Mechanism of Subunit Coordination of an AAA + Hexameric Molecular Nanomachine

BASIC SCIENCE Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531 – 541

Original Article

nanomedjournal.com

Mechanism of Subunit Coordination of an AAA + Hexameric Molecular Nanomachine Xian Jessica Yu, PhD a , William B. Greenleaf, PhD a , Yemin Stanley Shi, PhD a, 1 , Xiaojiang S. Chen, PhD a, b, c,⁎ a

Molecular and Computational Biology Program, Department of Biology, University of Southern California, Los Angeles, CA, USA b Department of Chemistry, University of Southern California, Los Angeles, CA, USA c Norris Cancer Center, University of Southern California, Los Angeles, CA, USA Received 4 August 2014; accepted 11 November 2014

Abstract Simian virus 40 large tumor antigen (LT) is both a potent oncogenic protein and an efficient hexameric nanomachine that harnesses the energy from ATP binding/hydrolysis to melt origin DNA and unwind replication forks. However, how the six subunits of the helicase motor coordinate during ATP hydrolysis and DNA unwinding/translocation is unresolved. Here we investigated the subunit coordination mechanisms “binomial distribution mutant doping” experiments in the presence of various DNA substrates. For ATP hydrolysis, we observed multiple coordination modes, ranging from random and semi-random, and semi-coordinated modes, depending on which type of DNA is present. For DNA unwinding, however, the results indicated a fully-coordinated mode for the natural origin-containing duplex DNA, but a semi-coordinated mode for a pre-existing fork-DNA, providing direct evidence for LT to use potentially different mechanisms to unwind the two types of substrates. The results of this study provide insights into DNA translocation and unwinding mechanisms for LT hexameric biomotor. From the Clinical Editor: The study describes the subunit coordination of simian virus 40 large tumor antigen (LT) showing that multiple mechanisms exist that handle the specific needs of different stages of DNA replication. © 2015 Elsevier Inc. All rights reserved. Key words: Replicative helicase; Hexameric nanomachine; ATP hydrolysis mode; Substrate-dependent subunit coordination; Origin DNA unwinding

Simian virus 40 (SV40), a tumor virus in the polyomavirus family, encodes large tumor antigen (LT) that can transform cells and cause cancer (reviewed in 1 -3 and references therein). However, LT is also an AAA + hexameric nanomotor that melts origin double-stranded DNA (dsDNA) and unwind fork DNA for viral replication. 4,5 LT by itself can accomplish the following complex tasks: recognizing the specific origin DNA (ori-DNA) sequence, assembling as a hexamer/double hexamer at the ori-DNA and melting the ori-DNA to produce single stranded DNA (ssDNA), unwinding the fork DNA, and recruiting DNA polymerase/primase and other cellular replication proteins. 6,7 These multiple functions allow LT to serve as a

Funding: National Institutes of Health R01. No competing interests. ⁎Corresponding author at: Molecular and Computational Biology Program, Department of Biology, University of Southern California, Los Angeles, CA 90089, USA. E-mail address: [email protected] (X.S. Chen). 1 Present address: Oracle Inc. 17901 Von Karman Avenue, Suite 800, Irvine, CA.

good and simple model system to study eukaryotic DNA replication initiation and elongation. 8 -11 Considering its essential roles in transforming cells and for viral replication, a deep understanding of the molecular mechanisms of LT functions will be needed in order to apply the knowledge to develop anti-viral and anti-cancer reagents in the future. As an efficient nanomotor, LT in a hexamer form can couple the energy of ATP binding/hydrolysis to the mechanical work for unwinding DNA or RNA. 12 -15 The six subunits in a hexamer reconstitute six active ATP sites. How the six subunits of an LT hexamer coordinate with each other for ATP hydrolysis and for DNA unwinding is unknown, even though previous crystal structures in different nucleotide binding states showed that all six subunits of LT has an all-or-none nucleotide binding mode, suggesting a highly concerted mode of action. 12,16 To date, the well-characterized ring-shaped motors include T7gp4/DnaB, Sulfolobus solfataricus MCM (ssoMCM), and BPV-E1, ClpX, and phi29 packaging motor. 17 -26 Biochemical data for ssoMCM indicate no subunit coordination for ATP hydrolysis and only limited coordination for DNA unwinding. 20 T7gp4 shows a fully-coordinated dTTP hydrolysis with ssDNA,

http://dx.doi.org/10.1016/j.nano.2014.11.005 1549-9634/© 2015 Elsevier Inc. All rights reserved. Please cite this article as: Yu XJ, et al, Mechanism of Subunit Coordination of an AAA+ Hexameric Molecular Nanomachine. Nanomedicine: NBM 2015;11:531-541, http://dx.doi.org/10.1016/j.nano.2014.11.005

532

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

consistent with both the biochemical and structural data. 27 -29 The structure of ssDNA-bound BPV-E1 showed ssDNA contacting all subunits in a spiral manner, implying a sequential mode. 26 Previous evidence from the “binomial distribution mutant doping assay” (simply referred to as “mutant doping assay” from here on) indicates that phi29 package motor uses a random ATPase hydrolysis mode in the absence of dsDNA, but a sequential coordinated mode in the presence of dsDNA. 23,30-34 The mutant doping study reveals that ClpX uses a random mode for ATP hydrolysis in the absence of substrate. 24 The above examples showed that, despite sharing a common ring-shaped architecture, these motors display different subunit coordination modes. The available structural evidence for LT implies a unique all-or-none nucleotide (nt) binding mode, i.e. all the six nucleotide-sites in an LT hexamer are always fully occupied by ATP, or by ADP, or are all empty, despite extensive testing under a wide range of the mixture of nt concentrations. 16,35,36 This all-or-none nt binding mode observed from the structural studies would suggest a highly coordinated mode of action for the six subunits in using the ATP and in unwinding the DNA. Alternatively, it is still possible that such an all-or-none nt binding mode observed in all six LT hexameric structures determined so far could be the results of particular conformations that are favored for crystal packing. As a result, more biochemistry evidence is needed to help resolve this coordination issue. Here, we performed biochemical studies to examine the subunit coordination mechanisms of LT hexamers for both ATP hydrolysis and DNA unwinding using different DNA substrates. Our data reveal that the subunit coordination mode for both ATP hydrolysis and DNA unwinding not only depends on whether DNA is present, but also depends on what type of DNA substrates present in the reaction. For ATP hydrolysis, it shows a random mode in the absence of DNA, a semi-random mode in the presence of ssDNA, and a semi-coordinated mode in the presence of fork or ori-DNA. For DNA unwinding, however, our result clearly demonstrated two distinct mechanisms: a semicoordinated mode the fork DNA that has existing ssDNA region, and a fully-coordinated mode for the blunt-ended ori-DNA that is the biologically starting substrate in nature for LT helicase. This offers the first example that a hexameric helicase motor employs two distinct coordination modes when unwinding two different types of DNA substrate.

Table 1 Biochemical properties of WT and mutant LTag. Hexamer:monomer peak ratio a

Catalytic activity

LTag protein

− ATP

+ ATP

kcat, min −1

Km, mM

WT Tri-trans Tri-cis

0.3 0.04 0.2

0.5 0.06 0.5

20 ± 1 –b –b

270 ± 40 –b –b

a

Hexamer:monomer peak ratios were calculated based on peak areas after analyzing 9 nmol protein on S200 analytical column (GE) in the presence or absence of ATP. ATP is known to promote hexamer formation, and increase the ratio of hexamer:monomer for wild type. b Only background activity; nd: not determined.

the Bradford method and Coomassie blue R-250 staining on SDS-PAGE. Oligomerization of LT The ability of LT WT or mutant to form a hexamer was determined by Superdex 200 gel filtration chromatography. 9 nmol of LT WT or mutant protein in 1 ml of buffer containing 25 mM Tris-Cl (pH 8.0), 250 mM NaCl, and with or without 1 mM ATP was incubated for 10 min at 18 °C before loading to Superdex 200 column for chromatography at 4 °C. Hexamerization of LT can be promoted by adding ATP alone without Mg ++. The integration of absorbance peak areas at 280 nm was used to determine the total ratio of hexameric to monomeric peaks of LT. 37,38 GST pull-down assay The ability of LT mutant to associate with itself or WT subunits, as an additional surrogate test for forming hexamers between mutant and WT, GST pull-down assay was performed by incubating 30 μl of GST-tagged protein with non-tagged protein in a 1:1 molar ratio in the buffer of 25 mM Tris-Cl (pH 8.0), 500 mM NaCl for 10 min at 4 °C. Then 30 μl of 25 mM Tris-Cl buffer with 4 mM ATP was added and incubated for 1 h at 4 °C. Next the mixture was incubated with 15 μl of GST resin for 15 min at 4 °C. The resin was washed extensively with buffer containing 25 mM Tris-Cl (pH 8.0), 250 mM NaCl and 2 mM ATP for three times and analyzed by SDS-PAGE. ATPase assay and helicase assay

Methods Site-directed mutagenesis and protein purification We performed standard site-directed mutagenesis, and all mutations were confirmed by sequencing the entire LT coding sequence. LT131-627 WT and mutant proteins were expressed and purified from an Escherichia coli expression system as described previously. 36 Briefly, WT or mutant protein was expressed as a GST-LT fusion using the PGEX-6P-1 vector. Fusion protein was purified through a glutathione affinity column, and then GST was cleaved by PreScission protease. The cleaved LT protein was further purified by Superdex-200 gel filtration chromatography. All proteins were quantified by using

The ATPase assay was performed using the EnzChek phosphate assay kit (Invitrogen) exactly as described previously. 38 For helicase assay, a Y-shaped fork DNA and a 146 bp blunt-ended dsDNA containing the 64 bp SV40 core origin DNA (ori-DNA) (Table 2) were used as substrates for helicase assay. Approximately 10-15 fmol of [γ-32P] labeled fork or ori-DNA substrates was incubated with 0.04 μM to 0.12 μM (as hexamer) of total LT protein (either WT or mutant alone or mixture of WT and mutant in different ratios) in helicase buffer containing 20 mM Tris-Cl pH 7.5, 10 mM MgCl2, 5 mM ATP, 1 mM DTT and 0.1 mg/ml BSA for 45 min at 37 °C. The reaction was terminated by adding to 0.1% SDS, 25 mM EDTA and 10% glycerol and analyzed on 12% native polyacrylamide gel in 1X TBE buffer. The radioactivity on the dried gel was

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

533

Table 2 DNA substrates for ATPase and helicase doping assays. Names

DNA sequences

60 nt ssDNA Fork DNA

5′-GAAGCCAATACAAAGGCTACATCCTCACTCGGGTGGACGGAAACGCAGAATTATGGTTAC 5′-(dT)44GCTCGTGCAGACGTCGAGGTGAGGACGAGCTCCTCGTGACCACG 3′-(dT)44CGAGCACGTCTGCAGCTCCACTCCTGCTCGAGGAGCACTGGTGC 5′- (AC…AT)41CACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTA(GT….GA)41 3′- (GT…AT)41GTGATGAAGACCTTATCGAGTCTCCGGCTCCGCCGGAGCCGGAGACGTATTTATTTTTTTTAAT(CA….CT)41

146 bp origin DNA a a

146 bp origin DNA: 64 bp SV40 core origin is flanked by 41 bp random sequence.

quantified by autoradiography. Data analysis was done by Quantity One and statistical computing software R. Results Generation of mutants for doping experiment In order to understand the coordination mechanisms between subunits within the ring-shaped hexamers of LT, we used the mutant doping method, in which increasing amounts of non-catalytic mutant are titrated into WT protein, and the ATPase and helicase activities of the resulting protein mixture containing increasing number of mutant are measured. For the doping experiments, we generated two types of mutants, with one type designed to disrupt ATPase activity, and the other type to disrupt only the helicase activity without abolishing the ATPase activity. For ATPase-defective mutant, we designed two mutants based on the high-resolution structure of LT in complex with ATP. 16 One is the tri-cis mutant (cT434A/cD474A/cN529A), with three “cis” residues (designated with a “c” in front of the residues) around the ATPase pocket mutated (Figure 1, B). Another is tri-trans mutant (tK418A/tR498A/tR540A), with three “trans” residues on an adjacent subunit (trans subunit) mutated (Figure 1, B). Both mutants showed no detectable ATPase activity (Table 1). However, hexamerization assay showed that only the tri-cis mutant has the WT-level hexamerization activity (Table 1). Moreover, GST pull-down assay showed that the tri-cis mutant interacts with WT protein just as well as the WT interacts with itself (Figure 2, A and B). Thus, the tri-cis mutant is an ATPase-defective mutant that is suitable for our mutant doping experiments. For the helicase defective mutant, we generated a β-hairpin mutant with mutations on the β-hairpin tip residues, K512A/ H513A (Figure 1, C). These two residues are located in the central channel and essential for DNA unwinding, but are distal to the ATP-binding pocket (Figure 1, D), and thus do not disrupt the intrinsic ATP hydrolysis. 36,37,39 Indeed, our results showed WT level of ATPase activity for the β-hairpin mutant in the absence of DNA (Figure 2, C). However, unlike the WT, this mutant lost the DNA-dependent stimulation of ATPase activity (Figure 2, C). 37,39 The oligomerization assay also showed this mutant binds to WT subunits just as well as WT bind to itself (Figure 2, A, lanes 2-4, 7-8; Figure 2, B). Thus, the β-hairpin mutant is a helicase-defective mutant that is suitable for the doping experiment to evaluate the subunit coordination for helicase activity.

Subunit coordination for ATP hydrolysis: doping with ATPase-defective mutant By using the ATPase-defective tri-cis mutant, we performed the mutant doping experiment to characterize the coordination mode of the six subunits for ATP hydrolysis in the absence and presence of various types of DNA. The mutant doping assay has been applied to investigate the subunit coordination mode for a number of oligomeric biomotors. 20,23-25,27 In this doping assay, the WT protein is titrated in with increasing amount of a catalytic-defective mutant, and the resulting activity of the titrated WT-mutant mixture will be analyzed to examine the coordination mode. Two extreme cases for the coordination mode for ATP hydrolysis are as follows: first is the random mode, in which no coordination exists between the six sites, and each site hydrolyzes ATP independent of the other sites in the hexamer. In the random mode, a hexamer can hydrolyze ATP even with only one WT subunit, and the ATPase activity decreases proportionally to the percentage of WT subunits decreases. The second extreme case is the full-coordination mode, in which ATP hydrolysis at one site is dependent on all the other sites being active in the hexamer, and ATP hydrolysis can only occur when all six subunits are WT. In this full-coordination mode, ATPase activity decreases exponentially as the percentage of WT subunits decreases. Between these two extreme cases, there are other possible intermediate coordination modes, which can be described by the mathematical model listed in Eq. 1 in Supplemental Information, with all the possible cases predicted by Eq. 1 listed in Supplementary Table 1, and the predicted curves for all mode plotted in Supplementary Figure 1. In our doping experiments using the ATPase-defective tri-cis mutant, the resulting ATP hydrolysis activity changes were measured in the absence/presence of DNA (ssDNA, fork DNA, and blunt-ended ori-DNA), and data were plotted against the modeled curves predicted by Eq. 1 (Figure 3, A-D). In the absence of DNA, the ATPase activity decreased proportionately to the percentage of WT, which fits well with the modeled curve of linear decrease (C = 1 model, i.e. one active WT subunit is sufficient for hydrolysis to occur) (Figure 3, A), indicating that the six subunits in an LT hexamer hydrolyze ATP independent of each other, or in a random mode. When ssDNA was included in the reaction, however, the ATPase activity decreased more rapidly as the WT was titrated out by the mutant (Figure 3, B), but only slightly deviating away from the random C = 1 linear curve (red line), and locating

534

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

Figure 1. Locations of mutations around ATP-pockets and the β-hairpin on LT hexamer. (A) The LT hexamer crystal structure viewing from C-terminus, showing the six ATPs (in yellow) bound to all sites, and the β-hairpin K512/H513 (in red). (B) Close-up view of an ATP-pocket between two subunits. The three cis-residues (in blue) on the cis subunit (in black) that has the p-loop, and the three trans-residues (in cyan) on the trans subunit (in silver) are shown. (C) Close-up view of the K512/H513 residues on the central channel β-hairpin (in red). (D) Summary of the locations of the mutated residues (in sticks and labeled) in the three mutants (tri-cis, Tri-tran, β-hairpin mutant) on a subunit structure.

somewhere between the C = 1 and the C = 2 (green) curves (Figure 3, B). To distinguish from the linear C = 1 random mode, we call this a “semi-random” mode. This result is clearly distinctive from the case for the bacteriophage T7 gp4 hexamer motor, which showed a complete switch from a random mode in the absence of DNA to a fully-coordinated mode that would fit the C = 6 curve (the yellow curve in Figure 3, B) when ssDNA was present, 27 which means that all six subunits need to be active WT for hydrolysis to occur. Next we examined the ATP hydrolysis in the presence of two types of dsDNA, a fork DNA and a blunt-ended dsDNA containing SV40 origin sequence (ori-DNA). The ATPase activity now decreased much more rapidly than when ssDNA is used, the data plot now follows the C = 3 model (blue curves in Figure 3, C and D) for both types of dsDNA, suggesting that presence of dsDNA somehow causes the hexamer to hydrolyze ATP in a much more coordinated manner than ssDNA. We call

this C = 3 model as the “semi-coordinated” mode, to distinguish from a fully-coordinated mode, as it suggests that three WT subunits are needed in a hexamer for activity. Taking the results together from above, it appears that different types of DNA can trigger different subunit coordination modes for LT: while ssDNA can do little in switching the coordination mode for ATP hydrolysis from a completely random mode to semi-random, and dsDNA can cause a much profound coordination mode switch to a semi-coordinated mode. Subunit coordination for DNA unwinding: doping with ATPase-defective mutant We next examined the subunit coordination for helicase activity by using the same doping approach. For the choice of unwinding substrates, we used fork DNA that can be used by most helicases. In addition, we also used the blunt-ended

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

535

Figure 2. Characterizations of the tri-cis and β-hairpin (β-hp) mutants, showing their suitability for mutant doping assay. (A) GST-pull down, showing that GST-WT LT pulled down the non-tagged WT, the tri-cis, and the β-hp mutants equally well. The non-tagged free-LT (WT and tri-cis) in lanes 3, 5, and 7 are pulled down with GST-WT. The residual free-LT in lanes 4, 6, and 8 are pulled down by resin only. (B) GST-pull down, showing GST-tri-cis and GST-β-hp mutants pulled down the free self (lanes 7, 8, 11, and 12) and WT (lanes 4 and 5) equally well. The results in (A, B) indicate the mutants retain the ability to associate with each other and with WT to hexamerize. (C) ATPase assay in the absence/presence of DNAs. The tri-cis showed undetectable ATPase activity, and the β-hairpin retained WT-level ATPase activity in the absence of DNA, but lost the DNA-stimulated ATPase activity. (D, E) Helicase assay, showing the tri-cis and β-hp mutants are helicase defective for fork-DNA (D) and blunt-ended ori-DNA (E). B: Boiled; UB: unboiled DNA with no protein. Lanes 1, 3, and 5 contain 0.11 μM protein, Lanes 2, 4, and 6 contain 0.22 μM protein as monomers.

ori-DNA because LT is the only helicase that is known to be able to use blunt-ended DNA as unwinding substrate in vitro. When fork DNA was used in the doping assay, the helicase activity decreased rapidly to follow the semi-coordinated mode (C = 3, blue curve) (Figure 4, A), which is the same coordination mode obtained for ATP hydrolysis with fork DNA, but not with ssDNA. This semi-coordinated mode requires at least three active ATPase subunits in the ring hexmer to function (Supplementary Table 1). This result is also different to the case for ssoMCM, in which ssoMCM displayed a less coordinated mode termed as pairs-model or the C = 2 model here that requires only two active WT subunits instead of three. 20 Surprisingly, when blunt-ended ori-DNA was used in the helicase doping assay, a distinct coordination mode for DNA unwinding was revealed. The result showed that the helicase activity decreased exponentially in the doping assay, which fit the fully-coordinated mode (C = 6, yellow curve in Figure 4, B). This

result indicates that ori-DNA unwinding requires full-coordination between six subunits, distinct from the semi-coordination mode for unwinding fork DNA (comparing Figure 4, A and B). This is the first direct biochemical evidence showing a clear difference in subunit coordination when unwinding fork DNA vs blunt-ended ori-DNA by LT hexameric helicase. Subunit coordination for DNA unwinding: doping with β-hairpin mutant The above doping studies were performed using an ATPase-defective mutant. Here we performed the doping assay using the β-hairpin mutant that has mutated residues not involved in ATP binding/hydrolysis, but involved in DNA sensing/unwinding in the central channel (Figure 1, D). Because this mutant has WT-level ATPase activity in the absence of DNA, it is not suitable for examining the ATP hydrolysis in the

536

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

Figure 3. ATPase doping assay with ATPase-defective mutant with different DNAs. For all panels, modeling of all possible coordination modes was described in Supplemental Information (Supplementary Table 1, Supplementary Figure 1), and the modeled curves for each possible mode (C = 1, 2…6) are drawn in colored curves in panels A-D. (A) In the absence of DNA substrate, the ATPase doping result fits the C = 1 linear simulated model (R 2 = 0.983) that is the random mode. (B) In the presence of ssDNA, the data fit between the C = 1 linear and the C = 2 “pairs” simulated model (green curve). We call this semi-random mode here. (C) In the presence of fork-DNA, the result fits the C = 3 “Trimer” simulation curve (or semi-coordinated model) (blue curve) (R 2 = 0.991), which requires at least three active subunits for ATP hydrolysis. (D) In the presence of a blunt-ended ori-DNA, the result again fits a “Trimer” simulation (R 2 = 0.998). The error bars in all panels represent the standard deviation of three independent experiments.

doping assay. However, because it has no unwinding activity (Figure 2, D and E), this mutant can be used to study the subunit coordination for helicase activity in the doping assay. Here, the helicase doping assay with this β-hairpin mutant revealed a semi-coordinated mode (C = 3 model, blue curve) with fork DNA (Figure 5, A), but a fully-coordinated mode (C = 6 model, yellow curve) with the ori-DNA (Figure 5, B), which is identical to the results obtained from using the ATPase-defective mutant. Discussion Here we investigated the mechanisms of subunit coordination for ATP hydrolysis and for DNA unwinding by the LT hexameric motor through the mutant doping assays. Our data

showed that LT hexamer uses multiple subunit coordination modes for ATP hydrolysis, and two distinct modes for DNA unwinding, depending on the type of DNA substrates present in the reaction (Figure 6). DNA-dependent coordination mode change for ATP hydrolysis For the ATP hydrolysis activity, a random or independent coordination mechanism was observed in the absence of DNA, which is similar to the previously reported case for ClpX in the absence of its substrate. 24 However, when ssDNA was present, ATP hydrolysis by LT is no longer completely random, but displayed a weak, but consistent, level of coordination, termed semi-random mode here (Figure 3, B). This behavior is in dark

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

537

Figure 4. Helicase doping assay of the ATPase-defective mutant. The modeled curves for helicase activity are drawn in the same colors as in Figure 3. (A) In the presence of fork-DNA, the helicase doping result has the best fit for the C = 3 “Trimer” simulation or a semi-coordinated model (blue curve) (R 2 = 0.993), suggesting that unwinding the fork DNA requires at least three active subunit in a hexamer. (B) In the presence of a blunt-ended ori-DNA, helicase doping result fits an “Exponential” simulation curve (in yellow) (R 2 = 0.993), which is a full-coordination model that requires all six subunits to be active to unwind the ori-DNA. The full-coordination model can either be fully concerted or fully sequential for the six subunits with a hexamer. The error bars represent the standard deviation of five independent experiments.

contrast with a phase helicase, T7 gp4 hexamer motor, whose nucleotide hydrolysis switches from a random to a fully-coordinated mode when ssDNA was added. 27 However, when dsDNA (either fork DNA or blunt-ended ori-DNA) was present in the ATPase doping assay, ATP hydrolysis of LT shifted to a much more coordinated mode, termed the semi-coordinated mode that requires at least three WT subunits in a hexamer, as described by the C = 3 modeled curve (Figure 3, C and D, Supplementary Table 1). This case again differs from another reported hexameric helicase motor, ssoMCM, whose ATP hydrolysis was shown to be the random mode either with or without DNA. 20 Additionally, the phi29 dsDNA packaging motor also behaved differently in that its ATP hydrolysis showed a random mode in the absence of dsDNA, but switched to a fully-coordinated mode when dsDNA was present. 23 The observation that LT clearly adopts two different coordination modes for ATP hydrolysis with an ssDNA or with a fork DNA containing ssDNA regions may provide insights into its unwinding mechanism. With ssDNA, the near random (or semi-random) mode for LT contrasts with the full-coordination mode for T7 gp4, which could be a reflection of the difference for the two helicase motors in translocating along ssDNA. The full-coordination in the presence of ssDNA for T7 gp4, a DnaB homolog, implies that pure translocation along ssDNA could be utilized to displace the other strand for unwinding. For LT, real subunit coordination was not observed with ssDNA, and a switch to a semi-coordinated mode only occurred when a fork DNA, a substrate for unwinding/ translocation. Therefore, these data suggest that fork DNA unwinding by LT may require more than the simple translocation along ssDNA to display the other strand as described in the “exclusion model” that is currently believed to be the case for T7 gp4 and DnaB. 19,40

DNA-dependent coordination mode change for DNA unwinding As a nanomachine, LT helicase couples the energy from ATP binding/hydrolysis to DNA unwinding. Our mutant doping data using ATPase-defective or helicase-defective mutants reveal that LT unwinds DNA with clearly two distinct subunit coordination mechanisms, depending on whether a fork DNA and a blunt-ended ori-DNA serve as the substrate. When fork DNA with an ssDNA overhang region is used as the substrate, a semi-coordination mode (C = 3 trimer model) is observed (Figure 4, A), which matches the mode for ATP hydrolysis with the same fork DNA (Figure 3, C). The C = 3 trimer coordination model requires at least three WT subunits in a hexamer to be active. There are three equally possible arrangements for the three active WT subunits in this model (Figure 6, C). As shown in Supplementary Table 1 (the mutant number k = 3), all three WT subunits in a hexamer can be consecutive, or only two WT consecutive, or all three WT are alternating with three inactive subunits. Regardless, this C = 3 trimer model observed for LT is different from the “pairs” (C = 2 dimer) model for ssoMCM where two WT subunits are sufficient to unwind fork DNA. 20 Surprisingly, when ori-DNA is used as the substrate, a full-coordination mode requiring all six LT subunits is apparent for helicase activity (Figures 4, B and 5, B), even though a semi-coordination mode is displayed for the ATPase activity. It is unclear why coordination mode for ATPase (semicoordinated) does not match the full-coordination mode for helicase when ori-DNA is present. One speculation is that not all ATP hydrolysis are coupled to ori-DNA unwinding. It's possible that some wasteful ATP hydrolysis occurred for translocation on the ssDNA product after unwinding, or occurred before being loaded on DNA during ori-DNA melting/unwinding, resulting in an apparent partial coordination mode. Nonetheless, the full-

538

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

Figure 5. Helicase mutant doping with the β-hairpin mutant. (A) In the presence of fork-DNA, helicase doping result has the best fit for the C = 3 “Trimer” simulation or a semi-coordinated model (blue curve) (R 2 = 0.994). (B) In the presence of a blunt-ended ori-DNA, helicase doping result fits an “Exponential” simulation curve (R 2 = 0.969). The error bars represent the standard deviation of three independent experiments.

coordination mode for ori-DNA unwinding suggests either a fully sequential (Figure 6, D) or a fully concerted mode among the six subunits (Figure 6, E), either of which requires all six subunits to be functional. The mutant doping experiments cannot distinguish the two coordination modes. Even though a sequential model cannot be excluded at this point, previous structural and biochemical data of LT favor a concerted mode (Figure 6, E). 16,36,41 First, the crystal structures of LT hexamers obtained so far under a wide range of concentrations with various nucleotide combinations are always in an all-or-none nt binding state, i.e. hexamers with all six nt pockets empty, or all occupied by ADP, or all by ATP. Second, biochemical analysis reveals that 1:1 ratio of ATP or ADP binding to LT subunits when LT forms hexamers in solution, 41 which is also consistent with an all-or-none nucleotide binding state. The interesting question is why LT adopts the multiple subunit coordination modes for ATP hydrolysis and for DNA unwinding (Figure 6, A). Considering that LT is unique in that LT protein alone fulfills both the initiator and the helicase functions for DNA replication, one plausible explanation is that it may need to use different subunit coordination modes in response to different type of DNA (ori-DNA, melted DNA, fork DNA with ssDNA region) present at different stages of replication. For example, LT encounters the blunt-ended ori-DNA that requires initial melting of dsDNA into ssDNA region before the melted region can be propagated into a fork-DNA. Nonetheless, a matured replication fork DNA has ssDNA regions that allow LT hexamer to bind to facilitate dsDNA unwinding. 42 During the initiation of replication, LT has to interact with two DNA strands of an ori-DNA at the origin to initiate duplex DNA melting. After a replication fork is formed, LT may switch conformation to interact with a fork DNA conformation, such as the ssDNA region with a fork junction, for the subsequent processive unwinding. 43 The DNA status in the central channel of LT at these different stages of replication initiation and elongation, therefore, may be

switched form dsDNA, fork DNA, or even ssDNA, which can trigger different subunit coordination modes for ATP hydrolysis and DNA unwinding observed for LT in this study. Other hexameric helicases (such as T7 gp4 and DnaB family helicases) have more specialized function than LT, and therefore, may not be required to develop versatile subunit coordination modes. A relevant issue is how DNA is translocated by helicase during unwinding. For phi29 dsDNA translocation motor, evidence indicates that dsDNA moves through its channel using a revolution mechanism without rotation or coiling, thus elegantly resolving the issue for packaging dsDNA into a preformed capsid. 23,25 However, because DNA being translocated by helicases has a DNA fork either ahead of the helicase or partially being bound, how DNA is translocated by helicases during unwinding is more difficult to be delineated. However, helicases such as PcrA or uvrD, use a two-motor domain movement to simply “grab” the ssDNA in front of the fork and pull it through a small channel, 44,45 resulting in the translocation of ssDNA to separate the other strand by “exclusion”. In this case, the ssDNA may be translocated through the narrow channel in a linear movement, without revolution or rotation. For hexameric helicases, prokaryotic DnaB helicase family has a relatively larger channel 19,46 than eukaryotic helicases such as LT and MCM. 16,47-50 The DnaB helicases have sufficient channel space for a potential revolution mechanism for ssDNA translocation to occur. LT has smaller channel and may interact with partially ssDNA/dsDNA during unwinding, and future study will be needed to understand how DNA is translocated by LT and other helicases during DNA unwinding. In summary, we observed three distinct subunit coordination modes for ATP hydrolysis in LT hexameric biomotor, which can be switched from random to semi-random, to semi-coordinated, dependent not only on the presence/absence of DNA, but also on the type of DNAs. For DNA unwinding, however, two different subunit coordination modes were consistently observed using either an ATPase-defective mutant or a helicase-defective

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

539

Figure 6. Summary of observed coordination modes and possible LT subunit coordination models. (A) Summary of coordination modes with various DNAs for ATPase and helicase activities of LT. (B) A random (or near random) mode for ATPase without DNA or with ssDNA, where ATP hydrolysis at a given site is independent of the other sites in the hexamer. (C) A C = 3 semi-coordinated mode that requires at least three active subunits in a hexamer. The data reported here suggest that LT likely can use this coordination mode to unwind fork DNA substrates. (D) A full-coordination mode in a sequential model, where function of all six subunits is needed, and they coordinate in a sequential (or rotary) fashion around the ring when hydrolyze ATP and unwind DNA. (E) A full-coordination mode in a concerted model, where function of the six subunits are concerted in the following three steps: first binding ATP at all six sites of a hexamer, then hydrolyzing all ATP to ADP, followed by a complete release of ADP to restart a new cycle. The results here, together with previous structural and biochemistry data, favor a concerted model when ori-DNA, a natural substrate for LT, is the substrate.

β-hairpin mutant: a semi-coordinated mode for unwinding a fork DNA substrate, and a fully-coordinated mode for unwinding an ori-DNA that is the natural biological substrate. These results clearly indicate that the six subunits of LT employ two distinctive coordination modes to unwind the two different types of DNA substrates, a fully-coordinated mode (likely concerted) for unwinding the ori-DNA that is the natural initial substrate for LT, and a semi-coordinated mode for unwinding the fork DNA that is available after the ori-DNA is fully melted. This

study provides evidence that multiple subunit coordination mechanisms for hexameric motors may exist to handle the specific needs at different stages of DNA replication.

Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.nano.2014.11.005.

540

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541

References 1. Fanning E, Knippers R. Structure and function of simian virus 40 large tumor antigen. Annu Rev Biochem 1992;61:55-85. 2. Ahuja D, Saenz-Robles MT, Pipas JM. SV40 large T antigen targets multiple cellular pathways to elicit cellular transformation. Oncogene 2005;24(52):7729-45 [Epub 2005/11/22]. 3. DeCaprio JA, Garcea RL. A cornucopia of human polyomaviruses. Nat Rev Microbiol 2013;11(4):264-76 [Epub 2013/03/12]. 4. Stillman B, Gerard RD, Guggenheimer RA, Gluzman Y. T antigen and template requirements for SV40 DNA replication in vitro. EMBO J 1985;4(11):2933-9. 5. Borowiec JA, Dean FB, Bullock PA, Hurwitz J. Binding and unwinding—how T antigen engages the SV40 origin of DNA replication. Cell 1990;60(2):181-4. 6. Dean FB, Bullock P, Murakami Y, Wobbe CR, Weissbach L, Hurwitz J. Simian virus 40 (SV40) DNA replication: SV40 large T antigen unwinds DNA containing the SV40 origin of replication. Proc Natl Acad Sci U S A 1987;84(1):16-20. 7. Stillman B. Smart machines at the DNA replication fork. Cell 1994;78(5):725-8. 8. Slaymaker IM, Chen XS. MCM structure and mechanics: what we have learned from archaeal MCM. Subcell Biochem 2012;62:89-111 [Epub 2012/08/25]. 9. Brewster AS, Chen XS. Insights into the MCM functional mechanism: lessons learned from the archaeal MCM complex. Crit Rev Biochem Mol Biol 2010;45(3):243-56 [Epub 2010/05/06]. 10. Chong J, Hayashi M, Simon M, Xu R, Stillman B. A double-hexamer archaeal mini-chromosome maintenance protein is an ATP-dependent DNA helicase. Proc Natl Acad Sci U S A 2000;97(4):1530-5. 11. Fletcher RJ, Bishop BE, Leon RP, Sclafani RA, Ogata CM, Chen XS. The structure and function of MCM from archaeal M. Thermoautotrophicum Nat Struct Biol 2003;10(3):160-7. 12. Gai D, Chang YP, Chen XS. Origin DNA melting and unwinding in DNA replication. Curr Opin Struct Biol 2010;20(6):756-62 [Epub 2010/09/28]. 13. Scheffner M, Knippers R, Stahl H. RNA unwinding activity of SV40 large T antigen. Cell 1989;57(6):955-63. 14. Fanning E, Zhao K. SV40 DNA replication: from the A gene to a nanomachine. Virology 2009;384(2):352-9 [Epub 2008/12/23]. 15. Bullock PA. The initiation of simian virus 40 DNA replication in vitro. Crit Rev Biochem Mol Biol 1997;32(6):503-68. 16. Gai D, Zhao R, Li D, Finkielstein CV, Chen XS. Mechanisms of conformational change for a replicative hexameric helicase of SV40 large tumor antigen. Cell 2004;119(1):47-60 [Epub 2004/09/30]. 17. Baker TA, Sauer RT. ClpXP, an ATP-powered unfolding and proteindegradation machine. Biochim Biophys Acta 2012;1823(1):15-28 [Epub 2011/07/09]. 18. Mott ML, Berger JM. DNA replication initiation: mechanisms and regulation in bacteria. Nat Rev Microbiol 2007;5(5):343-54 [Epub 2007/ 04/17]. 19. Itsathitphaisarn O, Wing RA, Eliason WK, Wang J, Steitz TA. The hexameric helicase DnaB adopts a nonplanar conformation during translocation. Cell 2012;151(2):267-77 [Epub 2012/10/02]. 20. Moreau MJ, McGeoch AT, Lowe AR, Itzhaki LS, Bell SD. ATPase site architecture and helicase mechanism of an archaeal MCM. Mol Cell 2007;28(2):304-14. 21. Bell SD, Botchan MR. The minichromosome maintenance replicative helicase. Cold Spring Harb Perspect Biol 2013;5(11):a012807 [Epub 2013/07/25]. 22. Hamdan SM, Richardson CC. Motors, switches, and contacts in the replisome. Annu Rev Biochem 2009;78:205-43 [Epub 2009/03/21]. 23. Schwartz C, Fang H, Huang L, Guo P. Sequential action of ATPase, ATP, ADP, Pi and dsDNA in procapsid-free system to enlighten mechanism in viral dsDNA packaging. Nucleic Acids Res 2012;40(6): 2577-86 [Epub 2011/11/24].

24. Martin A, Baker TA, Sauer RT. Rebuilt AAA + motors reveal operating principles for ATP-fuelled machines. Nature 2005;437(7062):1115-20 [Epub 2005/10/21]. 25. Guo P, Zhao Z, Haak J, Wang S, Wu D, Meng B, et al. Common mechanisms of DNA translocation motors in bacteria and viruses using one-way revolution mechanism without rotation. Biotechnol Adv 2014;32(4):853-72 [Epub 2014/06/11]. 26. Enemark EJ, Joshua-Tor L. Mechanism of DNA translocation in a replicative hexameric helicase. Nature 2006;442(7100):270-5. 27. Crampton DJ, Mukherjee S, Richardson CC. DNA-induced switch from independent to sequential dTTP hydrolysis in the bacteriophage T7 DNA helicase. Mol Cell 2006;21(2):165-74. 28. Singleton MR, Sawaya MR, Ellenberger T, Wigley DB. Crystal structure of T7 gene 4 ring helicase indicates a mechanism for sequential hydrolysis of nucleotides. Cell 2000;101(6):589-600. 29. Donmez I, Patel SS. Mechanisms of a ring shaped helicase. Nucleic Acids Res 2006;34(15):4216-24 [Epub 2006 Aug 25]. 30. Lee CS, Guo P. A highly sensitive system for the in vitro assembly of bacteriophage phi 29 of Bacillus subtilis. Virology 1994;202(2):1039-42 [Epub 1994/08/01]. 31. Schwartz C, De Donatis GM, Fang H, Guo P. The ATPase of the phi29 DNA packaging motor is a member of the hexameric AAA + superfamily. Virology 2013;443(1):20-7 [Epub 2013/05/28]. 32. Fang H, Zhang P, Huang LP, Zhao Z, Pi F, Montemagno C, et al. Binomial distribution for quantification of protein subunits in biological nanoassemblies and functional nanomachines. Nanomedicine 2014;10(7):1433-40 [Epub 2014/03/22]. 33. Chen C, Trottier MC, Guo P. New approaches to stoichiometry determination and mechanism investigation on RNA involved in intermediate reactions. Nucleic Acids Symp Ser 1997;36:190-3. 34. Trottier M, Guo P. Approaches to determine stoichiometry of viral assembly components. J Virol 1997;71(1):487-94 [Epub 1997/01/01]. 35. Gai D, Li D, Finkielstein CV, Ott RD, Taneja P, Fanning E, et al. Insights into the oligomeric states, conformational changes, and helicase activities of SV40 large tumor antigen. J Biol Chem 2004;279(37): 38952-9 [Epub 2004/07/13]. 36. Li D, Zhao R, Lilyestrom W, Gai D, Zhang R, DeCaprio JA, et al. Structure of the replicative helicase of the oncoprotein SV40 large tumour antigen. Nature 2003;423(6939):512-8 [Epub 2003/05/30]. 37. Shen J, Gai D, Patrick A, Greenleaf WB, Chen XS. The roles of the residues on the channel beta-hairpin and loop structures of simian virus 40 hexameric helicase. Proc Natl Acad Sci U S A 2005;102(32): 11248-53 [Epub 2005/08/03]. 38. Greenleaf WB, Shen J, Gai D, Chen XS. Systematic study of the functions for the residues around the nucleotide pocket in simian virus 40 AAA + hexameric helicase. J Virol 2008;82(12):6017-23 [Epub 2008/04/11]. 39. Kumar A, Meinke G, Reese DK, Moine S, Phelan PJ, Fradet-Turcotte A, et al. Model for T-antigen-dependent melting of the simian virus 40 core origin based on studies of the interaction of the beta-hairpin with DNA. J Virol 2007;81(9):4808-18 [Epub 2007/02/09]. 40. Biswas EE, Barnes MH, Moir DT, Biswas SB. An essential DnaB helicase of Bacillus anthracis: identification, characterization, and mechanism of action. J Bacteriol 2009;191(1):249-60 [Epub 2008/10/22]. 41. Huang SG, Weisshart K, Fanning E. Characterization of the nucleotide binding properties of SV40 T antigen using fluorescent 3'(2')-O-(2,4,6trinitrophenyl)adenine nucleotide analogues. Biochemistry 1998;37(44): 15336-44. 42. Patel SS, Picha KM. Structure and function of hexameric helicases. Annu Rev Biochem 2000;69:651-97. 43. Yardimci H, Wang X, Loveland AB, Tappin I, Rudner DZ, Hurwitz J, et al. Bypass of a protein barrier by a replicative DNA helicase. Nature 2012;492(7428):205-9 [Epub 2012/12/04]. 44. Soultanas P, Wigley DB. Unwinding the ‘Gordian knot’ of helicase action. Trends Biochem Sci 2001;26(1):47-54.

X.J. Yu et al / Nanomedicine: Nanotechnology, Biology, and Medicine 11 (2015) 531–541 45. Lee JY, Yang W. UvrD helicase unwinds DNA one base pair at a time by a two-part power stroke. Cell 2006;127(7):1349-60 [Epub 2006/12/28]. 46. Wang G, Klein MG, Tokonzaba E, Zhang Y, Holden LG, Chen XS. The structure of a DnaB-family replicative helicase and its interactions with primase. Nat Struct Mol Biol 2008;15(1):94-100 [Epub 2007/12/25]. 47. Brewster AS, Wang G, Yu X, Greenleaf WB, Carazo JM, Tjajadi M, et al. Crystal structure of a near-full-length archaeal MCM: functional insights for an AAA + hexameric helicase. Proc Natl Acad Sci U S A 2008; 105(51):20191-6 [Epub 2008/12/17]. 48. Gomez-Llorente Y, Fletcher RJ, Chen XS, Carazo JM, San Martin C. Polymorphism and double hexamer structure in the archaeal mini-

541

chromosome maintenance (MCM) helicase from Methanobacterium thermoautotrophicum. J Biol Chem 2005;280(49):40909-15 [Epub 2005/10/14]. 49. Fletcher RJ, Shen J, Gomez-Llorente Y, Martin CS, Carazo JM, Chen XS. Double hexamer disruption and biochemical activities of Methanobacterium thermoautotrophicum MCM. J Biol Chem 2005;280(51): 42405-10 [Epub 2005/10/14]. 50. Cuesta I, Nunez-Ramirez R, Scheres SH, Gai D, Chen XS, Fanning E, et al. Conformational rearrangements of SV40 large T antigen during early replication events. J Mol Biol 2010;397(5): 1276-86 [Epub 2010/03/12].