Mechanical Stimuli-induced Urothelial Differentiation in a Human Tissue-engineered Tubular Genitourinary Graft

EUROPEAN UROLOGY 60 (2011) 1291–1298

available at www.sciencedirect.com journal homepage: www.europeanurology.com

Reconstructive Urology

Mechanical Stimuli-induced Urothelial Differentiation in a Human Tissue-engineered Tubular Genitourinary Graft Vale´rie Cattan, Genevie`ve Bernard, Alexandre Rousseau, Sara Bouhout, Ste´phane Chabaud, Franc¸ois A. Auger, Ste´phane Bolduc * Centre LOEX de l’Universite´ Laval, Ge´nie tissulaire et re´ge´ne´ration: LOEX – Centre de recherche FRSQ du Centre hospitalier affilie´ universitaire de Que´bec, and De´partement de Chirurgie, Faculte´ de Me´decine, Universite´ Laval, Que´bec, QC, Canada

Article info

Abstract

Article history: Accepted May 26, 2011 Published online ahead of print on June 12, 2011

Background: A challenge in urologic tissue engineering is to obtain welldifferentiated urothelium to overcome the complications related to other sources of tissues used in ureteral and urethral substitution. Objective: We investigated the effects of in vitro mechanical stimuli on functional and morphologic properties of a human tissue-engineered tubular genitourinary graft (TTGG). Design, setting, and participants: Using the self-assembly technique, we developed a TTGG composed of human dermal fibroblasts and human urothelial cells without exogenous scaffolding. Eight substitutes were subjected to dynamic flow and hydrostatic pressure for up to 2 wk compared to static conditions (n = 8). Measurements: Stratification and cell differentiation were assessed by histology, electron microscopy, immunostaining, and uroplakin gene expression. Barrier function was determined by permeation studies with carbon 14–urea. Results and limitations: Dynamic conditions showed well-established stratified urothelium and basement membrane formation, whereas no stratification was observed in static culture. The first signs of cell differentiation were perceived after 7 d of perfusion and were fully expressed at day 14. Superficial cells under perfusion displayed discoidal and fusiform vesicles and positive staining for uroplakin 2, cytokeratine 20, and tight junction protein ZO-1, similar to native urothelium. Mechanical stimuli induced expression of the major uroplakin transcripts, whereas expression was low or undetectable in static culture. Permeation studies showed that mechanical constraints significantly improved the barrier function compared to static conditions ( p < 0.01 at 14 d, p < 0.05 at 7 d) and were comparable to native urothelium. Conclusions: Mechanical stimuli induced in vitro terminal urothelium differentiation in a human genitourinary substitute displaying morphologic and functional properties equivalent to a native urologic conduit.

Keywords: Barrier function Cell differentiation Human Mechanical stimuli Tissue engineering Ureteral reconstruction Urethral reconstruction Urothelium

Crown Copyright # 2011 Published by Elsevier B.V. on behalf of European Association of Urology. All rights reserved.

* Corresponding author. Laboratoire d’Organoge´ne`se Expe´rimentale (CMDGT/LOEX, Aile-R), Centre hospitalier affilie´ universitaire de Que´bec, 1401, 18e rue Que´bec, (Qc) Canada, G1J 1Z4. Tel. +1 418 990 8255; Fax: +1 418 990 8248. E-mail address: [email protected] (S. Bolduc). 0302-2838/$ – see back matter Crown Copyright # 2011 Published by Elsevier B.V. on behalf of European Association of Urology. All rights reserved.

doi:10.1016/j.eururo.2011.05.051

1292

1.

EUROPEAN UROLOGY 60 (2011) 1291–1298

Introduction

15 cm H2O in a humidified incubator with 8% carbon dioxide at 37 8C. We compared these conditions to static conditions without perfusion or

There is a clinical need for alternatives to surgical reconstruction of congenital and acquired genitourinary tract defects. Available quantities of genitourinary tissues or mucosa are too small for grafting. Other sources of tissues have been used for urethral reconstruction but with limited success at long-term follow-up on account of the development of significant complications related to the graft [1–3] or the donor site [4]. Tissue engineering provides a promising alternative for reconstructive urologic surgery. Synthetic biopolymers and acellular matrix have been developed to repair urethral defects; however, inflammation and fibrosis related to the use of such biomaterials were reported [5]. Seeded matrix with human urothelial cells (HUCs) has been settled and has shown urothelium stratification but no in vitro terminal differentiation [6,7]. Mechanical stimuli are known to influence cell structure and function. Forces exerted at the cell surface or deforming cell shape are detected by sensors that transduce mechanical stimuli to chemical signals through the cell. Recent studies have reported that urothelial cells are sensitive to mechanical stimuli and release signaling molecules in response to stretch or hydrostatic pressure [8,9]. We developed a tissue-engineered tubular genitourinary graft (TTGG) from human cells using the self-assembly approach, avoiding the use of exogenous biomaterials. We hypothesized that mechanical stimuli mediated by flow perfusion and hydrostatic pressure may promote urothelial stratification and differentiation associated with urinary barrier function. 2.

Materials and methods

2.1.

Cell isolation and culture

added hydrostatic pressure. Media were renewed twice a week. The shear stress tw was calculated using the following equation in which Q is the volumetric flow rate, m is the viscosity of the medium (0.011 Poise) [13], and D is the diameter of the TTGG: tw = 32 mQ / pD3.

2.3.

Histology

Harvested samples were fixed in 3.7% neutral buffered formaldehyde for 24 h and embedded in paraffin. Five-micrometer-thick sections were cut and then stained with Masson’s trichrome. To assess fibrillar collagen organization, we enhanced the natural birefringence properties of collagen fibrils under polarized light with Picrosirius red staining 0.1% (Sigma-Aldrich) diluted in saturated picric acid for 1 h and rinsed with 0.01 N hydrochloric acid before observation.

2.4.

Immunofluorescence

Cryosections (20 mm) were fixed in 3.7% formaldehyde for 10 min and then incubated for 45 min with primary antibodies in 1% bovine serum albumin–phosphate buffered saline before incubation with secondary antibody conjugated with Alexa-594 or -488. Dilutions and suppliers for specific antibodies are listed in Table 1. As negative control, primary antibodies were omitted. Nuclei were counterstained with Hoechst reagent. Sections were viewed using a Nikon C1 laser scanning confocal microscope (Nikon, Mississauga, Canada).

2.5.

Real-time polymerase chain reaction analysis

Total RNA was extracted using an RNeasy kit (Qiagen, Mississauga, Canada) from tissues homogenized with Trizol reagent (Invitrogen). First-strand complementary DNA (cDNA) was synthesized from 1 mg RNA using Oligo(dT) primer (Ambion, Austin, TX, USA) and SuperScript III reverse transcriptase (Invitrogen), according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (PCR) was performed on the Rotor-Gene 3000 (Corbett Research, Mortlake, Australia) in duplicate, using the Lightcycler 480 SYBR Green I master mix (Roche Diagnostics, Mannheim, Germany) and gene-specific

Tissues were obtained after written informed consent of volunteers and

primers (Table 2). For each examined gene, a standard curve was

approval of the local ethics committee. Human fibroblasts were isolated

generated from real-time PCR purified products. The cDNA quantifica-

from human skin biopsy, as previously described [10], and grown in the

tion was performed by comparison with the standard curve and

Dulbecco-Vogt modification of Eagle’s medium (DMEM; Invitrogen,

normalization to the external control b2-microglobuline.

Burlington, Canada) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA) and antibiotics (100 IU/ml penicillin; 25 mg/ml

2.6.

Electron microscopy

gentamicin). HUCs were extracted from human renal pelvis biopsy, as previously described [11], and cultured with a feeding layer composed of 1.5  105 irradiated fibroblasts in DMEM-Ham’s F12 (ratio 3:1;

Samples were fixed with 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) for 24 h, washed in cacodylate, and postfixed in 1% osmium

Invitrogen) supplemented with 10% FBS, 5 mg/ml insulin (Sigma-Aldrich

tetroxide for 30 min. Scanning electron microscopy (SEM) was

Corp., St. Louis, MO, USA), 0.4 mg/ml hydrocortisone (Calbiochem, La

performed on gold-coated specimens and observed with a JEOL JSM-

Jolla, CA, USA), 10 mg/ml epidermal growth factor (Austral Biologicals,

63060LV (Soquelec, Montreal, Canada). For transmission electronic

San Ramon, CA, USA), 1010M cholera toxin (ICN, Saint Laurent, Canada),

microscopy (TEM), regions of interest were counterstained with uranyl

and antibiotics.

2.2.

Genitourinary tissue construct Table 1 – The primary antibodies

Fibroblasts were cultured with sodium ascorbate 50 mg/ml (SigmaAldrich) for 4 wk until the formation of living tissue sheets, which were wrapped around a tubular support (6.5 mm in diameter) to produce a tube of 10 concentric layers. After 3 wk of maturation, the tubular supports were removed for intraluminal HUC seeding, as previously described [12]. The TTGGs were placed in a custom-made bioreactor for 7 d and 14 d to allow intraluminal flow (15 ml/min) of HUC medium (Ismatec pump; Colepalmer, Montreal, Canada) and internal pressure of

Specificity

Dilution

Elastin Uroplakin 2 Cytokeratine 20 Heparan sulfate ZO-1 Collagen 7

1:100 1:100 1:20 1:400 1:100 1:400

Source Abcam Santa Cruz Biotechnology Acris Sigma Zymed Chemicon

EUROPEAN UROLOGY 60 (2011) 1291–1298

Table 2 – Primer sequences used for polymerase chain reaction (PCR) amplification* Gene name UPK1A UPK1B UPK2 UPK3A B2M

Primer sequence (50 -30 )

Amplicon size (pb)

F: CCCTAGCCCTTACGTCCTTC R: CATGGAGAGGTCCCTTGAAA F: CCAAAGACAACTCAACTGTTCG R: GGGTAGAGGCTGTGTTGGTC F: GCATACCAGGTGACAAACCTC R: TGGATTCCATGTTCCTTCG F: GCCTCTCTGCATGTTTGACA R: CCCACCCTCTGTTTGTAGGA F: GGCTATCCAGCGTACTCCAAAG R: CAACTTCAATGTCGGATGGATG

135 130 130 154 116

F = forward primer; R = reverse primer; UPK = uroplakin and B2 M b2microglobuline. * Real-time PCR conditions were denaturation at 95 8C for 5 min; 40 PCR cycles (denaturing: 95 8C for 15 s; annealing: 60 8C for 15 s; extension: 72 8C for 20 s).

acetate and lead citrate and observed with a transmission electron

3.

Results

3.1.

TTGG organization

1293

Static conditions exhibited a monolayer and a bilayer of HUCs at 7 d and 14 d, respectively, whereas dynamic conditions showed well-established stratified cell layers similar to those of native urothelium with basal, intermediate, and superficial cells (Fig. 1A and 1B) morphologically equivalent to umbrella cells (Fig. 1C). Under polarized light, collagen fibers of TTGG under perfusion appeared highly birefringent, forming thick bundles of densely packed fibers, compared to those developed under static conditions, which appeared thinner and slightly less birefringent (Fig. 2A). Immunofluorescence analysis showed the presence of elastin organized in circular array in the fibroblast layer in both conditions (Fig. 2B).

microscope (JEOL JEM-1230; Soquelec).

3.2. 2.7.

The permeation studies were performed using Franz-type diffusion cells with open TTGG or native porcine urethra with urothelium facing the donor compartment. The receiver chamber was filled with DMEM, and the donor chamber was filled with 2.5 mCi of carbon 14 (14C)–urea (MP Biomedicals, Irvine, CA) in DMEM at 37 8C. The amount of radioactivity to be permeated was determined by removing medium in the receiver compartment at selected time intervals up to 24 h and assessed with a scintillation counter (Beckmann, Fullerton, CA).

2.8.

Statistical analysis

Values were expressed as mean plus or minus standard error of the mean. Statistical analysis was conducted using analysis of variance followed by a Bonferroni test to evaluate the difference between multiple data sets. Student t test was used to compare two data sets. The level of significance was established at a = 0.05.

[(Fig._1)TD$IG]

Urothelium marker expression

Permeation studies

Immunostaining for uroplakin 2 and cytokeratine 20 (CK20) was absent in static conditions, but positive staining was revealed in dynamic conditions in a few superficial cells at 7 d and in most cells at 14 d, similar to native tissue (Fig. 3). Tight junction protein ZO-1 at the intercellular boundaries between superficial cells, collagen 7, and heparan sulfate within the urothelial basement membrane (BM) were strongly expressed in dynamic conditions in the same pattern as native tissue, whereas weak staining was observed in static culture. 3.3.

Uroplakin messenger RNA expression

Mechanical constraints induced significantly higher expression of major uroplakin messenger RNA than did static conditions ( p < 0.01 for UPK1A and p < 0.05 for UPK1B at

Fig. 1 – Histology of the human tissue-engineered tubular genitourinary graft (TTGG). (A) Masson’s trichrome staining of a TTGG at days 7 and 14 after urothelial cell seeding under static or dynamic conditions. Cross-sections of the urethra constructs revealed a cohesive structure composed of collagen (blue) and fibroblasts (purple) on which urothelial cells (purple) lie. (B) Masson’s trichrome histologic staining of native porcine urethra. (C) Semithin section (0.5 mm) stained with blue toluidine showing apical superficial cells after 14 d of dynamic culture similar to umbrella cells of native urothelium. Scale: 50 mm.

[(Fig._2)TD$IG]

1294

EUROPEAN UROLOGY 60 (2011) 1291–1298

Fig. 2 – Matrix characterization of the human tissue-engineered tubular genitourinary graft (TTGG). (A) Analysis of TTGG sections by Sirius red staining viewed under polarized light in TTGG at days 7 and 14 under dynamic or static conditions. Mature type 1 collagen fibers appeared bright yellow or orange. Scale: 100 mm. (B) Immunofluorescence of elastin in TTGG under dynamic or static conditions. Scale: 100 mm.

[(Fig._3)TD$IG]

days 7 and 14; UPK2 and UPK3A were below the limit of detection for static groups) (Fig. 4). Quantitative PCR showed a three- to four-fold expression of UPK1A and UPK2 for graft perfused during 14 d compared to 7 d ( p < 0.05), but no significant difference was observed for UPK1B and UPK3A between 7 d and 14 d.

3.4.

Ultrastructure

Apical cell surface of the urothelium observed by SEM distinctly displayed cell boundaries and tight junctions (confirmed by TEM; Fig. 5F) after 14 d of stimuli, whereas cell junctions were difficult to identify at day 7 (Fig. 5A,

Fig. 3 – Expression of urothelial differentiation-associated protein and basal lamina in response to mechanical stimuli at days 7 and 14 compared to static conditions and human native ureter. Imunofluorescence with antiuroplakin 2, anticytokeratine 20 (anti-CK20, green) and antiheparan sulfate (red), antiZO-1, and anticollagen 7 antibodies. Scale: 50 mm.

EUROPEAN UROLOGY 60 (2011) 1291–1298

[(Fig._4)TD$IG]

1295

Fig. 4 – Messenger RNA (mRNA) levels for uroplakins during urothelium differentiation in the human tissue-engineered tubular genitourinary graft (TTGG) under perfusion or static conditions. Uroplakin mRNA expression (UPK1A, UPK1B, UPK2, and UPK3A) quantified by quantitative polymerase chain reaction in TTGG under dynamic (D) or static (S) conditions at 7 d and 14 d. Transcript levels were normalized to b2-microglobuline. Mean plus or minus standard error of the mean (n = 4). BDL = below detection limit. *p < 0.05. **p < 0.01.

5B, and 5F). Microvilli were observed at day 7 and associated with ropy and microridges at day 14 (Fig. 5C). In static conditions, microvilli and thin tight junctions were observed (data not shown). After 7 d of perfusion, TEM showed large and discoidal vesicles in superficial cells and abundant glycocalyx (Fig. 5D). At day 14, fusiform vesicles appeared associated with smaller discoidal vesicles (Fig. 5E). Because of the great fragility of the urothelium monolayer in static conditions, interpretable TEM images could not be obtained. 3.5.

Permeation studies

The TTGG subjected to 14 d of mechanical stimuli presented the highest barrier properties in comparison to other conditions (14 d vs 7 d; p < 0.05) (Fig. 6). After perfusion, the barrier function was significantly enhanced compared to static conditions at any time ( p < 0.01 at 14 d and p < 0.05 at 7 d), except for the 24 h time point, for which 7 d of dynamic versus static conditions were comparable. No significant difference between cumulative 14C-urea permeation of TTGG perfused (7 d and 14 d) and native tissue was observed at any time. 4.

Discussion

Our TTGG model is based exclusively on the use of human cells without synthetic or exogenous scaffolding. This

model presents several advantages compared to existing models of urologic substitution. First, our substitute supplies a living autologous graft with a biological matrix able to adapt to its environment and promote transplant tolerance. Second, we previously demonstrated that TTGG is suturable and presented excellent mechanical strength suitable for grafting [12]. Third, TTGG displays morphologic structures, specific markers of differentiation, and urine barrier function very close to native urologic tissues. We have demonstrated, for the first time, in vitro stratification and terminal differentiation of HUCs in response to mechanical constraints. Cross et al [6] and Southgate et al [7] have previously shown stratification but no terminal differentiation (absence of CK20 staining) with serum and calcium adjunction in HUCs. In contrast to HUCs, in vitro differentiation markers were observed in porcine urothelial cells [14]. Our results in static conditions showed that the presence of serum and a natural matrix secreted by cells was not sufficient for stratification and maturation. These results appear opposite to the previous studies, showing (1) that HUCs seeded on de-epithelialized urothelial organ exhibited stratification and partial differentiation [15] and (2) that porcine urothelial cells in contact with fibroblasts embedded in three-dimensional collagen gel culture displayed stratification and signs of differentiation [16]. However, in the first study, extracellular matrix BM was preserved after de-epithelialization and could promote

1296

[(Fig._5)TD$IG]

EUROPEAN UROLOGY 60 (2011) 1291–1298

Fig. 5 – Ultrastructure of superficial urothelial cells in human tissue-engineered urethra. (A–C) Scanning electron microscope micrographs of the human tissue-engineered tubular genitourinary graft (TTGG) surface under perfusion during (A) 7 d and (B,C) 14 d. Arrows show cell boundaries and tight junctions. (C) Higher magnification showed the presence of microvilli (black arrowhead) associated with ropy and microridges (white arrowhead) at day 14 on the apical cell surface. Scale for Figure 5A and 5B: 10 mm; scale for Figure 5C, 2 mm. (D–F) Transmission electron microscopy of superficial cells of TTGG submitted to perfusion during (D) 7 d and (E,F) 14 d. Note the immature discoidal vesicles (dv) and abundant glycocalyx (arrow) at day 7 (D) and the replacement of dv by mature fusiform vesicles (fv), the formation of asymmetric unit membrane (AUM), and the presence of desmosomes (De) and tight junctions (TJ) at day 14. Scale: 0.5 mm. L = lumen.

differentiation of seeded HUCs, whereas in our model, BM formation occurred after HUC seeding and was weak in static conditions. For the second study, it was shown that differences exist between in vitro comportment of porcine cells and HUCs [14], and experiments with HUCs should be performed to clarify this point. Mechanical constraints including low shear flow around 0.1 dynes/cm2 and hydrostatic pressure (15 cm H20) contributed to induce terminal differentiation and effective urinary barrier, suggesting that HUCs exhibited sensory properties able to respond to mechanical stimuli. Mechanotransduction was reported in urothelial cells under hydrostatic pressure [8]. However, we believe that shear

flow was involved in urothelium maturation, considering that stratification and differentiation also occurred without adding hydrostatic pressure to the residual pressure inherent to the bioreactor system (data not shown). Shear stress was described as involved in cell proliferation and differentiation [17,18] by inducing growth factor production and gene transcription by mechanotransduction via cell surface receptors such as integrins and transient receptor potential vanilloid channels, receptors described in HUCs [19,20]. Our model presented urothelial stratification associated with BM formation, supported by the presence of heparan sulfate, collagen 7, and laminin (previously shown) [21]. BM is a specialized extracellular matrix, essential to cell

1297

EUROPEAN UROLOGY 60 (2011) 1291–1298

[(Fig._6)TD$IG]

Cumulative percentage of 14C-urea permeated (%)

100 90 80 70 60 50 40 30

static 7 days static 14 days dynamic 7 days dynamic 14 days Native urethra

20 10 0 0

2

4

6

8

10

12

14

16

18

20

22

24

Time (h) Fig. 6 – Permeability studies. Cumulative percentage of carbon 14–urea permeated in vitro across porcine urethra or human tissue-engineered tubular genitourinary graft (TTGG) subjected to mechanical stimuli or static conditions during 7 d and 14 d. Each point represents mean plus or minus standard error of the mean (n = 4).

function and known to be involved in cell adhesion, proliferation, and differentiation via cell surface receptors [22]. We observed slight BM production when HUCs were in contact with the fibroblast layer in static conditions, suggesting crosstalk between fibroblasts and HUCs and cell matrix interactions. According to the hypothesis that HUCs display mechanosensors, BM formation was amplified by mechanical constraints and probably contributed to urothelium stratification and maturation. Mechanical stimuli also promoted matrix organization in the fibroblast layer, producing densely packed fibers of collagen. However, elastin staining was not affected by mechanical stimuli. Our model suggests that extracellular matrix could provide much more than a structural and mechanical support; matrix proteins could promote cell proliferation and differentiation. Tightness of urothelium relies on uroplakins and highly impermeable tight junctions. Tight junctions were described to be the first sign of superficial cell differentiation [23]. In our experiment, mechanical stimuli induced tight junction formation arranged in continuous lines, whereas nascent tight junctions were observed in static conditions. In vivo urothelium regeneration was completed within 2 wk [24]. CK20 was described as appearing at the final stage of urothelium differentiation after uroplakin transport to apical membrane in fusiform vesicles [24]. We showed the presence of fusiform vesicles, uroplakins, and CK20 expression in a few umbrella cells after 7 d of perfusion and in most superficial cells at day 14. Transcript expression of different uroplakins was higher at 14 d than at 7 d and was low or undetectable in static conditions, in accordance with the fact that uroplakin gene expression was restricted to differentiated urothelial cells [25]. The end stage of differentiation was characterized

by the formation of asymmetric unit membrane (AUM) plaques and well-developed microridges on the luminal surface [26]. AUM plaques and few microridges were observed after 14 d of perfusion but not on the entire apical surface of the engineered urothelium. However, we showed that permeability to urea in TTGG under perfusion was similar to native urothelium with the best profile at 14 d, in accordance with the differentiation state. This means that even if our TTGG expressed terminal differentiation markers without achieving complete maturation, the urinary barrier was effective. Terminal differentiation of porcine urothelial cells was reported in reconstructed urothelium after 3 wk of in vivo maturation in the omentum [27,28]. Moreover, 6-yr follow-up of urethral reconstruction with HUC-seeded tubularized polyglycolic acid scaffold showed functional characteristics [27,28]. We could hypothesize that our TTGG after urethral or ureteral replacement could rapidly complete its maturation to ensure all of its functions. Based on these findings, preclinical studies will begin to determine whether a urologic tissue-engineered model with a differentiated urothelium provides an advantage to prevent fibrosis and contraction after ureter or urethra replacement. 5.

Conclusions

The present study provided evidence that mechanical stimuli induced in vitro terminal urothelium differentiation in a human TTGG. Our reconstructed model, without an exogenous scaffold, mimics morphologic and functional properties of a native urologic conduit. Autologous, watertight, and with remarkable mechanical resistance, our

1298

EUROPEAN UROLOGY 60 (2011) 1291–1298

model may offer an alternative to substitution ureteroplasty or urethroplasty and may constitute an excellent in vitro research tool to understand urothelial function and to develop pharmacologic studies. Author contributions: Ste´phane Bolduc had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Cattan. Acquisition of data: Cattan, Bernard. Analysis and interpretation of data: Cattan. Drafting of the manuscript: Cattan. Critical revision of the manuscript for important intellectual content: Bolduc. Statistical analysis: Cattan.

[9] Yu W, Khandelwal P, Apodaca G. Distinct apical and basolateral membrane requirements for stretch-induced membrane traffic at the apical surface of bladder umbrella cells. Mol Biol Cell 2009;20: 282–95. [10] Auger FA, Lopez Valle CA, Guignard R, et al. Skin equivalent produced with human collagen. In Vitro Cell Dev Biol Anim 1995;31: 432–9. [11] Magnan M, Berthod F, Champigny MF, Soucy F, Bolduc S. In vitro reconstruction of a tissue-engineered endothelialized bladder from a single porcine biopsy. J Pediatr Urol 2006;2:261–70. [12] Magnan M, Levesque P, Gauvin R, et al. Tissue engineering of a genitourinary tubular tissue graft resistant to suturing and high internal pressures. Tissue Eng Part A 2009;15:197–202. [13] Thoumine O, Nerem RM, Girard PR. Oscillatory shear stress and

Obtaining funding: Bolduc, Auger.

hydrostatic pressure modulate cell-matrix attachment proteins in

Administrative, technical, or material support: Bernard, Bouhout,

cultured endothelial cells. In Vitro Cell Dev Biol Anim 1995;31:

Rousseau, Chabaud. Supervision: Bolduc. Other (specify): None.

45–54. [14] Turner AM, Subramaniam R, Thomas DFM, Southgate J. Generation of a functional, differentiated porcine urothelial tissue in vitro. Eur Urol 2008;54:1423–32.

Financial disclosures: I certify that all conflicts of interest, including

[15] Scriven SD, Booth C, Thomas DF, Trejdosiewicz LK, Southgate J.

specific financial interests and relationships and affiliations relevant to the

Reconstitution of human urothelium from monolayer cultures.

subject matter or materials discussed in the manuscript (eg, employment/

J Urol 1997;158:1147–52.

affiliation, grants or funding, consultancies, honoraria, stock ownership or

[16] Fujiyama C, Masaki Z, Sugihara H. Reconstruction of the urinary

options, expert testimony, royalties, or patents filed, received, or pending),

bladder mucosa in three-dimensional collagen gel culture: fibro-

are the following: None.

blast-extracellular matrix interactions on the differentiation of transitional epithelial cells. J Urol 1995;153:2060–7.

Funding/Support and role of the sponsor: This study was supported by grants from the Fonds de la Recherche en Sante´ du Que´bec and the Canadian Institutes of Health Research. This project was specifically supported by a grant from the Astellas Research Competition.

[17] Honda MJ, Shinohara Y, Sumita Y, Tonomura A, Kagami H, Ueda M. Shear stress facilitates tissue-engineered odontogenesis. Bone 2006;39:125–33. [18] Yourek G, McCormick SM, Mao JJ, Reilly GC. Shear stress induces osteogenic differentiation of human mesenchymal stem cells.

Acknowledgment statement: The authors thank Robert Gauvin and the LOEX team for useful discussions.

Regen Med 2010;5:713–24. [19] Wilson CB, Leopard J, Cheresh DA, Nakamura RM. Extracellular matrix and integrin composition of the normal bladder wall. World

References

J Urol 1996;14(Suppl 1):S30–7. [20] Birder LA. Urothelial signaling. Handb Exp Pharmacol 2011;207–31.

[1] Hauser S, Bastian PJ, Fechner G, Muller SC. Small intestine submu-

[21] Bouhout S, Perron E, Gauvin R, et al. In vitro reconstruction of an

cosa in urethral stricture repair in a consecutive series. Urology

autologous, watertight, and resistant vesical equivalent. Tissue Eng

2006;68:263–6. [2] Irani D, Hekmati P, Amin-Sharifi A. Results of buccal mucosal graft urethroplasty in complex hypospadias. Urol J 2005;2:111–4. [3] Kambouri K, Gardikis S, Giatromanolaki A, et al. Comparison of

Part A 2010;16:1539–48. [22] Kim SH, Turnbull JE, Guimond SE. Extracellular matrix and cell signalling: the dynamic cooperation of integrin, proteoglycan and growth factor receptor. J Endocrinol 2011;209:139–51.

angiogenic activity after urethral reconstruction using free grafts

[23] Veranic P, Erman A, Kerec-Kos M, Bogataj M, Mrhar A, Jezernik K.

and pedicle flap: an experimental study. Eur J Pediatr Surg 2006;

Rapid differentiation of superficial urothelial cells after chitosan-

16:323–8. [4] Fichtner J, Filipas D, Fisch M, Hohenfellner R, Thuroff JW. Long-term followup of buccal mucosa onlay graft for hypospadias repair: analysis of complications. J Urol 2004;172:1970–2. [5] Shokeir A, Osman Y, Gabr M, Mohsen T, Dawaba M, el-Baz M. Acellular matrix tube for canine urethral replacement: is it fact or fiction? J Urol 2004;171:453–6. [6] Cross WR, Eardley I, Leese HJ, Southgate J. A biomimetic tissue from cultured normal human urothelial cells: analysis of physiological function. Am J Physiol Renal Physiol 2005;289:F459–68. [7] Southgate J, Hutton KA, Thomas DF, Trejdosiewicz LK. Normal human urothelial cells in vitro: proliferation and induction of stratification. Lab Invest 1994;71:583–94.

induced desquamation. Histochem Cell Biol 2009;131:129–39. [24] Veranic P, Romih R, Jezernik K. What determines differentiation of urothelial umbrella cells? Eur J Cell Biol 2004;83:27–34. [25] Lobban ED, Smith BA, Hall GD, et al. Uroplakin gene expression by normal and neoplastic human urothelium. Am J Pathol 1998;153: 1957–67. [26] Wu XR, Kong XP, Pellicer A, Kreibich G, Sun TT. Uroplakins in urothelial biology, function, and disease. Kidney Int 2009;75: 1153–65. [27] Baumert H, Mansouri D, Fromont G, et al. Terminal urothelium differentiation of engineered neoureter after in vivo maturation in the ‘‘omental bioreactor’’. Eur Urol 2007;52:1492–8. [28] Raya-Rivera A, Esquiliano DR, Yoo JJ, Lopez-Bayghen E, Soker S,

[8] Olsen SM, Stover JD, Nagatomi J. Examining the role of mechan-

Atala A. Tissue-engineered autologous urethras for patients who

osensitive ion channels in pressure mechanotransduction in rat

need reconstruction: an observational study. Lancet 2011;377:

bladder urothelial cells. Ann Biomed Eng 2011;39:688–97.

1175–82.