- Email: [email protected]
Matrix protein gene expression in intervertebral disc cells subjected to altered osmolarity
Biochemical and Biophysical Research Communications 293 (2002) 932–938 www.academicpress.com
Matrix protein gene expression in intervertebral disc cells subjected to altered osmolarity Jun Chen,a,* Anthony E. Baer,b Phil Y. Paik,a Wei Yan,a and Lori A. Settona,c a
Department of Biomedical Engineering, Duke University, Box 90281, 136 Hudson Hall, Durham, NC 27708-0281, USA b Department of Biomedical Engineering, Columbia University, USA c Department of Surgery, Division of Orthopaedic Surgery, Duke University Medical Center, USA Received 25 March 2002
Abstract Physiologic loading of the intervertebral disc may lead to changes in the osmotic pressure experienced by the resident cells. In this study, changes in gene expression levels for extracellular matrix and cytoskeletal proteins were quantified in disc cells subjected to hypo-osmotic (255 mOsm) or hyper-osmotic conditions (450 mOsm), relative to iso-osmotic conditions (293 mOsm). Important differences were observed in osmolarity and between cells of different regions, corresponding to the transition zone and nucleus pulposus. Under hypo-osmotic conditions, gene expressions for aggrecan and type II collagen were up-regulated in the transition zone, but not in the nucleus pulposus cells. Genes for the small proteoglycans, biglycan, and decorin, but not lumican, were upregulated in transition zone cells following incubation in either hypo- or hyper-osmotic media. The same genes were down-regulated in nucleus pulposus cells under either hypo- or hyper-osmotic conditions. Differences in the response to altered osmolarity between cells of the intervertebral disc may relate to their different cytoskeletal structures or embryological origins. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: Intervertebral disc; Fibrochondrocyte; Nucleus pulposus; Osmolarity; Small proteoglycan; Gene expression; Real-time RT-PCR
The intervertebral disc (IVD) is a heterogeneous structure that contributes to load support and flexibility in the spine. The extracellular matrix of the intervertebral disc is comprised largely of water (60–99% by weight) and negatively charged proteoglycans that confer a net negative charge on the tissue. Under physiologic conditions, the intervertebral disc is subjected to static and dynamic compressive loads that give rise to interstitial hydrostatic pressures, stresses, and strains, as well as changes in tissue hydration that may modify extracellular cation concentrations, pH, and intracellular and extracellular osmolarities [1]. Biosynthesis in the intervertebral disc has been shown to change in response to these differing biophysical stimuli, both in vivo and in vitro. Compressive loads applied to the motion segment in vivo have been shown to produce changes in proteoglycan and collagen gene
*
Corresponding author. Fax: +1-919-660-5362. E-mail address: [email protected] (J. Chen).
expressions or biochemical contents in several animal models [2–4]. Static compressive loads applied to motion segments in vitro have generally inhibited posttranscriptional measures of proteoglycan and collagen syntheses [5,6]. Secondary to mechanical loading will be changes in extracellular hydration, ion concentrations, pH, and osmolarity. Cells of the intervertebral disc have exhibited a responsiveness to changes in osmotic pressure in both explant culture and as isolated cells, with changes in the post-transcriptional biosynthesis of proteoglycan [5,7]. Importantly, these studies have shown that maximal proteoglycan biosynthesis is achieved at osmolarities believed to represent in situ values (430 mOsm), i.e., at osmolarities above or below these values, proteoglycan biosynthesis is shown to decrease. Furthermore, the biological response does not appear to be mediated by ionic concentration changes, but rather depends directly on osmotic pressure [7]. The biological and biophysical mechanisms regulating this demonstrated sensitivity of disc biosynthesis to osmotic environment are not well understood.
0006-291X/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 0 0 0 6 - 2 9 1 X ( 0 2 ) 0 0 3 1 4 - 5
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
Significant zonal variations exist in the phenotypic expression and biosynthetic activity of the disc that partly reflect the activities of a heterogeneous cell population. The anulus fibrosus (AF) is a fibrocartilaginous tissue on the periphery of the disc and is populated by fibrochondrocyte-like cells of mesenchymal origin [8,9]. The centralmost nucleus pulposus (NP) is populated by both chondrocyte-like cells of mesenchymal origin and larger, highly vacuolated cells derived from the notochord that are present only in the immature tissue [9,10]. With increasing age, the notochordal cells disappear with consequent, but poorly understood changes in the biosynthesis of NP [11]. Bridging these regions is the transition zone (TZ) or inner anulus fibrosus, which contains cells that may be chondrocyte-like or fibrochondrocyte-like in nature [9]. Zonal differences have been observed in the biosynthesis of the intervertebral disc in vivo, in explant cultures, and in isolated cells, with results that generally identify TZ as the zone of greatest proteoglycan and protein biosynthesis [12–14]. Biological responses to physical stimuli further vary amongst zones, due to intrinsic differences in cell phenotype, local extracellular matrix composition, and structure, and/or local micro-mechanical stimuli. All cells of the disc have been shown to display a bimodal response to altered osmolarity in vitro, with maximal proteoglycan biosynthesis observed at hydrations believed to correspond to in situ values [5,7,13]. In articular chondrocytes, at least part of the observed changes in proteoglycan biosynthesis with altered osmolarity has been shown to be regulated at the transcriptional level [15–17]. Importantly, aggrecan gene expression changes appear to differ in chondrocytes in response to hypoosmotic and hyper-osmotic stimuli and thus may be regulated through different signalling pathways [15,16]. Studies have also shown that the kinetics and mechanisms for generating intracellular Ca2þ transients in chondrocytes differ in hypo- and hyper-osmotic media, likely due to differences in cell volume changes and regulatory mechanisms induced by these different stimuli [18,19]. Very limited information is available on isolated disc cell response to altered osmolarity, although there exists some evidence that disc cells undergo cell volume changes in response to altered osmolarity [7,32]. In addition, a recent study has shown that the organization of the actin cytoskeleton affected intracellular Ca2þ signalling in intervertebral disc cells subjected to hyper-osmotic loading [20], suggesting a role for the cytoskeleton in the biosynthetic response to altered osmolarity. In this study, we propose that disc cells respond to altered osmolarity with zonal-dependent changes in gene expression for abundant extracellular matrix proteins (aggrecan, type I, and II collagens), small leucinerich repeat proteoglycans (decorin, biglycan, and lumican), and cytoskeletal proteins (b-actin, vimentin,
933
and tubulin a1 ). Studies were performed using cells from an immature porcine disc source, with a nucleus pulposus that was previously shown to contain a high proportion of notochordal cells based on size and histological appearance [21]. In order to eliminate contributions from variations in extracellular matrix composition as well as micro-mechanical environment, cells were isolated from disc tissues and studied in an alginate bead culture system [22–24]. Cell–gel beads were cultured in media supplemented with sucrose or distilled water to modify osmolarity and mRNA levels for relevant genes were quantified using real-time quantitative RT-PCR. Materials and methods Cell isolation and culture. Lumbar spines were obtained from 4–5 month-old pigs within 24–48 h of sacrifice and storage at 4 °C (Nahunta Pork Center, Pikesville, NC). Spines were dissected to remove the surrounding soft tissue and to expose the intervertebral discs. Tissue from regions corresponding to the transition zone (TZ) and nucleus pulposus (NP) of the discs were used to isolate cells with a sequential pronase– collagenase digestion, as described previously [24]. Our previous study demonstrated that two subcultures did not significantly affect the pattern of gene expression for type I and II collagens and aggrecan in this cell population [12]. Therefore both NP and TZ cells were expanded in monolayer for two subcultures and then the cells were suspended at a density of 1 106 cells/ml in 1.2% alginate (low viscosity, Sigma Chemical, St Louis, MO) dissolved in 150 mM NaCl. Alginate beads were formed by a dropwise addition of the alginate from a 22 gauge needle into 102 mM CaCl2 , followed by 10 min of curing, as described previously [23,24]. Cell–gel beads were incubated in cell culture media consisting of Ham’s F-12 medium, supplemented with 10% FBS, 25 lg=ml ascorbic acid, 100 U/ml penicillin, 100 lg=ml streptomycin, and 1 lg=ml Fungizone at 5% CO2 in 37 °C. Osmotic loading of cells. After 24 h, the cell culture media were removed and the cell–gel beads were incubated for 4 h in one of the three osmotically active solutions. The iso-osmotic solution consisted of a cell culture medium (Ham’s F-12 media with the same supplements, as described above). Osmolarity of the iso-osmotic solution was 293 mOsm/ kg H2 O as measured with a freezing-point osmometer (Advanced Laboratory Wild Range 3W2, Advanced Instrument, Needham Heights, MA). The hypo-osmotic solution consisted of the same cell culture media diluted with de-ionized water to a final osmolarity of 250 mOsm/kg H2 O and the hyper-osmotic solution was created by the same cell culture media supplemented with sucrose to a final osmolarity of 450 mOsm/kg H2 O. Alginate solutions contain a net negative charge so that the osmotic environment of the cells in an alginate gel may not be expected to correspond to that of the measured incubation solutions. To test for a potential effect of alginate on the osmotic environment of the cells, an uncrosslinked solution of 2% alginate was serially diluted with F-12 medium and the osmolarity was measured. Results showed that the uncrosslinked alginate did not significantly modify the osmotic pressure from that of medium alone (Fig. 1). This finding suggests that the crosslinked alginate gel likely has a negligible effect on the osmotic environment of the cells in the cell–gel beads. RNA isolation and real-time quantitative RT-PCR. At the end of culture in the iso-, hypo-, or hyper-osmotic media, cells were released from alginate in a dissolving buffer (55 mM Na-citrate and 150 mM NaCl) with gentle agitation, as described previously [24]. Cells were pelleted by centrifugation and pooled from three samples equilibrated under each osmotic condition for studies on gene expression. Total RNA was extracted from the cells with RNeasy mini kit plus DNase I digestion
92 b
The underlined bases in the sequence indicate the position of an intron in the corresponding genomic sequence. The intron-spanning sequence of a lumican forward primer is based on the human sequence (HSU18728). c The sequence of aggrecan shown here was obtained by re-sequencing the porcine aggrecan cDNA clone.
CACAGTCATTGATGAAGTTCGCACTGGC AAGCATGTTCCCAGGGCAG
TCAGGGTGGAAGAGCTGGC F14514 Tubulin (a1)
a
144 CCATCTCTGGTCTCAACCGTCT AU058707 GGAAGGAGAAGAGAGCAGGATTTC Vimentin
CTTCCCTGAACCTGAGGGAAACCAATCTG
97 CCTCCTTTCCTGGGCATGGAGTCCTG TCCACGTCGCACTTCATGAT SSU07786 b-Actin
GGTGTCCAGAGGCGCTCTT
TCATACATGTCAGGTGGTAGACTAGTT TGATGCGATTGCCATCCAAACGC HSU18728 CAACTTGAGAAGTTTGACATAAAGAGCT AU059264 Lumican
AGTGCGAAAGGCTGTGTTCA
GCGATGCGGATGTAGGAGAG AF125537 Decorin
128
AGATGATCGTCGTAGAACTTGGCACCAACC 132
119 CAAGCTCCTCCAGGTGGTCTACCTGCA GAGCCGCACTTGGACAACA
AAGTCATTGACGCCCACCTT AF054419 Biglycan
79 TGCAGGTGACCATGGCC
CGGTAATGGAACACAACCCCT
CCCTGGGCAGCCACGACTTCC AF201722 Aggrecan
106 ACCAGGAACGCCCTGATCACCTGG CCACGAGCCAGGAGCT CCATCTGGCTTCCAGGGAC Collagen II (a1) AF201724
c
CCAAGAAGAAGACATCCCACCAGTCACCT CATGGTACCTGAGGCCGTTC
Reverse primer (50 ! 30 ) Forward primerb (50 ! 30 ) Accession number
GGCTCCTGCTCCTCTTAGCG
Sequences for the designed primers and probes, the size of the amplicons, and the position of the exon–exon
Collagen I (a1) AF201723
Efficiency of real-time quantitative RT-PCR
Target gene
Results
Table 1 Sequences of porcine probes and primers for real-time quantitative RT-PCR
(Qiagen, Valencia, CA) according to manufacturer’s instruction. Quantification of mRNAs was performed by real-time quantitative reverse transcriptase (RT)-PCR with a Smart Cycler System (Cepheid, Sunnyvale, CA). Quantification of mRNA was focused on genes for collagens and proteoglycans of extracellular matrix and cytoskeleton proteins (Table 1). For most genes of interest, porcine-specific PCR primers plus one fluorescently labelled intron-spanning probe were designed according to the sequences available in GenBank using Primer Express software (Applied Biosystems, Foster City, CA). For the lumican gene, the forward primer was designed from the human sequence because only limited information was available for the porcine lumican sequence. For each reaction, 20 ng total RNA was used in a one-step RTPCR with both Multiscribe reverse transcriptase and Amplitaq Gold polymerase. The final concentration of reagents in each PCR (25 ll total volume) was 1 Taqman buffer gold, 300 nM each of the forward and reverse primers, 200 nM probe, 300 nM each dNTP, 5.5 mM MgCl2 , 0.025 U/ll AmpliTaq gold, 0.25 U/ll Mutiscribe reverse transcriptase, and 0.4 U/ll RNase inhibitor (Applied Biosystems, Foster City, CA). The cycle parameters were 48 °C for 30 min to reverse transcribe RNA, 95 °C for 10 min to activate the Taq DNA polymerase, then 40 cycles of 95 °C for 15 s denaturation, followed by 60 °C for 45 s annealing and extension. 18S rRNA was amplified as an internal control (Taqman Ribosomal RNA Control Reagents kit-VIC Probe, Applied Biosystems, Foster City, CA) and 100 nM of probe and primers were used in each reaction. For mRNA quantification, the relative amounts of target genes were calculated by the comparative Ct method, where Ct denotes the cycle number for fluorescence detection above a threshold level (User Bulletin #2, Applied Biosystems, Foster City, CA). In this method, relative mRNA levels under hypo- or hyperosmotic conditions were normalized to that of the iso-osmotic condition. Duplicate PCRs were performed for pooled specimens under each osmotic condition. The efficiency of real-time quantitative RT-PCR for all targets including 18S rRNA was evaluated according to a protocol presented by Martin et al. [25]. Serial diluted total RNAs (100, 50, 25, 12.5 ng per reaction) from TZ cells were used for these evaluations.
Probea (50 ! 30 )
Fig. 1. The effect of uncrosslinked alginate on the experimentally measured osmolarity of cell culture medium.
132
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938 Amplicon size (bp)
934
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
junctions within the probe are shown in Table 1. The specificity and efficiency of the amplification for those probe and primer sets were tested using the serial diluted total RNA from TZ cells. For each target gene, the Ct value was found to correlate strongly with the initial amount of total RNA in the range of 12.5–100 ng (see Fig. 2A for a representative plot of data for collagen I ða1 Þ). The amplification efficiency of each target (Et ) was close to 1 (Et P 0:93, Fig. 2B). For the 18S rRNA internal control, the amplification efficiency was also close to 1 (Et ¼ 0:94). Using average error quantified from the linear correlation analyses, a onecycle increment of Ct permits detection of a 2-fold change in the total RNA within a 95% confidence limit (Fig. 2A). Therefore we used the comparative Ct method (User Bulletin #2, Applied Biosystems, Foster City, CA) to calculate the relative expression of each gene normalized to 18S rRNA and note significant
935
differences in relative gene expression levels if they fall out of this detection limit. Osmotic loading effects on gene expression of extracellular matrix Differences were observed between TZ and NP cells in response to altered osmolarity for all genes studied here (Table 2). Under hypo-osmotic conditions, gene expressions for aggrecan and type II collagen were upregulated in TZ, but not in NP cells. Both aggrecan and type II collagen are considered important markers of a chondrocytic phenotype, suggesting that a hypo-osmotic environment induced a unique phenotypic response in the TZ cells. In contrast, no changes in the TZ cell gene expression were observed following equilibration in hyper-osmotic media. Cells of the NP exhibited no changes in the gene expression for aggrecan and type I and II collagens in hypo- or hyper-osmotic media (Table 2). Osmotic loading effects on gene expression of small proteoglycans Gene expressions for the small proteoglycans, biglycan, and decorin, were up-regulated in TZ cells following incubation in either hypo- or hyper-osmotic media (Table 2). In particular, 5-fold increases in the levels of mRNA for biglycan were observed in the TZ cells following 4 h of incubation in either condition. In contrast, cells of the NP significantly down-regulated gene expressions for both small proteoglycans following incubation in hyper-osmotic media. There was no change in the gene expression for either biglycan or decorin in NP cells from the hypo-osmotic condition (Table 2). Gene expression for lumican was significantly down-regulated
Table 2 Fold differences in the relative mRNA levels in IVD cells subjected to an altered osmolarity Target gene
Fig. 2. (A) Standard curve for collagen type I (a1). The logarithm of total starting RNA was plotted against the cycle number (Ct) obtained with one-step real-time quantitative RT-PCR (1:2 fold serially diluted total RNA from 12.5 to 100 ng). (B) Efficiency curve for collagen type I (a1). For each dilution of total RNA, the expected DCt calculated as the logarithm in base 2 of the dilution factor was plotted against the measured change in Ct (DCt).The amplification efficiency for each target (Et ) was calculated as the slope of the best linear fit of the corresponding efficiency curve (e.g., Et ¼ 0:93 in this case).
Collagen I (a1) Collagen II (a1) Aggrecan Biglycan Decorin Lumican b-Actin Vimentin Tubulin (a1)
TZ cellsa
NP cellsa
Hypo
Hyper
Hypo
Hyper
NC 4.7 " 2.2 " 5.2 " 2.0 " NC NC NC NC
NC NC NC 5.1 " 2.1 " NC NC NC NC
NC NC NC NC NC 2.4 # NC NC 2.0 #
NC NC NC 2.5 # 2.3 # 2.0 # NC NC NC
NC ¼ no detectable change or fold difference <2:0; " ¼ increase; # ¼ decrease. a Values were normalized to mRNA levels at iso-osmotic loading condition (n ¼ 2).
936
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
in NP, but not in TZ cells under both hypo- or hyperosmotic conditions (Table 2). Osmotic loading effects on gene expression of cytoskeletal proteins Overall, both TZ and NP cells responded to either hypo- or hyper-osmotic conditions with almost no changes in the gene expression of cytoskeletal proteins: b-actin, vimentin, and tubulin a1 (Table 2). One exception was the finding of a 2-fold down-regulation of tubulin a1 mRNA in NP cells when equilibrated under hypo-osmotic conditions.
Discussion The results of this study suggest that osmotic pressure regulates the intervertebral disc cell synthesis of matrix molecules, including proteoglycans and collagen, at the transcriptional level. Important differences were observed in the response of all cells to hypo- and hyperosmotic conditions, as well as differences between TZ and NP cell types. In response to hypo-osmotic shock, many cells are known to experience an increase in the cell volume with initiation of active volume regulatory processes and associated intracellular signalling cascades in an effort to restore the cell volume [26,27]. These cascades may be involved not only in the volume regulation process, but may also influence other cellular responses such as gene expression, cellular metabolism, and apoptosis [26,28]. In many cell types including articular chondrocytes, cell volume changes are associated with the generation of Ca2þ transients and regulated by the breakdown and reorganization of the actin cytoskeleton [19,29–31]. In the present study, the TZ cells were more responsive to hypo-osmotic conditions with increases in gene expressions for small proteoglycans, aggrecan, and type II collagen. In contrast, the NP cells responded only with decreases in gene expression for lumican and tubulin. These differences in the biological response of TZ and NP cells to hypo-osmotic conditions may relate to differences in cytoskeletal organization between the fibro-chondrocytic TZ cells and the NP cells of notochordal origin. Cells of the TZ are similar in size and actin staining to the chondrocytes of articular cartilage, whereas cells of the NP that contain a high proportion of notochordal cells are larger, stiffer, and stain more intensely and diffusely for actin [21]. These important differences suggest that NP cells may not respond to hypo-osmotic conditions with the same pattern of volumetric changes as TZ cells, with their many similarities to articular chondrocytes. No information is available, however, on volume changes and active or passive regulatory processes in these two cell types under hypo-osmotic conditions. Thus, additional
studies are required to investigate the contribution of cytoskeletal differences to the observed differences in gene expression between these two cell types. Under hyper-osmotic conditions, NP and TZ cells exhibited respective decreases and increases in gene expression for the small proteoglycans, biglycan, and decorin. Again, this indicates that NP and TZ cells are perceiving and responding to the hyper-osmotic condition through dramatically different mechanisms. In contrast to hypo-osmotic conditions, cells subjected to hyper-osmotic shock may experience a transient decrease in cell volume, a process that has been shown to be partly regulated by actin breakdown in articular chondrocytes [18]. Ishihara et al. [7] showed that cells derived from the bovine NP are of smaller volume at 430 mOsm as compared to 280 mOsm and that this difference is sustained and not substantially regulated through active processes. Thus, it appears that cell volume changes may occur in this cell population under the hyper-osmotic conditions studied here. It should be noted that the NP cells in that study are not the same as those studied here; however, as NP cells derived from a bovine source do not retain any cells of notochordal origins. In another study, Pritchard et al. [32] showed that porcine NP cells of notochordal origin experience few changes in cell volume in response to hyper-osmotic conditions. Importantly, these NP cells, when treated with cytochalasin D to break down the actin cytoskeleton, experienced significant decreases in cell volume and increases in the kinetics of both Ca2þ transients and volume changes [20,32]. Thus, the more substantially developed actin cytoskeleton in the NP cells, as compared to TZ cells, may serve to stabilize the cell from changes in volume and related signalling responses. It should be noted that all cytoskeletal genes studied here did not significantly respond to osmotic change at the transcriptional level, suggesting that other post-transcriptional or translational regulations may be involved in these responses. Activity of an aggrecan promoter, as well as aggrecan mRNA levels, has been shown to be markedly different in articular chondrocytes cultured under hypo- and hyperosmotic conditions [15,16]. This response was shown for cells both in monolayer and in a three-dimensional culture system, such as those used here [33]. Thus, transcription of aggrecan in chondrocytes may be regulated through different mechanisms under hypo- and hyperosmotic conditions. The results of the current study provide additional support for this concept in two different cell populations, the fibrochondrocyte-like cells of TZ and the predominantly notochordal cells of NP. The finding of elevated aggrecan mRNA in TZ cells cultured under hypo-osmotic conditions is consistent with data reported previously for articular chondrocytes [16]. In contrast, the findings of no changes in aggrecan mRNA in TZ cells cultured under hyper-osmotic
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
conditions are not consistent with previous reports that hyper-osmotic conditions may up-regulate [17] or downregulate aggrecan gene expression in chondrocytes [15]. Furthermore, a previous study of bovine chondrocytes reported that gene expressions for type II collagen and biglycan were up-regulated by 2 h of hyper-osmotic treatment, while those of type I collagen and decorin were unchanged under the same conditions [17]. TZ cells in the current study responded to hyper-osmotic conditions with increases in gene expression for biglycan and decorin only, with no changes in type I or II collagen gene expression. Thus, cells of TZ appear to share some characteristics with chondrocytes. Notably, the sensitivity of the aggrecan gene to hypo-osmotic media and that of the biglycan gene to hyper-osmotic media were the most consistent findings between these two cell types. A major difference in the response to altered osmolarity between cells of the intervertebral disc was found in the genes for small proteoglycans. In general, TZ and NP cells responded to altered osmolarity with respective increases and decreases in genes for biglycan, decorin, and lumican. These small proteoglycans all contain a core protein composed of leucine-rich repeat structures and have been found to distribute differently in the zones of human and ovine intervertebral discs [34–37]. Small leucine-rich proteoglycans (SLRP) are believed to play important roles in the regulation of extracellular matrix assembly and cell–matrix interactions and in modifying matrix interactions with various glycoproteins, retinoic acid, cytokines, and growth factors [38–42]. Decorin and biglycan both carry one or two chondroitin/dermatan sulphate chains, with core proteins sharing 55% of their amino acid identity. These two SLRPs have distinctly different patterns of temporal and spatial expressions; however, suggesting different functions for these proteoglycans [43]. In the degenerating disc and in osteoarthritic cartilage, both decorin and biglycan have been found to increase at the mRNA and protein levels [44–48]. In addition, it has been shown that the biosynthesis of biglycan, not decorin, was stimulated in response to compressive loading at both mRNA and protein levels in tendon fibrocartilage [49]. Results of the present study suggest that biglycan, in particular, is strongly modified in response to hypo- or hyper-osmotic stress at the transcriptional level, as demonstrated by a 5-fold increase in the gene expression in TZ cells. Cartilage changes associated with osteoarthritis or induced degeneration commonly include elevated swelling, which may be partly consistent with the hypo-osmotic conditions and hence stimulatory mechanisms recreated here. Similarities in the stimulatory response of the genes for biglycan in TZ cells with those of articular chondrocytes reinforce the similarities in their mesenchymal origins and phenotypic characteristics.
937
Lumican carries three or four keratan sulphate chains and belongs to another sub-family of SLRP including fibromodulin [41]. Lumican may be important for the formation and maintenance of the extracellular matrix because lumican, like decorin, interacts with collagen and may inhibit fibrillogenesis [43]. Expression of lumican in articular cartilage appears to be up-regulated in adult tissue compared to juvenile tissue [50]. In the present study, lumican was down-regulated in NP but not in TZ cells, in response to the changes of osmolarity. The mechanisms for gene regulation of small proteoglycans in response to osmotic changes remain unclear; however, the different responses between TZ and NP cells suggest the existence of different signalling pathways downstream of osmotic stress and cell volume change. Further study of the unique differences between these cell types in volume regulation, Ca2þ responses, and other signalling pathways will help to elucidate the mechanisms for regulation of these small proteoglycans, as well as the other matrix proteins studied here.
Acknowledgments We wish to acknowledge Dr. Farshid Guilak, Mr. Scott Pritchard, and Mr. Larry M. Boyd for the many helpful discussions. This study was supported with funds from the NIH (AR47442) and a graduate research fellowship from The Whitaker Foundation.
References [1] J.P.G. Urban, in: J.A. Buckwalter, V.M. Goldberg, S.L.-Y. Woo (Eds.), Musculoskeletal Soft-tissue Aging: Impact on Mobility, American Academy of Orthopaedic Surgeons, Rosemont, IL, 1993, pp. 391–412. [2] J.C. Lotz, O.K. Colliou, J.R. Chin, N.A. Duncan, E. Liebenberg, Spine 23 (1998) 2493–2506. [3] W.C. Hutton, Y. Toribatake, W.A. Elmer, T.M. Ganey, K. Tomita, T.E. Whitesides, Spine 23 (1998) 2524–2537. [4] J.C. Iatridis, P.L. Mente, I.A.F. Stokes, D.D. Aronsson, M. Alini, Spine 24 (1999) 996–1002. [5] M.T. Bayliss, J.P. Urban, B. Johnstone, S. Holm, J. Orthop. Res. 4 (1986) 10–17. [6] H. Ohshima, J.P. Urban, D.H. Bergel, J. Orthop. Res. 13 (1995) 22–29. [7] H. Ishihara, K. Warensjo, S. Roberts, J.P. Urban, Am. J. Physiol. 272 (1997) C1499–C1506. [8] J.A. Buckwalter, Spine 20 (1995) 1307–1314. [9] T.R.J. Oegema, Clin. Sports Med. 12 (1993) 419–439. [10] J.J. Trout, J.A. Buckwalter, K.C. Moore, Anat. Rec. 204 (1982) 307–314. [11] J.J. Trout, J.A. Buckwalter, K.C. Moore, S.K. Landas, Tissue & Cell 14 (1982) 359–369. [12] J.Y. Wang, A.E. Baer, V.B. Kraus, L.A. Setton, Spine 26 (2001) 1747–1751. [13] H. Horner, S. Roberts, H. Evans, J. Menage, J. Urban, Trans. Orthop. Res. Soc. 25 (2000) 345. [14] M.T. Bayliss, B. Johnstone, J.P. O’Brien, Spine 13 (1988) 972–981.
938
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
[15] G.D. Palmer, P.H. Chao Ph, F. Raia, R.L. Mauck, W.B. Valhmu, C.T. Hung, Osteoarthritis Cartilage 9 (2001) 761–770. [16] C. Hung, G. Palmer, M. LeRoux, P. Chao, W.B. Valhmu, Trans. Orthop. Res. Soc. 27 (2002) 137. [17] A. Parker, J. Boutell, D. Beer, S. Powell, R. Maciewicz, Trans. Orthop. Res. Soc. 26 (2001) 31. [18] G.R. Erickson, L.G. Alexopoulos, F. Guilak, J. Biomech. 34 (2001) 1527–1535. [19] G.R. Erickson, R. Minkhorst, F. Guilak, Trans. Orthop. Res. Soc. 26 (2001) 555. [20] S. Pritchard, G.R. Erickson, F. Guilak, Trans. Orthop. Res. Soc. 26 (2001) 32. [21] F. Guilak, H.P. Ting-Beall, A.E. Baer, W.R. Trickey, G.R. Erickson, L.A. Setton, Spine 24 (1999) 2475–2483. [22] K. Chiba, G.B. Andersson, K. Masuda, S. Momohara, J.M. Williams, E.J. Thonar, Spine 23 (1998) 1821–1827, discussion 1828. [23] B.A. Maldonado, T.R. Oegema Jr., J. Orthop. Res. 10 (1992) 677– 690. [24] A.E. Baer, J.Y. Wang, V.B. Kraus, L.A. Setton, J. Orthop. Res. 19 (2001) 2–10. [25] I. Martin, M. Jakob, D. Schafer, W. Dick, G. Spagnoli, M. Heberer, Osteoarthritis Cartilage 9 (2001) 112–118. [26] F. Lang, G.L. Busch, H. Volkl, Cell. Physiol. Biochem. 8 (1998) 1–45. [27] P.G. Bush, A.C. Hall, J. Orthop. Res. 19 (2001) 768–778. [28] S. Waldegger, F. Lang, J. Membr. Biol. 162 (1998) 95–100. [29] N.A. McCarty, R.G. O’Neil, Physiol. Rev. 72 (1992) 1037–1061. [30] J.A. Rosado, S.O. Sage, J. Physiol. 526 Pt 2 (2000) 221–229. [31] J. Moran, M. Sabanero, I. Meza, H. Pasantes-Morales, Am. J. Physiol. 271 (1996) C1901–C1907. [32] S. Pritchard, F. Guilak, Ann. Biomed. Eng. 29 Suppl. 1 (2001) 3.3.4.
[33] M.A. LeRoux, T.N. Kelly, G.D. Palmer, S.L. Seyhan, C.T. Hung, Trans. Orthop. Res. Soc. 27 (2002) 384. [34] W. Gotz, S. Barnert, R. Bertagnoli, N. Miosge, H. Kresse, R. Herken, Cell Tissue Res. 289 (1997) 185–190. [35] R. Sztrolovics, M. Alini, J.S. Mort, P.J. Roughley, Spine 24 (1999) 1765–1771. [36] J. Melrose, S. Smith, P. Ghosh, J. Anat. 197 (2000) 189–198. [37] J. Melrose, P. Ghosh, T.K. Taylor, J. Anat. 198 (2001) 3–15. [38] H. Kresse, H. Hausser, E. Schonherr, Experientia 49 (1993) 403– 416. [39] H. Kresse, H. Hausser, E. Schonherr, K. Bittner, Eur. J. Clin. Chem. Clin. Biochem. 32 (1994) 259–264. [40] H. Kresse, E. Schonherr, J. Cell. Physiol. 189 (2001) 266–274. [41] R.V. Iozzo, Annu. Rev. Biochem. 67 (1998) 609–652. [42] R.V. Iozzo, J. Biol. Chem. 274 (1999) 18843–18846. [43] A.M. Hocking, T. Shinomura, D.J. McQuillan, Matrix Biol. 17 (1998) 1–19. [44] R.I. Inkinen, M.J. Lammi, S. Lehmonen, K. Puustjarvi, E. Kaapa, M.I. Tammi, J. Rheumatol. 25 (1998) 506–514. [45] J. Melrose, P. Ghosh, T.K. Taylor, B. Vernon-Roberts, J. Latham, R. Moore, Eur. Spine J. 6 (1997) 376–384. [46] C.B. Little, P. Ghosh, C.R. Bellenger, J. Orthop. Res. 14 (1996) 433–444. [47] G. Cs-Szabo, L.I. Melching, P.J. Roughley, T.T. Glant, Arthritis Rheum. 40 (1997) 1037–1045. [48] H.C. Bock, P. Michaeli, C. Bode, W. Schultz, H. Kresse, R. Herken, N. Miosge, Osteoarthritis Cartilage 9 (2001) 654–663. [49] J.R. Robbins, S.P. Evanko, K.G. Vogel, Arch. Biochem. Biophys. 342 (1997) 203–211. [50] L.I. Melching, G. Cs-Szabo, P.J. Roughley, Matrix Biol. 16 (1997) 1–11.
Matrix protein gene expression in intervertebral disc cells subjected to altered osmolarity Jun Chen,a,* Anthony E. Baer,b Phil Y. Paik,a Wei Yan,a and Lori A. Settona,c a
Department of Biomedical Engineering, Duke University, Box 90281, 136 Hudson Hall, Durham, NC 27708-0281, USA b Department of Biomedical Engineering, Columbia University, USA c Department of Surgery, Division of Orthopaedic Surgery, Duke University Medical Center, USA Received 25 March 2002
Abstract Physiologic loading of the intervertebral disc may lead to changes in the osmotic pressure experienced by the resident cells. In this study, changes in gene expression levels for extracellular matrix and cytoskeletal proteins were quantified in disc cells subjected to hypo-osmotic (255 mOsm) or hyper-osmotic conditions (450 mOsm), relative to iso-osmotic conditions (293 mOsm). Important differences were observed in osmolarity and between cells of different regions, corresponding to the transition zone and nucleus pulposus. Under hypo-osmotic conditions, gene expressions for aggrecan and type II collagen were up-regulated in the transition zone, but not in the nucleus pulposus cells. Genes for the small proteoglycans, biglycan, and decorin, but not lumican, were upregulated in transition zone cells following incubation in either hypo- or hyper-osmotic media. The same genes were down-regulated in nucleus pulposus cells under either hypo- or hyper-osmotic conditions. Differences in the response to altered osmolarity between cells of the intervertebral disc may relate to their different cytoskeletal structures or embryological origins. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: Intervertebral disc; Fibrochondrocyte; Nucleus pulposus; Osmolarity; Small proteoglycan; Gene expression; Real-time RT-PCR
The intervertebral disc (IVD) is a heterogeneous structure that contributes to load support and flexibility in the spine. The extracellular matrix of the intervertebral disc is comprised largely of water (60–99% by weight) and negatively charged proteoglycans that confer a net negative charge on the tissue. Under physiologic conditions, the intervertebral disc is subjected to static and dynamic compressive loads that give rise to interstitial hydrostatic pressures, stresses, and strains, as well as changes in tissue hydration that may modify extracellular cation concentrations, pH, and intracellular and extracellular osmolarities [1]. Biosynthesis in the intervertebral disc has been shown to change in response to these differing biophysical stimuli, both in vivo and in vitro. Compressive loads applied to the motion segment in vivo have been shown to produce changes in proteoglycan and collagen gene
*
Corresponding author. Fax: +1-919-660-5362. E-mail address: [email protected] (J. Chen).
expressions or biochemical contents in several animal models [2–4]. Static compressive loads applied to motion segments in vitro have generally inhibited posttranscriptional measures of proteoglycan and collagen syntheses [5,6]. Secondary to mechanical loading will be changes in extracellular hydration, ion concentrations, pH, and osmolarity. Cells of the intervertebral disc have exhibited a responsiveness to changes in osmotic pressure in both explant culture and as isolated cells, with changes in the post-transcriptional biosynthesis of proteoglycan [5,7]. Importantly, these studies have shown that maximal proteoglycan biosynthesis is achieved at osmolarities believed to represent in situ values (430 mOsm), i.e., at osmolarities above or below these values, proteoglycan biosynthesis is shown to decrease. Furthermore, the biological response does not appear to be mediated by ionic concentration changes, but rather depends directly on osmotic pressure [7]. The biological and biophysical mechanisms regulating this demonstrated sensitivity of disc biosynthesis to osmotic environment are not well understood.
0006-291X/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 0 0 0 6 - 2 9 1 X ( 0 2 ) 0 0 3 1 4 - 5
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
Significant zonal variations exist in the phenotypic expression and biosynthetic activity of the disc that partly reflect the activities of a heterogeneous cell population. The anulus fibrosus (AF) is a fibrocartilaginous tissue on the periphery of the disc and is populated by fibrochondrocyte-like cells of mesenchymal origin [8,9]. The centralmost nucleus pulposus (NP) is populated by both chondrocyte-like cells of mesenchymal origin and larger, highly vacuolated cells derived from the notochord that are present only in the immature tissue [9,10]. With increasing age, the notochordal cells disappear with consequent, but poorly understood changes in the biosynthesis of NP [11]. Bridging these regions is the transition zone (TZ) or inner anulus fibrosus, which contains cells that may be chondrocyte-like or fibrochondrocyte-like in nature [9]. Zonal differences have been observed in the biosynthesis of the intervertebral disc in vivo, in explant cultures, and in isolated cells, with results that generally identify TZ as the zone of greatest proteoglycan and protein biosynthesis [12–14]. Biological responses to physical stimuli further vary amongst zones, due to intrinsic differences in cell phenotype, local extracellular matrix composition, and structure, and/or local micro-mechanical stimuli. All cells of the disc have been shown to display a bimodal response to altered osmolarity in vitro, with maximal proteoglycan biosynthesis observed at hydrations believed to correspond to in situ values [5,7,13]. In articular chondrocytes, at least part of the observed changes in proteoglycan biosynthesis with altered osmolarity has been shown to be regulated at the transcriptional level [15–17]. Importantly, aggrecan gene expression changes appear to differ in chondrocytes in response to hypoosmotic and hyper-osmotic stimuli and thus may be regulated through different signalling pathways [15,16]. Studies have also shown that the kinetics and mechanisms for generating intracellular Ca2þ transients in chondrocytes differ in hypo- and hyper-osmotic media, likely due to differences in cell volume changes and regulatory mechanisms induced by these different stimuli [18,19]. Very limited information is available on isolated disc cell response to altered osmolarity, although there exists some evidence that disc cells undergo cell volume changes in response to altered osmolarity [7,32]. In addition, a recent study has shown that the organization of the actin cytoskeleton affected intracellular Ca2þ signalling in intervertebral disc cells subjected to hyper-osmotic loading [20], suggesting a role for the cytoskeleton in the biosynthetic response to altered osmolarity. In this study, we propose that disc cells respond to altered osmolarity with zonal-dependent changes in gene expression for abundant extracellular matrix proteins (aggrecan, type I, and II collagens), small leucinerich repeat proteoglycans (decorin, biglycan, and lumican), and cytoskeletal proteins (b-actin, vimentin,
933
and tubulin a1 ). Studies were performed using cells from an immature porcine disc source, with a nucleus pulposus that was previously shown to contain a high proportion of notochordal cells based on size and histological appearance [21]. In order to eliminate contributions from variations in extracellular matrix composition as well as micro-mechanical environment, cells were isolated from disc tissues and studied in an alginate bead culture system [22–24]. Cell–gel beads were cultured in media supplemented with sucrose or distilled water to modify osmolarity and mRNA levels for relevant genes were quantified using real-time quantitative RT-PCR. Materials and methods Cell isolation and culture. Lumbar spines were obtained from 4–5 month-old pigs within 24–48 h of sacrifice and storage at 4 °C (Nahunta Pork Center, Pikesville, NC). Spines were dissected to remove the surrounding soft tissue and to expose the intervertebral discs. Tissue from regions corresponding to the transition zone (TZ) and nucleus pulposus (NP) of the discs were used to isolate cells with a sequential pronase– collagenase digestion, as described previously [24]. Our previous study demonstrated that two subcultures did not significantly affect the pattern of gene expression for type I and II collagens and aggrecan in this cell population [12]. Therefore both NP and TZ cells were expanded in monolayer for two subcultures and then the cells were suspended at a density of 1 106 cells/ml in 1.2% alginate (low viscosity, Sigma Chemical, St Louis, MO) dissolved in 150 mM NaCl. Alginate beads were formed by a dropwise addition of the alginate from a 22 gauge needle into 102 mM CaCl2 , followed by 10 min of curing, as described previously [23,24]. Cell–gel beads were incubated in cell culture media consisting of Ham’s F-12 medium, supplemented with 10% FBS, 25 lg=ml ascorbic acid, 100 U/ml penicillin, 100 lg=ml streptomycin, and 1 lg=ml Fungizone at 5% CO2 in 37 °C. Osmotic loading of cells. After 24 h, the cell culture media were removed and the cell–gel beads were incubated for 4 h in one of the three osmotically active solutions. The iso-osmotic solution consisted of a cell culture medium (Ham’s F-12 media with the same supplements, as described above). Osmolarity of the iso-osmotic solution was 293 mOsm/ kg H2 O as measured with a freezing-point osmometer (Advanced Laboratory Wild Range 3W2, Advanced Instrument, Needham Heights, MA). The hypo-osmotic solution consisted of the same cell culture media diluted with de-ionized water to a final osmolarity of 250 mOsm/kg H2 O and the hyper-osmotic solution was created by the same cell culture media supplemented with sucrose to a final osmolarity of 450 mOsm/kg H2 O. Alginate solutions contain a net negative charge so that the osmotic environment of the cells in an alginate gel may not be expected to correspond to that of the measured incubation solutions. To test for a potential effect of alginate on the osmotic environment of the cells, an uncrosslinked solution of 2% alginate was serially diluted with F-12 medium and the osmolarity was measured. Results showed that the uncrosslinked alginate did not significantly modify the osmotic pressure from that of medium alone (Fig. 1). This finding suggests that the crosslinked alginate gel likely has a negligible effect on the osmotic environment of the cells in the cell–gel beads. RNA isolation and real-time quantitative RT-PCR. At the end of culture in the iso-, hypo-, or hyper-osmotic media, cells were released from alginate in a dissolving buffer (55 mM Na-citrate and 150 mM NaCl) with gentle agitation, as described previously [24]. Cells were pelleted by centrifugation and pooled from three samples equilibrated under each osmotic condition for studies on gene expression. Total RNA was extracted from the cells with RNeasy mini kit plus DNase I digestion
92 b
The underlined bases in the sequence indicate the position of an intron in the corresponding genomic sequence. The intron-spanning sequence of a lumican forward primer is based on the human sequence (HSU18728). c The sequence of aggrecan shown here was obtained by re-sequencing the porcine aggrecan cDNA clone.
CACAGTCATTGATGAAGTTCGCACTGGC AAGCATGTTCCCAGGGCAG
TCAGGGTGGAAGAGCTGGC F14514 Tubulin (a1)
a
144 CCATCTCTGGTCTCAACCGTCT AU058707 GGAAGGAGAAGAGAGCAGGATTTC Vimentin
CTTCCCTGAACCTGAGGGAAACCAATCTG
97 CCTCCTTTCCTGGGCATGGAGTCCTG TCCACGTCGCACTTCATGAT SSU07786 b-Actin
GGTGTCCAGAGGCGCTCTT
TCATACATGTCAGGTGGTAGACTAGTT TGATGCGATTGCCATCCAAACGC HSU18728 CAACTTGAGAAGTTTGACATAAAGAGCT AU059264 Lumican
AGTGCGAAAGGCTGTGTTCA
GCGATGCGGATGTAGGAGAG AF125537 Decorin
128
AGATGATCGTCGTAGAACTTGGCACCAACC 132
119 CAAGCTCCTCCAGGTGGTCTACCTGCA GAGCCGCACTTGGACAACA
AAGTCATTGACGCCCACCTT AF054419 Biglycan
79 TGCAGGTGACCATGGCC
CGGTAATGGAACACAACCCCT
CCCTGGGCAGCCACGACTTCC AF201722 Aggrecan
106 ACCAGGAACGCCCTGATCACCTGG CCACGAGCCAGGAGCT CCATCTGGCTTCCAGGGAC Collagen II (a1) AF201724
c
CCAAGAAGAAGACATCCCACCAGTCACCT CATGGTACCTGAGGCCGTTC
Reverse primer (50 ! 30 ) Forward primerb (50 ! 30 ) Accession number
GGCTCCTGCTCCTCTTAGCG
Sequences for the designed primers and probes, the size of the amplicons, and the position of the exon–exon
Collagen I (a1) AF201723
Efficiency of real-time quantitative RT-PCR
Target gene
Results
Table 1 Sequences of porcine probes and primers for real-time quantitative RT-PCR
(Qiagen, Valencia, CA) according to manufacturer’s instruction. Quantification of mRNAs was performed by real-time quantitative reverse transcriptase (RT)-PCR with a Smart Cycler System (Cepheid, Sunnyvale, CA). Quantification of mRNA was focused on genes for collagens and proteoglycans of extracellular matrix and cytoskeleton proteins (Table 1). For most genes of interest, porcine-specific PCR primers plus one fluorescently labelled intron-spanning probe were designed according to the sequences available in GenBank using Primer Express software (Applied Biosystems, Foster City, CA). For the lumican gene, the forward primer was designed from the human sequence because only limited information was available for the porcine lumican sequence. For each reaction, 20 ng total RNA was used in a one-step RTPCR with both Multiscribe reverse transcriptase and Amplitaq Gold polymerase. The final concentration of reagents in each PCR (25 ll total volume) was 1 Taqman buffer gold, 300 nM each of the forward and reverse primers, 200 nM probe, 300 nM each dNTP, 5.5 mM MgCl2 , 0.025 U/ll AmpliTaq gold, 0.25 U/ll Mutiscribe reverse transcriptase, and 0.4 U/ll RNase inhibitor (Applied Biosystems, Foster City, CA). The cycle parameters were 48 °C for 30 min to reverse transcribe RNA, 95 °C for 10 min to activate the Taq DNA polymerase, then 40 cycles of 95 °C for 15 s denaturation, followed by 60 °C for 45 s annealing and extension. 18S rRNA was amplified as an internal control (Taqman Ribosomal RNA Control Reagents kit-VIC Probe, Applied Biosystems, Foster City, CA) and 100 nM of probe and primers were used in each reaction. For mRNA quantification, the relative amounts of target genes were calculated by the comparative Ct method, where Ct denotes the cycle number for fluorescence detection above a threshold level (User Bulletin #2, Applied Biosystems, Foster City, CA). In this method, relative mRNA levels under hypo- or hyperosmotic conditions were normalized to that of the iso-osmotic condition. Duplicate PCRs were performed for pooled specimens under each osmotic condition. The efficiency of real-time quantitative RT-PCR for all targets including 18S rRNA was evaluated according to a protocol presented by Martin et al. [25]. Serial diluted total RNAs (100, 50, 25, 12.5 ng per reaction) from TZ cells were used for these evaluations.
Probea (50 ! 30 )
Fig. 1. The effect of uncrosslinked alginate on the experimentally measured osmolarity of cell culture medium.
132
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938 Amplicon size (bp)
934
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
junctions within the probe are shown in Table 1. The specificity and efficiency of the amplification for those probe and primer sets were tested using the serial diluted total RNA from TZ cells. For each target gene, the Ct value was found to correlate strongly with the initial amount of total RNA in the range of 12.5–100 ng (see Fig. 2A for a representative plot of data for collagen I ða1 Þ). The amplification efficiency of each target (Et ) was close to 1 (Et P 0:93, Fig. 2B). For the 18S rRNA internal control, the amplification efficiency was also close to 1 (Et ¼ 0:94). Using average error quantified from the linear correlation analyses, a onecycle increment of Ct permits detection of a 2-fold change in the total RNA within a 95% confidence limit (Fig. 2A). Therefore we used the comparative Ct method (User Bulletin #2, Applied Biosystems, Foster City, CA) to calculate the relative expression of each gene normalized to 18S rRNA and note significant
935
differences in relative gene expression levels if they fall out of this detection limit. Osmotic loading effects on gene expression of extracellular matrix Differences were observed between TZ and NP cells in response to altered osmolarity for all genes studied here (Table 2). Under hypo-osmotic conditions, gene expressions for aggrecan and type II collagen were upregulated in TZ, but not in NP cells. Both aggrecan and type II collagen are considered important markers of a chondrocytic phenotype, suggesting that a hypo-osmotic environment induced a unique phenotypic response in the TZ cells. In contrast, no changes in the TZ cell gene expression were observed following equilibration in hyper-osmotic media. Cells of the NP exhibited no changes in the gene expression for aggrecan and type I and II collagens in hypo- or hyper-osmotic media (Table 2). Osmotic loading effects on gene expression of small proteoglycans Gene expressions for the small proteoglycans, biglycan, and decorin, were up-regulated in TZ cells following incubation in either hypo- or hyper-osmotic media (Table 2). In particular, 5-fold increases in the levels of mRNA for biglycan were observed in the TZ cells following 4 h of incubation in either condition. In contrast, cells of the NP significantly down-regulated gene expressions for both small proteoglycans following incubation in hyper-osmotic media. There was no change in the gene expression for either biglycan or decorin in NP cells from the hypo-osmotic condition (Table 2). Gene expression for lumican was significantly down-regulated
Table 2 Fold differences in the relative mRNA levels in IVD cells subjected to an altered osmolarity Target gene
Fig. 2. (A) Standard curve for collagen type I (a1). The logarithm of total starting RNA was plotted against the cycle number (Ct) obtained with one-step real-time quantitative RT-PCR (1:2 fold serially diluted total RNA from 12.5 to 100 ng). (B) Efficiency curve for collagen type I (a1). For each dilution of total RNA, the expected DCt calculated as the logarithm in base 2 of the dilution factor was plotted against the measured change in Ct (DCt).The amplification efficiency for each target (Et ) was calculated as the slope of the best linear fit of the corresponding efficiency curve (e.g., Et ¼ 0:93 in this case).
Collagen I (a1) Collagen II (a1) Aggrecan Biglycan Decorin Lumican b-Actin Vimentin Tubulin (a1)
TZ cellsa
NP cellsa
Hypo
Hyper
Hypo
Hyper
NC 4.7 " 2.2 " 5.2 " 2.0 " NC NC NC NC
NC NC NC 5.1 " 2.1 " NC NC NC NC
NC NC NC NC NC 2.4 # NC NC 2.0 #
NC NC NC 2.5 # 2.3 # 2.0 # NC NC NC
NC ¼ no detectable change or fold difference <2:0; " ¼ increase; # ¼ decrease. a Values were normalized to mRNA levels at iso-osmotic loading condition (n ¼ 2).
936
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
in NP, but not in TZ cells under both hypo- or hyperosmotic conditions (Table 2). Osmotic loading effects on gene expression of cytoskeletal proteins Overall, both TZ and NP cells responded to either hypo- or hyper-osmotic conditions with almost no changes in the gene expression of cytoskeletal proteins: b-actin, vimentin, and tubulin a1 (Table 2). One exception was the finding of a 2-fold down-regulation of tubulin a1 mRNA in NP cells when equilibrated under hypo-osmotic conditions.
Discussion The results of this study suggest that osmotic pressure regulates the intervertebral disc cell synthesis of matrix molecules, including proteoglycans and collagen, at the transcriptional level. Important differences were observed in the response of all cells to hypo- and hyperosmotic conditions, as well as differences between TZ and NP cell types. In response to hypo-osmotic shock, many cells are known to experience an increase in the cell volume with initiation of active volume regulatory processes and associated intracellular signalling cascades in an effort to restore the cell volume [26,27]. These cascades may be involved not only in the volume regulation process, but may also influence other cellular responses such as gene expression, cellular metabolism, and apoptosis [26,28]. In many cell types including articular chondrocytes, cell volume changes are associated with the generation of Ca2þ transients and regulated by the breakdown and reorganization of the actin cytoskeleton [19,29–31]. In the present study, the TZ cells were more responsive to hypo-osmotic conditions with increases in gene expressions for small proteoglycans, aggrecan, and type II collagen. In contrast, the NP cells responded only with decreases in gene expression for lumican and tubulin. These differences in the biological response of TZ and NP cells to hypo-osmotic conditions may relate to differences in cytoskeletal organization between the fibro-chondrocytic TZ cells and the NP cells of notochordal origin. Cells of the TZ are similar in size and actin staining to the chondrocytes of articular cartilage, whereas cells of the NP that contain a high proportion of notochordal cells are larger, stiffer, and stain more intensely and diffusely for actin [21]. These important differences suggest that NP cells may not respond to hypo-osmotic conditions with the same pattern of volumetric changes as TZ cells, with their many similarities to articular chondrocytes. No information is available, however, on volume changes and active or passive regulatory processes in these two cell types under hypo-osmotic conditions. Thus, additional
studies are required to investigate the contribution of cytoskeletal differences to the observed differences in gene expression between these two cell types. Under hyper-osmotic conditions, NP and TZ cells exhibited respective decreases and increases in gene expression for the small proteoglycans, biglycan, and decorin. Again, this indicates that NP and TZ cells are perceiving and responding to the hyper-osmotic condition through dramatically different mechanisms. In contrast to hypo-osmotic conditions, cells subjected to hyper-osmotic shock may experience a transient decrease in cell volume, a process that has been shown to be partly regulated by actin breakdown in articular chondrocytes [18]. Ishihara et al. [7] showed that cells derived from the bovine NP are of smaller volume at 430 mOsm as compared to 280 mOsm and that this difference is sustained and not substantially regulated through active processes. Thus, it appears that cell volume changes may occur in this cell population under the hyper-osmotic conditions studied here. It should be noted that the NP cells in that study are not the same as those studied here; however, as NP cells derived from a bovine source do not retain any cells of notochordal origins. In another study, Pritchard et al. [32] showed that porcine NP cells of notochordal origin experience few changes in cell volume in response to hyper-osmotic conditions. Importantly, these NP cells, when treated with cytochalasin D to break down the actin cytoskeleton, experienced significant decreases in cell volume and increases in the kinetics of both Ca2þ transients and volume changes [20,32]. Thus, the more substantially developed actin cytoskeleton in the NP cells, as compared to TZ cells, may serve to stabilize the cell from changes in volume and related signalling responses. It should be noted that all cytoskeletal genes studied here did not significantly respond to osmotic change at the transcriptional level, suggesting that other post-transcriptional or translational regulations may be involved in these responses. Activity of an aggrecan promoter, as well as aggrecan mRNA levels, has been shown to be markedly different in articular chondrocytes cultured under hypo- and hyperosmotic conditions [15,16]. This response was shown for cells both in monolayer and in a three-dimensional culture system, such as those used here [33]. Thus, transcription of aggrecan in chondrocytes may be regulated through different mechanisms under hypo- and hyperosmotic conditions. The results of the current study provide additional support for this concept in two different cell populations, the fibrochondrocyte-like cells of TZ and the predominantly notochordal cells of NP. The finding of elevated aggrecan mRNA in TZ cells cultured under hypo-osmotic conditions is consistent with data reported previously for articular chondrocytes [16]. In contrast, the findings of no changes in aggrecan mRNA in TZ cells cultured under hyper-osmotic
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
conditions are not consistent with previous reports that hyper-osmotic conditions may up-regulate [17] or downregulate aggrecan gene expression in chondrocytes [15]. Furthermore, a previous study of bovine chondrocytes reported that gene expressions for type II collagen and biglycan were up-regulated by 2 h of hyper-osmotic treatment, while those of type I collagen and decorin were unchanged under the same conditions [17]. TZ cells in the current study responded to hyper-osmotic conditions with increases in gene expression for biglycan and decorin only, with no changes in type I or II collagen gene expression. Thus, cells of TZ appear to share some characteristics with chondrocytes. Notably, the sensitivity of the aggrecan gene to hypo-osmotic media and that of the biglycan gene to hyper-osmotic media were the most consistent findings between these two cell types. A major difference in the response to altered osmolarity between cells of the intervertebral disc was found in the genes for small proteoglycans. In general, TZ and NP cells responded to altered osmolarity with respective increases and decreases in genes for biglycan, decorin, and lumican. These small proteoglycans all contain a core protein composed of leucine-rich repeat structures and have been found to distribute differently in the zones of human and ovine intervertebral discs [34–37]. Small leucine-rich proteoglycans (SLRP) are believed to play important roles in the regulation of extracellular matrix assembly and cell–matrix interactions and in modifying matrix interactions with various glycoproteins, retinoic acid, cytokines, and growth factors [38–42]. Decorin and biglycan both carry one or two chondroitin/dermatan sulphate chains, with core proteins sharing 55% of their amino acid identity. These two SLRPs have distinctly different patterns of temporal and spatial expressions; however, suggesting different functions for these proteoglycans [43]. In the degenerating disc and in osteoarthritic cartilage, both decorin and biglycan have been found to increase at the mRNA and protein levels [44–48]. In addition, it has been shown that the biosynthesis of biglycan, not decorin, was stimulated in response to compressive loading at both mRNA and protein levels in tendon fibrocartilage [49]. Results of the present study suggest that biglycan, in particular, is strongly modified in response to hypo- or hyper-osmotic stress at the transcriptional level, as demonstrated by a 5-fold increase in the gene expression in TZ cells. Cartilage changes associated with osteoarthritis or induced degeneration commonly include elevated swelling, which may be partly consistent with the hypo-osmotic conditions and hence stimulatory mechanisms recreated here. Similarities in the stimulatory response of the genes for biglycan in TZ cells with those of articular chondrocytes reinforce the similarities in their mesenchymal origins and phenotypic characteristics.
937
Lumican carries three or four keratan sulphate chains and belongs to another sub-family of SLRP including fibromodulin [41]. Lumican may be important for the formation and maintenance of the extracellular matrix because lumican, like decorin, interacts with collagen and may inhibit fibrillogenesis [43]. Expression of lumican in articular cartilage appears to be up-regulated in adult tissue compared to juvenile tissue [50]. In the present study, lumican was down-regulated in NP but not in TZ cells, in response to the changes of osmolarity. The mechanisms for gene regulation of small proteoglycans in response to osmotic changes remain unclear; however, the different responses between TZ and NP cells suggest the existence of different signalling pathways downstream of osmotic stress and cell volume change. Further study of the unique differences between these cell types in volume regulation, Ca2þ responses, and other signalling pathways will help to elucidate the mechanisms for regulation of these small proteoglycans, as well as the other matrix proteins studied here.
Acknowledgments We wish to acknowledge Dr. Farshid Guilak, Mr. Scott Pritchard, and Mr. Larry M. Boyd for the many helpful discussions. This study was supported with funds from the NIH (AR47442) and a graduate research fellowship from The Whitaker Foundation.
References [1] J.P.G. Urban, in: J.A. Buckwalter, V.M. Goldberg, S.L.-Y. Woo (Eds.), Musculoskeletal Soft-tissue Aging: Impact on Mobility, American Academy of Orthopaedic Surgeons, Rosemont, IL, 1993, pp. 391–412. [2] J.C. Lotz, O.K. Colliou, J.R. Chin, N.A. Duncan, E. Liebenberg, Spine 23 (1998) 2493–2506. [3] W.C. Hutton, Y. Toribatake, W.A. Elmer, T.M. Ganey, K. Tomita, T.E. Whitesides, Spine 23 (1998) 2524–2537. [4] J.C. Iatridis, P.L. Mente, I.A.F. Stokes, D.D. Aronsson, M. Alini, Spine 24 (1999) 996–1002. [5] M.T. Bayliss, J.P. Urban, B. Johnstone, S. Holm, J. Orthop. Res. 4 (1986) 10–17. [6] H. Ohshima, J.P. Urban, D.H. Bergel, J. Orthop. Res. 13 (1995) 22–29. [7] H. Ishihara, K. Warensjo, S. Roberts, J.P. Urban, Am. J. Physiol. 272 (1997) C1499–C1506. [8] J.A. Buckwalter, Spine 20 (1995) 1307–1314. [9] T.R.J. Oegema, Clin. Sports Med. 12 (1993) 419–439. [10] J.J. Trout, J.A. Buckwalter, K.C. Moore, Anat. Rec. 204 (1982) 307–314. [11] J.J. Trout, J.A. Buckwalter, K.C. Moore, S.K. Landas, Tissue & Cell 14 (1982) 359–369. [12] J.Y. Wang, A.E. Baer, V.B. Kraus, L.A. Setton, Spine 26 (2001) 1747–1751. [13] H. Horner, S. Roberts, H. Evans, J. Menage, J. Urban, Trans. Orthop. Res. Soc. 25 (2000) 345. [14] M.T. Bayliss, B. Johnstone, J.P. O’Brien, Spine 13 (1988) 972–981.
938
J. Chen et al. / Biochemical and Biophysical Research Communications 293 (2002) 932–938
[15] G.D. Palmer, P.H. Chao Ph, F. Raia, R.L. Mauck, W.B. Valhmu, C.T. Hung, Osteoarthritis Cartilage 9 (2001) 761–770. [16] C. Hung, G. Palmer, M. LeRoux, P. Chao, W.B. Valhmu, Trans. Orthop. Res. Soc. 27 (2002) 137. [17] A. Parker, J. Boutell, D. Beer, S. Powell, R. Maciewicz, Trans. Orthop. Res. Soc. 26 (2001) 31. [18] G.R. Erickson, L.G. Alexopoulos, F. Guilak, J. Biomech. 34 (2001) 1527–1535. [19] G.R. Erickson, R. Minkhorst, F. Guilak, Trans. Orthop. Res. Soc. 26 (2001) 555. [20] S. Pritchard, G.R. Erickson, F. Guilak, Trans. Orthop. Res. Soc. 26 (2001) 32. [21] F. Guilak, H.P. Ting-Beall, A.E. Baer, W.R. Trickey, G.R. Erickson, L.A. Setton, Spine 24 (1999) 2475–2483. [22] K. Chiba, G.B. Andersson, K. Masuda, S. Momohara, J.M. Williams, E.J. Thonar, Spine 23 (1998) 1821–1827, discussion 1828. [23] B.A. Maldonado, T.R. Oegema Jr., J. Orthop. Res. 10 (1992) 677– 690. [24] A.E. Baer, J.Y. Wang, V.B. Kraus, L.A. Setton, J. Orthop. Res. 19 (2001) 2–10. [25] I. Martin, M. Jakob, D. Schafer, W. Dick, G. Spagnoli, M. Heberer, Osteoarthritis Cartilage 9 (2001) 112–118. [26] F. Lang, G.L. Busch, H. Volkl, Cell. Physiol. Biochem. 8 (1998) 1–45. [27] P.G. Bush, A.C. Hall, J. Orthop. Res. 19 (2001) 768–778. [28] S. Waldegger, F. Lang, J. Membr. Biol. 162 (1998) 95–100. [29] N.A. McCarty, R.G. O’Neil, Physiol. Rev. 72 (1992) 1037–1061. [30] J.A. Rosado, S.O. Sage, J. Physiol. 526 Pt 2 (2000) 221–229. [31] J. Moran, M. Sabanero, I. Meza, H. Pasantes-Morales, Am. J. Physiol. 271 (1996) C1901–C1907. [32] S. Pritchard, F. Guilak, Ann. Biomed. Eng. 29 Suppl. 1 (2001) 3.3.4.
[33] M.A. LeRoux, T.N. Kelly, G.D. Palmer, S.L. Seyhan, C.T. Hung, Trans. Orthop. Res. Soc. 27 (2002) 384. [34] W. Gotz, S. Barnert, R. Bertagnoli, N. Miosge, H. Kresse, R. Herken, Cell Tissue Res. 289 (1997) 185–190. [35] R. Sztrolovics, M. Alini, J.S. Mort, P.J. Roughley, Spine 24 (1999) 1765–1771. [36] J. Melrose, S. Smith, P. Ghosh, J. Anat. 197 (2000) 189–198. [37] J. Melrose, P. Ghosh, T.K. Taylor, J. Anat. 198 (2001) 3–15. [38] H. Kresse, H. Hausser, E. Schonherr, Experientia 49 (1993) 403– 416. [39] H. Kresse, H. Hausser, E. Schonherr, K. Bittner, Eur. J. Clin. Chem. Clin. Biochem. 32 (1994) 259–264. [40] H. Kresse, E. Schonherr, J. Cell. Physiol. 189 (2001) 266–274. [41] R.V. Iozzo, Annu. Rev. Biochem. 67 (1998) 609–652. [42] R.V. Iozzo, J. Biol. Chem. 274 (1999) 18843–18846. [43] A.M. Hocking, T. Shinomura, D.J. McQuillan, Matrix Biol. 17 (1998) 1–19. [44] R.I. Inkinen, M.J. Lammi, S. Lehmonen, K. Puustjarvi, E. Kaapa, M.I. Tammi, J. Rheumatol. 25 (1998) 506–514. [45] J. Melrose, P. Ghosh, T.K. Taylor, B. Vernon-Roberts, J. Latham, R. Moore, Eur. Spine J. 6 (1997) 376–384. [46] C.B. Little, P. Ghosh, C.R. Bellenger, J. Orthop. Res. 14 (1996) 433–444. [47] G. Cs-Szabo, L.I. Melching, P.J. Roughley, T.T. Glant, Arthritis Rheum. 40 (1997) 1037–1045. [48] H.C. Bock, P. Michaeli, C. Bode, W. Schultz, H. Kresse, R. Herken, N. Miosge, Osteoarthritis Cartilage 9 (2001) 654–663. [49] J.R. Robbins, S.P. Evanko, K.G. Vogel, Arch. Biochem. Biophys. 342 (1997) 203–211. [50] L.I. Melching, G. Cs-Szabo, P.J. Roughley, Matrix Biol. 16 (1997) 1–11.