS, Siddique M, Hussain I, Khan A, Mansoor MK. Protection capability of recombinant plasmid DNA vaccine containing VP2 gene of highly virulent infectious bursal disease virus in chickens adjuvanted with CpG oligodeoxynucleotide. Vaccine 2006;24:4838–46.
6149
[14] Cui ZZ, Guo HJ, Sun SH. Prevalence situation and prevention and control of avian leukosis. Chin J Vet Drug 2009;43:37–41. [15] Zhang JY, Cui ZZ, Ding JB, Jiang SJ. Construction of infectious clone of subgroup J avian leukosis virus strain NX0101 and its pathogenicity. Acta Microbiol Sin 2005;45:437–40. [16] Sun BB, Cui ZZ, Zhang QC, Lou BH. Dynamics of viremia and antibody responses in chickens inoculated with ALV-J. Sci Agric Sin 2009;42:4069–76. [17] Venugopal K, Smith LM, Howes K, Payne LN. Antigenic variants of J subgroup avian leukosis virus: sequence analysis reveals multiple changes in the env gene. J Gen Virol 1998;79:757–66. [18] Silva RF, Fadly AM, Hunt HD. Hypervariability in the envelope genes of subgroup J avian leukosis viruses obtained from different farms in the United States. Virology 2000;272:106–11. [19] Pandiri AR, Mays JK, Silva RF, Hunt HD, Reed WM, Fadly AM. Subgroup J avian leukosis virus neutralizing antibody escape variants contribute to viral persistence in meat-type chickens. Avian Dis 2010;54:848–56. [20] Wang XP, Qun K, Qin AJ, Shen HY, Wang PP, Jin WJ, et al. Recombinant avian leukosis viruses of subgroup J isolated from field infected commercial layer chickens with hemangioma and myeloid leukosis possess an insertion in the E element. Vet Res Commun 2010;34:619–32. [21] Pan W, Gao YL, Qin LT, Ni W, Liu ZS, Yun BL, et al. Genetic diversity and phylogenetic analysis of glycoprotein GP85 of ALV-J isolates from Mainland China between 1999 and 2010: coexistence of two extremely different subgroups in layers. Vet Microbiol 2012;156:205–12. [22] Stills Jr HF. Adjuvants and antibody production: dispelling the myths associated with Freund’s complete and other adjuvants. ILAR J 2005;46:280–93. [23] Davis HL, Weeratna R, Waldschmidt TJ, Tygrett L, Schorr J, Krieg AM, et al. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J Immunol 1998;160:870–6. [24] Liu Y, Luo X, Yang CT, Yu SK, Xu HL. Three CpG oligodeoxynucleotide classes differentially enhance antigen-specific humoral and cellular immune responses in mice. Vaccine 2011;29:5778–84. [25] Mutwiri G, den Hurk SDL, Babiuk LA. Approaches to enhancing immune responses stimulated by CpG oligodeoxynucleotides. Adv Drug Deliv Rev 2009;61:226–32. [26] Mutwiri G, Benjamin P, Soita H, Babiuk LA. Co-administration of polyphosphazenes with CpG oligodeoxynucleotides strongly enhances immune responses in mice immunized with Hepatitis B virus surface antigen. Vaccine 2008;26:2680–8.
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
Maternal antibody induced by recombinant gp85 protein vaccine adjuvanted with CpG-ODN protects against ALV-J early infection in chickens Wenwen Dou 1 , Hongmei Li 1 , Ziqiang Cheng, Peng Zhao, Jianzhu Liu, Zhizhong Cui, Haigang Liu, Weifang Jing, Huijun Guo ∗ Key Laboratory of Animal Biotechnology and Disease Control and Prevention, College of Animal Science and Veterinary Medicine, Shandong Agricultural University, Tai’an 271018, PR China
a r t i c l e
i n f o
Article history: Received 21 March 2013 Received in revised form 8 June 2013 Accepted 19 June 2013 Available online 2 July 2013 Keywords: Subgroup J avian leukosis virus (ALV-J) Recombinant gp85 protein CpG-ODN Maternal antibody Immunoprotection
a b s t r a c t In this study, the efficacy of a recombinant protein vaccine encoding the gp85 gene from the subgroup J avian leukosis virus (ALV-J) co-administered with cytosine-phosphate-guanine oligodeoxynucleotide (CpG-ODN) or Freund’s adjuvants was investigated for the protection against early ALV-J infection in chickens. The gp85 gene from ALV-J was amplified using polymerase chain reaction (PCR), and the recombinant protein was expressed in Escherichia coli. The purified recombinant protein was injected intramuscularly into the breeder hens along with CpG-ODN or Freund’s adjuvants, and the antibodies in the serum were assayed regularly post inoculation. The fertilized eggs from the vaccinated hens were hatched, the hatched chickens were challenged with 102.2 50% tissue culture infective dose (TCID50) ALVJ on 1 day, and the maternal antibodies in the hatched chickens were examined regularly before and after the challenge. The viremia was determined weekly, and a histopathological analysis of the immunosuppressive lesions was performed. The results suggest that the gp85 recombinant protein was successfully prepared and was inoculated with CpG-ODN adjuvant into breeder hens to induce serological antibody against ALV-J in the hens and in the hatched chickens. The positive maternal antibodies in the hatched chickens provided effective protection for most chickens against viremia and dramatically decreased the number of immunosuppressive lesions; these protective effects were better than those of the gp85 recombinant protein plus Freund’s adjuvant. The data will provide a scientific basis for the application of the ALV-J subunit vaccine to control ALV-J infection in chicken flocks. © 2013 Elsevier Ltd. All rights reserved.
1. Introduction Subgroup J avian leukosis virus (ALV-J) can induce predominantly myeloid leukosis (ML) and immunosuppression effects, such as growth retardation, the abnormal development of immune organs, decreased immune responses, etc., in both naturally and experimentally infected flocks [1,2] and has caused severe economic losses worldwide since the 1990s [3]. In China, the infection of broilers with ALV-J was first detected and officially recognized in 1999 [4], followed by some reports of the infection of meat-type and local chickens in a number of areas in China [5,6]. Interestingly, since 2008, the ALV-J infection in Chinese layer flocks has become widespread and cases of ALV-J infection and tumors in commercial
∗ Corresponding author at: Shandong Agricultural University, 61 Daizong Street, Tai’an 271018, PR China. Tel.: +86 538 8249222-8208; fax: +86 538 8241419. E-mail address: [email protected] (H. Guo). 1 Authors contributed equally. 0264-410X/$ – see front matter © 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.vaccine.2013.06.058
layer chickens and breeders of egg-type chickens have continued to emerge in China [7–9]. It is necessary and imperative to take measures to prevent and control ALV-J infection in chicken flocks; however, vaccines that are effective in protecting against ALV-J infection have not been reported until now. Because ALV-J is an RNA virus and the attenuated vaccine poses high risk for reactivation and infection, the inactivated vaccine cannot produce enough antibodies to protect against ALV-J infection (unpublished data). A number of studies have suggested that cytosine-phosphate-guanine oligodeoxynucleotide (CpG-ODN) enhances the immune response and protection induced by several recombinant protein and DNA vaccines against certain pathogens [10–13]; however, it is unclear whether CpG-ODN can enhance the immune responses and protection afforded by recombinant protein vaccines containing ALV-J gp85 protein. In this study, the enhancing effects of CpG-ODN on the immune protection of a prepared subunit vaccine containing ALV-J gp85 protein were compared with those of Freund’s adjuvants.
W. Dou et al. / Vaccine 31 (2013) 6144–6149
It is known that ALV-J causes losses of chicken flocks mainly due to vertical and early horizontal infections, where the latter in particular is the most important infection pathway of ALV-J among chicken flocks [14]. This study shows that the maternal antibodies from breeder hens vaccinated with a prepared subunit vaccine containing gp85 protein with adjuvants effectively protected hatched chickens against early infection by ALV-J. 2. Materials and methods 2.1. Virus, plasmids, antibodies, and adjuvants The ALV-J-NX0101 strain was isolated from a commercial broiler chicken house in the Ningxia Province of China [15]. The pMD18-T simple vector was purchased from Dalian Takara Biotechnology Co., Ltd. (Dalian, China) and was used for plasmid-cloning experiments. The pET32a expression vector was obtained commercially (Invitrogen, Shanghai, China) and was used for gp85 gene expression. Prof. Zhizhong Cui donated the gp85-specific mouse monoclonal antibody (MAb JE9). The CpG sequence TCGTCGTTTTGTCGTTTTGTCGTT was synthesized using a phosphorothioate backbone at Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). Each CpG-ODN was diluted appropriately and emulsified. The Freund’s adjuvant used in this study included complete Freund’s adjuvant and incomplete Freund’s adjuvant, both purchased from the Sigma Company (Beijing, China). 2.2. Chickens Hy-Line Brown layer breeder hens were purchased from Shandong Yisheng Livestock & Poultry Breeding Co., Ltd. (Shandong Province, China) and housed in a clean and comfortable room. Before the start of the experiment, ALV-J-antibody ELISA (IDEXX USA Inc., Beijing, China) and ALV-J viremia assays were performed to confirm that each hen was negative for the ALV-J antibody and virus. The Animal Ethics Committee at the Shangdong Province Animal Protection and Welfare Institute approved the animal experiments. 2.3. Expression and purification of recombinant fusion proteins The primers were designed according to the ALV-J-NX0101 gp85 gene sequence published in GenBank (Number AY897227) and synthesized. The gp85 gene was amplified using the forward primer (5 -CGCG GATCCGGAGTTCATCTGTTGCAACAACCA-3 ) and the reverse primer (5 -CCCAAGCTTGGC GCCTGCTACGGCGGTG-3 ) with proviral cDNA extracted from ALV-J infected cells as the template. The PCR product was cloned into the pMD18T vector to generate the recombinant clone vector pMD18T-gp85, which was then amplified in E. coli (DH5␣). The construct was confirmed by DNA sequencing. The recombinant ALV-J gp85 gene was expressed in BL21 (DE3) cells (Invitrogen, Carlsbad, CA, USA). The cells were transformed with the pET32a(+)-gp85 DNA and were grown at 37 ◦ C in Luria broth (LB) medium containing 0.5% glucose and carbenicillin (50 g/mL). Protein expression was induced using 1 mM IPTG. The cells were harvested at 3 h post induction and were lysed in lysis buffer (150 mM NaCl, 100 mM Tris–Cl, 1 mM phenylmethanesulfonyl fluoride (PMSF), 1 mg/mL lysozyme, and 1% glycerol; pH 8.0). The soluble fraction was harvested and applied to a high-affinity Ni-NTA column (GenScript USA Inc., Nanjing, China). The eluted proteins were further purified by running the eluate through an SD200 gel filtration column (GenScript USA Inc., Nanjing, China) twice, with and without 1% nadeoxycholate, to remove the endotoxins. The purity of the proteins was evaluated by SDS-PAGE in 12% polyacrylamide gels, and the proteins were identified by western
6145
blot analysis using the gp85-specific mouse monoclonal antibody JE9. 2.4. Protein concentration assay The protein concentration was determined by performing thinlayer chromatography scanning and the Bradford total protein content assay using the Bio-Rad Protein Assay kit (Bio-Rad); bovine serum albumin (BSA) was used as the standard. 2.5. Immunization of chickens The layer breeder hens (aged 30 weeks, 30 in total) were randomly divided into three groups: control group, gp85 + F group, and gp85 + C group. Each group contained 10 hens, and each group was maintained in a clean and comfortable room. The chickens in each group were immunized twice at 2-week intervals. The chickens in the control group were inoculated with PBS and used as the negative control. The vaccines applied to each hen were prepared as Freund’s adjuvant emulsions containing 600 g recombinant gp85 protein for the gp85 + F group and as CpG-ODN adjuvant emulsions containing 600 g recombinant gp85 protein plus 300 g CpG-ODN for the gp85 + C group. The vaccines were injected intramuscularly into each hen in the three groups. After the first vaccination, the serum samples were collected from each hen at weekly intervals for up to 11 weeks. The fertilized eggs were collected from each hen at 3 weeks after the booster vaccination and were hatched in a dedicated chicken incubator. 2.6. Evaluation of maternal antibody protection against ALV-J challenge in the hatched chickens The 10 hatched chickens from each group were challenged intraperitoneally with 102.2 TCID50 of the ALV-JNX0101 strain at 1 day of age, and the chickens were monitored daily for signs of illness. ALV-J and the serological antibody in the blood of hatched chickens were detected at weekly intervals. ALV-J in the spleens and immunosuppressive lesions were examined at the end of the breeding experiment. 2.7. Investigation of serological antibody To determine the anti-ALV-J antibody titers in the sera, a commercial ALV-J antibody test kit (IDEXX USA Inc., Beijing, China) was used in accordance with the manufacturer’s protocol. The relative antibody titer level in the serum was determined by calculating the sample to positive (S/P) ratio [(mean of sample optical density) − (mean of negative control optical density)]/[(mean of positive control optical density) − (mean of negative control optical density)]. The sera from each group were tested in triplicate, and the serum samples with a sample to positive (S/P) ratio higher than 0.6 were considered ALV-J antibody positive. 2.8. ALV viremia detection The DF1 cells were inoculated with the plasma samples from the hens and hatched chickens, and following incubation at 38.5 ◦ C and 5% CO2 for 7 days, the cells were checked for the presence of the virus using ALV P27 antigen ELISA test kits (IDEXX USA Inc., Beijing, China). The relative antigen titer level was determined by calculating the sample to positive (S/P) ratio using the formula shown in Section 2.7. The samples from each group were tested in triplicate, and the plasma samples with a sample to positive (S/P) ratio higher than 0.2 were considered virus positive.
6146
W. Dou et al. / Vaccine 31 (2013) 6144–6149
Fig. 1. PCR amplification of the recombinant plasmid containing the gp85 gene (A), recombinant plasmid identification using double enzyme digestion (B), purification of the expressed products (C), and western blot analysis of the recombinant protein (D). Note. (A) M, DNA markers; 1, positive recombinant plasmid; (B) M, DNA markers; 1, fragments after digestion of the recombinant plasmid with restriction enzymes EcoR I and HindIII; (C) M, protein markers; 1, before purification; 2, after purification; (D) M, protein marker ladder with two colors; 1, western blot using MAb JE9. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
2.9. ALV-J detection in the spleen using IFA The spleens from the dead or killed chickens in the three groups were prepared and each was tested for ALV-J using IFA mediated by ALV-J gp85 monoclonal antibody. Briefly, the slices of tissue were dipped into a confining liquid for 30 min. The confining liquid was discarded, and the ALV-J monoclonal antibody JE9 (diluted 1:20 in PBS) was added directly to the samples, without washing, for 1 h at 37 ◦ C. The tissue samples were washed three times with PBS, and the FITC-labeled anti-mouse antibody (dilution 1:200) (Sigma) was added. The samples were placed in a wet box for 1 h at 37 ◦ C and washed three times with PBS, and a small amount of 50% PBS glycerol mounting solution was added. The samples were viewed under a fluorescence microscope. The samples exhibiting green fluorescence in the cytoplasm were considered positive for ALV-J.
digestion and sequencing results confirmed that the recombinant plasmid was constructed successfully.
3.2. Expression, purification and western blot analysis of recombinant gp85 gene in E. coli The recombinant gene was expressed in E. coli, and the Histagged proteins were purified using high-affinity chromatography followed by gel filtration chromatography. The expression and purity of the recombinant protein was confirmed by SDS-PAGE (Fig. 1C) and western blot analysis using the gp85-specific MAb (Fig. 1D). The purity of the recombinant fusion protein was not less than 95%, and the protein concentration was determined using thin-layer chromatography scanning and the Bradford total protein content assay.
2.10. Detection of immunosuppressive lesions in chickens The chickens were weighed at 45 days post challenge, the spleen and bursa were weighed, and the development indices of the spleen and bursa were calculated using the following equation: (spleen weight)/(body weight) or (bursa weight)/(body weight) × 100, respectively. 2.11. Data analysis The data are represented by the means ± standard deviation (X¯ ± SD). The inter-group differences were analyzed using ANOVA software followed by Student–Newman–Keuls tests of multiple comparisons. Values of P < 0.05 were considered statistically significant. 3. Results 3.1. Construction of recombinant plasmids Fig. 1A shows the PCR amplification of the ALV-J-NX0101 gp85 gene (expected size 909 bp). The cloning of the segment into the plasmid was confirmed using restriction endonuclease digestion and gel electrophoresis (Fig. 1B). Both the restriction endonuclease
3.3. Antibody responses to ALV-J in breeder hens immunized with gp85 recombinant protein plus CpG-ODN or Freund’s adjuvants In our previous studies, double inoculations of the ALV-J gp85 recombinant protein induced chickens to produce specific antibodies against ALV-J; however, the titer was low and the antibodies persisted for less than 1 week (unpublished data). The results in Fig. 2 shows that, in this study, the gp85 recombinant protein plus CpG-ODN adjuvant stimulated the breeder hens to rapidly produce antibodies against ALV-J, and the antibody titers increased significantly following the booster vaccination at 2 weeks. The highest antibody titers were observed at week 2 after the booster vaccination, and the average S/P value of antibody titers were 1.66 ± 0.70 (n = 10). The antibody positive ratio was 10/10 in the gp85 + C group, and according to the positive critical value obtained using the ALVJ antibody ELISA kit (IDEXX), the positive antibodies persisted for more than 5 weeks. In contrast, in the gp85 + F group, the highest antibody titers were 1.10 ± 0.58 (n = 10) and the antibody positive ratio was 8/10 at 4 weeks post booster vaccination and the positive antibodies lasted only 3 weeks, values that were dramatically lower than those of the gp85 + C group. The results suggest that the CpGODN enhanced the humoral responses of the gp85 recombinant protein more than Freund’s adjuvants.
W. Dou et al. / Vaccine 31 (2013) 6144–6149
6147
Table 1 The positive viremia ratios (P.V.R.) and protection ratios (P.R.) in the hatched chickens from 7 to 28 d after challenge with ALV-J. 7 dpi
Control gp85 + F gp85 + C
14 dpi
28 dpi
P.R. (%)
P.V.R.
P.R. (%)
P.V.R.
P.R. (%)
9/10 4/10 3/10
10% 60% 70%
5/10 3/10 3/10
50% 70% 70%
7/9 3/10 2/9
22.2% 70% 77.8%
control
S/P value
21 dpi
P.V.R.
gp85+F
P.V.R. 6/8 4/9 2/9
P.R. (%) 25% 55.6% 77.8%
positive rate is 3/10); however, the titers were lower than those produced by the recombinant protein plus CpG-ODN vaccine.
gp85+C
1.8 1.5
3.5. Maternal antibodies protection against ALV-J early infection
1.2
The viremias were determined weekly starting on day 7 after the challenge until day 28, and the results are shown in Table 1. The results suggest that the positive ratio of viremias was 90% in the control chickens at 7 days post infection (dpi), 40% in the gp85 + F group chickens, and 30% in the gp85 + C group chickens. The positive ratio of viremias in the control group remained greater than that in the other vaccinated groups until the end of the experiment. Of the 10 chickens in the control group, 2 died from the ALV-J challenge during the 28-day experiment, and in each vaccinated group, 1 chicken died; all of the dead chickens tested positive for viremias and for ALV-J in the spleen (detected using IFA, Fig. 4A). The results suggest that the maternal antibody induced by the gp85 recombinant protein plus adjuvants protected most chickens against ALV-J early infection.
0.9 0.6 0.3 0.0
w.p.f.i
Booster inoculation
1 w 2w
3w
4w
5w
6w
7w
8w
9w 1 0w 1 1 w
Fig. 2. Serum antibody against ALV-J detected weekly in breeder hens vaccinated with gp85 recombinant protein vaccines plus CpG-ODN or Freund’s adjuvants post the first inoculation. Note. w.p.f.i., weeks post first inoculation; the line with the red arrow indicates the positive critical value determined using the IDEXX ELISA test kit; serum antibody was detected from 1 week to 11 weeks post the first inoculation with IDEXX ELISA test kit, and booster inoculation was conducted at the 2nd w.p.f.i.; the serum samples with a sample to positive (S/P) ratio higher than 0.6 were considered ALV-J antibody positive. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.6. Maternal antibody protects against immunosuppressive lesions caused by ALV-J infection
3.4. Detection of maternal antibodies against ALV-J To determine whether the gp85 recombinant protein plus the adjuvants stimulated the breeder hens to produce maternal antibodies in their offspring, the fertilized eggs at the 3rd week post the booster vaccination were hatched, and the serum samples from 10 hatched chickens in each group were tested for antibodies against ALV-J weekly starting at age 1 day to age 35 days. The results shown in Fig. 3 suggest that the gp85 recombinant protein plus the CpG-ODN adjuvant induced the breeder hens to produce maternal antibodies in the hatched chickens (the antibody positive rate is 7/10). Based on the results in Fig. 3, we deduced that the positive maternal antibody in the serum of the hatched chickens persisted for approximately 3 days and decreased rapidly to levels similar to those of the control chickens. The recombinant protein plus Freund’s adjuvant also produced maternal antibodies (the antibody
S/P value
control
gp85+F
gp85+C
1.0
As shown in Table 2, the average body weights of the chickens in the gp85 + C and gp85 + F groups were significantly greater than the average body weight of those in the control group (P < 0.05). The average weights and development indices of the spleen and bursa in the vaccinated groups were higher than those in the control group; however, the differences were not statistically significant (P > 0.05). In the vaccinated groups, the average weights and development indices were higher in the gp85 + C group than in the gp85 + F group, which may be related to the higher maternal antibody titer in the gp85 + C group. 3.7. Safety evaluation of vaccine The emulsifier (0.2 mL) containing the gp85 recombinant protein plus the CpG-ODN or Freund’s adjuvants was injected into the leg muscle of the breeder hens. Mortality, signs of disease, and effects on egg-laying were not observed during the 11 weeks of the investigation. 4. Discussion
0.8 0.6 0.4 0.2 0.0
Days age
1d
7d
14d
21d
28d
35d
Fig. 3. Serum antibodies against ALV-J in the hatched chickens assayed weekly from age 1 to 25 d. Note. The fertilized eggs for hatching were collected from the hens at 3 weeks post booster vaccination; the serum antibody in hatched chickens was determined using the IDEXX ELISA test kit; the line with the red arrow indicates the positive critical value determined using the IDEXX ELISA test kit. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
In China, ALV-J is present in many chicken species, such as meattype chickens, layer chickens, and local breeder flocks [4–9], and has become a serious threat to the preservation of local breeder flocks. Studies indicate that the extensive spread of ALV-J among chicken flocks is mainly due to vertical and early horizontal infections [14]. Breeder hens or cocks with ALV-J can infect offspring via the reproductive tract or eggs, and hatched chickens with ALVJ can infect other non-infected chickens via their dung or cloacal secretions. In contrast, the probability of ALV-J infection between adult chickens is rather low [14,16]. This study focused mainly on the protective effects of the maternal antibody, induced by the gp85 recombinant protein, against ALV-J early infection in hatched chickens.
6148
W. Dou et al. / Vaccine 31 (2013) 6144–6149
Fig. 4. The distribution of the virus in the spleen slices detected using IFA mediated by MAb JE9 ((A) positive sample from control group chickens for ALV-J indicated with green fluorescence; (B) negative sample from gp85 + C group chickens for ALV-J; magnification 400×). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Table 2 Maternal antibody protects against immunosuppressive lesions in hatched chickens on 45 days after ALV-J challenge (X¯ ± SD). N
Control gp85 + F gp85 + C
8 9 9
Body weight (g)
348 ± 112 428 ± 183* 560 ± 159*
Spleen
Bursa
Weight (g)
Indices (%)
Weight (g)
Indices (%)
0.76 ± 0.22 1.21 ± 0.72 1.51 ± 0.65
0.22 ± 0.02 0.27 ± 0.09 0.27 ± 0.09
0.80 ± 0.52 1.14 ± 1.00 1.72 ± 0.84
0.21 ± 0.09 0.23 ± 0.12 0.30 ± 0.10
N, numbers of chickens; spleen (bursa) indices were calculated using the equation: spleen (bursa) weight/body weight × 100. * P < 0.05 compared with control group.
The gp85 protein, the main viral envelope protein, is the most variable of the structural proteins in the genome of ALV-J [17–19]. The protein is also associated with virus neutralization [20,21]. We used the gp85 gene sequence published in GenBank to design a pair of primers and amplified the target gene from the cDNA of ALV-JNX0101 strain, which is widespread in local chicken flocks in China [15,21]. The target gene was stably expressed in E. coli, and the expressed recombinant protein was recognized by the ALV-J gp85specific MAb JE9 (Fig. 1), confirming the successful construction of the gp85 recombinant protein. We have previously demonstrated that this recombinant protein induces vaccinated chickens to produce antibody with low titers and does not produce sufficient quantities of serum antibody (unpublished data). Therefore, it was important to enhance the immunogenicity of the gp85 recombinant protein and produce maternal antibody at high titers. Freund’s adjuvants and CpG-ODN adjuvant are both effective immunoadjuvants that enhance cellular and humoral immune responses [22,23]. CpG-ODNs have been shown to be very strong adjuvants in mice and promote Th1-type immune responses, often performing better than Freund’s adjuvant, which is the gold standard for inducing cell-mediated immune responses in rodents [24–26]. This study is the first to demonstrate that recombinant proteins containing gp85 protein plus CpG-ODN adjuvant can induce breeder hens not only to produce higher amounts of serum antibody against ALV-J – the positive antibody persisted for a longer period (Fig. 2) – but also to produce protective maternal antibody in hatched chickens’ sera (Fig. 3). Moreover, compared with the Freund’s adjuvants, the CpG-ODN adjuvant induced higher antibody titers. The average maternal antibody titers induced by gp85 recombinant protein plus CpG-ODN in the hatched chickens was 0.98 ± 0.22 and lasted for approximately three days; however, the antibodies induced significant protection against early ALV-J infection. The
positive viremia ratio in the absence of the maternal antibody was 90% and the mortality ratio was 20%, whereas the positive viremia ratio in the presence of the maternal antibody was 30% and the mortality ratio was 10% (Table 1). The chickens without the maternal antibody were challenged and demonstrated growth retardation and abnormal development of the immune organs, whereas the chickens with the maternal antibody demonstrated normal growth and development after being challenged with ALV-J (Table 2), which suggests that the maternal antibody reduced the immunosuppressive lesions caused by the ALV-J infection to a degree. Compared with the gp85 recombinant protein plus Freund’s adjuvants, the gp85 recombinant protein plus CpG-ODN could induce better immunoprotection. These results indicate that 70% of the hatched chickens were successfully protected against ALV-J early infection by immunizing breeder hens with recombinant protein vaccines plus CpG-ODN adjuvant. In summary, the gp85 recombinant protein was successfully generated and, when adjuvanted with CpG-ODN, induced breeder hens to produce effective maternal antibody that protected the hatched chickens against early ALV-J infection. This recombinant protein represents the first commercially effective subunit vaccine for the control of early infection of ALV-J in chickens. Conflict of interest statement The authors declare that they have no competing interests. Acknowledgments The study was supported by the earmarked fund Special Fund for Agro-scientific Research in the Public Interest (No. 201203055). We would like to thank Prof. Zhizhong Cui for his support.
W. Dou et al. / Vaccine 31 (2013) 6144–6149
References [1] Payne LN, Gillespie AM, Howes K. Recovery of acutely transforming viruses from myeloid leukosis induced by the HPRS-103 strain of avian leukosis virus. Avian Dis 1993;37:438–50. [2] Witter R. Avian tumor viruses: persistent and evolving pathogens. Acta Vet Hung 1997;45:261–6. [3] Fadly AM, Smith EJ. Isolation and some characteristics of an isolate associated with myeloid leukosis in meat-type chickens in the United States. Avian Dis 1999;43:391–400. [4] Du Y, Cui ZZ, Qin AJ. Subgroup J of avian leukosis viruses in China. China Poult Sci 1999;3:1–4. [5] Chen Z, Zhang L, Liu S, Zhang L, Cui Z. Emerging of avian leukosis virus subgroup J in a flock of Chinese local breed. Acta Microbiol Sin 2005;45: 584–7. [6] Sun SH, Cui ZZ. Epidemiological and pathological studies of subgroup J avian leukosis virus infections in Chinese local “yellow” chickens. Avian Pathol 2007;36:221–6. [7] Cheng Z, Liu J, Cui Z, Zhang L. Tumors associated with avian leukosis virus subgroup J in layer hens during 2007 to 2009 in China. J Vet Med Sci 2010;72:1027–33. [8] Gao YL, Qin LT, Pan W, Wang YQ, Qi XL, Gao HL, et al. Subgroup J avian leukosis virus in layer flocks in China. Emerg Infect Dis 2010;16:1637–8. [9] Lai HZ, Zhang HN, Ning ZY, Chen RA, Zhang WZ, Qin AJ, et al. Isolation and characterization of emerging subgroup J avian leukosis virus associated with hemangioma in egg-type chickens. Vet Microbiol 2011;3:1–9. [10] Vleugels B, Ververken C, Goddeeris BM. Stimulatory effect of CpG sequences on humoral response in chickens. Poult Sci 2002;81:1317–21. [11] Wang X, Jiang P, Deen S, Wu J, Liu X, Xu J. Efficacy of DNA vaccines against infectious bursal disease virus in chickens enhanced by coadministration with CpG oligodeoxynucleotide. Avian Dis 2003;47:1305–12. [12] Dalloul RA, Lillehoj HS, Klinman DM, Ding X, Min W, Heckert RA, et al. In ovo administration of CpG oligodeoxynucleotides and the recombinant microneme protein MIC2 protects against Eimeria infections. Vaccine 2005;23: 3108–13. [13] Mahmood MS, Siddique M, Hussain I, Khan A, Mansoor MK. Protection capability of recombinant plasmid DNA vaccine containing VP2 gene of highly virulent infectious bursal disease virus in chickens adjuvanted with CpG oligodeoxynucleotide. Vaccine 2006;24:4838–46.
6149
[14] Cui ZZ, Guo HJ, Sun SH. Prevalence situation and prevention and control of avian leukosis. Chin J Vet Drug 2009;43:37–41. [15] Zhang JY, Cui ZZ, Ding JB, Jiang SJ. Construction of infectious clone of subgroup J avian leukosis virus strain NX0101 and its pathogenicity. Acta Microbiol Sin 2005;45:437–40. [16] Sun BB, Cui ZZ, Zhang QC, Lou BH. Dynamics of viremia and antibody responses in chickens inoculated with ALV-J. Sci Agric Sin 2009;42:4069–76. [17] Venugopal K, Smith LM, Howes K, Payne LN. Antigenic variants of J subgroup avian leukosis virus: sequence analysis reveals multiple changes in the env gene. J Gen Virol 1998;79:757–66. [18] Silva RF, Fadly AM, Hunt HD. Hypervariability in the envelope genes of subgroup J avian leukosis viruses obtained from different farms in the United States. Virology 2000;272:106–11. [19] Pandiri AR, Mays JK, Silva RF, Hunt HD, Reed WM, Fadly AM. Subgroup J avian leukosis virus neutralizing antibody escape variants contribute to viral persistence in meat-type chickens. Avian Dis 2010;54:848–56. [20] Wang XP, Qun K, Qin AJ, Shen HY, Wang PP, Jin WJ, et al. Recombinant avian leukosis viruses of subgroup J isolated from field infected commercial layer chickens with hemangioma and myeloid leukosis possess an insertion in the E element. Vet Res Commun 2010;34:619–32. [21] Pan W, Gao YL, Qin LT, Ni W, Liu ZS, Yun BL, et al. Genetic diversity and phylogenetic analysis of glycoprotein GP85 of ALV-J isolates from Mainland China between 1999 and 2010: coexistence of two extremely different subgroups in layers. Vet Microbiol 2012;156:205–12. [22] Stills Jr HF. Adjuvants and antibody production: dispelling the myths associated with Freund’s complete and other adjuvants. ILAR J 2005;46:280–93. [23] Davis HL, Weeratna R, Waldschmidt TJ, Tygrett L, Schorr J, Krieg AM, et al. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J Immunol 1998;160:870–6. [24] Liu Y, Luo X, Yang CT, Yu SK, Xu HL. Three CpG oligodeoxynucleotide classes differentially enhance antigen-specific humoral and cellular immune responses in mice. Vaccine 2011;29:5778–84. [25] Mutwiri G, den Hurk SDL, Babiuk LA. Approaches to enhancing immune responses stimulated by CpG oligodeoxynucleotides. Adv Drug Deliv Rev 2009;61:226–32. [26] Mutwiri G, Benjamin P, Soita H, Babiuk LA. Co-administration of polyphosphazenes with CpG oligodeoxynucleotides strongly enhances immune responses in mice immunized with Hepatitis B virus surface antigen. Vaccine 2008;26:2680–8.