Matrix Metalloproteinase-19 in Capillary Endothelial Cells: Expression in Acutely, but Not in Chronically, Inflamed Synovium

Experimental Cell Research 250, 122–130 (1999) Article ID excr.1999.4493, available online at http://www.idealibrary.com on

Matrix Metalloproteinase-19 in Capillary Endothelial Cells: Expression in Acutely, but Not in Chronically, Inflamed Synovium Cornelia Kolb, 1 Simon Mauch, Ulrich Krawinkel, and Radislav Sedlacek University of Konstanz, D-78464 Koustanz, Germany

Matrix metalloproteinase-19 (MMP-19), originally isolated as an autoantigen from the synovium of a patient suffering from rheumatoid arthritis (RA), is expressed in smooth muscle cells of the tunica media of large blood vessels of an RA patient, but not in the endothelial cell layer. By contrast, in acutely inflamed tissue, synovial capillaries strongly express MMP-19 in the cytoplasm, as shown by immunofluorescence of cryostat sections. In MMP-19-producing capillaries the b3 integrin chain was found at the endothelial cell surface, as was the vascular endothelial cell growth factor receptor-2 (KDR). The specific tissue inhibitor of metalloproteinases TIMP-1 was absent or faintly stained in MMP-19-expressing capillaries, whereas TIMP-1, but not TIMP-2, was strongly expressed in large vessels and in MMP-19-negative capillaries of RA synovia. In the spontaneously transformed human umbilical vein endothelial cell line ECV304 neither MMP-19 transcripts nor protein could be detected. By contrast, primary cultures of human endothelial cells of either dermal or adipose tissue origin produced MMP-19 mRNA and protein. The results strongly suggest the regulated induction of matrix metalloproteinase-19 in capillary endothelial cells during acute inflammation and hint at a role of MMP-19 in angiogenesis. © 1999 Academic Press Key Words: MMP-19; capillary endothelium; inflammation; angiogenesis.

INTRODUCTION

Matrix metalloproteinases (MMP) are a family of zinc-binding enzymes that are active in the remodeling of the extracellular matrix during normal growth and wound repair [1, 2]. They are considered to play a crucial role also in a number of pathological states, such as in the destruction of tissues in rheumatoid arthritis [3] and in tumor growth, progression, and metastasis [4]. In recent years, the action of MMPs 1 To whom correspondence and reprint requests should be addressed at Faculty of Biology, Department of Immunology, University of Konstanz, P.O. Box 5560M661, D-78464 Konstanz, Germany. Fax: 0049-7531-883102. E-mail: [email protected].

0014-4827/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.

during angiogenesis in growing tumors has been the focus of interest since their activity and their inhibition by tissue inhibitors of MMPs (TIMPs) are possible targets of intervention [4 – 6]. The matrix metalloproteinase MMP-19, designated RASI, has been isolated as an autoantigen from the inflamed synovium of a patient suffering from rheumatoid arthritis (RA) [7]. It is the prototypic member of a new MMP subclass, as deduced from several unusual structural features [7–9]. The protein has been localized to the smooth muscle cells (SMC) of the tunica media of blood vessels in an RA patient’s synovium and in normal skin as well as in smooth muscle cells of uterine ligaments [10]. Endothelial cells (EC) in these tissues did not express MMP-19. In this study we show that MMP-19 was strongly expressed by capillary EC of the synovium from patients suffering from an acute inflammation or from patella luxation. MATERIALS AND METHODS Tissue samples. Synovial membranes were either fresh or shock frozen. Patient STU fulfilled the revised criteria for RA diagnosis of the American Rheumatism Association (ACR) [11]. Patient RAM suffered from bursitis olecrani. Patient LER had articular swelling of the knee (hydrops articularis intermittens), indicating the beginning of polyarthritis, and chondropathia retropatellaris. Patient SCH had suffered from patella luxation. Immunofluorescence. Tissue staining was done as described [10]. Isolated cells were grown on cover slips or chamber slides (LabTek), fixed with 4% paraformaldehyde in PBS for 10 min at room temperature, and washed in PBS before immunostaining. Photographs were digitized and processed with Adobe photoshop 5.0. Antibodies. MMP-19 specific antibodies have been described previously [10]. The secondary antibody was either Cy3- or Alexa greenconjugated goat-anti-rabbit-IgG-specific antibodies (Dianova, Molecular Probes). Primary monoclonal IgG1 antibodies, specific for CD31, (BioGenex), type IV collagen (Biogenex), smooth muscle myosin (Sigma), b3 integrin (ICN), VEGF-R2 (KDR, a kind gift of Dr. D. Marme´, Freiburg, Germany), MMP-2, MMP-3, MMP-9, TIMP-1, TIMP-2 (all Dianova), and primary monoclonal IgG2a antibodies specific for MMP-1, and PCNA (both Dianova) were reacted with biotinylated goat-anti-mouse subclass-specific antibodies (Amersham) and streptavidin–Cy3 or –FITC, respectively (Dianova), or with Alexa-green-conjugated goat-anti-mouse-IgG (Molecular Probes). Binding of monoclonal IgM antibody EN7/44 (BMA) was detected with Cy3-conjugated goat-anti mouse IgM specific antibodies (Dianova).

122

123

MMP-19 IN CAPILLARY ENDOTHELIUM Isolation and culture of human vascular cells. Human macrovascular EC from human umbilical veins (HUVEC) and arteries (HUAEC) as well as SMCs were isolated and cultured by a modification of described techniques [12]. Briefly, arteries and veins were removed from the umbilical cord under sterile conditions, cleaned, and rinsed with 13 HBSS. After stripping of arterial tunica adventitia, both types of vessels were treated with 1 mg/ml collagenase (Boehringer-Mannheim) in DMEM/F12 medium supplemented with 2% FCS at 37°C. While the veins were incubated in the medium for at least 30 min, the arteries were treated only for 20 min in order to preferentially detach EC. Afterward, the arterial remnants were allowed to sediment, while EC were collected, washed, and plated on culture vessels. To isolate SMC, the arterial remnants were incubated in DMEM/F12 supplemented with 1 mg/ml collagenase, 4 mg/ml elastase, and 2% FCS. The macrovascular EC were further cultured in EC growth medium MV (Promocell) containing 10 ng/ml EGF and heparin to forward the expansion of EC over SMC and other contaminating cell types in primary cultures. SMC were plated in SMC growth medium (Promocell) with low serum content, plus 10 ng/ml EGF and 2 ng/ml bFGF, and then grown in DMEM/F12 complete medium supplemented with 20% FCS, 25 mmol/liter Hepes, and penicillin/streptomycin. Human microvascular EC were isolated directly from liposuctioned fat tissue. Most of the fat tissue was washed off with Dulbecco’s Ca- and Mg-free phosphate-buffered saline. The mixture was then incubated for 30 min at 37°C with DMEM/F12 medium supplemented with 2% FCS and 1 mg/ml collagenase. The dissolved tissue was centrifuged at 900g for 6 min and a supernatant containing adipocytes was removed. The remaining pellet consisting of EC and fragments of capillaries were washed in complete medium DMEM/F12 and plated on culture flasks with low-serum EC growth medium MV (Promocell) containing 10 ng/ml EGF. The endothelial cell line ECV304 (ATCC number CRL-1998) was cultured in complete 199 medium with Glutamax (Gibco BRL), with or without TPA, and in EC growth medium (Promocell) with 10 ng/ml EGF and 1 ng/ml bFGF. RNA preparation. Total RNA was isolated using RNAzol B (WAK-Chemie). All RNA preparations were tested to be free of genomic DNA by PCR using 100 ng of total RNA and an amplification for 25 cycles using the GAPDH-specific primer pair. Reverse transcription reactions. Each 30-ml cDNA synthesis reaction contained 1 mg of total RNA, 50 mmol/liter Tris–HCl (pH 8.3), 75 mmol/liter, 3 mmol/liter MgCl 2, 10 mmol/liter DTT, 0.5 mmol/liter of all four dNTPs, 20 U RNAguard (Pharmacia), 200 U of Superscript II reverse transcriptase (Life Technologies), and 0.5 mg of oligo(dT)12–18 (Pharmacia). Control reactions contained the same components except the Superscript enzyme. Reverse transcription was accomplished by heating the RNA to 70°C for 5 min, chilling down on ice, and incubation at 42°C for 50 min after addition of the remaining reaction components. Reactions were heated to 70°C for 5 min to terminate the reaction.

PCR reactions. Semiquantitative PCR was performed in 100-ml reaction volumes on a PREM thermal cycler (LEP Scientific). Each reaction contained 3 ml cDNA from the above reverse transcription reaction (corresponding to cDNA synthesized from 100 ng of total RNA) or 3 ml of negative control, 10 mmol/liter Tris–HCl (pH 9.0), 50 mmol/liter KCl, 1.5 mmol/liter MgCl 2, 0.1% Triton X-100, 0.2 mg/ml BSA, 0.2 mmol/liter of all four dNTPs (AGS), 2.5 U Taq polymerase (Appligene Oncor), and 0.5 mmol/liter MMP-19-specific primers. Primer and template cDNA were separated from the other reaction components by a layer of paraffin wax until the first denaturation step. Each PCR cycle consisted of a denaturation step at 94°C for 45 s, an annealing step at 62°C for 45 s, and an elongation step at 72°C for 45 s. Five microliters of the GAPDH-specific primer pair (0.5 mmol/liter each) was added after 15 cycles and PCR was continued for another 15 cycles. The number of cycles for the MMP-19- and the GAPDH-specific primer pairs was chosen to be in the exponential range of the amplification reaction to obtain semiquantitative results (data not shown). All RT-PCR experiments were repeated at least once. Primers. Sequences for human GAPDH were obtained from GenBank and used to design the GAPDH-specific primer pair. Primers were: MMP-19, 59TGCCCACAGAACCCAGTCC 39 and 59GGTATTCCCACCTGATGGGGTAG39 (product length, 626 bp); and GAPDH, 59ACCATCTTCCAGGAGCGAG39 and 59ACGTTGGCAGTGGGGACAC39 (product length, 498 bp).

RESULTS

Differential Expression of MMP-19 in Synovial Blood Vessels of Different Diseases In the thick collagenous synovial membrane of an RA patient (STU) and a patient suffering from bursitis olecrani (RAM), the expression of MMP-19 was detected exclusively in the smooth muscle cells of the tunic media of arteries [10]. The endothelial cell layer as defined by a mAb specific for CD31 (PECAM) did not stain for MMP-19, neither in arteries nor venules or capillaries, which were numerous in this tissue (Fig. 1A). By contrast, the thin and slack synovial membrane of a patient (LER) with early arthritis, indicated by unclear swelling (hydrops articularis intermittens) and chondropathia retropatellaris, and a patient suffering from a patella luxation (SCH) showed many capillaries with bright MMP-19 staining. Double staining for

FIG. 1. Cryostat sections of synovial membranes. (Left) Chronic inflammation, RA patient STU (A,C,E,G,I). (Right) Acute inflammation, patient LER (B,D,F,H,K). Double-staining with antibodies specific for MMP-19 in red and various specificities in green. Bars in the graphs are 50 mm. (A) The RA synovium shows localization of MMP-19 (red) in SMC of the tunica media of large vessels, with no overlap with the endothelial cell marker CD31 (green) (confocal microscopic image). (B) Patient LER with acute inflammation. MMP-19 (red) is localized in the cytoplasm of endothelial cells of many small capillaries; co-staining of CD31 (green) at the luminal cell surface appears yellow. (C) Overlapping distribution (yellow) of MMP-19 (red) and SMC myosin (green) in the tunica media, but not in small vessels in the RA synovium. (D) In the acutely inflamed synovium, some small vessels show coexpression of MMP-19 (red) and myosin (green). (E) MMP-19 (red) and type IV collagen (green) are coexpressed (yellow) only in the tunica media of the RA synovium. (F) Many capillary endothelial cells coexpress MMP-19 (red) with type IV collagen (green) in patient LER. (G) EN7/44 (green) is found in many small vessels in the RA patient, but these are negative for MMP-19 (red). (H) Acutely inflamed synovium of patient LER, small capillaries show overlapping stain (yellow) for both MMP-19 (red) and EN7/44 antigen (green). (I) Synovium of RA patient STU, with staining of MMP-19 (red) only in the tunica media and VEGF-R2 (green) only in small blood vessels, with no overlap. (K) Synovium in acute inflammation. The capillaries express both MMP-19 (red) in the cytoplasm and VEGF-R2 (green) at the luminal endothelial cell surface.

124

KOLB ET AL.

MMP-19 IN CAPILLARY ENDOTHELIUM

125

126

KOLB ET AL.

MMP-19 and CD31 confirmed the endothelial origin of the stained structures (Fig. 1B) and revealed a difference in the localization of the antigens: CD31 molecules were situated in the center of capillaries, whereas MMP-19 was stained in the cytoplasm and around endothelial cells. Smooth-muscle-cell-specific myosin was found in the RA synovium coexpressed with MMP-19 in the tunica media of larger vessels, but also in many smaller MMP-19-negative vessels (Fig. 1C). In the acutely inflamed synovium, myosin was expressed in correlation with the size of MMP-19-positive capillaries (Fig. 1D). Basal-lamina-specific collagen type IV was coexpressed with MMP-19 in the tunica media of the RA synovium (Fig. 1E) and in the small capillaries of the acute inflammation (Fig. 1F). MMP-19 Expression in Growing Capillaries The differential expression of MMP-19 in capillaries led us to ask whether MMP-19 expression in endothelial cells (EC) could be a marker for growing capillaries. To this end we used a mAb claimed to stain specifically budding capillaries (EN7/44) [13]. The synovium of RA patient STU showed staining of MMP-19-negative capillaries and small vessels and of the endothelial cell layer of veins (Fig. 1G). Patient LER, with early arthritis, revealed partial costaining (Fig. 1H) or a close association of disparate MMP-19- and EN7/44-positive cells. Therefore, we conclude MMP-19 in endothelial cells may be correlated, but not necessarily coexpressed with the unspecified antigen stained by antibody EN7/44. Correlation of MMP-19 Expression with Inflammation Since the staining pattern of MMP-19 in capillaries is quite distinct in the different tissue samples, we asked whether capillary MMP-19-expression results from inflammatory signals, which are known to induce the upregulation of the receptor for vascular endothelial cell growth factor 2 (VEGF-R2) in endothelial cells early in angiogenesis [14]. In the RA synovium smaller vessels showed staining for VEGF-R2, whereas the tunica media of larger vessels had MMP-19, but no

overlap of staining was observed (Fig. 1I). However, the synovium of the patient with early arthritis showed many capillaries with concomitant expression of MMP-19 in the cytoplasm and VEGF-R2 at the luminal surface of the endothelial cells (Fig. 1K), thus indicating the inflamed state of the synovium. Another molecule, upregulated by inflammatory cytokines, is avb3 integrin [15]. The RA synovium had some small vessels positive for avb3 integrin, but they were negative for MMP-19 (Fig. 2A). By contrast, in the acutely inflamed synovium, most of the capillaries, which showed avb3 integrin at the luminal side, expressed MMP-19 in the cytoplasm (Fig. 2B). Thus, two molecules that are upregulated by inflammatory influence are coexpressed with MMP-19 in endothelial cells of the acutely inflamed synovium, but not of the chronically inflamed RA synovium. MMP-19-expressing capillaries were negative for all other MMPs tested. Interstitial collagenase (MMP-1) and gelatinase A (MMP-2) were found in stromal cells and in infiltrated monocytes, and gelatinase B (MMP-9) was in single monocytes, stromelysin (MMP-3) was not detected (not shown). MMP-19 and TIMP Tissue inhibitors of metalloproteinases (TIMP) are known to inhibit the enzymatic activity of MMPs as important regulators of the destructive action of these enzymes. Whereas staining for TIMP-2 did not reveal prominent structures except the collagenous border of the synovium (not shown), TIMP-1 was coexpressed with MMP-19 in the tunica media of arteries and in the wall of other greater vessels. This held true for the synovia of all patients examined. While in the synovium of the RA patient the MMP-19-negative endothelium also of smaller vessels including capillaries expressed TIMP-1 (Fig. 2C), the MMP-19-positive endothelia in the synovium of early arthritis (patient LER) showed a distinctive pattern of TIMP-1 expression: The tunica media of larger vessels had strong TIMP-1 staining (green fluorescence in Fig. 2D), but MMP-19-positive capillaries (red fluorescence in Fig.

FIG. 2. Cryostat sections of synovial membranes (A–D) and endothelial cells in vitro (E–F). Double staining with antibodies specific for MMP-19 is shown in red and various specificities in green. Bars in the graphs are 50 mm, except for E and E‘, where it is 10 mm. (A) Synovium of RA patient STU. b3 chain of integrin (green) is found in several small capillaries, and MMP-19 was not detected. (B) The acutely inflamed synovium shows islands of b3 chain integrin on the luminal surface of small capillaries that strongly stain for MMP-19. (C) Synovium of an RA patient. The tunica media costains, partially overlapping (yellow), for both MMP-19 (red) and TIMP-1 (green) (confocal image). A small vessel exhibits TIMP-1, but not MMP-19. (D) The acutely inflamed synovium of patient LER has larger vessels strongly staining for TIMP-1 (green only in D), but TIMP-1-negative capillaries staining for MMP-19 (red and green in D9). The different strength of TIMP-1 expression is compared in large vessels, where TIMP-1 is brightly staining (D0), and in small capillaries of the same section, where TIMP-1 is only weakly detected (D-). (E) Human arterial endothelial cells after 1 day of primary culture. Projections of the highest 12 (E) and the lowest 6 (E9) optical sections, respectively, by confocal microscopy. While the surface marker CD31 (green) is displayed at the cellular membrane, MMP-19 (red) is localized in cellular protrusions (arrow) and in macrovilli (vacuols, arrowheads). (F) Human microvascular endothelial cells in primary culture show MMP-19 (red) within the cytoplasm, whereas CD31 (green) covers the cellular surface.

127

MMP-19 IN CAPILLARY ENDOTHELIUM

FIG. 3. MMP-19 mRNA expression in various blood-vessel-derived cell types. The HUVEC line ECV304 and primary cultures of HUVEC are negative for MMP-19 mRNA. HUAEC show only weak expression. Stimulation with 10 ng/ml EGF for at least 24 h had no effect on the expression level in either cell type. Human microvascular EC (MVEC) from skin and from fat tissue show MMP-19 expression that is stimulated with 20 ng/ml TPA (20 h). SMC, either confluent or proliferating, show a strong MMP-19 mRNA-derived signal which is elevated by stimulation with growth factors (10 ng/ml EGF and 2 ng/ml bFGF) and to a higher level with 20 ng/ml TPA for 20 h.

2D9 of the same field) were nearly negative for TIMP-1. Vessels of intermediate size showed TIMP-1 in the endothelium (Fig. 2D0), but the very smallest capillaries, the ones consisting of one cell layer, did not express TIMP-1 (Fig. 2D-). The latter two figures were taken from a single section and have been exposed for exactly the same time. The reciprocal correlation of MMP-19 and the inhibitor TIMP-1 in capillaries suggests a delicate control not only of the expression of this matrix metalloproteinase, but also of its enzymatic activity in endothelial cells. A summary of the results is given in Table 1. Human Vascular Endothelial Cells Express MMP-19 in Vitro In order to verify MMP-19 expression in EC in vitro, we cultured EC from various origins. To investigate MMP-19 gene expression at the mRNA level, we established a semiquantitative RT-PCR assay based on the primer dropping method [16]. Primer pairs specific for MMP-19, and for GAPDH serving as an internal control, were employed. The macrovascular HUVEC line ECV304 did not express MMP-19, neither in immunostaining nor in the MMP-19 RT-PCR (Fig. 3). Stimulation with 20 ng/ml TPA, 10 ng/ml EGF, or 1 ng/ml bFGF for 24 h did not induce transcription of the mmp-19 gene in ECV304 cells (data not shown). As transformation of this cell line could have switched off its MMP-19 expression, as has already been shown for other markers [17], primary cultures of human endothelial cells were established. Primary HUVEC from umbilical cord showed faint MMP-19 staining of the

cytoplasm and were negative for MMP-19 mRNA, even after stimulation with 10 ng/ml EGF or 1 ng/ml bFGF for 24 h (Fig. 3). By contrast, EGF-stimulated primary HUAEC from the same source had MMP-19 in the cytoplasm (Fig. 2E). Granulous staining was observed at discrete locations, in long protrusions and macrovilli, whereas the cell adhesion molecule CD31 is stained on the cell membrane. MMP-19 staining was strongest shortly after explantation, the MMP19 protein was then downregulated upon further cultivation. This is paralleled by the expression of MMP-19 mRNA, which decreased during prolonged cultivation. Human microvascular EC from skin showed high expression of MMP19 protein in the cytoplasm with bright staining around the nucleus, whereas staining for CD31 extended over the whole surface of the spreaded cell body (Fig. 2F). Microvascular EC from fat tissue, with smaller elongated morphology, also had cytoplasmic MMP-19 (not shown). Human microvascular EC from both sources exhibited strong expression of MMP-19 mRNA upon cultivation in medium with or without supplementation of 10 ng/ml EGF (Fig. 3). Furthermore, the level of mRNA expression was elevated after stimulation with TPA, a potent inducer of angiogenesis [18]. Smooth muscle cells from umbilical cord preparations strongly costained for MMP-19 and SMC myosin. SMC most strongly expressed MMP-19 mRNA in comparison to the other blood-vessel-derived cell types (Fig. 3), confirming staining data that have been documented in a previous study [10]. MMP-19 mRNA expression is elevated after stimulation with TPA, EGF, and bFGF. In addition, proliferating SMC exhibit a higher level of MMP-19 mRNA than resting cells kept in dense culture for 2 days. Thus, mRNA expression of the various cell types studied here is in accordance with immunostaining. DISCUSSION

In a previous study we have localized the expression of MMP-19 to smooth muscle cells in the tunica media of arteries and veins in the thick and collagen-rich tissue of an RA patient, while the endothelial cell layer and the numerous capillaries did not express MMP-19 [10]. By contrast, in the thin and loose synovial tissue of a patient (LER) with early arthritis, where larger vessels are rare, MMP-19 is strongly expressed in small capillaries. These endothelial cells, as defined by CD31 expression at the luminal surface, coexpressed MMP-19 with the b3 chain of integrin and with the vascular endothelial growth factor receptor-2. avb3 Integrin has been identified as the most important survival signal for nascent vessels [19] through the inhibition of apoptosis in endothelial cells by induction of NF-kB [20]. The level of av chain mRNA expression is

128

KOLB ET AL.

TABLE 1 Summary of Results Chronic inflammation (STU, rheumatoid arthritis; RAM, bursitis olecrani)

Acute inflammation (LER, hydrops articularis; SCH, patella luxation)

Synovia (antibody specificity)

Capillary

Small vessel

Tunica media

Capillary

Small vessel

Tunica media

MMP-19 CD31 myosin collagen IV EN7/44 VEGF-R2 b3 integrin TIMP-1 TIMP-2 MMP-1 MMP-2 MMP-3 MMP-9

2 1 2 1 2 2 2 1 2 2 2 2 2

2 1 1 1 1 1 1 1 2 2 2/1 2 2

1 2 1 1 2 2 1 1 2 2/1 2 2 2

1 1 2 1 2 2 or 1 2 or 1 2 2 2 2 2 2

1 1 1 1 1 1 1 2/1 2 2 2 2 2

1 2 1 1 2 2 1 1 2 2 2 2 2

upregulated in angiogenesis [21–24] through inflammatory cytokines [15, 25, 26]. MMP-19 expression in capillaries of patient LER suggests that these are in a state of angiogenesis during inflammation. The patient suffered from unclear swelling at several joints, has not been treated with pharmaca when the biopsy was taken, and probably was at the beginning of a polyarthitis. This is in contrast to the synovia of patients suffering from chronic inflammation, probably under the influence of therapy, where capillaries did not express MMP-19. MMP-19 is actively produced in capillary endothelium of acutely inflamed synovia, in contrast to gelatinase A (MMP-2), which is bound to avb3 at the outer membrane of angiogenic endothelial cells [27, 28]. This is demonstrated by MMP-19 mRNA expression in microvascular endothelial cells in vitro and by the localization of MMP-19 protein in the cytoplasm and potentially in storage vesicles (Figs. 2E and 2F). A similar distribution pattern has been shown for gelatinase B (MMP-9) [29]. The acute inflammatory state of the synovium of patient LER with capillaries expressing MMP-19 is confirmed by the coexpression of VEGF-R2 [14]. This transmembrane receptor tyrosine kinase is upregulated in angiogenic endothelial cells by several cytokines, namely, TNFa [30], TGFa [31], bFGF [32], and IL-1b [33]. Furthermore, VEGF induces avb3 integrin mRNA and expression of the protein at the cell surface [25]. We therefore conclude that MMP-19 is expressed in angiogenic endothelium but not in resting endothelium. We did not detect proliferating cell nuclear antigen [34] in these capillaries (data not shown), indicating that there is no intrinsic correlation of activation and proliferation in angiogenesis [35] and that the state of

migration preceeds the proliferating state. Antibody EN7/44, which has been claimed to stain budding capillaries [13], indeed detects cells in close association with MMP-19-expressing capillaries. Whether these are activated pericytes [36, 37] remains to be clarified. The regulated expression of MMPs during angiogenesis is an interesting field of recent studies [5, 38]. In vivo and in vitro, MMP-2, MMP-1, and/or MMP-9 have been found to be upregulated in angiogenesis [39 – 43]. However, we did not detect any of these MMPs in MMP-19-expressing synovial capillaries. This suggests a special regulation and function of MMP-19. In vitro studies confirm the upregulation of MMP-19 synthesis upon stimulation by growth factors or mitogens in endothelial cells and smooth muscle cells. Whereas macrovascular cells do not or do only transiently produce MMP-19, microvascular cells express mRNA and protein abundantly. The potentially destructive capability of matrix metalloproteinases demands a strong and delicate regulation. Besides the regulation of transcription as described above, regulation of enzymatic activity is achieved by TIMPs, of which four different molecular species have been identified [1, 2, 4, 44, 45]. TIMP-1 is coexpressed with MMP-19 in the smooth muscle cells of the tunica media of larger blood vessels [10], whereas TIMP-2 is not correlated with MMP-19 expression at all. Interestingly, TIMP-1 expression is seen also in the MMP-19-negative endothelial cell layer of many blood vessels and capillaries of the synovium of the RA patient. By contrast, TIMP-1 could not be detected in the small capillaries of the patient with early arthritis. In fact, the intensity of TIMP-1 staining correlates with the size of the vessels (Fig. 2D). The upregulation of MMP-19 in acutely inflamed

MMP-19 IN CAPILLARY ENDOTHELIUM

endothelium suggests an as yet unknown functional role in angiogenesis. The smallest capillaries express MMP-19 without TIMP-1, possibly indicating the enzymatic activity of matrix degradation. Collagen type IV is the basal lamina specific component, and it is clearly coexpressed with MMP-19 in these capillaries, a possible hint of the natural substrate for this MMP. Somewhat larger capillaries stain positive for smoothmuscle-cell-specific myosin, indicating the need for cellular motility in angiogenic vessels. Whether this is produced by EC themselves or by pericytes could not be decided by the means of our study. After these first events of angiogenesis, the enzymatic activity appears to be held in check by the coexpression of TIMP-1. Resting endothelium does not produce MMP-19 any more. Possibly, pericytes do so at first, smooth muscle cells then commence its production, with the concomitant regulatory expression of TIMP-1.

9.

10.

11.

12.

13. This work was supported by the Deutsche Forschungsgemeinschaft through grant St 112/17-1 to U.K., by the “Friedrich-BauerStiftung” through a grant to U.K. and R.S., and through a fellowship of the Graduiertenfo¨rderungskolleg “Biochemical Pharmacology” to S.M. We thank Petra Reusch, Tumor Biology Center in Freiburg, for kindly providing the KDR-specific antibody, Eberhardt Weiler for critical reading of the manuscript, and Marcel Leist and Martin Bastmeyer for help with the confocal microscope. Hans-Hartmut Peter (University of Freiburg), Werner Mang (Lindau), Gu¨nther Stubenrauch (Hospital of Konstanz, Germany), and Christian Herzog (St.Gallen, Switzerland) are gratefully acknowledged for the kind donation of tissue specimens.

14. 15. 16.

17.

REFERENCES 1.

2.

3.

4.

5.

6. 7.

8.

Murphy, G., and Docherty, A. J. (1992). The matrix metalloproteinases and their inhibitors. Am. J. Respir. Cell. Mol. Biol. 7, 120 –125. Corcoran, M. L., Kleiner, D. E., Jr., and Stetler-Stevenson, W. G. (1995). Regulation of matrix metalloproteinases during extracellular matrix turnover. Adv. Exp. Med. Biol. 385, 151– 159. Hembry, R. M., Bagga, M. R., Reynolds, J. J., and Hamblen, D. L. (1995). Immunolocalisation studies on six matrix metalloproteinases and their inhibitors, TIMP-1 and TIMP-2, in synovia from patients with osteo- and rheumatoid arthritis. Ann. Rheum. Dis. 54, 25–32. Wojtowicz-Praga, S. M., Dickson, R. B., and Hawkins, M. J. (1997). Matrix metalloproteinase inhibitors. Invest. New Drugs 15, 61–75. Moses, M. A. (1997). The regulation of neovascularization of matrix metalloproteinases and their inhibitors. Stem Cells 15, 180 –189. Edwards, D. R., and Murphy, G. (1998). Cancer: Proteases— Invasion and more. Nature 394, 527–528. [News] Sedlacek, R., Mauch, S., Kolb, B., Scha¨tzlein, C., Eibel, H., Peter, H.-H., Schmitt, J., and Krawinkel, U. (1998). Matrix metalloproteinase MMP-19 (RASI-1) is expressed on the surface of activated peripheral blood mononuclear cells and is detected as an autoantigen in rheumatoid arthritis. Immunobiology 198, 408 – 423. Pendas, A. M., Knauper, V., Puente X. S., Llano, E., Mattei, M.-G., Apte, S., Murphy, G., and Lopez-Otin, C. (1997). Identi-

18.

19.

20.

21.

22.

23.

24.

129

fication and characterization of a novel human matrix metalloproteinase with unique structural characteristics, chromosomal location, and tissue distribution. J. Biol. Chem. 272, 4281– 4286. Cossins, J., Dudgeon, T. J., Catlin, G., Gearing, A. J., and Clements, J. M. (1996). Identification of MMP-18, a putative novel human matrix metalloproteinase. Biochem. Biophys. Res. Commun. 228, 494 – 498. Kolb, C., Mauch, S., Peter, H.-H., Krawinkel, U., and Sedlacek, R. (1997). The matrix metalloproteinase RASI-1 is expressed in synovial blood vessels of a rheumatoid arthritis patient. Immunol. Lett. 57, 83– 88. Arnett, F. C., Edworthy, S. M., Bloch, D. A., McShane, D. J., Fries, J. F., Cooper, N. S., Healey, L. A., Kaplan, S. R., Liang, M. H., Luthra, H. S., et al. (1988). The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 31, 315–324. Stopeck, A. T., Vahedian, M., and Williams, S. K. (1997). Transfer and expression of the interferon gamma gene in human endothelial cells inhibits vascular smooth muscle cell growth in vitro. Cell. Transplant. 6, 1– 8. Hagemeier, H. H., Vollmer, E., Goerdt, S., Schulze-Osthoff, K., and Sorg, C. (1986). A monoclonal antibody reacting with endothelial cells of budding vessels in tumors and inflammatory tissues, and non-reactive with normal adult tissues. Int. J. Cancer 38, 481– 488. Hanahan, D. (1997). Signaling vascular morphogenesis and maintenance. Science 277, 48 –50. [Comment] Imhof, B. A., and Dunon, D. (1995). Leukocyte migration and adhesion. Adv. Immunol. 58, 345– 416. Wong, H., Anderson, W., Cheng, T., and Riabowol, K. (1994). Monitoring mRNA expression by polymerase chain reaction: The “primer-dropping” method. Anal. Biochem. 223, 251–258. Takahashi, K., Sawasaki, Y., Hata, J., Mukai, K., and Goto, T. (1990). Spontaneous transformation and immortalization of human endothelial cells. In Vitro Cell. Dev. Biol. 26, 265–274. Piechocki, M. P., Kantak, S., and Onoda, J. M. (1992). TPAinduced differentiation of rat aortic endothelial cells is substrate-specific and receptor mediated. Exs 61, 152–157. Bussolino, F., Mantovani, A., and Persico, G. (1997). Molecular mechanisms of blood vessel formation. Trends Biochem. Sci. 22, 251–256. Scatena, M., Almeida, M., Chaisson, M. L., Fausto, N., Nicosia, R. F., and Giachelli, C. M. (1998). NF-kappaB mediates alphavbeta3 integrin-induced endothelial cell survival. J. Cell. Biol. 141, 1083–1093. Varner, J. A., Brooks, P. C., and Cheresh, D. A. (1995). The integrin alpha V beta 3: Angiogenesis and apoptosis. Cell. Adhes. Commun. 3, 367–374. Suzuki, M., Naruse, K., Asano, Y., Okamoto, T., Nishikimi, N., Sakurai, T., Nimura, Y., and Sokabe, M. (1997). Up-regulation of integrin beta 3 expression by cyclic stretch in human umbilical endothelial cells. Biochem. Biophys. Res. Commun. 239, 372–376. Christofidou-Solomidou, M., Bridges, M., Murphy, G. F., Albelda, S. M., and DeLisser, H. M. (1997). Expression and function of endothelial cell alpha v integrin receptors in woundinduced human angiogenesis in human skin/SCID mice chimeras. Am. J. Pathol. 151, 975–983. Stouffer, G. A., Hu, Z., Sajid, M., Li, H., Jin, G., Nakada, M. T., Hanson, S. R., and Runge, M. S. (1998). Beta3 integrins are upregulated after vascular injury and modulate thrombospondin- and thrombin-induced proliferation of cultured smooth muscle cells. Circulation 97, 907–915.

130 25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

KOLB ET AL. Senger, D. R., Ledbetter, S. R., Claffey, K. P., PapadopoulosSergiou, A., Peruzzi, C. A., and Detmar, M. (1996). Stimulation of endothelial cell migration by vascular permeability factor/ vascular endothelial growth factor through cooperative mechanisms involving the alphavbeta3 integrin, osteopontin, and thrombin. Am. J. Pathol. 149, 293–305. Friedlander, M., Brooks, P. C., Shaffer, R. W., Kincaid, C. M., Varner, J. A., and Cheresh, D. A. (1995). Definition of two angiogenic pathways by distinct alpha v integrins. Science 270, 1500 –1502. Brooks, P. C., Stromblad, S., Sanders, L. C., von Schalscha, T. L., Aimes, R. T., Stetler-Stevenson, W. G., Quigley, J. P., and Cheresh, D. A. (1996). Localization of matrix metalloproteinase MMP-2 to the surface of invasive cells by interaction with integrin alpha v beta 3. Cell 85, 683– 693. Brooks, P. C., Silletti, S., von Schalscha, T. L., Friedlander, M., and Cheresh, D. A. (1998). Disruption of angiogenesis by PEX, a noncatalytic metalloproteinase fragment with integrin binding activity. Cell 92, 391– 400. Nguyen, M., Arkell, J., and Jackson, C. J. (1998). Active and tissue inhibitor of matrix metalloproteinase-free gelatinase B accumulates within human microvascular endothelial vesicles. J. Biol. Chem. 273, 5400 –5404. Giraudo, E., Primo, L., Audero, E., Gerber, H. P., Koolwijk, P., Soker, S., Klagsbrun, M., Ferrara, N., and Bussolino, F. (1998). Tumor necrosis factor-alpha regulates expression of vascular endothelial growth factor receptor-2 and of its co-receptor neuropilin-1 in human vascular endothelial cells. J. Biol. Chem. 273, 22128 –22135. Dvorak, H. F., Brown, L. F., Detmar, M., and Dvorak, A. M. (1995). Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am. J. Pathol. 146, 1029 –1039. Pepper, M. S., and Mandriota, S. J. (1998). Regulation of vascular endothelial growth factor receptor-2 (Flk-1) expression in vascular endothelial cells. Exp. Cell Res. 241, 414 – 425. Ristimaki, A., Narko, K., Enholm, B., Joukov, V., and Alitalo, K. (1998). Proinflammatory cytokines regulate expression of the lymphatic endothelial mitogen vascular endothelial growth factor-C. J. Biol. Chem. 273, 8413– 8418. Jonsson, Z. O., and Hubscher, U. (1997). Proliferating cell nuclear antigen: More than a clamp for DNA polymerases. Bioessays 19, 967–975. Yoshida, A., Anand-Apte, B., and Zetter, B. R. (1996). Differential endothelial migration and proliferation to basic fibroblast

Received December 2, 1998 Revised version received March 9, 1999

growth factor and vascular endothelial growth factor. Growth Factors 13, 57– 64. 36.

Verbeek, M. M., Otte-Holler, I., Wesseling, P., Ruiter, D. J., and de Waal, R. M. (1994). Induction of alpha-smooth muscle actin expression in cultured human brain pericytes by transforming growth factor-beta 1. Am. J. Pathol. 144, 372–382.

37.

Wesseling, P., Schlingemann, R. O., Rietveld, F. J., Link, M., Burger, P. C., and Ruiter, D. J. (1995). Early and extensive contribution of pericytes/vascular smooth muscle cells to microvascular proliferation in glioblastoma multiforme: An immunolight and immuno-electron microscopic study. J. Neuropathol. Exp. Neurol. 54, 304 –310.

38.

Korpelainen, E. I., and Alitalo, K. (1998). Signaling angiogenesis and lymphangiogenesis. Curr. Opin. Cell. Biol. 10, 159 – 164.

39.

Haas, T. L., Davis, S. J., and Madri, J. A. (1998). Three-dimensional type I collagen lattices induce coordinate expression of matrix metalloproteinases MT1-MMP and MMP-2 in microvascular endothelial cells. J. Biol. Chem. 273, 3604 –3610.

40.

Tyagi, S. C., Kumar, S., Cassatt, S., and Parker, J. L. (1996). Temporal expression of extracellular matrix metalloproteinases and tissue plasminogen activator in the development of collateral vessels in the canine model of coronary occlusion. Can. J. Physiol. Pharmacol. 74, 983–995.

41.

Foda, H. D., George, S., Conner, C., Drews, M., Tompkins, D. C., and Zucker, S. (1996). Activation of human umbilical vein endothelial cell progelatinase A by phorbol myristate acetate: A protein kinase C-dependent mechanism involving a membranetype matrix metalloproteinase. Lab. Invest. 74, 538 –545.

42.

Fisher, C., Gilbertson-Beadling, S., Powers, E. A., Petzold, G., Poorman, R., and Mitchell, M. A. (1994). Interstitial collagenase is required for angiogenesis in vitro. Dev. Biol. 162, 499 –510.

43.

Jackson, C. J., and Nguyen, M. (1997). Human microvascular endothelial cells differ from macrovascular endothelial cells in their expression of matrix metalloproteinases. Int. J. Biochem. Cell. Biol. 29, 1167–1177.

44.

Greene, J., Wang, M., Liu, Y. E., Raymond, L. A., Rosen, C., and Shi, Y. E. (1996). Molecular cloning and characterization of human tissue inhibitor of metalloproteinase 4. J. Biol. Chem. 271, 30375–30380.

45.

Gomez, D. E., Alonso, D. F., Yoshiji, H., and Thorgeirsson, U. P. (1997). Tissue inhibitors of metalloproteinases: Structure, regulation and biological functions. Eur. J. Cell Biol. 74, 111–122.