- Email: [email protected]
Mechanism of cardioprotection following trauma-hemorrhagic shock by a selective estrogen receptor-β agonist: up-regulation of cardiac heat shock factor-1 and heat shock proteins
Journal of Molecular and Cellular Cardiology 40 (2006) 185–194 www.elsevier.com/locate/yjmcc
Original article
Mechanism of cardioprotection following trauma-hemorrhagic shock by a selective estrogen receptor-b agonist: up-regulation of cardiac heat shock factor-1 and heat shock proteins Huang-Ping Yu a,b, Tomoharu Shimizu a, Mashkoor A. Choudhry a, Ya-Ching Hsieh a, Takao Suzuki a, Kirby I. Bland a, Irshad H. Chaudry a,* a
Center for Surgical Research and Department of Surgery, University of Alabama at Birmingham, 1670 University Boulevard, Volker Hall, Room G094, Birmingham, AL 35294-0019, USA b Graduate Institute of Clinical Medical Sciences, Chang Gung University, Taoyuan, Taiwan, ROC Received 6 September 2005; received in revised form 30 September 2005; accepted 3 October 2005 Available online 08 November 2005
Abstract Although 17b-estradiol (E2) administration following trauma-hemorrhage (T-H) improves cardiac function in male rodents, it is not known whether the salutary effects of E2 are mediated via estrogen receptor (ER)-a or ER-b, and whether cardiac heat shock proteins (Hsp) are affected by E2 administration. Male Sprague–Dawley rats underwent T-H (mean BP 40 mmHg for 90 min, then resuscitation). ER-a agonist propyl pyrazole triol (PPT) (5 µg/kg), ER-b agonist diarylpropiolnitrile (DPN) (5 µg/kg), or vehicle (10% DMSO) was injected subcutaneously during resuscitation. At 24 h after T-H or sham operation, cardiac output (CO), stroke volume (SV), mean blood pressure, and ± dP/dtmax were measured (n = 6 rats per group). Cardiac Hsp32, 60, 70, and 90 mRNA/protein expressions and heat shock factor (HSF)-1 DNA binding activity were determined. One-way ANOVA and Tukey’s test were used for statistical analysis. CO, SV and ± dP/dtmax decreased significantly after T-H, however, administration of ER-b agonist DPN after T-H restored the above parameters. Moreover, DPN treatment prevented T-H-mediated decrease in Hsp60 mRNA/protein and Hsp90 protein expressions in the heart. Hsp32 and Hsp70 mRNA/protein expression and HSF-1 DNA binding activity in the hearts were increased even above the shams in DPN treated T-H rats. In contrast, no significant change in the above parameters was observed in T-H rats treated with ER-a agonist PPT. Thus, the salutary effects of E2 on cardiac function are mediated via ER-b and ER-b-induced up-regulation of Hsp likely plays a significant role in the E2-mediated cardioprotection after T-H. © 2005 Elsevier Ltd. All rights reserved. Keywords: Shock; Estrogen; Hormones; Receptors; Agonists
1. Introduction Severe hemorrhage, which often occurs with trauma, is known to produce many life-threatening sequelae. Patients who survive the initial traumatic insult remain susceptible to sepsis, septic shock, multiple organ failure, and death [1,2]. Cellular dysfunction occurs in many organs, including cardiovascular, liver, gut, and adrenal following hemorrhagic shock, and these alterations persist despite fluid resuscitation for a prolonged period of time [3,4].
* Corresponding author. Tel.: +1 205 975 2195; fax: +1 205 975 9719. E-mail address: [email protected] (I.H. Chaudry). 0022-2828/$ - see front matter © 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.yjmcc.2005.10.001
Sex hormones are known to modulate immune function in animals and in humans under normal and stress conditions [5]. Studies have shown that proestrus female mice show normal immune response, however, male mice have markedly altered immune responses following trauma-hemorrhage (T-H) [6]. Studies have also demonstrated that male sex steroids appear to be responsible for producing the depression in cell and organ functions following T-H [7]. Additional support for this notion comes from studies that showed that castration of male animals 14 days before T-H prevented the depression in myocardial functions that are observed in noncastrated animals under those conditions [7]. Furthermore, administration of flutamide, a testosterone receptor antagonist following T-H, improved the depressed cardiac functions in male animals [8]. These studies suggest that male and
186
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
female sex steroids such as 5a-dihydrotestosterone and 17bestradiol (E2) have an opposite effect on cell and organ function following injury. E2 is the predominant circulating sex hormone in females, and has been shown to have cardioprotective effects following adverse circulatory conditions such as T-H in male animals [9,10]. Moreover, estrogen receptors (ER) are expressed in several organs including the heart in female and male animals [11]. Furthermore, it appears that the biologic effects of E2 on cardiac function are receptor dependent since simultaneous administration of ICI 182,780, a selective ER antagonist, abolished the salutary effects of E2 on cardiac function [9]. Although two subtypes of ERs (ER-a and ER-b) are known to exist, it remains unknown which subtype of receptor is predominantly responsible for producing the salutary effects of E2 on cardiac function following T-H. E2 has been reported to provide protection against vascular injury even in mice in which ER-a has been disrupted [12]. Moreover, the expression of ER-b, but not of ER-a, is stimulated after vascular injury in male rats [13]. Furthermore, studies utilizing ER-a or ER-b knock-out mice suggest that ER-b plays a role in cardioprotection following ischemia–reperfusion [14]. Thus, E2 may inhibit cardiovascular injury by an ER-b dependent mechanism. The heat shock proteins (Hsp) are an important family of endogenous, protective proteins. In this regard, Hsp72 is induced by brief ischemia, and over expression of Hsp72 protects cells and tissues against various forms of stress [15–17]. Conversely, under expression resulting from treatment with antisense oligonucleotides to Hsp72, increase susceptibility to hypoxia and reoxygenation injury [18]. Over expression of other Hsp including Hsp32 and Hsp60, is also reported to be protective against cardiac injury [19,20]. Hsp synthesis is controlled by a family of transcription factors, the heat-shock factors (HSF). Four HSF have been identified, but only HSF-1 has been shown to regulate the expression of Hsp in response to ischemia, hypoxia, heat, stress, or injury [21]. Heat and hypoxia activate HSF-1, which is present in the cytoplasm in an inactive, monomeric form. With stress, trimerization as well as phosphorylation occurs following which HSF-1 migrates to the nucleus. In the nucleus, HSF-1 binds to the heat-shock element, which is present in the promoter of the stress response gene, and then initiates Hsp transcription and synthesis. Hsp90 is known to bind to intracellular steroid receptor, including the ER [22]. Previous studies have suggested that Hsp90 complexes with HSF-1 in cardiomyocytes [22]. Interactions involving Hsp90 and ER as well as the binding between Hsp90 and HSF thus represent an important element in the activation of HSF-1 by E2 [22]. We hypothesized that the salutary effects of E2 on cardiac function following T-H are mediated via ER-b-dependent up-regulation of Hsp. The aim of our study therefore was to determine which E2 receptor is predominantly responsible for the salutary effect on the depressed cardiovascular function following T-H and whether cardiac Hsp are affected by E2 administration under those conditions.
2. Materials and methods 2.1. T-H procedure Our previously described non-heparinized rat model of T-H was used in this study [23]. Briefly, male SD rats (275–325 g, Charles River Labs, Wilmington, MA) were fasted overnight before the experiment but were allowed water ad libitum. The rats were anesthetized by isoflurane (Attane, Minrad Inc., Bethlehem, PA) inhalation prior to the induction of soft tissue trauma via 5-cm midline laparotomy. The abdomen was closed in layers, and catheters were placed in both femoral arteries and the right femoral vein (polyethylene [PE-50] tubing; Becton Dickinson & Co., Sparks, MD). The wounds were bathed with 1% lidocaine (Elkins-Sinn Inc., Cherry Hill, NJ) throughout the surgical procedure to reduce postoperative pain. Rats were then allowed to awaken, and bled to and maintained at a mean arterial pressure (MAP) of 40 mmHg. This level of hypotension was continued until the animals could not maintain MAP of 40 mmHg unless additional fluid in the form of Ringer’s lactate (RL) was administered. This time was defined as maximum bleed-out, and the amount of withdrawn blood was noted. Following this, the rats were maintained at MAP of 40 mmHg until 40% of the maximum bleedout volume was returned in the form of RL. The animals were then resuscitated with four times the volume of the shed blood over 60 min with RL. Thirty minutes before the end of the resuscitation period, the rats received E2 (50 µg/kg, subcutaneously), E2 co-administered with ER antagonist ICI 182,780 (3 mg/kg, intraperitoneally at the beginning of resuscitation), ER-a agonist propyl pyrazole triol (PPT) (5 µg/kg, subcutaneously), ER-b agonist diarylpropiolnitrile (DPN) (5 µg/kg, subcutaneously), DPN administration with ICI 182,780 (3 mg/kg, intraperitoneally at the beginning of resuscitation), or an equal volume of the vehicle (~0.2 ml, 10% DMSO, Sigma). The catheters were then removed, the vessels ligated, and the skin incisions closed with sutures. Sham-operated animals underwent the same groin dissection, which included the ligation of the femoral artery and vein, but neither hemorrhage nor resuscitation was carried out. The animals were then returned to their cages and were allowed food and water ad libitum. All animal experiments were performed according to the guidelines of the Animal Welfare Act and The Guide for Care and Use of Laboratory Animals from the National Institutes of Health. This project was approved by the Institutional Animal Care and Use Committee of the University of Alabama at Birmingham. 2.2. Measurement of cardiac output (CO) and in vivo heart performance At 24 h after the completion of fluid resuscitation or shamoperation, the animals were anesthetized with isoflurane and catheterized via the right jugular vein. Under continued general anesthesia with pentobarbital sodium (25–30 mg/kg BW), CO and stroke volume were measured in each animal. A 2.4-
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
187
science, Palo Alto, CA) according to the manufacturer’s instruction. The total RNA content in samples was determined by a spectrophotometer (BIO-RAD, Smart TM 300) and the isolated RNA was then stored at –80 °C until analyzed.
French fiberoptic catheter was placed into the right carotid artery and connected to an in vivo hemoreflectometer (Hospex Fiberoptics, Chestnut Hill, MA), as described previously in [23]. Indocyanine green (ICG; Cardio Green, Becton Dickinson) solution was injected via the catheter in the jugular vein (1 mg/ml aqueous solution as a 50-µl bolus). The concentration of ICG was recorded by using a computer-assisted data-acquisition program (Asystant, Asyst Software, Rochester, NY). Following the measurement of CO, the right carotid artery was recannulated with PE-50 tubing and connected to a blood pressure analyzer (DigiMed, Louisville, KY). After the MBP was recorded, the PE-50 tubing was advanced into the left ventricle and connected to a heart performance analyzer (DigiMed) to monitor and record maximal rate of pressure increase (+dP/dtmax) and decrease (–dP/dtmax), respectively.
Heart Hsp32, 60, 70, and 90 gene expressions were determined by real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) as described previously in [23]. Amplification of cDNA was performed on an ABI PRISM 7900HT Sequence Detection System. The primer sequences are shown in Table 1. 18s were used for endogenous control. All the samples were amplified for one cycle at 50 °C for 2 min and at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and at 60 °C for 1 min.
2.3. Isolation of heart RNA
2.5. Western blot assay
Heart RNA was isolated immediately after harvesting the heart using a Nucleospin RNA purification kit (BA Bio-
The hearts were homogenized in a buffer containing 10 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM
2.4. mRNA expression assay
Fig. 1. Hsp32 (A), Hsp60 (B), Hsp70 (C), and Hsp90 (D) protein expression in heart from sham animals with vehicle (Sham), T-H with vehicle (T-H + Veh), T-H with 17b-estradiol (T-H + E2), and T-H with 17b-estradiol and ICI 182,780 (T-H + E2 + ICI). For equal protein loading, membranes were reprobed for b-actin using mouse monoclonal antibody. The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment are normalized as 1.0. Data are shown as mean ± S.E.M. from five rats in each group. *P < 0.05 as compared with Sham; †P < 0.05 compared to T-H + Veh; ‡P < 0.05 compared to T-H + E2.
188
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
Table 1 Primers for quantitative real-time PCR analyses Primers (5′–3′) Gene Hsp32 Hsp60 Hsp70 Hsp90
Sense GGTGTCCAGGGAAGGCTTTAAG ACCTGTGACAACCCCTGAAG GAGTTCAAGCGCAAACACAA AAGGCTGAGGCAGACAAAAA
Antisense GTGCAGCTCCTCAGGGAAGTAG TCTTCCTGTTGTCCCCAAAC CTCAGACTTGTCGCCAATGA CACCCAACCCTGCTATCTGT
EGTA, 50 mM NaF, 0.5 mM phenylmethylsulfonyl fluoride, 1 mM sodium vanadate, 1% Triton X-100, 0.5% Nonidet P-40, and 1 µg/ml of aprotinin. The homogenates were centrifuged at 12,000 × g for 15 min at 4 °C and protein aliquots were mixed with 4 × sample buffer and subjected to electrophoresis and then transferred to nitrocellulose membranes. The membranes were incubated with anti-Hsp32, 60, 70, and 90 overnight at 4 °C. The membranes were later incubated with horseradish peroxidase-conjugated goat anti-rabbit antibody or goat anti-mouse antibody for 1.5 h at room temperature. The blots were immersed for 5 min in Super Signal West Pico detection reagent and then exposed to film. Signals were quantified using cheminogen 5500 imaging software (Alpha Innotech Corp., CA). 2.6. Electrophoretic mobility shift assay (EMSA) HSF-1 DNA binding activity was determined in nuclear extracts of heart. A self-complementary consensus HSE oligonucleotide probe (5′-CTAGAAGCTTCTAGAAGCTTCTAG-3′) (Sigma) was labeled with c-32P-ATP (≥6000 Ci/ mmol, Amersham, Piscataway, NJ). Nuclear extracts, ≥ 20,000 cpm of radiolabeled double-stranded target oligonucleotide, poly (Di–Dc) and incubation buffer (Promega, Madison, WI) were mixed and incubated. After 30 min incubation at room temperature, each of the samples was loaded onto 6% DNA retardation gel (Novex, Carlsbad, CA) and run at 10–15 mA for 90 min. Following electrophoresis, band intensities were quantified using autoradiography. For cold competition experiments, the samples were incubated with a 100-fold molar excess of unlabeled HSE for 15 min before the addition of labeled HSE. Signal densities were evaluated by ChemiImager 5500 software (Alpha Inotech, San Leandro, CA). 2.7. Statistical analysis Results are presented as mean ± S.E.M. (standard error of mean). The data were analyzed using one-way analysis of variance and Tukey’s test, and differences were considered significant at a P value of ≤ 0.05. 3. Results 3.1. Effect of 17b-estradiol on cardiac Hsp 32, 60, 70, and 90 protein expressions There was a significant increase in Hsp32 following T-H, and a significant decrease in Hsp60 and 90 following T-H
Fig. 2. Hsp32 (A), Hsp60 (B), Hsp70 (C), and Hsp90 (D) mRNA gene expression in heart from sham operation with vehicle (Sham), T-H with vehicle (T-H + Veh), T-H with PPT (T-H + PPT), and T-H with DPN (T-H + DPN). Data are shown as mean ± S.E.M. of five rats in each group. *P < 0.05 compared to Sham + Veh; †P < 0.05 compared to T-H + Veh. RQ, relative quantification.
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
189
Fig. 3. Hsp32 (A), Hsp60 (B), Hsp70 (C), and Hsp90 (D) protein expression in heart from sham operation with vehicle (Sham), T-H with vehicle (T-H + Veh), T-H with PPT (T-H + PPT), and T-H with DPN (T-H + DPN). For equal protein loading, membranes were reprobed for b-actin using mouse monoclonal antibody. The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment are normalized as 1.0. Data are shown as mean ± S.E.M. of five rats in each group. *P < 0.05 compared with Sham; †P < 0.05 compared to T-H + Veh.
(Fig. 1). E2 treatment prevented T-H-mediated decrease in Hsp60 and 90 protein expressions in the heart. In addition, Hsp32 and 70 protein expressions were further increased in E2 treated T-H rats. Administration of ER antagonist ICI 182,780 along with E2 prevented the E2-induced upregulation of cardiac Hsp following T-H. 3.2. Effect of ER-␣ agonist PPT and ER-b agonist DPN in cardiac Hsp32, 60, 70, and 90 expression Hsp60 mRNA gene expression decreased significantly in vehicle treated rats following T-H (Fig. 2B). DPN administration following T-H restored Hsp60 (Fig. 2B), and significantly up-regulated Hsp32 and 70 mRNA gene expression in the heart (Fig. 2A, C). There was no significant difference in Hsp90 mRNA gene expression in the heart between sham or T-H animals treated with vehicle, or DPN (Fig. 2D). Further-
more, there was no significant difference in above parameters in T-H rats treated with PPT. In addition to mRNA gene expression, we examined the effects of PPT and DPN on the protein levels of cardiac Hsp following T-H. Hsp60 and 90 protein expression decreased significantly in vehicle treated rats following T-H (Fig. 3B, D). DPN treatment following T-H restored Hsp60 and 90, and significantly increased Hsp32 and 70 protein expression in the heart (Fig. 3A, C). In contrast, no significant change in above parameters was observed in T-H rats treated with PPT. 3.3. DNA binding activity of HSF-1 in heart Since HSF-1 up-regulates Hsp expression in response to stresses, we examined whether ER-a or ER-b agonist affects HSF-1 DNA binding activity following T-H. As shown in Fig. 4, there was no significant difference in cardiac HSF-
190
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
mals receiving PPT or DPN compared with vehicle-treated sham animals (data not shown). As shown in Fig. 6C, DPN significantly improved MBP following T-H compared to vehicle, however, it remained lower than shams. Furthermore, DPN administration increased CO and SV following T-H and the values were similar to those observed in shamoperated animals (Figs. 6A, B and Fig. 7). In addition, DPN prevented the decrease in +dP/dtmax and –dP/dtmax; however, –dP/dtmax remained lower than shams. In contrast, no significant change in above parameters was observed in T-H rats treated with PPT. In order to evaluate whether the cardioprotective effect of DPN was via ER, a group of T-H rats were treated with DPN and ICI 182,780. Administration of ICI 182,780 abolished the DPN-induced attenuation of cardiac function following T-H.
4. Discussion
Fig. 4. DNA binding activity of HSF-1. Lane 1: negative (probe only) (N), lane 2: sham with vehicle (Sham), lane 3: T-H with vehicle (T-H + Veh), lane 4: T-H with PPT (T-H + PPT), lane 5: T-H with DPN (T-H + DPN), lane 6: cold competitive (C). The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment are normalized as 1.0. Data are shown as mean ± S.E.M. of five animals in each group. *P < 0.05 compared with Sham; † P < 0.05 compared to T-H + Veh.
1 DNA binding activity in vehicle treated T-H and PPT treated T-H animals compared to shams. However, administration of DPN following T-H significantly increased HSF-1 DNA binding activity. The specificity of HSF-1 binding was further confirmed by performing competition assays with a cold probe and the results as shown in Fig. 4 (lane 4) clearly indicate that the binding is completely blocked in samples which were incubated with a 100-fold molar excess of unlabeled HSE for 15 min prior to addition of labeled HSE. 3.4. Effect of ICI 182,780 on DPN-induced up-regulation of cardiac Hsp Since DPN up-regulated cardiac Hsp following T-H (Figs. 2–3), we examined if administration of ICI 182,780 had any effect on DPN-induced up-regulation of cardiac Hsp. Administration of DPM with ICI 82,780 prevented the DPNinduced up-regulation of cardiac Hsp following T-H (Fig. 5A– D). 3.5. Effect of ER-␣ agonist PPT and ER-b agonist DPN in hemodynamic parameters A significant decrease in CO, SV, ±dP/dtmax and MBP was evident following T-H (Figs. 6 and 7). There was no significant difference in CO, SV, ±dP/dtmax and MBP in sham ani-
Previous studies have shown that cardiac function is significantly depressed in male animals following T-H [8]. In contrast, female rats in the proestrus state, a state in which plasma levels of estradiol were found to be the highest, showed no depression in CO at 24 h following T-H [24]. However, ovariectomized females displayed depression in organ functions after T-H, similar to those observed in males. Thus, it appears that female sex steroids have protective effects on cardiac function following T-H. There are two ERs, ER-a and ER-b, which are differentially expressed in different tissues [25]. However, studies have shown that both ER-a and ER-b are expressed in cardiomyocytes [11,23]. In view of that, we attempted to determine which of the ER plays a predominant role in cardioprotection following T-H. Our results indicate that left ventricular performance (±dP/dtmax) was significantly depressed following T-H. Male rats treated with ER-b agonist DPN displayed improvement in ± dP/dtmax at 24 h following T-H. Moreover, the improved cardiac contractility was evident by the restored cardiac index in DPN-treated rats. Furthermore, our findings suggested that the biologic effects of DPN on cardiac function are receptor dependent since the administration of ICI 182,780, a selective ER antagonist, along with DPN abolished the DPN-induced cardioprotection in T-H rats. In contrast to DPN, treatment with ER-a agonist PPT did not confer cardioprotection following T-H. The present study is the first to examine the effects of selective ER agonist on cardiac functions following T-H and to show cardioprotective effects of DPN in vivo. DPN acts as an agonist on both ER subtypes but has a 70-fold higher relative binding affinity and 170-fold higher relative estrogenic potency in transcription assays with ER-b than ER-a [26]. PPT on the other hand is a selective agonist for the ER-a subtype and is the best agonist for ER-a out of a series of tetrasubstituted pyrazole analogs [27]. PPT binds to ER-a with high affinity, displaying 410-fold binding selectivity over ER-b [27]. ER-a and ER-b can form homo- and heterodimers
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
191
Fig. 5. Hsp32 (A), Hsp60 (B), Hsp70 (C), and Hsp90 (D) protein expression in heart from sham operation with vehicle (Sham), T-H with vehicle (T-H + Veh), T-H with DPN (T-H + DPN), and T-H with DPN and ICI 182,780 (T-H + DPN + ICI). For equal protein loading, membranes were reprobed for b-actin using mouse monoclonal antibody. The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment is normalized as 1.0. Data are shown as mean ± S.E.M. of five rats in each group. *P < 0.05 compared with Sham; †P < 0.05 compared to T-H + Veh.
and there are data suggesting that different compositions of the dimer differentially regulate gene expression [28]. These observations have led to the concept that selective ER modulators (SERMs) selectively activate E2-dependent protection in an organ such as heart, without stimulating the breast or ovarian proliferation. Our results provide evidence that following T-H, E2-induced cardioprotection is mediated via ER-b activation. Furthermore, the findings that ER antagonist, ICI 182,780 abolished DPN-induced cardioprotection following T-H, suggest that the salutary effects of DPN are mediated via ER. These findings corroborate previous studies by Gabel et al. [14], which showed that ER-b knockout mice display increased cardiac injury following ischemia– reperfusion injury compared to the wild-type mice. It can be argued that we should have administered ICI 182,780 alone in these studies to determine if that per se has any adverse effects. In this regard, our previous studies have shown that administration of ICI 182,780 alone did not produce any del-
eterious effects but its administration with estrogen blocked the salutary effects of estrogen on cardiac function following T-H [9,29]. Since ICI 182,780 administration in itself did not influence cardiac function in trauma-hemorrhaged animals [29], administration of ICI 182,780 alone was not carried out in this study. While the precise mechanism by which DPN mediates its salutary effects remains unknown, our findings suggest that DPN up-regulates Hsp. A couple of studies have examined the effects of E2 and gender on cardiac Hsp expression [22,30,31]. Those studies have shown that female rat hearts have twice as much Hsp72 as male hearts [30]. Ovariectomy reduced the level of Hsp72 in female hearts, and this could be prevented by E2 replacement therapy [30]. Additional studies showed that 10 h of E2 treatment doubled the level of Hsp72 in adult cardiomyocytes from male rats [22]. Consistent with these findings, we observed that over-expression of heart Hsp32 following T-H with E2 administration [20].
192
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
Fig. 7. Maximal rate of left ventricular pressure increase (+dP/dtmax, A) and maximal rate of left ventricular pressure decrease (–dP/dtmax, B) at 24 h after sham operation (Sham) or T-H and resuscitation (T-H). Animals were treated with either vehicle (Veh), propyl pyrazole triol (PPT), diarylpropiolnitrile (DPN) or co-administration of DPN and ICI 182,780 (ICI). Data are presented as mean ± S.E.M. of six animals in each group. *P < 0.05 compared to Sham + Veh; †P < 0.05 compared to T-H + Veh; ‡P < 0.05 compared to T-H + DPN.
Fig. 6. Cardiac output (CO, A), stroke volume (SV, B), and mean blood pressure (MBP, C) in rats at 24 h after sham operation (Sham) or T-H and resuscitation (T-H). Animals were treated with either vehicle (Veh), propyl pyrazole triol (PPT), diarylpropiolnitrile (DPN) or co-administration of DPN and ICI 182,780 (ICI). Data are presented as mean ± S.E.M. of six rats in each group. *P < 0.05 compared to Sham + Veh; †P < 0.05 compared to T-H + Veh; ‡P < 0.05 compared to T-H + DPN. BW, body weight.
Up-regulation of Hsp synthesis is considered to be a powerful physiological, endogenous route for protecting crucial cellular homeostatic mechanisms against deleterious external factors. Physiological stresses ranging from myocardial ischemia to genetic mutations produce disease state in which protein damage and misfolded protein structures are a common denominator [32]. Multiple endogenous pathways are involved in restoring cellular homeostasis, but one wellcharacterized mechanism that involves protein folding is the heat shock family of stress proteins, i.e. Hsp [33–36]. There are several potential mechanisms by which Hsp produce cardioprotective effects. Hsp are generally thought to be useful in correcting the folding of many proteins and restore their functional structures [33]. Moreover, Hsp targets denatured proteins to the lysosome for degradation as molecular chaperones [33]. These functions of Hsp as molecular chaperones play important roles in maintaining the normal cell functions and promoting cell survival.
Hsp are also known to regulate the process of programmed cell death/apoptosis. One major pathway of apoptosis involves the release of cytochrome C from mitochondria. In turn, cytochrome C binds to a protein known as Apaf-1 and triggers its oligomerization. This complex than attracts the inactive unprocessed pro-form of the proteolytic enzyme caspase9 that is then cleaved to its active form thereby initiating apoptosis. Hsp have been shown to inhibit this process at various points. In this regard, Hsp90 has been shown to bind to Apaf1 and prevent it binding to cytochrome C [37]. Furthermore, Hsp70 prevents oilgomerized Apaf-1 from recruiting procaspase-9 [38]. Studies have also suggested an anti-apoptotic role of Hsp60 [39–41]. Over-expression of Hsp60 inhibits myocardial apoptosis in response to ischemic injury [39]. Furthermore, a recent study has shown that reducing Hsp60 expression with antisense oligonucleotides is associated with an increase in Bax and a reduction in Bcl-2, which induces apoptosis of cardiomyocytes [40]. These findings raise the possibility that Hsp60 may regulate apoptosis through modulation of Bcl-2 family [40]. In addition, Hsp90 has been shown to bind to endothelial nitric oxidase synthase (eNOS) and stimulate its activity [42]. Thus, the Hsp protect cells via multiple mechanisms that target key cellular components and regulatory process. Studies have shown that the induction of the Hsp by stressful stimuli is mediated by HSF-1 [43]. As a classical stressresponsive factor, HSF-1 binds to heat shock element, which
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
is present upstream of many Hsp genes, and activates transcription of Hsp genes under stress conditions. HSF-1 has also been reported to be expressed in hearts [22], and protect cardiomyocytes from ischemia/reperfusion injury in transgenic mouse model [21]. Intermolecular interaction between HSF-1 and a multichaperone complex including Hsp90 provides mechanism for repression of HSF-1 activity [22]. In addition, Hsp90 is also known to bind to intracellular steroid receptors, including ER [22]. Thus, ligand-dependent interactions have been proposed to modify the equilibrium between Hsp90 and its molecular partners, HSF-1 and ER [22]. Our present study indicates that ER-b agonist DPN increased HSF1 DNA binding activity, thus suggesting that DPN may up-regulate cardiac Hsp through increase in cardiac HSF1 DNA binding activity. In conclusion, our results suggest that similar to E2, DPN that is ER-b agonist also provides cardioprotection following T-H. Furthermore, our results indicate that up-regulation of Hsp likely plays a significant role in the DPN-mediated cardioprotection following T-H.
Acknowledgments This study was supported by National Institutes of Health Grant R37 GM39519.
References [1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
Baue AE, Durham R, Faist E. Systemic inflammatory response syndrome (SIRS), multiple organ dysfunction syndrome (MODS), multiple organ failure (MOF): are we winning the battle? Shock 1998;10: 79–89. Wu LL, Tang C, Liu MS. Altered phosphorylation and calcium sensitivity of cardiac myofibrillar proteins during sepsis. Am J Physiol Regul Integr Comp Physiol 2001;281:R408–R416. Wang P, Ba ZF, Jarrar D, Cioffi WG, Bland KI, Chaudry IH. Mechanism of adrenal insufficiency following trauma and severe hemorrhage: role of hepatic 11 beta-hydroxysteroid dehydrogenase. Arch Surg 1999;134:394–401. Wang W, Wang P, Chaudry IH. Intestinal alkaline phosphatase: role in the depressed gut lipid transport after trauma-hemorrhagic shock. Shock 1997;8:40–4. Homo-Delarche F, Fitzpatrick F, Christeff N, Nunez EA, Bach JF, Dardenne M. Sex steroids, glucocorticoids, stress and autoimmunity. J Steroid Biochem Mol Biol 1991;40:619–37. Wichmann MW, Zellweger R, DeMaso CM, Ayala A, Chaudry IH. Enhanced immune responses in females, as opposed to decreased responses in males following haemorrhagic shock and resuscitation. Cytokine 1996;8:853–63. Remmers DE, Cioffi WG, Bland KI, Wang P, Angele MK, Chaudry IH. Testosterone: the crucial hormone responsible for depressing myocardial function in males after trauma-hemorrhage. Ann Surg 1998;227:790–9. Remmers DE, Wang P, Cioffi WG, Bland KI, Chaudry IH. Testosterone receptor blockade after trauma-hemorrhage improves cardiac and hepatic functions in males. Am J Physiol 1997;273:H2919–H2925. Jarrar D, Wang P, Knöferl MW, Kuebler JF, Cioffi WG, Bland KI, et al. Insight into the mechanism by which estradiol improves organ functions after trauma-hemorrhage. Surgery 2000;128:246–52.
193
[10] Kher A, Wang M, Tsai BM, Pitcher JM, Greenbaum ES, Nagy RD, et al. Sex differences in the myocardial inflammatory response to acute injury. Shock 2005;23:1–10. [11] Mendelsohn ME, Karas RH. Molecular and cellular basis of cardiovascular gender differences. Scinece 2005;308:1583–7. [12] Iafrati MD, Karas RH, Aronovitz M, Kim S, Sullivan Jr. TR, Lubahn DB, et al. Estrogen inhibits the vascular injury response in estrogen receptor (alpha)-deficient mice. Nat Med 1997;3:545–8. [13] Lindner V, Kim SK, Karas RH, Kuiper GGJM, Gustafsson J-A, Mendelsohn ME. Increased expression of estrogen receptor (beta) mRNA in male blood vessels after vascular injury. Circ Res 1998;83: 224–9. [14] Gabel SA, Walker VR, London RE, Steenbergen C, Korach KS, Murphy E. Estrogen receptor beta mediates gender differences in ischemia/reperfusion injury. J Mol Cell Cardiol 2005;38:289–97. [15] Hutter JJ, Mestril R, Tam EKW, Sievers RE, Dillmann WH, Wolfe CL. Over expression of heat shock protein 72 in transgenic mice decreases infarct size in vivo. Circulation 1996;94:1408–11. [16] Wang JL, Ke DS, Lin MT. Heat shock pretreatment may protect against heatstroke-induced circulatory shock and cerebral ischemia by reducing oxidative stress and energy depletion. Shock 2005;23: 161–7. [17] Chen HW, Hsu C, Lu TS, Wang SJ,Yang RC. Heat shock pretreatment prevents cardiac mitochondrial dysfunction during sepsis. Shock 2003;20:274–9. [18] Nakano M, Mann DL, Knowlton AA. Blocking the endogenous increase in HSP72 increases susceptibility to hypoxia and reoxygenation in isolated adult feline cardiocytes. Circulation 1997;95:1523– 31. [19] Lau S, Patnaik N, Sayen R, Mestril R. Simultaneous overexpression of two stress proteins in rat cardiomyocytes and myogenic cells confers protection against ischemia-induced injury. Circulation 1997;96:2287–94. [20] Szalay L, Shimizu T, Schwacha MG, Choudhry MA, Rue III LW, Bland KI, et al. Mechanism of the salutary effects of estradiol on organ function following trauma-hemorrhage: upregulation of hemeoxygenase. Am J Physiol 2005;289:H92–H98. [21] Nishizawa J, Nakai A, Komeda M, Ban T, Nagata K. Increased preload directly induces the activation of heat shock transcription factor 1 in the left ventricular overloaded heart. Cardiovasc Res 2002;55:341–8. [22] Knowlton AA, Sun L. Heat-shock factor-1, steroid hormones, and regulation of heat-shock protein expression in the heart. Am J Physiol 2001;280:H455–H464. [23] Yu HP, Yang S, Choudhry MA, Hsieh YC, Bland KI, Chaudry IH. Mechanism responsible for the salutary effects of flutamide on cardiac performance following trauma-hemorrhagic shock: upregulation of cardiomyocyte estrogen receptors. Surgery 2005;138:85–92. [24] Jarrar D, Wang P, Cioffi WG, Bland KI, Chaudry IH. The female reproductive cycle is an important variable in the response to traumahemorrhage. Am J Physiol 2000;279:H1015–H1021. [25] Kuiper GGJM, Carlsson B, Grandien J, Enmark E, Haggblad J, Nilsson S, et al. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptor a and b. Endocrinology 1997;138:863–70. [26] Meyers MJ, Sun J, Carlson KE, Marriner GA, Katzenellenbogen BS, Katzenellenbogen JA. Estrogen receptor-b potency-selective ligands: structure–activity relationship studies of diarylpropionitriles and their acetylene and polar analogues. J Med Chem 2001;44:4230–51. [27] Stauffer SR, Coletta CJ, Tedesco R, Nishiguchi G, Carlson K, Sun J, et al. Pyrazole ligands: structure-affinity/activity relationships and estrogen receptor-a-selective agonists. J Med Chem 2000;43:4934– 47. [28] Hall J, Couse J, Korach K. The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 2001;276:36869–72.
194
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
[29] Hsieh YC, Yang S, Choudhry MA, Yu HP, Bland KI, Schwacha MG, et al. Flutamide restores cardiac functions following traumahemorrhage via an estrogen-dependent pathway through upregulation of PGC-1. Am J Physiol 2005 (in press). [30] Voss MR, Stallone JN, Li M, Cornelussen RNM, Knuefermann P, Knowlton AA. Gender differences in the expression of heat shock proteins: the effect of estrogen. Am J Physiol 2003;285:H687–H692. [31] Hamilton KL, Gupta S, Knowlton AA. Estrogen and regulation of heat shock protein expression in female cardiomyocytes: cross-talk with NF kappa B signaling. J Mol Cell Cardiol 2004;36:577–84. [32] Kumarapeli AR, Wang X. Genetic modification of the heart: chaperones and the cytoskeleton. J Mol Cell Cardiol 2004;37:1097–109. [33] Benjamin IJ, McMillan DR. Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res 1998;83: 117–32. [34] Menezes JM, Hierholzer C, Watkins SC, Billiar TR, Peitzman AB, Harbrecht BG. The modulation of hepatic injury and heat shock expression by inhibition of inducible nitric oxide synthase after hemorrhagic shock. Shock 2002;17:13–8. [35] Meng X, Harken AH. The interaction between Hsp70 and TNF-alpha expression: a novel mechanism for protection of the myocardium against post-injury depression. Shock 2002;17:345–53. [36] Menezes JM, Hierholzer C, Watkins SC, Billiar TR, Peitzman AB, Harbrecht BG. The modulation of hepatic injury and heat shock expression by inhibition of inducible nitric oxide synthase after hemorrhagic shock. Shock 2002;17:13–8.
[37] Pandey P, Saleh A, Nakazawa A, Kumar S, Srinivasula SM, Kumar V, et al. Negative regulation of cytochrome c-mediated oligomerization of Apaf-1 and activation of procaspase-9 by heat shock protein 90. EMBO J 2000;19:4310–22. [38] Beere HM, Wolf BB, Cain K, Mosser DD, Mahboubi A, Kuwana T, et al. Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat Cell Biol 2000; 2:469–75. [39] Lin KM, Lin B, Lian IY, Mestril R, Scheffler IE, Dillmann WH. Combined and individual mitochondrial HSP60 and HSP10 expression in cardiac myocytes protects mitochondrial function and prevents apoptotic cell deaths induced by simulated ischemia-reoxygenation. Circulation 2001;103:1787–92. [40] Kirchhoff SR, Gupta S, Knowlton AA. Cytosolic heat shock protein 60, apoptosis, and myocardial injury. Circulation 2002;105:2899– 904. [41] Shan YX, Liu TJ, Su HF, Samsamshariat A, Mestril R, Wang PH. Hsp10 and Hsp60 modulate Bcl-2 family and mitochondria apoptosis signaling induced by doxorubicin in cardiac muscle cells. J Mol Cell Cardiol 2003;35:1135–43. [42] Shi Y, Hutchins W, Ogawa H, Chang CC, Pritchard Jr. KA, Zhang C, et al. Increased resistance to myocardial ischemia in the Brown Norway vs. Dahl S rat: role of nitric oxide synthase and Hsp90. J Mol Cell Cardiol 2005;38:625–35. [43] Melling CW, Thorp DB, Noble EG. Regulation of myocardial heat shock protein 70 gene expression following exercise. J Mol Cell Cardiol 2004;37:847–55.
Original article
Mechanism of cardioprotection following trauma-hemorrhagic shock by a selective estrogen receptor-b agonist: up-regulation of cardiac heat shock factor-1 and heat shock proteins Huang-Ping Yu a,b, Tomoharu Shimizu a, Mashkoor A. Choudhry a, Ya-Ching Hsieh a, Takao Suzuki a, Kirby I. Bland a, Irshad H. Chaudry a,* a
Center for Surgical Research and Department of Surgery, University of Alabama at Birmingham, 1670 University Boulevard, Volker Hall, Room G094, Birmingham, AL 35294-0019, USA b Graduate Institute of Clinical Medical Sciences, Chang Gung University, Taoyuan, Taiwan, ROC Received 6 September 2005; received in revised form 30 September 2005; accepted 3 October 2005 Available online 08 November 2005
Abstract Although 17b-estradiol (E2) administration following trauma-hemorrhage (T-H) improves cardiac function in male rodents, it is not known whether the salutary effects of E2 are mediated via estrogen receptor (ER)-a or ER-b, and whether cardiac heat shock proteins (Hsp) are affected by E2 administration. Male Sprague–Dawley rats underwent T-H (mean BP 40 mmHg for 90 min, then resuscitation). ER-a agonist propyl pyrazole triol (PPT) (5 µg/kg), ER-b agonist diarylpropiolnitrile (DPN) (5 µg/kg), or vehicle (10% DMSO) was injected subcutaneously during resuscitation. At 24 h after T-H or sham operation, cardiac output (CO), stroke volume (SV), mean blood pressure, and ± dP/dtmax were measured (n = 6 rats per group). Cardiac Hsp32, 60, 70, and 90 mRNA/protein expressions and heat shock factor (HSF)-1 DNA binding activity were determined. One-way ANOVA and Tukey’s test were used for statistical analysis. CO, SV and ± dP/dtmax decreased significantly after T-H, however, administration of ER-b agonist DPN after T-H restored the above parameters. Moreover, DPN treatment prevented T-H-mediated decrease in Hsp60 mRNA/protein and Hsp90 protein expressions in the heart. Hsp32 and Hsp70 mRNA/protein expression and HSF-1 DNA binding activity in the hearts were increased even above the shams in DPN treated T-H rats. In contrast, no significant change in the above parameters was observed in T-H rats treated with ER-a agonist PPT. Thus, the salutary effects of E2 on cardiac function are mediated via ER-b and ER-b-induced up-regulation of Hsp likely plays a significant role in the E2-mediated cardioprotection after T-H. © 2005 Elsevier Ltd. All rights reserved. Keywords: Shock; Estrogen; Hormones; Receptors; Agonists
1. Introduction Severe hemorrhage, which often occurs with trauma, is known to produce many life-threatening sequelae. Patients who survive the initial traumatic insult remain susceptible to sepsis, septic shock, multiple organ failure, and death [1,2]. Cellular dysfunction occurs in many organs, including cardiovascular, liver, gut, and adrenal following hemorrhagic shock, and these alterations persist despite fluid resuscitation for a prolonged period of time [3,4].
* Corresponding author. Tel.: +1 205 975 2195; fax: +1 205 975 9719. E-mail address: [email protected] (I.H. Chaudry). 0022-2828/$ - see front matter © 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.yjmcc.2005.10.001
Sex hormones are known to modulate immune function in animals and in humans under normal and stress conditions [5]. Studies have shown that proestrus female mice show normal immune response, however, male mice have markedly altered immune responses following trauma-hemorrhage (T-H) [6]. Studies have also demonstrated that male sex steroids appear to be responsible for producing the depression in cell and organ functions following T-H [7]. Additional support for this notion comes from studies that showed that castration of male animals 14 days before T-H prevented the depression in myocardial functions that are observed in noncastrated animals under those conditions [7]. Furthermore, administration of flutamide, a testosterone receptor antagonist following T-H, improved the depressed cardiac functions in male animals [8]. These studies suggest that male and
186
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
female sex steroids such as 5a-dihydrotestosterone and 17bestradiol (E2) have an opposite effect on cell and organ function following injury. E2 is the predominant circulating sex hormone in females, and has been shown to have cardioprotective effects following adverse circulatory conditions such as T-H in male animals [9,10]. Moreover, estrogen receptors (ER) are expressed in several organs including the heart in female and male animals [11]. Furthermore, it appears that the biologic effects of E2 on cardiac function are receptor dependent since simultaneous administration of ICI 182,780, a selective ER antagonist, abolished the salutary effects of E2 on cardiac function [9]. Although two subtypes of ERs (ER-a and ER-b) are known to exist, it remains unknown which subtype of receptor is predominantly responsible for producing the salutary effects of E2 on cardiac function following T-H. E2 has been reported to provide protection against vascular injury even in mice in which ER-a has been disrupted [12]. Moreover, the expression of ER-b, but not of ER-a, is stimulated after vascular injury in male rats [13]. Furthermore, studies utilizing ER-a or ER-b knock-out mice suggest that ER-b plays a role in cardioprotection following ischemia–reperfusion [14]. Thus, E2 may inhibit cardiovascular injury by an ER-b dependent mechanism. The heat shock proteins (Hsp) are an important family of endogenous, protective proteins. In this regard, Hsp72 is induced by brief ischemia, and over expression of Hsp72 protects cells and tissues against various forms of stress [15–17]. Conversely, under expression resulting from treatment with antisense oligonucleotides to Hsp72, increase susceptibility to hypoxia and reoxygenation injury [18]. Over expression of other Hsp including Hsp32 and Hsp60, is also reported to be protective against cardiac injury [19,20]. Hsp synthesis is controlled by a family of transcription factors, the heat-shock factors (HSF). Four HSF have been identified, but only HSF-1 has been shown to regulate the expression of Hsp in response to ischemia, hypoxia, heat, stress, or injury [21]. Heat and hypoxia activate HSF-1, which is present in the cytoplasm in an inactive, monomeric form. With stress, trimerization as well as phosphorylation occurs following which HSF-1 migrates to the nucleus. In the nucleus, HSF-1 binds to the heat-shock element, which is present in the promoter of the stress response gene, and then initiates Hsp transcription and synthesis. Hsp90 is known to bind to intracellular steroid receptor, including the ER [22]. Previous studies have suggested that Hsp90 complexes with HSF-1 in cardiomyocytes [22]. Interactions involving Hsp90 and ER as well as the binding between Hsp90 and HSF thus represent an important element in the activation of HSF-1 by E2 [22]. We hypothesized that the salutary effects of E2 on cardiac function following T-H are mediated via ER-b-dependent up-regulation of Hsp. The aim of our study therefore was to determine which E2 receptor is predominantly responsible for the salutary effect on the depressed cardiovascular function following T-H and whether cardiac Hsp are affected by E2 administration under those conditions.
2. Materials and methods 2.1. T-H procedure Our previously described non-heparinized rat model of T-H was used in this study [23]. Briefly, male SD rats (275–325 g, Charles River Labs, Wilmington, MA) were fasted overnight before the experiment but were allowed water ad libitum. The rats were anesthetized by isoflurane (Attane, Minrad Inc., Bethlehem, PA) inhalation prior to the induction of soft tissue trauma via 5-cm midline laparotomy. The abdomen was closed in layers, and catheters were placed in both femoral arteries and the right femoral vein (polyethylene [PE-50] tubing; Becton Dickinson & Co., Sparks, MD). The wounds were bathed with 1% lidocaine (Elkins-Sinn Inc., Cherry Hill, NJ) throughout the surgical procedure to reduce postoperative pain. Rats were then allowed to awaken, and bled to and maintained at a mean arterial pressure (MAP) of 40 mmHg. This level of hypotension was continued until the animals could not maintain MAP of 40 mmHg unless additional fluid in the form of Ringer’s lactate (RL) was administered. This time was defined as maximum bleed-out, and the amount of withdrawn blood was noted. Following this, the rats were maintained at MAP of 40 mmHg until 40% of the maximum bleedout volume was returned in the form of RL. The animals were then resuscitated with four times the volume of the shed blood over 60 min with RL. Thirty minutes before the end of the resuscitation period, the rats received E2 (50 µg/kg, subcutaneously), E2 co-administered with ER antagonist ICI 182,780 (3 mg/kg, intraperitoneally at the beginning of resuscitation), ER-a agonist propyl pyrazole triol (PPT) (5 µg/kg, subcutaneously), ER-b agonist diarylpropiolnitrile (DPN) (5 µg/kg, subcutaneously), DPN administration with ICI 182,780 (3 mg/kg, intraperitoneally at the beginning of resuscitation), or an equal volume of the vehicle (~0.2 ml, 10% DMSO, Sigma). The catheters were then removed, the vessels ligated, and the skin incisions closed with sutures. Sham-operated animals underwent the same groin dissection, which included the ligation of the femoral artery and vein, but neither hemorrhage nor resuscitation was carried out. The animals were then returned to their cages and were allowed food and water ad libitum. All animal experiments were performed according to the guidelines of the Animal Welfare Act and The Guide for Care and Use of Laboratory Animals from the National Institutes of Health. This project was approved by the Institutional Animal Care and Use Committee of the University of Alabama at Birmingham. 2.2. Measurement of cardiac output (CO) and in vivo heart performance At 24 h after the completion of fluid resuscitation or shamoperation, the animals were anesthetized with isoflurane and catheterized via the right jugular vein. Under continued general anesthesia with pentobarbital sodium (25–30 mg/kg BW), CO and stroke volume were measured in each animal. A 2.4-
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
187
science, Palo Alto, CA) according to the manufacturer’s instruction. The total RNA content in samples was determined by a spectrophotometer (BIO-RAD, Smart TM 300) and the isolated RNA was then stored at –80 °C until analyzed.
French fiberoptic catheter was placed into the right carotid artery and connected to an in vivo hemoreflectometer (Hospex Fiberoptics, Chestnut Hill, MA), as described previously in [23]. Indocyanine green (ICG; Cardio Green, Becton Dickinson) solution was injected via the catheter in the jugular vein (1 mg/ml aqueous solution as a 50-µl bolus). The concentration of ICG was recorded by using a computer-assisted data-acquisition program (Asystant, Asyst Software, Rochester, NY). Following the measurement of CO, the right carotid artery was recannulated with PE-50 tubing and connected to a blood pressure analyzer (DigiMed, Louisville, KY). After the MBP was recorded, the PE-50 tubing was advanced into the left ventricle and connected to a heart performance analyzer (DigiMed) to monitor and record maximal rate of pressure increase (+dP/dtmax) and decrease (–dP/dtmax), respectively.
Heart Hsp32, 60, 70, and 90 gene expressions were determined by real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) as described previously in [23]. Amplification of cDNA was performed on an ABI PRISM 7900HT Sequence Detection System. The primer sequences are shown in Table 1. 18s were used for endogenous control. All the samples were amplified for one cycle at 50 °C for 2 min and at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and at 60 °C for 1 min.
2.3. Isolation of heart RNA
2.5. Western blot assay
Heart RNA was isolated immediately after harvesting the heart using a Nucleospin RNA purification kit (BA Bio-
The hearts were homogenized in a buffer containing 10 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM
2.4. mRNA expression assay
Fig. 1. Hsp32 (A), Hsp60 (B), Hsp70 (C), and Hsp90 (D) protein expression in heart from sham animals with vehicle (Sham), T-H with vehicle (T-H + Veh), T-H with 17b-estradiol (T-H + E2), and T-H with 17b-estradiol and ICI 182,780 (T-H + E2 + ICI). For equal protein loading, membranes were reprobed for b-actin using mouse monoclonal antibody. The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment are normalized as 1.0. Data are shown as mean ± S.E.M. from five rats in each group. *P < 0.05 as compared with Sham; †P < 0.05 compared to T-H + Veh; ‡P < 0.05 compared to T-H + E2.
188
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
Table 1 Primers for quantitative real-time PCR analyses Primers (5′–3′) Gene Hsp32 Hsp60 Hsp70 Hsp90
Sense GGTGTCCAGGGAAGGCTTTAAG ACCTGTGACAACCCCTGAAG GAGTTCAAGCGCAAACACAA AAGGCTGAGGCAGACAAAAA
Antisense GTGCAGCTCCTCAGGGAAGTAG TCTTCCTGTTGTCCCCAAAC CTCAGACTTGTCGCCAATGA CACCCAACCCTGCTATCTGT
EGTA, 50 mM NaF, 0.5 mM phenylmethylsulfonyl fluoride, 1 mM sodium vanadate, 1% Triton X-100, 0.5% Nonidet P-40, and 1 µg/ml of aprotinin. The homogenates were centrifuged at 12,000 × g for 15 min at 4 °C and protein aliquots were mixed with 4 × sample buffer and subjected to electrophoresis and then transferred to nitrocellulose membranes. The membranes were incubated with anti-Hsp32, 60, 70, and 90 overnight at 4 °C. The membranes were later incubated with horseradish peroxidase-conjugated goat anti-rabbit antibody or goat anti-mouse antibody for 1.5 h at room temperature. The blots were immersed for 5 min in Super Signal West Pico detection reagent and then exposed to film. Signals were quantified using cheminogen 5500 imaging software (Alpha Innotech Corp., CA). 2.6. Electrophoretic mobility shift assay (EMSA) HSF-1 DNA binding activity was determined in nuclear extracts of heart. A self-complementary consensus HSE oligonucleotide probe (5′-CTAGAAGCTTCTAGAAGCTTCTAG-3′) (Sigma) was labeled with c-32P-ATP (≥6000 Ci/ mmol, Amersham, Piscataway, NJ). Nuclear extracts, ≥ 20,000 cpm of radiolabeled double-stranded target oligonucleotide, poly (Di–Dc) and incubation buffer (Promega, Madison, WI) were mixed and incubated. After 30 min incubation at room temperature, each of the samples was loaded onto 6% DNA retardation gel (Novex, Carlsbad, CA) and run at 10–15 mA for 90 min. Following electrophoresis, band intensities were quantified using autoradiography. For cold competition experiments, the samples were incubated with a 100-fold molar excess of unlabeled HSE for 15 min before the addition of labeled HSE. Signal densities were evaluated by ChemiImager 5500 software (Alpha Inotech, San Leandro, CA). 2.7. Statistical analysis Results are presented as mean ± S.E.M. (standard error of mean). The data were analyzed using one-way analysis of variance and Tukey’s test, and differences were considered significant at a P value of ≤ 0.05. 3. Results 3.1. Effect of 17b-estradiol on cardiac Hsp 32, 60, 70, and 90 protein expressions There was a significant increase in Hsp32 following T-H, and a significant decrease in Hsp60 and 90 following T-H
Fig. 2. Hsp32 (A), Hsp60 (B), Hsp70 (C), and Hsp90 (D) mRNA gene expression in heart from sham operation with vehicle (Sham), T-H with vehicle (T-H + Veh), T-H with PPT (T-H + PPT), and T-H with DPN (T-H + DPN). Data are shown as mean ± S.E.M. of five rats in each group. *P < 0.05 compared to Sham + Veh; †P < 0.05 compared to T-H + Veh. RQ, relative quantification.
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
189
Fig. 3. Hsp32 (A), Hsp60 (B), Hsp70 (C), and Hsp90 (D) protein expression in heart from sham operation with vehicle (Sham), T-H with vehicle (T-H + Veh), T-H with PPT (T-H + PPT), and T-H with DPN (T-H + DPN). For equal protein loading, membranes were reprobed for b-actin using mouse monoclonal antibody. The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment are normalized as 1.0. Data are shown as mean ± S.E.M. of five rats in each group. *P < 0.05 compared with Sham; †P < 0.05 compared to T-H + Veh.
(Fig. 1). E2 treatment prevented T-H-mediated decrease in Hsp60 and 90 protein expressions in the heart. In addition, Hsp32 and 70 protein expressions were further increased in E2 treated T-H rats. Administration of ER antagonist ICI 182,780 along with E2 prevented the E2-induced upregulation of cardiac Hsp following T-H. 3.2. Effect of ER-␣ agonist PPT and ER-b agonist DPN in cardiac Hsp32, 60, 70, and 90 expression Hsp60 mRNA gene expression decreased significantly in vehicle treated rats following T-H (Fig. 2B). DPN administration following T-H restored Hsp60 (Fig. 2B), and significantly up-regulated Hsp32 and 70 mRNA gene expression in the heart (Fig. 2A, C). There was no significant difference in Hsp90 mRNA gene expression in the heart between sham or T-H animals treated with vehicle, or DPN (Fig. 2D). Further-
more, there was no significant difference in above parameters in T-H rats treated with PPT. In addition to mRNA gene expression, we examined the effects of PPT and DPN on the protein levels of cardiac Hsp following T-H. Hsp60 and 90 protein expression decreased significantly in vehicle treated rats following T-H (Fig. 3B, D). DPN treatment following T-H restored Hsp60 and 90, and significantly increased Hsp32 and 70 protein expression in the heart (Fig. 3A, C). In contrast, no significant change in above parameters was observed in T-H rats treated with PPT. 3.3. DNA binding activity of HSF-1 in heart Since HSF-1 up-regulates Hsp expression in response to stresses, we examined whether ER-a or ER-b agonist affects HSF-1 DNA binding activity following T-H. As shown in Fig. 4, there was no significant difference in cardiac HSF-
190
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
mals receiving PPT or DPN compared with vehicle-treated sham animals (data not shown). As shown in Fig. 6C, DPN significantly improved MBP following T-H compared to vehicle, however, it remained lower than shams. Furthermore, DPN administration increased CO and SV following T-H and the values were similar to those observed in shamoperated animals (Figs. 6A, B and Fig. 7). In addition, DPN prevented the decrease in +dP/dtmax and –dP/dtmax; however, –dP/dtmax remained lower than shams. In contrast, no significant change in above parameters was observed in T-H rats treated with PPT. In order to evaluate whether the cardioprotective effect of DPN was via ER, a group of T-H rats were treated with DPN and ICI 182,780. Administration of ICI 182,780 abolished the DPN-induced attenuation of cardiac function following T-H.
4. Discussion
Fig. 4. DNA binding activity of HSF-1. Lane 1: negative (probe only) (N), lane 2: sham with vehicle (Sham), lane 3: T-H with vehicle (T-H + Veh), lane 4: T-H with PPT (T-H + PPT), lane 5: T-H with DPN (T-H + DPN), lane 6: cold competitive (C). The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment are normalized as 1.0. Data are shown as mean ± S.E.M. of five animals in each group. *P < 0.05 compared with Sham; † P < 0.05 compared to T-H + Veh.
1 DNA binding activity in vehicle treated T-H and PPT treated T-H animals compared to shams. However, administration of DPN following T-H significantly increased HSF-1 DNA binding activity. The specificity of HSF-1 binding was further confirmed by performing competition assays with a cold probe and the results as shown in Fig. 4 (lane 4) clearly indicate that the binding is completely blocked in samples which were incubated with a 100-fold molar excess of unlabeled HSE for 15 min prior to addition of labeled HSE. 3.4. Effect of ICI 182,780 on DPN-induced up-regulation of cardiac Hsp Since DPN up-regulated cardiac Hsp following T-H (Figs. 2–3), we examined if administration of ICI 182,780 had any effect on DPN-induced up-regulation of cardiac Hsp. Administration of DPM with ICI 82,780 prevented the DPNinduced up-regulation of cardiac Hsp following T-H (Fig. 5A– D). 3.5. Effect of ER-␣ agonist PPT and ER-b agonist DPN in hemodynamic parameters A significant decrease in CO, SV, ±dP/dtmax and MBP was evident following T-H (Figs. 6 and 7). There was no significant difference in CO, SV, ±dP/dtmax and MBP in sham ani-
Previous studies have shown that cardiac function is significantly depressed in male animals following T-H [8]. In contrast, female rats in the proestrus state, a state in which plasma levels of estradiol were found to be the highest, showed no depression in CO at 24 h following T-H [24]. However, ovariectomized females displayed depression in organ functions after T-H, similar to those observed in males. Thus, it appears that female sex steroids have protective effects on cardiac function following T-H. There are two ERs, ER-a and ER-b, which are differentially expressed in different tissues [25]. However, studies have shown that both ER-a and ER-b are expressed in cardiomyocytes [11,23]. In view of that, we attempted to determine which of the ER plays a predominant role in cardioprotection following T-H. Our results indicate that left ventricular performance (±dP/dtmax) was significantly depressed following T-H. Male rats treated with ER-b agonist DPN displayed improvement in ± dP/dtmax at 24 h following T-H. Moreover, the improved cardiac contractility was evident by the restored cardiac index in DPN-treated rats. Furthermore, our findings suggested that the biologic effects of DPN on cardiac function are receptor dependent since the administration of ICI 182,780, a selective ER antagonist, along with DPN abolished the DPN-induced cardioprotection in T-H rats. In contrast to DPN, treatment with ER-a agonist PPT did not confer cardioprotection following T-H. The present study is the first to examine the effects of selective ER agonist on cardiac functions following T-H and to show cardioprotective effects of DPN in vivo. DPN acts as an agonist on both ER subtypes but has a 70-fold higher relative binding affinity and 170-fold higher relative estrogenic potency in transcription assays with ER-b than ER-a [26]. PPT on the other hand is a selective agonist for the ER-a subtype and is the best agonist for ER-a out of a series of tetrasubstituted pyrazole analogs [27]. PPT binds to ER-a with high affinity, displaying 410-fold binding selectivity over ER-b [27]. ER-a and ER-b can form homo- and heterodimers
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
191
Fig. 5. Hsp32 (A), Hsp60 (B), Hsp70 (C), and Hsp90 (D) protein expression in heart from sham operation with vehicle (Sham), T-H with vehicle (T-H + Veh), T-H with DPN (T-H + DPN), and T-H with DPN and ICI 182,780 (T-H + DPN + ICI). For equal protein loading, membranes were reprobed for b-actin using mouse monoclonal antibody. The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment is normalized as 1.0. Data are shown as mean ± S.E.M. of five rats in each group. *P < 0.05 compared with Sham; †P < 0.05 compared to T-H + Veh.
and there are data suggesting that different compositions of the dimer differentially regulate gene expression [28]. These observations have led to the concept that selective ER modulators (SERMs) selectively activate E2-dependent protection in an organ such as heart, without stimulating the breast or ovarian proliferation. Our results provide evidence that following T-H, E2-induced cardioprotection is mediated via ER-b activation. Furthermore, the findings that ER antagonist, ICI 182,780 abolished DPN-induced cardioprotection following T-H, suggest that the salutary effects of DPN are mediated via ER. These findings corroborate previous studies by Gabel et al. [14], which showed that ER-b knockout mice display increased cardiac injury following ischemia– reperfusion injury compared to the wild-type mice. It can be argued that we should have administered ICI 182,780 alone in these studies to determine if that per se has any adverse effects. In this regard, our previous studies have shown that administration of ICI 182,780 alone did not produce any del-
eterious effects but its administration with estrogen blocked the salutary effects of estrogen on cardiac function following T-H [9,29]. Since ICI 182,780 administration in itself did not influence cardiac function in trauma-hemorrhaged animals [29], administration of ICI 182,780 alone was not carried out in this study. While the precise mechanism by which DPN mediates its salutary effects remains unknown, our findings suggest that DPN up-regulates Hsp. A couple of studies have examined the effects of E2 and gender on cardiac Hsp expression [22,30,31]. Those studies have shown that female rat hearts have twice as much Hsp72 as male hearts [30]. Ovariectomy reduced the level of Hsp72 in female hearts, and this could be prevented by E2 replacement therapy [30]. Additional studies showed that 10 h of E2 treatment doubled the level of Hsp72 in adult cardiomyocytes from male rats [22]. Consistent with these findings, we observed that over-expression of heart Hsp32 following T-H with E2 administration [20].
192
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
Fig. 7. Maximal rate of left ventricular pressure increase (+dP/dtmax, A) and maximal rate of left ventricular pressure decrease (–dP/dtmax, B) at 24 h after sham operation (Sham) or T-H and resuscitation (T-H). Animals were treated with either vehicle (Veh), propyl pyrazole triol (PPT), diarylpropiolnitrile (DPN) or co-administration of DPN and ICI 182,780 (ICI). Data are presented as mean ± S.E.M. of six animals in each group. *P < 0.05 compared to Sham + Veh; †P < 0.05 compared to T-H + Veh; ‡P < 0.05 compared to T-H + DPN.
Fig. 6. Cardiac output (CO, A), stroke volume (SV, B), and mean blood pressure (MBP, C) in rats at 24 h after sham operation (Sham) or T-H and resuscitation (T-H). Animals were treated with either vehicle (Veh), propyl pyrazole triol (PPT), diarylpropiolnitrile (DPN) or co-administration of DPN and ICI 182,780 (ICI). Data are presented as mean ± S.E.M. of six rats in each group. *P < 0.05 compared to Sham + Veh; †P < 0.05 compared to T-H + Veh; ‡P < 0.05 compared to T-H + DPN. BW, body weight.
Up-regulation of Hsp synthesis is considered to be a powerful physiological, endogenous route for protecting crucial cellular homeostatic mechanisms against deleterious external factors. Physiological stresses ranging from myocardial ischemia to genetic mutations produce disease state in which protein damage and misfolded protein structures are a common denominator [32]. Multiple endogenous pathways are involved in restoring cellular homeostasis, but one wellcharacterized mechanism that involves protein folding is the heat shock family of stress proteins, i.e. Hsp [33–36]. There are several potential mechanisms by which Hsp produce cardioprotective effects. Hsp are generally thought to be useful in correcting the folding of many proteins and restore their functional structures [33]. Moreover, Hsp targets denatured proteins to the lysosome for degradation as molecular chaperones [33]. These functions of Hsp as molecular chaperones play important roles in maintaining the normal cell functions and promoting cell survival.
Hsp are also known to regulate the process of programmed cell death/apoptosis. One major pathway of apoptosis involves the release of cytochrome C from mitochondria. In turn, cytochrome C binds to a protein known as Apaf-1 and triggers its oligomerization. This complex than attracts the inactive unprocessed pro-form of the proteolytic enzyme caspase9 that is then cleaved to its active form thereby initiating apoptosis. Hsp have been shown to inhibit this process at various points. In this regard, Hsp90 has been shown to bind to Apaf1 and prevent it binding to cytochrome C [37]. Furthermore, Hsp70 prevents oilgomerized Apaf-1 from recruiting procaspase-9 [38]. Studies have also suggested an anti-apoptotic role of Hsp60 [39–41]. Over-expression of Hsp60 inhibits myocardial apoptosis in response to ischemic injury [39]. Furthermore, a recent study has shown that reducing Hsp60 expression with antisense oligonucleotides is associated with an increase in Bax and a reduction in Bcl-2, which induces apoptosis of cardiomyocytes [40]. These findings raise the possibility that Hsp60 may regulate apoptosis through modulation of Bcl-2 family [40]. In addition, Hsp90 has been shown to bind to endothelial nitric oxidase synthase (eNOS) and stimulate its activity [42]. Thus, the Hsp protect cells via multiple mechanisms that target key cellular components and regulatory process. Studies have shown that the induction of the Hsp by stressful stimuli is mediated by HSF-1 [43]. As a classical stressresponsive factor, HSF-1 binds to heat shock element, which
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
is present upstream of many Hsp genes, and activates transcription of Hsp genes under stress conditions. HSF-1 has also been reported to be expressed in hearts [22], and protect cardiomyocytes from ischemia/reperfusion injury in transgenic mouse model [21]. Intermolecular interaction between HSF-1 and a multichaperone complex including Hsp90 provides mechanism for repression of HSF-1 activity [22]. In addition, Hsp90 is also known to bind to intracellular steroid receptors, including ER [22]. Thus, ligand-dependent interactions have been proposed to modify the equilibrium between Hsp90 and its molecular partners, HSF-1 and ER [22]. Our present study indicates that ER-b agonist DPN increased HSF1 DNA binding activity, thus suggesting that DPN may up-regulate cardiac Hsp through increase in cardiac HSF1 DNA binding activity. In conclusion, our results suggest that similar to E2, DPN that is ER-b agonist also provides cardioprotection following T-H. Furthermore, our results indicate that up-regulation of Hsp likely plays a significant role in the DPN-mediated cardioprotection following T-H.
Acknowledgments This study was supported by National Institutes of Health Grant R37 GM39519.
References [1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
Baue AE, Durham R, Faist E. Systemic inflammatory response syndrome (SIRS), multiple organ dysfunction syndrome (MODS), multiple organ failure (MOF): are we winning the battle? Shock 1998;10: 79–89. Wu LL, Tang C, Liu MS. Altered phosphorylation and calcium sensitivity of cardiac myofibrillar proteins during sepsis. Am J Physiol Regul Integr Comp Physiol 2001;281:R408–R416. Wang P, Ba ZF, Jarrar D, Cioffi WG, Bland KI, Chaudry IH. Mechanism of adrenal insufficiency following trauma and severe hemorrhage: role of hepatic 11 beta-hydroxysteroid dehydrogenase. Arch Surg 1999;134:394–401. Wang W, Wang P, Chaudry IH. Intestinal alkaline phosphatase: role in the depressed gut lipid transport after trauma-hemorrhagic shock. Shock 1997;8:40–4. Homo-Delarche F, Fitzpatrick F, Christeff N, Nunez EA, Bach JF, Dardenne M. Sex steroids, glucocorticoids, stress and autoimmunity. J Steroid Biochem Mol Biol 1991;40:619–37. Wichmann MW, Zellweger R, DeMaso CM, Ayala A, Chaudry IH. Enhanced immune responses in females, as opposed to decreased responses in males following haemorrhagic shock and resuscitation. Cytokine 1996;8:853–63. Remmers DE, Cioffi WG, Bland KI, Wang P, Angele MK, Chaudry IH. Testosterone: the crucial hormone responsible for depressing myocardial function in males after trauma-hemorrhage. Ann Surg 1998;227:790–9. Remmers DE, Wang P, Cioffi WG, Bland KI, Chaudry IH. Testosterone receptor blockade after trauma-hemorrhage improves cardiac and hepatic functions in males. Am J Physiol 1997;273:H2919–H2925. Jarrar D, Wang P, Knöferl MW, Kuebler JF, Cioffi WG, Bland KI, et al. Insight into the mechanism by which estradiol improves organ functions after trauma-hemorrhage. Surgery 2000;128:246–52.
193
[10] Kher A, Wang M, Tsai BM, Pitcher JM, Greenbaum ES, Nagy RD, et al. Sex differences in the myocardial inflammatory response to acute injury. Shock 2005;23:1–10. [11] Mendelsohn ME, Karas RH. Molecular and cellular basis of cardiovascular gender differences. Scinece 2005;308:1583–7. [12] Iafrati MD, Karas RH, Aronovitz M, Kim S, Sullivan Jr. TR, Lubahn DB, et al. Estrogen inhibits the vascular injury response in estrogen receptor (alpha)-deficient mice. Nat Med 1997;3:545–8. [13] Lindner V, Kim SK, Karas RH, Kuiper GGJM, Gustafsson J-A, Mendelsohn ME. Increased expression of estrogen receptor (beta) mRNA in male blood vessels after vascular injury. Circ Res 1998;83: 224–9. [14] Gabel SA, Walker VR, London RE, Steenbergen C, Korach KS, Murphy E. Estrogen receptor beta mediates gender differences in ischemia/reperfusion injury. J Mol Cell Cardiol 2005;38:289–97. [15] Hutter JJ, Mestril R, Tam EKW, Sievers RE, Dillmann WH, Wolfe CL. Over expression of heat shock protein 72 in transgenic mice decreases infarct size in vivo. Circulation 1996;94:1408–11. [16] Wang JL, Ke DS, Lin MT. Heat shock pretreatment may protect against heatstroke-induced circulatory shock and cerebral ischemia by reducing oxidative stress and energy depletion. Shock 2005;23: 161–7. [17] Chen HW, Hsu C, Lu TS, Wang SJ,Yang RC. Heat shock pretreatment prevents cardiac mitochondrial dysfunction during sepsis. Shock 2003;20:274–9. [18] Nakano M, Mann DL, Knowlton AA. Blocking the endogenous increase in HSP72 increases susceptibility to hypoxia and reoxygenation in isolated adult feline cardiocytes. Circulation 1997;95:1523– 31. [19] Lau S, Patnaik N, Sayen R, Mestril R. Simultaneous overexpression of two stress proteins in rat cardiomyocytes and myogenic cells confers protection against ischemia-induced injury. Circulation 1997;96:2287–94. [20] Szalay L, Shimizu T, Schwacha MG, Choudhry MA, Rue III LW, Bland KI, et al. Mechanism of the salutary effects of estradiol on organ function following trauma-hemorrhage: upregulation of hemeoxygenase. Am J Physiol 2005;289:H92–H98. [21] Nishizawa J, Nakai A, Komeda M, Ban T, Nagata K. Increased preload directly induces the activation of heat shock transcription factor 1 in the left ventricular overloaded heart. Cardiovasc Res 2002;55:341–8. [22] Knowlton AA, Sun L. Heat-shock factor-1, steroid hormones, and regulation of heat-shock protein expression in the heart. Am J Physiol 2001;280:H455–H464. [23] Yu HP, Yang S, Choudhry MA, Hsieh YC, Bland KI, Chaudry IH. Mechanism responsible for the salutary effects of flutamide on cardiac performance following trauma-hemorrhagic shock: upregulation of cardiomyocyte estrogen receptors. Surgery 2005;138:85–92. [24] Jarrar D, Wang P, Cioffi WG, Bland KI, Chaudry IH. The female reproductive cycle is an important variable in the response to traumahemorrhage. Am J Physiol 2000;279:H1015–H1021. [25] Kuiper GGJM, Carlsson B, Grandien J, Enmark E, Haggblad J, Nilsson S, et al. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptor a and b. Endocrinology 1997;138:863–70. [26] Meyers MJ, Sun J, Carlson KE, Marriner GA, Katzenellenbogen BS, Katzenellenbogen JA. Estrogen receptor-b potency-selective ligands: structure–activity relationship studies of diarylpropionitriles and their acetylene and polar analogues. J Med Chem 2001;44:4230–51. [27] Stauffer SR, Coletta CJ, Tedesco R, Nishiguchi G, Carlson K, Sun J, et al. Pyrazole ligands: structure-affinity/activity relationships and estrogen receptor-a-selective agonists. J Med Chem 2000;43:4934– 47. [28] Hall J, Couse J, Korach K. The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem 2001;276:36869–72.
194
H.-P. Yu et al. / Journal of Molecular and Cellular Cardiology 40 (2006) 185–194
[29] Hsieh YC, Yang S, Choudhry MA, Yu HP, Bland KI, Schwacha MG, et al. Flutamide restores cardiac functions following traumahemorrhage via an estrogen-dependent pathway through upregulation of PGC-1. Am J Physiol 2005 (in press). [30] Voss MR, Stallone JN, Li M, Cornelussen RNM, Knuefermann P, Knowlton AA. Gender differences in the expression of heat shock proteins: the effect of estrogen. Am J Physiol 2003;285:H687–H692. [31] Hamilton KL, Gupta S, Knowlton AA. Estrogen and regulation of heat shock protein expression in female cardiomyocytes: cross-talk with NF kappa B signaling. J Mol Cell Cardiol 2004;36:577–84. [32] Kumarapeli AR, Wang X. Genetic modification of the heart: chaperones and the cytoskeleton. J Mol Cell Cardiol 2004;37:1097–109. [33] Benjamin IJ, McMillan DR. Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res 1998;83: 117–32. [34] Menezes JM, Hierholzer C, Watkins SC, Billiar TR, Peitzman AB, Harbrecht BG. The modulation of hepatic injury and heat shock expression by inhibition of inducible nitric oxide synthase after hemorrhagic shock. Shock 2002;17:13–8. [35] Meng X, Harken AH. The interaction between Hsp70 and TNF-alpha expression: a novel mechanism for protection of the myocardium against post-injury depression. Shock 2002;17:345–53. [36] Menezes JM, Hierholzer C, Watkins SC, Billiar TR, Peitzman AB, Harbrecht BG. The modulation of hepatic injury and heat shock expression by inhibition of inducible nitric oxide synthase after hemorrhagic shock. Shock 2002;17:13–8.
[37] Pandey P, Saleh A, Nakazawa A, Kumar S, Srinivasula SM, Kumar V, et al. Negative regulation of cytochrome c-mediated oligomerization of Apaf-1 and activation of procaspase-9 by heat shock protein 90. EMBO J 2000;19:4310–22. [38] Beere HM, Wolf BB, Cain K, Mosser DD, Mahboubi A, Kuwana T, et al. Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat Cell Biol 2000; 2:469–75. [39] Lin KM, Lin B, Lian IY, Mestril R, Scheffler IE, Dillmann WH. Combined and individual mitochondrial HSP60 and HSP10 expression in cardiac myocytes protects mitochondrial function and prevents apoptotic cell deaths induced by simulated ischemia-reoxygenation. Circulation 2001;103:1787–92. [40] Kirchhoff SR, Gupta S, Knowlton AA. Cytosolic heat shock protein 60, apoptosis, and myocardial injury. Circulation 2002;105:2899– 904. [41] Shan YX, Liu TJ, Su HF, Samsamshariat A, Mestril R, Wang PH. Hsp10 and Hsp60 modulate Bcl-2 family and mitochondria apoptosis signaling induced by doxorubicin in cardiac muscle cells. J Mol Cell Cardiol 2003;35:1135–43. [42] Shi Y, Hutchins W, Ogawa H, Chang CC, Pritchard Jr. KA, Zhang C, et al. Increased resistance to myocardial ischemia in the Brown Norway vs. Dahl S rat: role of nitric oxide synthase and Hsp90. J Mol Cell Cardiol 2005;38:625–35. [43] Melling CW, Thorp DB, Noble EG. Regulation of myocardial heat shock protein 70 gene expression following exercise. J Mol Cell Cardiol 2004;37:847–55.