Maternal exposure to volatile anesthetics induces IL-6 in fetal brains and affects neuronal development

European Journal of Pharmacology 863 (2019) 172682

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Full length article

Maternal exposure to volatile anesthetics induces IL-6 in fetal brains and affects neuronal development

T

Akiko Hirotsua, Yoshika Iwataa, Kenichiro Tatsumia, Yoshimitsu Miyaia, Tomonori Matsuyamab, Tomoharu Tanakaa,∗ a b

Department of Anesthesia, Kyoto University Hospital, 54 Kawahara-Cho, Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan Department of Anesthesia, National Hospital Organization Kyoto Medical Center, 1-1 Mukaihata-cho, Fukakusa, Fushimi-ku, Kyoto, 612-0861, Japan

ARTICLE INFO

ABSTRACT

Keywords: Volatile anesthetic Sevoflurane Interleukin-6 Neuroinflammation Neural precursor cell

Most clinically used general anesthetics have demonstrated neurotoxicity in animal studies, but the related mechanisms remain unknown. Previous studies suggest that anesthetics affect neuronal development through neuroinflammation, and significant effects of neuroinflammation on neurogenesis and neuronal disease have been shown. In the present study, we treated pregnant mice with 2% sevoflurane for 3 h at gestational day 15.5 and analyzed the expression of proinflammatory cytokines, including IL-6 and IL-17, in fetal mice brains. Sevoflurane induced IL-6 mRNA significantly, but did not upregulate IL-17. Other volatile anesthetics, including isoflurane, enflurane, and halothane, induced IL-6 mRNA in fetal brains as well as sevoflurane, but propofol did not. Sevoflurane and isoflurane showed the same effects in cultured microglia and astrocytes, but not in neurons. Because IL-6 induction in fetal brains may affect neuronal precursor cells (NPCs), numbers of NPCs in the subventricular zone were studied, revealing that maternal sevoflurane treatment significantly increases NPCs in offspring at 8 weeks after birth (p8wk). But this effect was absent in IL-6 knockout mice. Finally, behavioral experiments also revealed that maternal sevoflurane exposure causes learning impairments in p8wk offspring. These findings collectively demonstrate that maternal exposure to volatile anesthetics upregulates IL-6 in fetal mice brains, and the effects could result in long-lasting influences on neuronal development.

1. Introduction

been reported as possible causes (Vutskits and Xie, 2016). In addition to anesthetics, maternal immune activation (MIA) significantly impacts neuronal development (Estes and McAllister, 2016; Missault et al., 2014; van den Pol et al., 2017) by increasing the expression of proinflammatory cytokines, such as interleukin (IL)-6, IL-1β, tumor necrosis factor (TNF)-α, and IL-17. These mediators reach the fetal brain through the placenta and immature fetal blood–brain barrier, thus causing neurodevelopmental disorders and subsequent behavioral impairments in adulthood (Choi et al., 2016; Patterson, 2009). IL-6 and IL-17 are especially essential for MIA-related phenotypes in offspring. Accordingly, blocking of each cytokine prevented the emergence of abnormalities in adult MIA offspring (Wu et al., 2017). In addition to MIA, maternal separation stress (Careaga et al., 2017) and maternal obesity (Tozuka et al., 2010) activate fetal microglia and induce cerebral proinflammatory cytokines, ultimately resulting in learning impairments in offspring. Therefore, proinflammatory cytokines in the brain are key regulators of neuronal development, and are closely associated with cognitive dysfunctions and psychopathologies (Wu et al., 2017).

The toxic effects of general anesthetics in developing brains have been a serious concern for anesthesiologists and other clinicians for decades (Levin et al., 1987). Especially, since Jevtovic-Todorovic et al. reported the anesthetic combination of midazolam, nitrous oxide and isoflurane induced widespread apoptotic neurogeneration and persistent memory impairment (Jevtovic-Todorovic et al., 2003), most clinically used anesthetics, including sevoflurane (Satomoto et al., 2009), isoflurane (Istaphanous et al., 2011), desflurane (Kodama et al., 2011), and propofol (Cattano et al., 2008) are found to induce abnormal neuroapoptosis in developing animal brains and can trigger cognitive dysfunction. Considering the diversity of pharmacological actions of these anesthetics, their common detrimental effects are surprising and the underlying mechanisms remain controversial. Among suggested mechanisms, the effects of anesthetics on neurotrophin signaling (Lu et al., 2006), mitochondrial function (Boscolo et al., 2013), interneuron phenotypes (Takesian and Hensch, 2013), and phosphorylation of the microtubule-associated protein tau (Tao et al., 2014) have ∗

Corresponding author. E-mail address: [email protected] (T. Tanaka).

https://doi.org/10.1016/j.ejphar.2019.172682 Received 19 June 2019; Received in revised form 10 September 2019; Accepted 19 September 2019 Available online 20 September 2019 0014-2999/ © 2019 Published by Elsevier B.V.

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

The effect of anesthetics on proinflammatory cytokines during developmental have been studied previously, but most studies focused on neonates and their results varied between experimental settings. For example, sevoflurane administration to mice pups for 3 h on one day did not alter brain IL-6 levels, whereas treatments for three consecutive days significantly induced IL-6 in the brain (Shen et al., 2013). Similarly, propofol administration for 6 h in rat pups did not increase proinflammatory cytokine levels in the brain (Kargaran et al., 2015). But whether maternal anesthetic administration can induce neuroinflammation in the fetus is mostly unreported. Although the fetal period, especially during mid-gestation, is critical for neurogenesis, and fetuses are sensitive to environmental factors (Palanisamy, 2012). Considering that proinflammatory cytokines that are induced in fetal brains, as in the case of MIA, can significantly affect neuronal development, the effects of anesthetics on proinflammatory cytokine expression levels in fetal brains during pregnancy should be clarified. In this study, we evaluated the effects of maternal exposures to anesthetics on proinflammatory cytokine production in fetal mice brains during the midgestational period, and investigated neuroinflammation responses to anesthetics and their effects on future neuronal configurations.

volatile anesthetics were monitored continuously using an infrared analyzer (Capnomac Ultima; Datex-Ohmeda, Helsinki, Finland). The rectal temperature of anesthetized mice was monitored using an ATB1100 (Nihon Kohden, Tokyo, Japan) after induction of anesthesia, and a heat lamp was used to maintain the temperature at 37 °C ± 0.5 °C. Anesthetic treatment durations were 3 h for RNA analysis and 5 h for protein analyses. Propofol was administered at doses that are known to have anesthetic effects for about 1.5 h in mice (Alves et al., 2007). Single pulse (1 × 75 mg/kg or 150 mg/kg) or a double pulse (2 × 75 mg/kg) propofol or the same amount of 1% lipid emulsion was intraperitoneally administered to G15.5 pregnant mice. For double pulse analyses, a second injection of a double pulse was performed at 1.5 h after the first injection. After the indicated maternal anesthetic exposure time, caesarian sections were performed to extract fetal brains. Whole brains were used for biochemical assays. Unless otherwise indicated, all fetus were used for further experiments, except when numbers of fetus were more than six, we selected 5 of them randomly without discriminating sex.

2. Materials and methods

2.3.1. Cell culture BV-2 immortalized mouse cells have reactive microglia properties, as indicated by previous phenotype and function analyses (Bocchini et al., 1992). The cell line was originally developed by Dr. V. Bocchini (University of Perugia, Perugia, Italy) and was kindly provided to us by Dr. Inoue (Kyushu University, Fukuoka, Japan). BV-2 was cultured in Dulbecco's modified Eagle's medium (DMEM, Sigma-Aldrich) containing 10% fetal bovine serum (FBS) and antibiotics (0.1 mg/ml streptomycin, 100 U/ml penicillin). Primary cultures of cerebral cortical astrocytes were prepared from 1-day-old C57BL/6NCrSlc mice according to a previously described method (Tanaka et al., 2011). Briefly, cerebral cortices were treated with trypsin and DNase for 20 min and were then filtered through a 100-μm mesh and placed in cell culture flasks with 50 ml of a prepared DMEM-based medium. Experiments were performed at day 14 of in vitro cultivation. Primary neuronal cultures of the cerebral cortex were obtained from embryonic day 14.5 (E14.5) C57BL/6NCrSlc mice using a modification of Numakawa's method (Numakawa et al., 2002). Papain- and DNase-treated cortical cells were plated on polyethyleneimine-coated plates with 10-μM 2mercaptoethanol. The culture medium comprised 45% DMEM, 45% Ham's F12 nutrient mixture (GE Healthcare), 5% FBS, and 5% horse serum with penicillin (100 U/ml) and streptomycin (0.1 mg/ml). Two days after plating, half of the medium was replaced with NeurobasalTM medium (Thermo Fisher Scientific) containing 0.25% glutamine, 2% B27 (Thermo Fisher Scientific), and 2-μM AraC (Cayman Chemical, MI, USA). The medium was replaced every 3–4 days with Neurobasal-based medium as described above. Cultures were maintained for 6–8 days prior to experiments.

2.3. In vitro experiments

2.1. Drugs and chemicals Sevoflurane (PubChem CID: 5206) was obtained from Mylan Pharmaceutical Co., Ltd. (Osaka, Japan), isoflurane (PubChem CID: 3763) was purchased from Abbvie (Tokyo, Japan), halothane (PubChem CID: 3562) was from Takeda Pharmaceutical Co., Ltd. (Osaka, Japan), enflurane (PubChem CID: 3226) was from Abbott Laboratories (Chicago, IL, USA), propofol (2,6-diisopropylphenol; PubChem CID: 4943) for in vitro experiments was purchased from Sigma-Aldrich (St. Louis, MO, USA), and propofol dissolved in a lipid emulsion was purchased from Maruishi (Osaka, Japan) and was used for in vivo experiments. Finally, 10% Intralipos®, which is a soybean oilbased intravenous lipid emulsion, was obtained from Otsuka (Tokushima, Japan). The gas mixture comprised 21% O2, 74% N2, and 5% CO2 and was acquired from Imamura Sanso (Kyoto, Japan). CO2 and N2 gases were obtained from Kist Co., Ltd. (Kyoto, Japan). 2.2. Animals This study (Permit Number: 18318) was approved by the Animal Research Committee of Kyoto University (Kyoto, Japan). All experiments were performed according to the institutional and National Institutes of Health (NIH) guidelines for the care and the use of animals. Pregnant C57BL/6NCrSlc mice were purchased from Japan SLC Inc. (Shizuoka, Japan). Pregnant mice were maintained under controlled environmental conditions (24 °C, 12-h light/12-h dark cycle) with ad libitum feeding. The IL-6 knockout (IL-6 −/−) mouse strain B6; 129S2Il6 < tm1Kopf > (RBRC04918) was kindly provided by RIKEN BRC (Japan) as IL-6 heterozygotes (IL-6 +/−) (Kopf et al., 1994). IL-6 −/− mice and their wild-type (WT) littermates (IL-6 +/+) were compared in analyses.

2.3.2. Volatile anesthetic exposures of cultured cells Cell culture dishes were maintained in airtight chambers housed in a water jacket incubator maintained at 37 °C before anesthetic exposure. An in-line calibrated anesthetic agent vaporizer was used to deliver volatile anesthetics to the gas phase of culture wells. The gas mixture, comprising 21% O2, 74% N2, and 5% CO2, was administered at a flow rate of 3 L/min until the appropriate effluent anesthetic concentration was achieved. Effluent anesthetic concentrations were continuously monitored via a sampling port connected to an anesthetic agent analyzer (Capnomac Ultima). Immediately after indicated treatment times, cells were collected and stored at −80 °C for subsequent experiments.

2.2.1. Administration of anesthetics to mice Pregnant mice were administered anesthetics on a gestation-day 15.5 (G15.5), corresponding with the neurogenic phase of brain development during the mid-gestational period (Hirabayashi and Gotoh, 2005). Pregnant mice were placed in an airtight polypropylene container of 34 cm in diameter and 15 cm in height with a pair of 25 mmside holes for anesthetic input/output flow and an 8 mm-ceiling hole for anesthetic concentration monitoring. Air with or without the volatile anesthetics sevoflurane, isoflurane, halothane, or enflurane was delivered to the chamber at a flow rate of 3 L/min using an anesthetic machine (Custom50; Aika, Tokyo, Japan). Concentrations of O2, CO2, and

2.3.3. Propofol administration to cultured cells Propofol dissolved in dimethyl sulfoxide (DMSO) was administrated to cultured cell medium to give a final concentration of 25 μM or 50 μM. 2

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

For the control, the same amount of 1% lipid emulsion was administrated to cultured cell medium. Cultured cells were collected 3 h after treatment and stored at −80 °C for subsequent experiments.

2.7. Immunoblot assay Aliquots containing 100 μg of protein were fractionated using 10% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and separated proteins were electrotransferred to polyvinylidene difluoride (PVNF) membranes using a transfer buffer. Membranes were then probed with primary antibodies for the following proteins overnight at 4 °C: β-actin (A5316; Sigma-Aldrich), extracellular signal-regulated kinase (ERK) 1/2 (#4696; Cell Signaling), phospho-ERK1/2 (#4370; Cell Signaling), Jun N-terminal protein kinase (JNK) (#9252; Cell Signaling), phospho-JNK (#9255; Cell Signaling), p38 mitogen-activated protein kinases (MAPK) (#9212; Cell Signaling), phospho-p38 MAPK (#9211; Cell Signaling), caspase-3 (#9662, Cell Signaling), and cleaved caspase-3 (#9664 Cell Signaling). Subsequently, membranes were incubated with horseradish peroxidase (HRP)-conjugated anti-mouse immunoglobulin G (IgG) (GE Healthcare, Piscataway, NJ) or anti-rabbit IgG antibodies (GE Healthcare) for 1 h at room temperature. All antibodies were used according to the manufacturer's instructions. Membranes were stripped and reblotted twice to detect loading controls. To this end, PVDF membranes were incubated at 50 °C for 30 min in 5-ml aliquots of stripping buffer comprising 40 ml of 10% SDS, 12.5 ml of 1-M Tris HCl (pH 6.8), and 146 ml of distilled water with 40 μl of β-mercaptoethanol. All chemiluminescence signals were developed using enhanced chemiluminescence reagents (GE Healthcare) and band intensities were quantified using the NIH software Image J Version 1.37. We calculated the band intensities of ERK and phopho-ERK, and compared relative ratios of phospho-ERK and ERK between groups.

2.4. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) RNA was purified from whole brains and cultured cells using Nucleospin® RNA II Kits (Macherey-Nagel, Düren, Germany) according to the manufacturer's instructions. First-strand cDNA synthesis and RTPCR were performed using a One Step SYBRTM PrimeScriptTM RT-PCR Kit II (Takara Bio, Shiga, Japan) according to the manufacturer's instructions. qRT-PCR assays were performed with a 7300 Real-Time PCR System (Applied Biosystems, CA, USA). PCR primers for the mouse 18S rRNA and IL-6 genes were purchased from Qiagen (Valencia, CA, USA; Catalog Numbers: 18S mouse, QT02448075; IL-6 mouse, QT00098875), and primers targeting IL-17, IL-1β, and TNF-α were purchased from Invitrogen (CA, USA). Primer sequences are as follows: IL-17 5′ - CTGTGTGTGTGATGCTGTTGCT - 3′ (forward) and 5′- AAGG GAGTTAAAGACTTTGAGGTTG - 3′ (reverse); IL-1β 5′- ATGAGGACAT GAGCACCTTC - 3′ (forward) and 5′- CATTGAGTTGGAGAGCTTTC - 3′ (reverse); TNF-α 5′- TCGTAGCAAACCACCAAGTG - 3′ (forward) and 5′CCTTGAAGAGAACCTGGGAGT - 3′ (reverse). For each target mRNA, fold changes in expression were calculated relative to those of 18S rRNA. 2.5. Protein extraction

2.8. Nuclear protein preparation and trans-AM assays

Whole brain tissues were gently homogenized using a Dounce tissue grinder in ice-cold radio-immunoprecipitation assay (RIPA) buffer (Wako, Osaka, Japan) containing 2-mM dithiothreitol (DTT), 1-mM sodium orthovanadate (Na3VO4), and complete protease inhibitor (Roche Diagnostics, Basel, Switzerland). Homogenates were centrifuged at 10,000 × g and supernatants were then extracted. Whole cell lysates were prepared from cultured cells using ice-cold lysis buffer containing 0.1% sodium dodecyl sulfate (SDS), 1% Nonidet P40, 5-mM EDTA, 150mM NaCl, 50-mM Tris-Cl (pH 8.0), 2-mM DTT, 1-mM Na3VO4, and complete protease inhibitor (Roche Diagnostics)] following a previously described protocol (Takabuchi et al., 2004). Total protein concentrations were determined using the modified Bradford assay with bovine serum albumin as a standard.

Nuclear extracts were prepared from BV-2 cells using a nuclear extraction kit (Active Motif, Carlsbad, CA, USA). Activation of Nuclear factor-kappa B (NF-κB) was quantified using an ELISA-based assay kit (Trans-AM; Active Motif) according to the manufacturer's instructions. Briefly, nuclear proteins (25 μg) were incubated in 96-well plates coated with oligonucleotides containing the NF-κB consensus site ( 5′-GGGACTTTCC-3′). NF-κB contents of nuclear extracts bind specifically to this oligonucleotide after 2-h incubation at room temperature. A NF-κB p65 antibody (100 μl of a 1:1,000 dilution) was then added to each well and incubated for 1.5 h, followed by the addition of 100 μl of HRP-conjugated antibody (1:1,000 dilution) and a further incubation for 1 h. After adding 100-μl aliquots of developing solution, the color was allowed to develop for up to 15 min and then the reactions were stopped. NF-κB activity was determined according to absorbance at 450 nm using a spectrophotometer with a reference wavelength of 655 nm.

2.6. Enzyme-linked immunosorbent assays (ELISA) IL-6 concentrations in extracted protein solutions from whole brains and BV-2 cells were assayed using an IL-6 ELISA kit (Abcam plc, Cambridge, UK) according to the manufacturer's instructions. Briefly, 20-μl tissue and cell lysates were diluted 5-fold with sample dilution buffer and were applied to IL-6 microplates with concentration-regulated standard solutions. Plates were covered well and incubated overnight at 4 °C with gentle shaking. After washing 4 times with wash solution (300 μl per each), 100-μL aliquots of biotinylated IL-6 detection antibody were added and incubated for 1 h at room temperature with gentle shaking. After washing 4 times, 100-μl aliquots of HRPstreptavidin solution were added and incubated for 1 h at room temperature prior to washing 4 times again. Finally, 100-μl aliquots of 3,3′,5,5′- tetramethylbenzidine (TMB) one step substrate reagent were added to develop blue color. After incubating for 30 min at room temperature in the dark with gentle shaking, 50-μl aliquots of stop solution were applied to each well to change the color from blue to yellow. Immediately, absorbance intensities were measured at 450 nm with a reference wavelength of 655 nm. Data are expressed as ratios of IL-6 quantities (in pg) to total protein (in mg) contents in brain lysates.

2.9. Bromodeoxyuridine (BrdU) labeling and immunocytochemical analysis G15.5-pregnant IL-6 −/− mice mated with male IL-6 −/− mice and G15.5-pregnant wild-type (WT) counterpart littermates (IL-6 +/+) mated with male IL-6 +/+ were treated with or without 1.5% sevoflurane for 3 h. Mice were then returned to their cages and allowed to deliver naturally. Mice offspring were weaned at 4 weeks of age (p4wk). To quantify neural precursors, single injections of 100-mg/kg BrdU (BD Biosciences, NJ, USA) were administered intraperitoneally to p8wk male offspring from each group (n = 4–5). Twenty-four hours after administration, mice were sacrificed and whole-body fixation was performed using transcardial perfusions of 20 ml of 4% paraformaldehyde (PFA) followed by 20 ml of PBS. Skulls were carefully removed and whole brains were harvested using a microspatula. Brains were then soaked in 4% PFA for 48 h, were embedded in paraffin blocks, and were sectioned coronally and ventrally in 10-μm-thick slices starting at 1 mm anterior to the Bregma using a cryostat. Sections were placed on glass slides, were deparaffinized, and were then microwaved for 3

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

Fig. 1. Effect of maternal sevoflurane exposure on proinflammatory cytokine expression in fetal mice brains C57BL/6NCrSlc pregnant mice at gestational day 15.5 (G15.5) were exposed to sevoflurane for 3 h and mRNA expression levels of proinflammatory cytokines were determined in the fetal mice brains. Interleukin (IL)-6 (A), IL-17 (B), tumor necrosis factor (TNF)-α (C), and IL-1β (D) mRNA were assayed using real-time quantitative polymerase chain reactions (qRT-PCR; n = 5). IL-6, IL17, TNF-α and IL-1β mRNA expression levels were normalized to those of 18S rRNA and are expressed relative to the mean in control mice. After maternal exposures to 1% sevoflurane for 5 h, IL-6 protein concentrations (pg/ml) were quantified using enzyme-linked immunosorbent assay (ELISA) and were divided by the total protein concentrations (mg/ml) in fetal whole mouse brains (E; n = 5). Data are presented as means ± standard deviations (S.D.); *P < 0.05 versus control; N.S., not significant.

20 min. After incubating slides with 4-N HCl at 37 °C for 30 min, 0.1-M di-sodium tetraborate was applied for 10 min, and the slides were washed with PBS 6 times for 5 min each. Slides were mounted with 1% horse normal serum for 30 min and were then reacted overnight with 4% anti-BrdU antibody (NCL-BrdU, Leica, Wetzlar, Germany). Slides were then incubated with biotinylated horse anti-mouse serum antibody (BA-2000, Vector Laboratories, Inc., CA, USA, diluted to 1:300 in PBS) for 40 min, followed by 6 × 5-min washes in PBS and reaction with a 1:100 dilution of avidin-biotin-peroxidase complex (ABC; ABCElite, Vector Laboratories) in BSA for 50 min. After washing in PBS (6 times, 5 min each), color reactions were conducted using 3,3′-diaminobenzidine and nuclei were counterstained with hematoxylin. All BrdU-labeled nuclei in the bilateral subventricular zone (SVZ) were quantified using three consecutive 10-μm thick sections per animal. BrdU-positive cells were stained red with lateral ventricles, and were manually counted by two different blinded researchers.

2.10. Behavioral analysis Pregnant C57BL/6NCrSlc mice were exposed to air (n = 3) or sevoflurane 1.5% (n = 3) for 3 h at G15.5. After treatment, mice were returned to their cages and allowed to deliver naturally. Mice offspring were maintained under normal conditions and were weaned at p4wk. Only male littermates were maintained in the same cage, and behavior testing was started at p8wk using four male offspring per day (12 mice per group). Behavioral tests included general health and neurological screenings (GHNS) and the memory test Y-maze (YM). GHNS were followed by YM and all tests were administered between 10:00 a.m. and 4:00 p.m. Intervals between tests were at least 24 h. During behavioral testing, mice were housed four animals per cage and were maintained under controlled environmental conditions (24 °C, 12-h light/12-h dark cycles) with food and water provided ad libitum in the Division for Mouse Behavior Analysis, Medical Research Support Center, Graduate School of Medicine, Kyoto University.

4

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

Fig. 2. Effects of maternal exposure to various anesthetics on proinflammatory cytokine levels in fetal mouse brains C57BL/6NCrSlc G15.5 pregnant mice were exposed to 1% isoflurane, 1% enflurane, or 1% halothane for 3 h and fetal brain IL-6 mRNA was examined using real-time qRT-PCR (A; n = 5). Propofol was administered to G15.5 pregnant mice via intraperitoneal injections at 75 or 150 mg/kg once (B; n = 4) or twice every 1.5 h at a rate of 75 mg/kg (C; n = 5). IL-6 mRNA in fetal mice brains was evaluated 3 h later. IL-6 mRNA expression was normalized to that of 18S rRNA and is expressed relative to the mean of that in control mice. Data are presented as means ± standard deviations (S.D.); *P < 0.05, **P < 0.01 versus control, N.S., not significant.

2.10.1. General health and neurological screening After measuring body weights and rectal temperatures, neuromuscular strength was tested using grip strength and wire hang tests. A grip strength meter (O'Hara & Co., Tokyo, Japan) was used to assess forelimb grip strength. Mice were lifted and held by their tails so that their forepaws could grasp the wire grid. Mice were then gently pulled backward by the tail with their posture parallel to the surface of the table until they released the grid. The peak forces applied by the forelimbs of mice were recorded in grams (g). In wire hang tests, mice were placed on a wire mesh that was then inverted and waved gently so that the mouse gripped the wire. Latency to fall was recorded for up to 60 s.

between three or more groups were performed using non-repeated measures one-way analysis of variance followed by the Tukey-Kramer test, and when appropriate, Kruskal–Wallis H-tests were used with the Mann–Whitney U-tests and Bonferroni correction. 3. Results 3.1. Maternal exposure to volatile anesthetics induces IL-6 mRNA in fetal mice brains To determine whether maternal sevoflurane exposure induces proinflammatory cytokines in fetal brains, we treated C57BL/6NCrSlc pregnant mice with 1%–2% sevoflurane for 3 h on gestational day 15.5 (G15.5). As shown in Fig. 1A–D, IL-6 expression was significantly increased, whereas IL-17 and TNF-α were not influenced by sevoflurane treatments. Yet, IL-1β in the fetal brains was suppressed by sevoflurane treatments. Confirming that IL-6 was induced at the protein level, ELISA showed significant increases in IL-6 protein concentrations in whole fetal mice brains after 5 h of maternal sevoflurane treatment (Fig. 1E). To determine whether other volatile anesthetics induce IL-6, we exposed pregnant mice to 1% isoflurane, enflurane, and halothane for 3 h. As shown in Fig. 2A, all anesthetics significantly induced IL-6 mRNA in fetal brains, as observed with sevoflurane. In contrast, the intravenous general anesthetic propofol did not affect IL-6 expression in fetal brains, regardless of whether it was administered to pregnant mice as single pulse (1 × 75 mg/kg or 150 mg/kg) or double pulse (2 × 75 mg/kg) intraperitoneal injections (Fig. 2B and C).

2.10.2. Y-maze tests In YM tests, mice were placed in the center of a Y-maze apparatus (O'Hara & Co., 40 cm long, 3 cm wide, and 12 cm high) and were allowed to move freely and explore the three arms of the Y for 10 min. Total numbers of arm entries (A) and numbers of three consecutive arm entries (B) were counted and percentage (%) alternations were calculated using the following formula: alternation (%) = B/(A − 2) × 100. 2.11. Statistical analysis All data are presented as means ± standard deviations. Statistical analyses were performed using GraphPad Prism version 7.01 and differences were considered significant when P < 0.05. Sample sizes were determined based on power analyses. Normality was tested using data from our recent similar studies. Differences between two groups were analyzed using unpaired t-tests or Mann–Whitney U-tests. Comparisons 5

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

Fig. 3. Effects of various anesthetics on IL-6 expression in BV-2, primary cultured astrocytes, and neurons BV-2 microglial cells were exposed to sevoflurane (A), isoflurane (B), or propofol (C) for 4 h. Primary cultured astrocytes (E) and neurons (F) were exposed to sevoflurane for 4 h. IL-6 mRNA was analyzed using real-time qRT-PCR. IL-6 expression levels were normalized to those of 18S rRNA and are expressed relative to the control mean. After 5h sevoflurane exposures, IL-6 protein concentrations (D) in BV-2 cell culture media were measured using ELISA. Data are presented as means ± S.D. (n = 3); *P < 0.05 versus control, N.S., not significant.

3.2. Volatile anesthetics induce IL-6 mRNA in cultured glial cells

3.3. Sevoflurane induces phosphorylation of ERK, but does not induce NFκB in BV-2 cells

We performed in vitro experiments to exclude the possibility that anesthetic-induced hypercapnia or hypotension affected cytokine expression. Among cells of the central nervous system (CNS), microglia, astrocytes, and neurons are possible sources of IL-6 (Erta et al., 2012). Thus, to determine which cells are primary sources of sevoflurane-induced IL-6, we treated cultured BV-2 microglial cells with anesthetics. Sevoflurane and isoflurane induced IL-6 mRNA expression in BV-2 cells after 4-h treatments (Fig. 3A and B), whereas propofol did not (Fig. 3C). In addition, 5-h exposures to sevoflurane increased IL-6 protein expression in a concentration-dependent manner (Fig. 3D). In identical experiments with primary cultured astrocytes and neurons, 4-h sevoflurane treatments significantly induced IL-6 mRNA expression in primary cultured astrocytes (Fig. 3E), but did not induce IL-6 mRNA in neurons (Fig. 3F).

NF-κB (Ajmone-Cat et al., 2003) and MAPKs (Lu et al., 2010) have been widely associated with proinflammatory cytokine induction in various cells, including glial cells. To elucidate the mechanisms through which IL-6 is induced by volatile anesthetics, we examined the effects of anesthetics on NF-κB and MAPK activities in BV-2 cells. An ELISA-based kit found no change in NF-κB transcription after exposure of the cells to sevoflurane and isoflurane for 3 h (Fig. 4A). Moreover, immunoblot analyses of ERK 1/2, JNK, and p38 MAPK using antibodies for phosphoor total forms revealed that sevoflurane significantly induces ERK phosphorylation, but had no apparent effect on JNK or p38 MAPK signaling (Fig. 4B and C).

6

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

Fig. 4. Mechanism underlying sevoflurane-induced IL-6 upregulation in BV-2 cells. BV-2 cells were exposed to sevoflurane or isoflurane for 3 h and nuclear factor-kappa B (NF-κB) transcriptional activity was measured using an ELISA-based kit (A). Data are presented as means ± S.D. (n = 3); N.S., not significant. After 3-h sevoflurane exposures, whole BV-2 cell lysates were analyzed for extracellular signal-regulated kinase (ERK), phospho-ERK (P-ERK), c-Jun NH2terminal kinase (JNK), phospho-JNK (P-JNK), p38 mitogen-activated protein kinase (p38-MAPK), phospho-p38 MAPK (P-p38MAPK), and β-actin expression using immunoblot analyses is shown in (B). Immunoblot quantification of p-ERK/ERK is shown in (C; n = 3). Data are presented as means ± S.D. (n = 3); *P < 0.05 versus control.

3.4. Sevoflurane-induced IL-6 during fetal development causes prolonged neurogenic abnormalities

Song, 2005). Therefore, we performed behavioral tests to define the effects of maternal anesthetic exposure on memory function in YM tests. With the exception of body weight, sevoflurane administration in utero (Sev + vs Sev-) had no significant effect on GHNS test results (Fig. 6A–D). Yet in YM tests, Sev + mice had significantly lower % alternations than Sev-mice (Fig. 6E). Because the present mice groups did not differ in total numbers of entries and distances traveled (Fig. 6F and G), these results suggest that Sev + mice had impaired memory.

Herein, we show that maternal volatile anesthetic exposures induce IL-6 in fetal brains. Excess IL-6 in the fetal brain reportedly caused significant increases in numbers of neuronal precursor cells (NPC) in the offspring (Gallagher et al., 2013), and these perturbations in NPC levels have been shown to affect cognitive function (Choi et al., 2016; Smith et al., 2007). Thus, to clarify the effects of anesthetics on neuronal development in the presence of increased IL-6 expression, we next focused on NPCs. NPCs are present in developing brains and in adult hippocampus and SVZ tissues, where they are responsible for generating neurons constantly (Kempermann and Gage, 1999; Morshead et al., 1994). Thus, we investigated the histology of the SVZ to determine whether maternal sevoflurane exposure affects adult neurogenesis in offspring through NPCs. Maternal mice were exposed to 1.5% sevoflurane for 3 h, and the offspring mice were reared normally after delivery. At p8wk, offspring were administered BrdU intraperitoneally and after 1 day and their brains were harvested to determine numbers of BrdU-positive cells in the SVZ. Mice that were exposed to sevoflurane in utero had around 1.5-fold more BrdU-positive cells than their control counterparts (Fig. 5A and B). In addition, to determine whether increases in BrdU-positive cell numbers in offspring are directly related to IL-6, we performed the same experiments using IL-6 knockout mice. Following exposure of maternal IL-6 −/− mice to sevoflurane for 3 h on G15.5 BrdU-positive cell numbers in p8wk offspring were not changed, in contrast with those in WT offspring (Fig. 5C and D).

4. Discussion In this study, we focused on the effects of anesthetics on proinflammatory cytokine expression in fetal mice brains following in utero administration. Recent evidence suggests that neuroinflammation is particularly important during CNS development. For example, MIA caused by bacterial or viral infection upregulates maternal proinflammatory cytokines, such as IL-6 and IL-17 (Careaga et al., 2017; Choi et al., 2016; Patterson, 2009). These cytokines can reach the fetal brain through the placenta and the immature fetal blood–brain barrier, thus activating fetal microglia to produce proinflammatory cytokines that disturb neuronal development (Bergdolt and Dunaevsky, 2019). In addition to MIA, various other environmental factors, including maternal psychological stress (Diz-Chaves et al., 2013), obesity (Bilbo and Tsang, 2010), and high-fat diets (Sasaki et al., 2013), can adversely affect fetal brains through the expression of proinflammatory cytokines. Therefore, we determined whether maternal exposure to anesthetics can induce proinflammatory cytokines in fetal brains. Maternal sevoflurane administration significantly induced IL-6 mRNA and protein expression in fetal brains. However, the other proinflammatory cytokines IL-17, IL-1β, and TNF-α were not elevated in response to anesthetics. Other volatile anesthetics, including isoflurane, halothane, and enflurane, also induced IL-6 expression. Because microglia, astrocytes, and neurons can express IL-6 in the CNS, we conducted in vitro experiments to identify cell types that respond to

3.5. Behavioral changes in offspring after maternal exposure to sevoflurane Maternal volatile anesthetic exposures induced IL-6 in the present fetal brains, and affected NPC dynamics in offspring. Although the functions of NPC in adulthood remain unclear, previous reports suggest that NPCs can affect cognitive function, especially memory (Ming and 7

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

Fig. 5. Effect of maternal sevoflurane exposure on neuronal precursor cells (NPCs) in the subventricular zone (SVZ) of offspring Pregnant IL-6 +/+ (WT) and IL-6 −/− (KO) mice at G15.5 were exposed to 1.5% sevoflurane for 3 h and numbers of NPCs in the SVZ of postnatal 8-week-old (p8wk) offspring were compared to those of the control. Bromodeoxyuridine (BrdU) was injected intraperitoneally into p8wk offspring and brains were harvested 24 h later. Coronal cortical sections through the SVZ and lateral ventricles were immunostained for BrdU (A, C). Numbers of BrdU-positive cells in WT mice (B; n = 5) and IL-6 −/− mice (D; n = 4) were quantified. Scale bars, 200 μm (×100) and 50 μm (×400). Data are presented as means ± S.D.; **P < 0.01, N.S., not significant.

volatile anesthetics. The induction of IL-6 by sevoflurane was confirmed in BV-2 microglial cells and in cultured astrocytes, but not in neurons. Glial cells, including astrocytes and microglia, have been shown to be the main sources of IL-6 in the brain (Erta et al., 2012). Therefore, our results indicate that volatile anesthetics induce IL-6 in fetal brains by affecting glial cells. Several studies show effects of volatile anesthetics on IL-6 expression. We reported previously that general anesthetics, including sevoflurane, suppress lipopolysaccharide-induced IL-6 expression in mice glial cell cultures (Tanaka et al., 2013), although sevoflurane itself induces IL-6 expression. Previous in vivo experiments with repeated exposures of young mice to 3% sevoflurane (3 × 2-h exposures) resulted in accumulation of IL-6 and TNF-α in the brain (Shen et al., 2013). We adopted more clinically relevant conditions of single 3–5-h maternal exposures to 1–2% sevoflurane, and observed significant induction of IL-6, but not TNF-α. The transcription factor NF-κB is the main regulator of IL-6 (Ajmone-Cat et al., 2003). Yet, NFκB expression was not enhanced by sevoflurane or isoflurane in our experiments. The other main pathway controlling proinflammatory cytokine release involves MAPKs, and we found that ERK phosphorylation was promoted by sevoflurane in BV-2 cells. Sevoflurane was also shown to induce ERK phosphorylation in neonatal rat brains (Zhu et al., 2018), and IL-6 is regarded as a primary target of ERK signaling in glial cells (Tanaka et al., 2013). Thus, it is likely that sevoflurane induces IL6 by activating ERK signaling. Gallagher et al. reported that maternally administered IL-6 crosses the fetal blood–brain barrier during the mid-gestational period and increases NPCs in the SVZ of adult offspring (Gallagher et al., 2013). Therefore, IL-6 in fetal brains may affect NPCs in offspring. Under the

present conditions of IL-6-induction following maternal exposures to 1.5% sevoflurane for 3 h, BrdU-positive SVZ cells, which are considered proliferative NPCs, were present in significantly increased numbers. This effect was not observed in IL-6 knockout mice, indicating that maternal sevoflurane exposure increases NPC levels in offspring by inducing IL-6 in fetal brains. Several studies report effects of anesthetics on neurogenesis, but the results are not consistent between these. For example, three consecutive daily 35-min exposures to 1.7% isoflurane in P14 rats (Zhu et al., 2010) or 3%–5% sevoflurane in P7 rats (Fang et al., 2012) led to reductions in NPCs. Yet, short, single exposures of sevoflurane did not change neurogenesis in P7 and P15 rats (Qiu et al., 2016). In another report, 6-h exposures to 1.8% sevoflurane in P4 rats increased neurogenesis (Chen et al., 2015). Most of these studies were performed with neonates, and the effects of sevoflurane on fetuses have been little studied. The diversity of reported effects of anesthetics on neurogenesis might be significantly influenced by the anesthetic administration period. The functions of NPCs remain controversial. Whereas adult NPCs directly affect cognitive function under pathological conditions, such as brain ischemia or trauma (Arvidsson et al., 2002), and under normal physiological conditions (Toda et al., 2019), it has been proposed that the dividing capacity of adult NPCs is very limited, and thus contributes very little to neuronal function (Kornack and Rakic, 2001; Sorrells et al., 2018). We investigated whether maternal exposure to sevoflurane affects cognitive function in offspring using behavioral analyses. Memory function was significantly impaired by maternal exposures to sevoflurane in our YM tests. Considering that our experimental sevoflurane administration protocol is similar to those of clinical settings, 8

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

Fig. 6. Mouse behavior tests. C57BL/6NCrSlc G15.5 pregnant mice were exposed to sevoflurane (1.5%) for 3 h. Physical characteristics, including body weights (A) and rectal temperatures (B) of 8-week-old offspring, are shown. Sensorimotor function tests of offspring were performed, and grip strengths (C) and tendencies to fall while hanging from a wire (D) are depicted. The results of the YM test (E–G) are presented as follows: percentages of correct alternation responses (E), total numbers of entries (F), traveling distances (G) in 5-min YM tests. Data are presented as means ± S.D. (n = 12); *P < 0.05, N.S., not significant.

this finding is very surprising. In particular, NPCs are reportedly neurons that are incorporated into neural circuits and contribute to cognitive functions (Ming and Song, 2005). Therefore, maternal volatile anesthetics administration may induce IL-6 in fetal brains, leading to changes to NPCs and memory impairment. But our data are insufficient to determine whether this change in NPCs is responsible for cognitive dysfunctions. As stated in a recent review, current evidence suggests that altered neurogenesis contributes to cognitive dysfunction, but conclusive proof is lacking (Kang et al., 2017). Hence, further studies are warranted to investigate how anesthetics affect cognitive functions through their effects on neurogenesis. In contrast with inhaled anesthetics, propofol did not induce IL-6 in the present fetal brains. We administered propofol in vivo using intraperitoneal injections rather than continuous intravenous injections, which are common in clinical practice. However, in our in vitro experiments, propofol did not upregulate IL-6. These findings suggest that sevoflurane and propofol differ in their induction of neuroinflammation in fetal brains when administered in utero. Further clinical studies are required to compare volatile anesthetics with propofol, and to optimize clinical anesthetic management during early development. Our studies have several important limitations. First, we performed in vivo experiments only on G15.5, which corresponds with the neurogenic period during the second trimester. Given that the timing of anesthetic exposure may significantly influence outcomes, other time settings will likely reveal different effects. Second, we did not examine dose-dependency of volatile anesthetics other than sevoflurane. Rather, we performed in vivo experiments with isoflurane and halothane at

approximately 1 minimal alveolar concentration, although we used enflurane at 1%, almost 0.5 MAC. Third, we only evaluated NPCs using BrdU immunohistochemical analyses, and more precise examinations with other NPC markers, such as Nestin or Pax-6, would be favorable. Fourth, neuroapoptosis is frequently investigated in studies of anesthetic neurotoxicity of anesthetics. We did not examine apoptosis directly, but were unable to detect cleaved caspase-3 in in vivo immunoblotting analyses (data not shown), albeit potentially due to technical difficulties. Therefore, whereas the deleterious effects of anesthetics on cognitive function in offspring may be mediated by neuroapoptosis, apoptotic neurons may have been relatively absent in the present experiments. Fifth, adult NPCs are present in the SVZ and in the subgranular layer of the dentate gyrus (DG) (Deng et al., 2010). We did not examine NPCs in the DG, but are aware that they play roles in memory function and that the effects of anesthetics may be related to these cells. Finally, we demonstrate that maternal sevoflurane exposure induces IL-6 in fetal brains and causes learning impairment, but the direct relationship between IL-6 elevation and cognitive dysfunction is left to be proved, as we did not investigate behavioral analysis with IL-6 knockout mice. Other factors like neurotrophin signaling, mitochondrial dysfunction or tau phosphorylation could be the possible cause. In conclusion, maternal exposure to volatile anesthetics under clinically relevant conditions directly affects fetal glial cells and enhances IL-6, probably through phospho-ERK signaling. Sevoflurane-induced IL-6 in the fetal brain increased NPC levels in offspring, and associated behavioral alterations were observed. Our findings strongly suggest that fetal IL-6 induction following maternal anesthetic exposure 9

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al.

effects neuronal development. Therefore, efforts to optimize anesthetic administration during pregnancy should be approached with the view of managing neuroinflammation.

Vessey, J.P., Cancino, G.I., Sachewsky, N., Woltjen, K., Fatt, M.P., Morshead, C.M., Kaplan, D.R., Miller, F.D., 2013. Transient maternal IL-6 mediates long-lasting changes in neural stem cell pools by deregulating an endogenous self-renewal pathway. Cell Stem Cell 13, 564–576. Hirabayashi, Y., Gotoh, Y., 2005. Stage-dependent fate determination of neural precursor cells in mouse forebrain. Neurosci. Res. 51, 331–336. Istaphanous, G.K., Howard, J., Nan, X., Hughes, E.A., McCann, J.C., McAuliffe, J.J., Danzer, S.C., Loepke, A.W., 2011. Comparison of the neuroapoptotic properties of equipotent anesthetic concentrations of desflurane, isoflurane, or sevoflurane in neonatal mice. Anesthesiology 114, 578–587. Jevtovic-Todorovic, V., Hartman, R.E., Izumi, Y., Benshoff, N.D., Dikranian, K., Zorumski, C.F., Olney, J.W., Wozniak, D.F., 2003. Early exposure to common anesthetic agents causes widespread neurodegeneration in the developing rat brain and persistent learning deficits. J. Neurosci. 23, 876–882. Kang, E., Berg, D.A., Furmanski, O., Jackson, W.M., Ryu, Y.K., Gray, C.D., Mintz, C.D., 2017. Neurogenesis and developmental anesthetic neurotoxicity. Neurotoxicol. Teratol. 60, 33–39. Kargaran, P., Lenglet, S., Montecucco, F., Mach, F., Copin, J.C., Vutskits, L., 2015. Impact of propofol anaesthesia on cytokine expression profiles in the developing rat brain: a randomised placebo-controlled experimental in-vivo study. Eur. J. Anaesthesiol. 32, 336–345. Kempermann, G., Gage, F.H., 1999. New nerve cells for the adult brain. Sci. Am. 280, 48–53. Kodama, M., Satoh, Y., Otsubo, Y., Araki, Y., Yonamine, R., Masui, K., Kazama, T., 2011. Neonatal desflurane exposure induces more robust neuroapoptosis than do isoflurane and sevoflurane and impairs working memory. Anesthesiology 115, 979–991. Kopf, M., Baumann, H., Freer, G., Freudenberg, M., Lamers, M., Kishimoto, T., Zinkernagel, R., Bluethmann, H., Kohler, G., 1994. Impaired immune and acutephase responses in interleukin-6-deficient mice. Nature 368, 339–342. Kornack, D.R., Rakic, P., 2001. Cell proliferation without neurogenesis in adult primate neocortex. Science 294, 2127–2130. Levin, E.D., Uemura, E., DeLuna, R., Franks, P., Bowman, R.E., 1987. Neurobehavioral effects of chronic halothane exposure during developmental and juvenile periods in the rat. Exp. Neurol. 98, 584–593. Lu, L.X., Yon, J.H., Carter, L.B., Jevtovic-Todorovic, V., 2006. General anesthesia activates BDNF-dependent neuroapoptosis in the developing rat brain. Apoptosis 11, 1603–1615. Lu, X., Ma, L., Ruan, L., Kong, Y., Mou, H., Zhang, Z., Wang, Z., Wang, J.M., Le, Y., 2010. Resveratrol differentially modulates inflammatory responses of microglia and astrocytes. J. Neuroinflammation 7, 46. Ming, G.L., Song, H., 2005. Adult neurogenesis in the mammalian central nervous system. Annu. Rev. Neurosci. 28, 223–250. Missault, S., Van den Eynde, K., Vanden Berghe, W., Fransen, E., Weeren, A., Timmermans, J.P., Kumar-Singh, S., Dedeurwaerdere, S., 2014. The risk for behavioural deficits is determined by the maternal immune response to prenatal immune challenge in a neurodevelopmental model. Brain Behav. Immun. 42, 138–146. Morshead, C.M., Reynolds, B.A., Craig, C.G., McBurney, M.W., Staines, W.A., Morassutti, D., Weiss, S., van der Kooy, D., 1994. Neural stem cells in the adult mammalian forebrain: a relatively quiescent subpopulation of subependymal cells. Neuron 13, 1071–1082. Numakawa, T., Yokomaku, D., Kiyosue, K., Adachi, N., Matsumoto, T., Numakawa, Y., Taguchi, T., Hatanaka, H., Yamada, M., 2002. Basic fibroblast growth factor evokes a rapid glutamate release through activation of the MAPK pathway in cultured cortical neurons. J. Biol. Chem. 277, 28861–28869. Palanisamy, A., 2012. Maternal anesthesia and fetal neurodevelopment. Int. J. Obstet. Anesth. 21, 152–162. Patterson, P.H., 2009. Immune involvement in schizophrenia and autism: etiology, pathology and animal models. Behav. Brain Res. 204, 313–321. Qiu, L., Zhu, C., Bodogan, T., Gomez-Galan, M., Zhang, Y., Zhou, K., Li, T., Xu, G., Blomgren, K., Eriksson, L.I., Vutskits, L., Terrando, N., 2016. Acute and long-term effects of brief sevoflurane anesthesia during the early postnatal period in rats. Toxicol. Sci. 149, 121–133. Sasaki, A., de Vega, W.C., St-Cyr, S., Pan, P., McGowan, P.O., 2013. Perinatal high fat diet alters glucocorticoid signaling and anxiety behavior in adulthood. Neuroscience 240, 1–12. Satomoto, M., Satoh, Y., Terui, K., Miyao, H., Takishima, K., Ito, M., Imaki, J., 2009. Neonatal exposure to sevoflurane induces abnormal social behaviors and deficits in fear conditioning in mice. Anesthesiology 110, 628–637. Shen, X., Dong, Y., Xu, Z., Wang, H., Miao, C., Soriano, S.G., Sun, D., Baxter, M.G., Zhang, Y., Xie, Z., 2013. Selective anesthesia-induced neuroinflammation in developing mouse brain and cognitive impairment. Anesthesiology 118, 502–515. Smith, S.E., Li, J., Garbett, K., Mirnics, K., Patterson, P.H., 2007. Maternal immune activation alters fetal brain development through interleukin-6. J. Neurosci. 27, 10695–10702. Sorrells, S.F., Paredes, M.F., Cebrian-Silla, A., Sandoval, K., Qi, D., Kelley, K.W., James, D., Mayer, S., Chang, J., Auguste, K.I., Chang, E.F., Gutierrez, A.J., Kriegstein, A.R., Mathern, G.W., Oldham, M.C., Huang, E.J., Garcia-Verdugo, J.M., Yang, Z., AlvarezBuylla, A., 2018. Human hippocampal neurogenesis drops sharply in children to undetectable levels in adults. Nature 555, 377–381. Takabuchi, S., Hirota, K., Nishi, K., Oda, S., Oda, T., Shingu, K., Takabayashi, A., Adachi, T., Semenza, G.L., Fukuda, K., 2004. The intravenous anesthetic propofol inhibits hypoxia-inducible factor 1 activity in an oxygen tension-dependent manner. FEBS Lett. 577, 434–438. Takesian, A.E., Hensch, T.K., 2013. Balancing plasticity/stability across brain development. Prog. Brain Res. 207, 3–34. Tanaka, T., Kai, S., Koyama, T., Daijo, H., Adachi, T., Fukuda, K., Hirota, K., 2011.

Authors' contributions A.H. performed most of the experiments and wrote the manuscript. Y.I. performed experiments using neuronal cultures, K.T., Y.M., and T.M. helped in conducting the experiments. T.T. performed and supervised the experiment and wrote the manuscript. Declaration of interest None declared. Acknowledgements This research received the Grant-in Aid for Scientific Research (17K11076) from the Japan Society for the Promotion of Science (Tokyo, Japan). We wish to thank RIKEN BRC for providing IL-6 knockout mouse (RBRC04918), thank Center for Anatomical, Pathological and Forensic Medical Researches, Graduate School of Medicine, Kyoto University for helping immunocytochemical analysis and thank Division for Mouse Behavior Analysis, Medical Research Support Center, Graduate School of Medicine, Kyoto University for technical help and advice for mouse behavior test. References Ajmone-Cat, M.A., De Simone, R., Nicolini, A., Minghetti, L., 2003. Effects of phosphatidylserine on p38 mitogen activated protein kinase, cyclic AMP responding element binding protein and nuclear factor-kappaB activation in resting and activated microglial cells. J. Neurochem. 84, 413–416. Alves, H.C., Valentim, A.M., Olsson, I.A., Antunes, L.M., 2007. Intraperitoneal propofol and propofol fentanyl, sufentanil and remifentanil combinations for mouse anaesthesia. Lab. Anim. 41, 329–336. Arvidsson, A., Collin, T., Kirik, D., Kokaia, Z., Lindvall, O., 2002. Neuronal replacement from endogenous precursors in the adult brain after stroke. Nat. Med. 8, 963–970. Bergdolt, L., Dunaevsky, A., 2019. Brain changes in a maternal immune activation model of neurodevelopmental brain disorders. Prog. Neurobiol. 175, 1–19. Bilbo, S.D., Tsang, V., 2010. Enduring consequences of maternal obesity for brain inflammation and behavior of offspring. FASEB J. 24, 2104–2115. Bocchini, V., Mazzolla, R., Barluzzi, R., Blasi, E., Sick, P., Kettenmann, H., 1992. An immortalized cell line expresses properties of activated microglial cells. J. Neurosci. Res. 31, 616–621. Boscolo, A., Milanovic, D., Starr, J.A., Sanchez, V., Oklopcic, A., Moy, L., Ori, C.C., Erisir, A., Jevtovic-Todorovic, V., 2013. Early exposure to general anesthesia disturbs mitochondrial fission and fusion in the developing rat brain. Anesthesiology 118, 1086–1097. Careaga, M., Murai, T., Bauman, M.D., 2017. Maternal immune activation and autism spectrum disorder: from rodents to nonhuman and human primates. Biol. Psychiatry 81, 391–401. Cattano, D., Young, C., Straiko, M.M., Olney, J.W., 2008. Subanesthetic doses of propofol induce neuroapoptosis in the infant mouse brain. Anesth. Analg. 106, 1712–1714. Chen, C., Shen, F.Y., Zhao, X., Zhou, T., Xu, D.J., Wang, Z.R., Wang, Y.W., 2015. Low-dose sevoflurane promotes hippocampal neurogenesis and facilitates the development of dentate gyrus-dependent learning in neonatal rats. ASN Neuro 7. Choi, G.B., Yim, Y.S., Wong, H., Kim, S., Kim, H., Kim, S.V., Hoeffer, C.A., Littman, D.R., Huh, J.R., 2016. The maternal interleukin-17a pathway in mice promotes autism-like phenotypes in offspring. Science 351, 933–939. Deng, W., Aimone, J.B., Gage, F.H., 2010. New neurons and new memories: how does adult hippocampal neurogenesis affect learning and memory? Nat. Rev. Neurosci. 11, 339–350. Diz-Chaves, Y., Astiz, M., Bellini, M.J., Garcia-Segura, L.M., 2013. Prenatal stress increases the expression of proinflammatory cytokines and exacerbates the inflammatory response to LPS in the hippocampal formation of adult male mice. Brain Behav. Immun. 28, 196–206. Erta, M., Quintana, A., Hidalgo, J., 2012. Interleukin-6, a major cytokine in the central nervous system. Int. J. Biol. Sci. 8, 1254–1266. Estes, M.L., McAllister, A.K., 2016. Maternal immune activation: implications for neuropsychiatric disorders. Science 353, 772–777. Fang, F., Xue, Z., Cang, J., 2012. Sevoflurane exposure in 7-day-old rats affects neurogenesis, neurodegeneration and neurocognitive function. Neurosci. Bull. 28, 499–508. Gallagher, D., Norman, A.A., Woodard, C.L., Yang, G., Gauthier-Fisher, A., Fujitani, M.,

10

European Journal of Pharmacology 863 (2019) 172682

A. Hirotsu, et al. General anesthetics inhibit erythropoietin induction under hypoxic conditions in the mouse brain. PLoS One 6, e29378. Tanaka, T., Kai, S., Matsuyama, T., Adachi, T., Fukuda, K., Hirota, K., 2013. General anesthetics inhibit LPS-induced IL-1beta expression in glial cells. PLoS One 8, e82930. Tao, G., Zhang, J., Zhang, L., Dong, Y., Yu, B., Crosby, G., Culley, D.J., Zhang, Y., Xie, Z., 2014. Sevoflurane induces tau phosphorylation and glycogen synthase kinase 3beta activation in young mice. Anesthesiology 121, 510–527. Toda, T., Parylak, S.L., Linker, S.B., Gage, F.H., 2019. The role of adult hippocampal neurogenesis in brain health and disease. Mol. Psychiatry 24, 67–87. Tozuka, Y., Kumon, M., Wada, E., Onodera, M., Mochizuki, H., Wada, K., 2010. Maternal obesity impairs hippocampal BDNF production and spatial learning performance in young mouse offspring. Neurochem. Int. 57, 235–247. van den Pol, A.N., Mao, G., Yang, Y., Ornaghi, S., Davis, J.N., 2017. Zika virus targeting in

the developing brain. J. Neurosci. 37, 2161–2175. Vutskits, L., Xie, Z., 2016. Lasting impact of general anaesthesia on the brain: mechanisms and relevance. Nat. Rev. Neurosci. 17, 705–717. Wu, W.L., Hsiao, E.Y., Yan, Z., Mazmanian, S.K., Patterson, P.H., 2017. The placental interleukin-6 signaling controls fetal brain development and behavior. Brain Behav. Immun. 62, 11–23. Zhu, C., Gao, J., Karlsson, N., Li, Q., Zhang, Y., Huang, Z., Li, H., Kuhn, H.G., Blomgren, K., 2010. Isoflurane anesthesia induced persistent, progressive memory impairment, caused a loss of neural stem cells, and reduced neurogenesis in young, but not adult, rodents. J. Cereb. Blood Flow Metab. 30, 1017–1030. Zhu, Q.L., Luo, Y., Xue, Q.S., Zhang, F.J., Yu, B.W., 2018. Different doses of sevoflurane facilitate and impair learning and memory function through activation of the ERK pathway and synthesis of ARC protein in the rat hippocampus. Brain Res. 1678, 174–179.

11