Mechanism of transmembrane signaling in osmoregulation

MECHANISM OF TRANSMEMBRANE SIGNALING IN OSMOREGULATION

Arfaan A. Rampersaud

I. II. Ill.

Introduction: Signal Transduction and Osmoregulation . . . . . . . . . . . . . Regulation of Porin Gene Expression by EnvZ and OmpR . . . . . . . . . . . General Studies of the ompB Operon; the ompR and envZ Genes . . . . . . . A. A Model for Osmoregulation by EnvZ and OmpR . . . . . . . . . . . . . B. Organization and Transcription of ompB . . . . . . . . . . . . . . . . . . C. Related Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. Expression of ompB . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E. Well Characterized ompB Mutants . . . . . . . . . . . . . . . . . . . . . IV. Structure of OmpR AND EnvZ . . . . . . . . . . . . . . . . . . . . . . . . . A. OmpR Structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Organization of EnvZ . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. Relationships with Other Proteins . . . . . . . . . . . . . . . . . . . . . . V. Phosphorylation Studies of OmpR and EnvZ . . . . . . . . . . . . . . . . . . A. Phosphate Transfer Reactions . . . . . . . . . . . . . . . . . . . . . . . . B. Phosphorylation Mutants of EnvZ and OmpR . . . . . . . . . . . . . . . C. Forms of OmpR-P . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. Importance of a Phosphate Relay Cycle for Porin Gene Expression . . . .

Advances in Cell and Molecular Biology of Membranes and OrganeHes Volume 4, pages 219-262. Copyright 9 1995 by JAI Press Inc. All rights of reproduction in any forumreserved. ISBN: 1-55938-924-9

219

220 221 222 223 225 227 228 228 234 234 235 236 237 237 238 239 240

220

ARFAAN A. RAMPERSAUD

E. Alternative Routes of OmpR Phosphorylation . . . . . . . . . . . . . . . VI. EnvZ Signaling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Osmosensing by EnvZ . . . . . . . . . . . . . . . . . . . . . . . . . . . B. The Amino Terminus as the Sensor Domain . . . . . . . . . . . . . . . C. The Hybrid Tar-EnvZ Sensor . . . . . . . . . . . . . . . . . . . . . . . D. Activation of EnvZ by Local Anesthetics . . . . . . . . . . . . . . . . . VII. Multifunetional Properties of OmpR . . . . . . . . . . . . . . . . . . . . . . A. Conformational Changes in OmpR . . . . . . . . . . . . . . . . . B. Multimerization of OmpR . . . . . . . . . . . . . . . . . . . . . . . . . C. Additional OmpR Mutants . . . . . . . . . . . . . . . . . . . . . . . . . VIII. DNA-Binding and Transcriptional Properties of OmpR . . . . . . . . . . . . A. Binding to the ompF Promoter . . . . . . . . . . . . . . . . . . . . . . B. Binding to the ompC Promoter . . . . . . . . . . . . . . . . . . . . . . . C. Transcriptional Activation at ompF and ompC . . . . . . . . . . . . . . . IX. Other Factors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. The r Subunit of RNA-polymerase . . . . . . . . . . . . . . . . . . . . B. Integration Host Factor . . . . . . . . . . . . . . . . . . . . . . . . . . . X. Future Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

241 242 242 243 243 244 245 . . . 246 247 247 248 248 251 252 252 252 253 254 254 254

I. INTRODUCTION: SIGNAL TRANSDUCTION A N D OSMOREGULATION Escherichia coli are highly responsive to their external environment and have adaptive mechanisms that allow them to adjust their metabolism or behavior to suit particular environmental circumstances (.5, 23, 24, 98, 108, 130, 131). In many instances the adaptive mechanism involves signal-transmitting protein pairs, consisting of a sensor protein and a response regulator. The sensor detects an environmental stimulus and relays the information to the response regulator. In turn, the response regulator initiates changes in cellular metabolism or behavior (5, 101, 108, 130, 131). As sensors are often integral membrane proteins, transmembrane signaling can be an important part of the signal transduction process. A large number of sensor/response regulator protein pairs have been reported, and the broad aspects of their signaling mechanism have been reviewed (5, 14, 33, 101, 108, 130, 131). As a group they are related through their common mechanism of protein phosphorylation in which phosphate is transferred between a histidine residue of the sensor and an aspartate residue of the response regulator. The sensor class of proteins share segmented amino acid sequence similarities around a highly conserved histidine residue that represents their site of phosphorylation. Response regulators are often DNA-binding proteins, and as a class, share amino acid similarities at their N-terminus. A highly conserved aspartate residue in this same region represents the phosphate acceptor site.

Transmembrane Signaling in Osmoregulation

221

This chapter focuses on the EnvZ and OmpR couple that is a particularly well characterized sensor/response regulator pair in E. coli K- 12. They act in concert to differentially regulate two major outer membrane porin (omp) proteins, OmpF and OmpC, according to changes in external osmolarity (33, 45, 56, 86, 89, 114). EnvZ is a membrane-bound sensor while OmpR represents the response regulator. The goal of this chapter is to discuss the signaling mechanism for these two proteins and how this results in osmoregulation of porin genes.

II. REGULATION OF PORIN GENE EXPRESSION BY ENVZ AND OMPR The OmpF and OmpC proteins form homotrimedc pores in the outer membrane for the passive diffusion of small hydrophilic solutes (less than 600 Daltons) from the external environment into the periI~iasm (99, I00). They are major constituents of the bacterial outer membrane and can represent as much as 2% of the total protein content in the cell (99, 100). Due to their abundance, as well as their non-selective diffusion properties, the pot'in channels have a key role in determining the permeability properties of the outer membrane (99, 100). OmpF and OmpC are differentially expressed according to a variety of environmental conditions such as medium osmolarity (70, 144), carbon source (123), temperature (6), pH (50, 51), or the presence of membrane perturbants (27, 41, 107). Under conditions of low osmoladty, neutral pH, or at 30 ~ OmpF is mainly produced; increases in osmolarity or temperature, decreases in pH, or the presence of membrane perturbants cause OmpC levels to increase with a dramatic decrease in OmpF production. Despite fluctuations in the amounts of OmpF and OmpC protein, the total amount of porin in the cell remains constant (99, 100). Medium osmolarity is the main environmental condition used to study reciprocal changes in OmpF and OmpC. The OmpF and OmpC proteins are of the same size, are functionally similar, and show considerable sequence homology at both the protein and DNA levels (61% and 69%, respectively) (92, 99, 100). They are not essential proteins, and their expression patterns can be switched without adversely affecting cell growth (82, 99, 100). Given these data it is curious that an E. coli cell chooses to differentially regulate these highly similar proteins using a sensitive signal transduction system. The pore formed by OmpF is, however, slightly larger than OmpC and provides for a greater diffusion rate through this channel (99, 100). Thus, the relative amounts of OmpF and OmpC can influence the amount and/or type of solutes that diffuse across the outer membrane, and this is probably important to the cell. Osmoregulation of the ompF and ompC porin genes occurs at the transcriptional level through the combined action of the OmpR and EnvZ proteins. OmpR and EnvZ are encoded at the ompR and envZ genes, respectively, which together form the ompB operon (33, 43, 45). The ompB operon maps to 74 minutes on the E. coli

222

ARFAAN A. RAMPERSAUD

chromosome (43) and is unlinked to either ompF or ompC loci, which map to 21 minutes and 48 minutes, respectively, on the chromosome (9). In addition to regulation at the transcriptional level, OmpF mRNA is further regulated at the translational level by the micFgene (6, 7). The micF gene is located upstream to the ompC gene and is transcribed in the opposite direction (6, 7). It produces an RNA transcript complementary to the Shine-Dalgarno and initiation codon on the ompF mRNA. It is proposed that micF hybridizes with the ompF mRNA and blocks further translation of the message (6, 7). This type of regulation occurs primarily for thermal adaptation and does not appear to be a significant factor for osmoregulation (22). The micF gene will not be discussed any further in this chapter.

III. GENERAL STUDIES OF THE ompBOPERON; THE ompR AND envZGENES The ompB operon was identified as a regulatory locus in which mutations affected both OmpF and OmpC expression (122, 145, 147, 148). Clarification of the regulatory role of ompB came about by the creation and analysis of ompC-lacZ and ompF-lacZ operon fusion strains (37, 42-44). Such strains expressed 13-galactosidase in the same osmoregulatory fashion as the corresponding porin protein with their expression pattern being dependent on ompB. For example, strains that do not make functional OmpR protein or have lost the entire ompB operon do not express either ompF-lacZ or ompC-lacZoperon fusions (37, 42-44). In an envZ nonsense mutant (envZ22), expression of both operon fusions is reduced but not completely eliminated (36, 146). These studies establish some of the features of ompF and ompC regulation. First, the absolute level of OmpF and OmpC is controlled at the transcriptional level by ompB (43). Second, ompB is primarily responsible for osmoregulation of ompF and ompC transcription and coordinates this so that total podn content in the outer membrane remains constant (43). Finally, expression of ompF and ompC is absolutely dependent on OmpR and exhibits a strong but not strict requirement for EnvZ

(42-44, 37, 146). The ompB operon not only controls ompF and ompC expression but is also involved with regulation of microcin B- 17 biosynthesis (mcrB), expresgion of the gene for tripeptide permease (tppB), as well as regulation of an outer membrane protease (opr) (23, 39, 47). These additional regulatory processes are not completely understood, but indicate that ompB may have a more general regulatory role than previously suspected.

Transmembrane Signaling in Osmoregulation

223

A. A Model for Osmoregulation by EnvZ and OmpR Originally the OmpR protein was proposed to be a bifunctional regulatory molecule that shifted between two different states, one causing ompF expression and the other causing ompC expression (44). EnvZ was believed to be an envelope protein that modulated the two states of OmpR depending on environmental conditions (44). Extensive biochemical and genetic analyses have added further details to this model. One important result has been the demonstration that OmpR binds to recognition sequences in both ompF and ompC promoters and therefore is a transcription factor for both genes (87, 103, 142). In addition, EnvZ has been shown to phosphorylate and dephosphorylate OmpR and therefore is both a kinase as well as a phosphatase for OmpR (1, 30, 53-55). Finally, increasing OmpR-phosphate levels correlate closely with increasing OmpC and decreasing OmpF levels (33, 56, 86, 89). This has led to a general agreement that the relative phosphorylated state of OmpR determines reciprocal expression of ompF and ompC, possibly through differential binding of OmpR to high and low affinity target sites in their promoter regions (3, 4, II 8, 126). Based on the above points, a simple model of EnvZ/OmpR action can be created and is shown in Figure 1A. EnvZ is an inner-membrane protein having a putative sensor domain and a known signaling domain on opposite sides of the membrane. The cytoplasmic signaling domain undergoes phosphorylation and transfers phosphate to and from OmpR. At low osmolarity conditions EnvZ produces low levels of OmpR-phosphate (OmpR-P) through the combined action of its kinase and phosphatase activity. The amount of OmpR-P produced is sufficient for ompF but not ompC expression, and accordingly an OmpF +, OmpC" (F+C-) porin pattern is produced (Figure 1B). In this model, non-phosphorylated OmpR is considered to be nonfunctional. Environmental (osmotic) signals are believed to stimulate EnvZ so as to increase the amounts of OmpR-E At intermediate osmolarity enough OmpR-P is produced to allow activation of both ompF and ompC genes. At high osmolarity EnvZ further increases the amount of OmpR-E and when a particular level is reached, OmpR-P actively represses the ompF gene (Figure l A and I B). The ompC gene remains activated and thus produces an OmpF-OmpC + (F-C +) outer membrane phenotype (Figure 1B). While signaling by EnvZ involves changes in kinase and phosphatase activities, it is not clear whether this involves reduced phosphatase activity or elevated kinase activity. At present all that can be said is that these activities are not equivalent or that the ratio of these activities is not I. Environmental (osmotic) signals modulate these two activities with the signal thought to be received at the amino terminus of EnvZ. This information may be transmitted across the membrane to affect the cytoplasmic signaling domain. For OmpR, phosphorylation may cause conformational changes necessary for DNA-binding. These different conformations are not well understood and are best

ElzVZ A.

~]amuto

AcP

,Mj)p

low

~ P (low]~eb)

=..

o==l=T~ p_h,x,p=~,.a Idu=~

JI

inte~

lB.

+

4.

"-

---

4.

4.

--4. MalE"

Figure 1. General model for EnvZ and OmpR signal transduction and the relationship between phosphorylated OmpR and porin expression. Panel A shows how phosphatase and kinase activities of EnvZ affect the amounts of non-phosphorylated OmpR (OmpR) and phosphorylated OmpR (OmpR-P). Phosphorylation of EnvZ (P) occurs on Histidine-243 at the expense of ATE Phosphate is transferred to Aspartate-55 on OmpR to form OmpR-P. Environmental conditions (low and high osmolarity) determine the relative kinase and phosphatase activities of EnvZ. The downward bold line on the far right indicates increased OmpR-P production. Panel B shows a diagram relating phosphorylated OmpR (OmpR-P) levels to osmolarity conditions and porin phenotypes. Non-phosphorylated (OmpR) is believed to be nonfunctional. A plus sign (+) indicates expression and a minus sign (-) indicates little or no expression. Pleiotropic forms of EnvZ are shown to greatly increase OmpR-P levels and cause reduced production of PhoA and MalE proteins. This aspect may be the result of a qualitative rather than a quantitative change in OmpR-P levels. 224

Transmembrane Signaling in Osmoregulation

225

described as low- and high-osmolarity forms. Whether OmpR is phosphorylated at one or more sites is also not clear, but current evidence suggests that EnvZ phosphorylates OmpR at a single site (26). In certain circumstances a form of OmpR-P is produced that is characterized by an F-C + phenotype and by its pleiotropic effects on other proteins such as Male and PhoA (19, 77, 145, 147). This is shown in Figure 1B as a highly phosphorylated form, since these OmpRs are closely associated with pleiotropic EnvZ mutants that accumulate OmpR-P (2, 136, 137).

B. Organization and Transcription of ompB The genes for ompR and envZ have been cloned and sequenced (20, 96). The ompR gene encodes the 239 amino acid OmpR protein (29.5 kD) while envZ encodes the 450 amino acid EnvZ protein (50 kD). Their amino acid sequences as well as other details are shown in Figures 2 and 3. The genes overlap by four base

Met Gin Glu Am Tyr L3m= lie I ~

Olu Aq[ T ~

Leu Thr Glu Gin Gly Phe Gin VM ~

Leu~*Leu ~

Asp ~

Val Val~ Asp* Asp* Asp Met Arlg* Leu* Arg Ak

,.

Arg Gly* Leu 8er

~

8er Val Ale Asn Ala* Glu Gin Met-40*

VM Gly* Leu Glu* lie

Gly Ala Asp-100

..

Asp Tyr* He P r o i 4 m Pro, Phe Ash Pro ~ R

Leu-~0

Arll Gin Ber* ])he His Leu Met VMt Leu Asp" Leu Met Leu Pro Oly-60

Met Val* *Thr Ale Lye Oly Glu* Giu Vsl* Asp* Arg He ,

L~

~ 9 . : .~-

Any Gin AIa Lys Phe L ~ Thr 8er* g~ly Arx*~Asp Lys ne Asp Val* Gin Tyr Be Gin Thr

Olu* Leu Leu Ale Arg* He

Arg Ale# Ved Leu-120

Pro* 8er Glu,,Me,,t AJ,~t ,,Leu Oly* Arg Met Val Val Phe

Val Gu ,ArK Met Ala Ser

-

Asn Leu, Glu Leu lie Vsl

Glu A~m Phe Met Set Trp

Leu Leu Ale* Am Arg Gly

Pro Gly Vsl Leu Leu Leu

Gly* A l p Thr Arg, Leu L35 Ala* Arg* A~ Arg Gly Tyr

Gin phe Val Olu* Olu Va]

Glu ArK Set Tyr Glu Pro

Giu Giu His Set Asp Asp

Ala ,, Asp Pro, AIs Pro Gly

Ile Pro Glu Olu Hi, Lys

/ida Phe-140 Met Pro-160 ..Pro, ,Leu-,180 ~ Ser-200 Pro Arg-320* AIm-239

Figure 2. Sequence of OmpR and proposed secondary structure at the amino terminus. The amino acid sequence of OmpR (239 residues) was taken from reference 20. Superimposed above the amino terminus is a diagram of alternating a and 13 secondary structures (from ref. 131). The boundaries of these structures are not absolute assignments. Within the sequence, point mutations are indicated with a symbol (.). Other symbols correspond to amino acid differences between OmpR from E. coli B (u) or S. typhi (#) or to a three amino acid insertion (f) which replaces Val-53 with the sequence Ala-Leu-Glu. The amino acid residues that are deleted in the OmpR101 molecule are enclosed within the box. For further details about these amino acid replacements see Table 2 and the text.

ARFAAN A. RAMPERSAUD

226

I'1~243 Am-,~17 [~ , DXGXG GXG I

.

.

.

m

.

...........

. . . . . . .

m

m

I Periplssmic domsin

Met Ar8 Tbr Leu Pro'Set Lye Leu Tyr Arl[ Trp Ale Glu Vsl Pro Asn Phe ArE ne Gin lie Pro Ash _His V.al" 8er" Olu Gin lle G]u Leu Am .Thr. AIm VsI Ala GI.y Thr Glu (]In Gly Thr Glu Leu Thr Arg

Art Leu Leu Gin Olu (]In Ar~ lie Tyr ASh

I

I__

m L

m

,

,,I

|'~ O ~ e doaudn

Leu Art Phe 8er Pro ArS 8er Set Phe AIm Arw Thr Leu P h o A l a 8er Ldm Vsl Thr Thr Tyr L e u V s l Val L e s * A m GInOGIn Pho Ash Lys Vsl Lea .Ms Tyr GIn Vsl Arg Met Leu Glu Asp Oly Thr Gin Leu Val Vsl Pro Pro AIa Phe Leu Gly Ue 8er Leu Tyr 8er Ash Olu AIs AIs Olu Glu His Tyr Glu Phe Leu Set His GIn Met Ala Gin Gin Leu Vsi Glu Vsl Am Lys Set 8er Pro Vsl Vsl Trp Leu Lys Trp Vsl Art Vsl Pro Leu Thr Glu lie His (]In Gly Asp Thr Leu Aia Be Met Leu ~ Ale Re Gly Gly Ala Trp A q Pro" Leu Val Asp Leu Glu His AIm Aims Leu Gin Val Pro Pro Leu Arg Olu Tyr Gly Ale 8er Glue Vnl Arl[ 8er Vid Met ,,A]a Als Oly Val Lye Gin Leu Ale Asp Asp Arg Thr Leu l i b " Asp. Leu...An~ Thr" Pro" Leu -Thr JAr~' lie Ant Leu Ala Thr Asp Gly Tyr Leu Ala Glu 8er lie Ash Lys Asp He Glu Glu Gin Phe lie Asp ~ Leu ~ Thr Gly Gin Glu Met Pro Met Ai. Vsl ~ Gly Glu Vsl lie Ala AIs Glu Set .Oly Tyr. Glu Leu ~yr Pro Gly 8er lie_ Glu Vsl Lys Met His [Pro . . . . . Leu . 8er ASh Met Vsl Vsl AsneAls JAIs At[ ~ O l y , . . . A s h G l y Trp lle GIu...Pr0 Ash Ars AI. Trp phe Qln JVsl Glu Asp Asp GIy Pro Arl[ Lys His Leu Phe Gin Pro !~h,, Vsd A r t GIy &.so 8er &Is Gly Leu,,Gly . Leu . . . Ala lie Vsl [-(]ln ArE He Vsi Asp ASh His Gly Thr Set Giu Arg Gly Giy Leu Set lie Arg .Ms Trp Leu Ala Gin Oly Thr Thr bys Olu Giy*450

Leu Pho Leu Arl AI8 Oly Thr Phe Leu Gly Thr Leu Olu Cys Glu ArK lie_ L~. Gly Ar~ Ash Pro

L e u ' l l e VJd-Z} Ala IDle Leu-40 Met Thr Asp-60 A ~ Glu lie.SO Oly Leu Arg-100 Oly Pro Thr-120 Trp Leu 8er-140 Set Pros Leu-160 Phe lie Ar~-180" Lye Gly lie-200 Arl[ Ala* Phe-220 Met AIs'IGIy-240* Met Met 8er-~N30 Ash Ale Ile-280 Met AIs Asp-S00 Glu lie Glu-.~0 Lye ArE "'Aia-340 Vsi 8 e r - S e r - 3 ~ He AI. Pro-380 / Thr He 8er-400 I Giy Met Leu-420 Vsl Pro Vsl-440

Figure 3. Organization and amino acid sequence of the EnvZ protein. Panel A shows the major structural features of EnvZ (450 residues), with the amino acid sequence shown at the bottom. The sequence was taken from reference 20. In the top diagram, the filled boxes (a) refer to transmembrane regions 1 and 2 (TM1 and TM2, respectively) while the periplasmic and cytoplasmic domains refer to portions of the molecule localized to the same compartments. The stippled boxes (1) correspond to the three conserved domains, Regions I, II and III and are labeled as I, II and III, respectively. Conserved sequences DXGXG and GXG or conserved residues His-243 and Asn-347 are indicated. In the amino acid sequence the transmembrane domains are shown in bold, and the Region I, II and III domains are boxed. Relevant amino acid residues in these regions are highlighted in bold and point mutations are indicated with a symbol (,). Point mutations correlate with those in Table 1.

pairs and are regulated by a promoter region in front of ompR (20). Both proteins are made from a long polycistronic mRNA that includes a 100- to 123-bp untranslated region (150). Transcription of ompB initiates at a number of start sites within the 5' regulatory region but occurs primarily at two sites, designated T1 and T2 (49). They are reciprocally regulated by cyclic AMP-cyclic AMP receptor protein (cAMP-CRP) complexes that increase the'l"2 transcript and has an overall positive effect on ompB expression (49). Production of the TI transcript is favored by integration host factor (IHF), which has a negative effect on ompBexpression (140). The molecular details of how these transcripts regulate ompB expression are not yet clear, but it has been

Transmembrane Signaling in Osmoregulation

227

proposed that the different transcripts may specify altered ratios of EnvZ and OmpR in the cell, which in turn affect porin production (49, 140). Altered porin patterns in CRP- and IHF-strains seem to support this idea (49, 123, 140).

C. Related Genes OmpB or highly similar ompB-like DNA sequences have been identified in E. coil B, S. typhimurium, Shigella sp., E. cloacae, K. pneumoniae, S. marcesens, (11, 72-74, 91, 128) and X. nematophilus (S. Forst, personal communication). The ompR and envZ genes from S. typhimurium and X. nematophilus have been cloned and sequenced, as well as the ompR gene from E. coil B (74, 91, and S. Forst, personal communication). Comparisons between deduced amino acid sequences reveals that OmpR from E. coli B differs from the E. coli K- 12 OmpR at positions 6 and 130, while the S. typhimurium OmpR differs from the E. coli K-12 OmpR at position 118 (Table 1). There are 21 amino acid differences between E. coli and S. typhimurium envZ genes with most of the alterations occurring in the cytoplasmic signaling region (Table 1). The changes do not occur in any of the amino acid

table 1. Amino Acid Differences between EnvZ and OmpR Proteins from E. coli K-12, E. coli B, and S. typhimurium LT-2a OmpRComparisons E. coil K-12 Lys-6 Ala-ll8 Aia-130

E. coliB

S. t)phi.

Ash-6 Ala-ll8 Thr-130

Lys-6 Pro-liB Ala-130

EnvZ Comparisons E. coil K-12

S. typhi.

E. coil K-12

S. ryphi

Leu-4 Ala-25 Ser-90 Arg-206 Set-260 Gin-262 Ala-303 Glu-320 Tyr-324 Pro-325 Glu-329

Met-4 Val-25 Thr-90 Leu-206 Gly-260 Glu-262 Ser-303 Asn-320 Gin-324 Aia-325 Gin-329

Pro-364 Asn-365 Ala-379 Thr-398 Ile-399 Val-413 Leu-422 Thr-441 Ala-443 Gly-450

Ser-364 His-365 Lys-379 Ser-398 Thr-399 Lys-413 I!e-422 Ala-441 Val-443 Ala-450

Note: aData taken from references20, 74.9 I.

228

ARFAAN A. RAMPERSAUD

residues thought to be important for EnvZ function. Most are found outside of the Region I, If, and 111domains that characterize the sensor class of proteins (see below). S. typhimurium and E. coil B need ompB for porin production. Both OmpF and OmpC are made in S. typhimurium (72-74), while E. coil B only makes OmpF, due in part to deletion of a portion of the ompC gene (106). The ompR gene from S. typhimurium complements an ompR deletion strain of E. coli K-12, indicating that the two OmpR proteins are functionally similar (72-74). Complementation experiments indicate that the E. coil B OmpR is not the same as the E. coli K-12 OmpR

(91). D. Expressionof ompB While OmpR and EnvZ are produced from the same mRNA their expression levels differ considerably (20, 74). Analysis of ompR-lacZ and envZ-lacZ expression in S. typhimurium indicates that EnvZ is produced at levels 10-fold lower than OmpR (74). In both E. coli K- 12 and S. typhimurium, the termination codon for the OmpR protein (TGA) overlaps the initiation codon (ATG) for EnvZ in the sequence ATGA resulting in a 1-bp shift in the reading frame of the envZ gene (20, 74). This arrangement, as well as the absence of a typical ribosome binding site immediately before the envZ gene, probably accounts for the reduced level of EnvZ expression

(20, 74). E. Well Characterized

ompBMutants

Much of our knowledge about EnvZ and OmpR has come from mutant analysis. Tables 2 and 3 show most, if not all, reported ompR and envZ mutants at the time this chapter was prepared and include their amino acid replacements and relative porin phenotypes. It should be emphasized that for OmpR mutants, phenotypes are based on either protein or lacZ expression levels and may not be directly comparable (lacZ determinations are much more sensitive). Interested readers should consult the primary reference for further details.

OmpR Mutants

OmpR mutants have been categorized into three genetic classes depending on their outer membrane phenotypes, ompRl, ompR2 and ompR3 (33, 44, 45). The ompRl class causes an F-C- phenotype; the ompR2 class produces an F+Cphenotype, while the ompR3 class causes an F'C + phenotype. Two other ompR groups have also been reported: ompR20, which produces OmpF but not OmpC at high osmolarity, and ompR40, which produces substantial amounts of OmpC at low osmolarity (96, 97). At least one allele for each class of mutants has been cloned and sequenced and, most are point mutations that alter a single amino acid (see Table 2 and Figure 2).

TransmembraneSignaling in Osmoregulation

229

Table 2. O m p R Mutations and Phenotypes at Low and High Osmolarities Phenotype Mutation a

LOWb

Lys-6 to Asn (E. coli B)

F+C-

Val-lO to lie*

F+C:!:

PhenoO'pe

Highf

Ref. g

F+C-

91

Giy-94 to Asp

F-C-

F,I,CI'

F+C+

F,I,CI"

F-C-

118 26

F-C1"

16

Glu-96 to Ala. (ompR96A )

F-C-

F+C+

Tyr- 102 to Cys. (ompRl02C)

F+C+

26

F"CI" FI"c-

F+C-

Pro-106 to Leu

F+C+

Glu-lll to Lys

F-C +

Leu- 16 to Gin (ompR77)

F+CFJ,CT (d)envZ l l sup

Ala-37 to Thr

F+C+

16 66

Arg-115 to Set. (ompRllSS)

F-C-

F-C +

96

(d)

F,I,c l '

83 I 18

FJ,CI'

118

F-Cn.d. Dn~P

16

F-C-

Gly- 129 to Asp

F+C-

Ala- 130 to Thr (E. coli B)

F+C-

57

F-C-

F~C~

Pro-131to Ser (ompR307)

F+C~

F+C+

Val-82 to Met

F~C~

Gly 141 to Asp Arg- 150 to Cys (ompR20)

F-C-

95

F+cl "

118

F+C-

91

F+cl "

118

F+cl "

118

Arg- 150 to His

F+c9

F1"r

96

(c) 118

(c) Set-163 to Asn

F+C~

F-C-

16 66

AGly- 164 to Arg182, (ompRlOl)

F-C-

F~C1'

26

Aia-167 to Val

F~C -

F+cl "

118

F-C= (e)

96

F'rc'r

118

F=C-

18

F+cl '

118

(c) F,I,CT

97

Arg- 182 to Cys

F-C(d)

(e) FI"cT

(c)

F-C-

(r

(d)

Arg-71 to Cys (ompR40)

18

(r

(d)

Asp-55 to Ala

F-C-

(d)

(d) F-C=

118

(r

(c)

OmpRX6, 3 a. a. insertion at Vai-53 Asp-55 to Gin

67

(d)

(c)

Ser-48 to Phe

FJ,cT

(c)

Arg 15 to Cys (ompR36)

F+C+

95

F,[,C'I'

F-C-

(d)

Met-40 to lie

F-C-

(d)

(d) Asp- 12 to Val

18

(c) F,I,CI"

F-C-

F-C-

(d), endZind

(d) Asp- 12 to Gin

Ref.8

(d)

(d) Asp- 12 to Ala

Highf (d)

(d) Asp- I 1 to Asn

Lowb

(d) (c)

Asp- ! I to Ala

Mutationa

118

Ala-189 to Val

F+C(c)

(continued)

ARFAAN A. RAMPERSAUD

230

Table 2. (continued) Phenotype Mutation a

Lowb

Thr-83 to Ala

F+C + F,I,c T (d)env2~ nd

Glu-87 to Lys

High f

F• +

F,I,CT

PhenoOpe R~ g

17

Mutation a

Low b

F• "

118

Gly-191 to Ser

~c-

118

Glu- 193 to Lys

Pc+

F+C +

Pc+

118

(e) FTCT

I 18

(c) Gly-94 to Ser

~8

(r FTCT

F-C"

~c1'

(c)

(r Asp-90 to Ash

Ref. s

Arg- 190 to Cys

(r Val-89 to Met

High f

F,I,CI"

17

Val-203 to Met,

F+C " F+C (e)envZll r

97

(ompR472) Val-203 to Gin

F+C -

46

(d)e,wz ~d

F+C "

(d)envZll s Arg-220 to Cys (ompR324) and S. o'phi. .

.

.

F+C-

FTC~ (e)

]]8 75

.

Holes: qVlutations are shown using standard three letter abbreviations and col'respond to those shown in Figure 2. The original residue is shown first and alleles are indicated. * OmpRV 101 also has a point mutation at the ribosome binding site (118). ~henotypes were taken from (c) measurements of [3-galactosidase of ompF-lacZ or ompC-iacZ operon fusions; (d) outer membrane porin patterns: or (e) both. /Relative phenotypes at low and high osmolarity conditions are indicated by a plus sign (+) for moderate to high levels of expression; a (• sign for low levels of expression or: a negative sign (-) for very low levels of exwession or none at all. Relative changes in ompF and ompC expression levels are indicated by a (,[) or (~) sign to indicate overall decreases or increases, respectively. Other abbreviations are envZll wp, em,ZIi suppressor: em,Z~, em,Z independent: D I I ~ upsuppressor of OmpR(D 11N); en~,Zllr insensitive to envZll and em,Zl l s sensitive to envZi l. # Numbers refer to references at the end of the chapter.

The ompRlO1 allele is a member of the ompR1 class of mutants (33, 44, 45). Its porin-minus phenotype is due to the lack of functional OmpR (31, 96). DNA sequencing of the ompRlOl gene reveals a loss of nucleotides between positions 547-789 that corresponds to an in-frame deletion of Gly164 to Arg182 (96). In diploid analysis, ompRlOl is recessive to most ompR mutants (44, 126), as would be expected for a null mutant. However, ompRlOl negatively compliments an ompR4 allele (a member of the ompR2 class of mutants), indicating that ompRlOl is not completely without function (44). This curious interference characteristic has also been shown for ompRlOl genes carried on multicopy plasmids in wild type cells (97). The ompR472gene is the best characterized ompR2mutant and produces an WC" porin pattern regardless of medium osmolarity (44, 126). In diploid studies ompR472 is recessive to wild-type ompR as well as to ompR3 (120, 126), but is not

Transmembrane Signaling in Osmoregulation

231

Table 3. EnvZ Point Mutations and Deletions EnvZ point Mutations

Comment/ Phenotype

Ref.

EnvZ point Mutations

Leu-18 to Phc

FCC-

136

Thr-247 to Arg,

Leu-35 to Gin,

F-C+

83

F-C c

136

Pro-41 to Leu

F-C c

136

Gin-44 to stop,

low levels of F and C

*

Tyr-351 to Ser, (envZ30)

Pro-159 to Set, (envZ250)

F-C-

118

* Sequence from S. Forst (unpublisheddata).

Arg- 180 to Cys

FCC-

136

Truncated E n v Z

Pro-185 to Leu

F-C c

136, 46

Ala-193 to Val

F'-Cc

46

Glu-212 to Lys

~c c

46

Aia-219 to Val,

low levels o f f

136, 149

(envZl60) Pro-41 to Ser

(envZ22)

(envZ3) Ala-239 to Thr

and C F-'C-

Comment/ Phenotype

R~

F"C'c

83

Pro-248 to Ser

F"C c

136

Arg-253 to His

F-C"c

46

(envZll)

non-functional ompR36 suppressor

65

Comment

Ref.

envZllS(411 a.a.) From Ala-39 to

53

Gly-450 EnvZ* ('369 a.a.)

From Tyr-81 to Gly-450

EnvZc (270 a.a)

From Arg- 180 to Gly-450

lib

1 30

Gly-240 to Glu

F-C c

16

Val-241 to Gly,

F-C c

149

Asn-381 to D, Q, A, T, C or H

12

F-C c

136

GI: G409A, G411A and A413S

152

G2: G437A,G439A, A441G and 1442L

152

(envZ473) Ser-242 to Asp His-243 to Val

envZ22-1ike

30

His-243 to Arg

envZ22-1ike

66

Tar-EnvZ Mutants

EnvZ hlternal Deletions

gel.

Comment

envZAB, (412 a.a.). From Ala-38 to

Ref. 137

Ile-80

envZAC, (428 a.a.) From lie-80 to

137

Glu-106

affected by strong OmpC producing envZ mutants such as envZll or envZ473 (46, 126). Other R2 alleles such as ompR321, and ompR307 are, to varying degrees, sensitive to envZ473, indicating that not all ompR2 mutants are equivalent (46, 120, 126). An OmpR2-1ike phenotypr is also generated by an OmpR-LacZ fusion in which all but the last amino acid of OmpR is fused to the C-terminal portion of the ~-galactosidase enzyme (10, 126).

232

ARFAAN A. RAMPERSAUD

Genetic data indicate that ompR472 has lost the ability to negatively regulate ompF expression (126). The OmpR472 protein has a Val-to-Met replacement at position 203 in its amino acid sequence (V203M) (96) and has been shown to only bind activator sites in the ompF promoter (87, 142). A DNA-binding defect explains why ompR472 is not affected by envZll or envZ473, since envZmutants indirectly influence DNA-binding activity by affecting intracellular OmpR-P levels (2, 32, 126, 149). It is not clear whether the DNA-binding defect of OmpR472 is due to an altered protein-DNA interaction or an inability to adopt an appropriate DNA-binding conformation (i.e., a high osmolarity form) (46, 126). Based on genetic studies, OmpR472 requires EnvZ for its phenotype, indicating that the protein is not fixed into a conformation that acts independently of EnvZ (126). OmpR472 does appear to interact with the ompC promoter since in certain genetic backgrounds an ompR472 allele can activate ompC expression (139). Additionally, an OmpR mutant having a glutamine instead of a methionine substitution at Val-203 produces a strong !72 phenotype in a wild-type envZ background, but unlike OmpR472 is sensitive to an envZll niutant (46). For the OmpRV203Q mutant, an inability to adopt a (DNA-binding) conformation for ompC activation is thought to be the underlying reason for its R2 phenotype (46). The ompRl07, ompRllO and ompR36 alleles are members of the ompR3 class of mutants (phenotypically F-C +) and are dominant to virtually all other ompR alleles (44, 97, 126). In particular, ompRl07 and ompRllO maintain their OmpF-minus phenotypes even in an ompR472 background (126), and this led to the conclusion that OmpR actively represses ompF expression (126). The OmpR36 mutant has an Arg-15-to-Cys replacement (96), which seems to allow the protein to be phosphorylated but not dephosphorylated by EnvZ (2). Phosphorylated OmpR36 is thought to accumulate in an ompR36 strain and ultimately cause an F-C + phenotype (2). This is one of several studies that has correlated elevated levels of OmpR-P with ompC expression. At low osmolarity ompRl07, ompRllO strains require envZ for their phenotype (126). They can also produce the same porin patterns in the absence of envZ provided that cells are grown at high osmolarity (126). This may be explained on the basis of an EnvZ-independent phosphorylation (crosstalk) pathway that operates at high osmolarity to phosphorylate OmpR3 mutant proteins. The porin phenotypes of ompR3 mutants are very similar to those caused by envZll or envZ473 mutants (discussed next). However, in an envZll or envZ473 strain, OmpR causes pleiotropic effects on other genes (77, 147, 148) while ompRl07 and ompRllO alleles have no such effects (126). Thus, an ompR3 mutant is distinct from the pleiotropic form of OmpR. EnvZ Mutants

Table 3 shows most EnvZ missense mutants and their resulting porin phenotypes. The best characterized mutants are envZll and envZ473 (33, 44). Both produce an

TransmembraneSignaling in Osmoregulation

233

F-C + porin pattern, have similar phenotypes in diploid analysis, and are pleiotropic on the same subset of genes (33). They are dominant to most other envZ alleles as well as a number of ompR mutants (44, 126). The amino acid replacements in EnvZ11 and EnvZA73, (Thr-247 to Arg and Val-241 to Gly, respectively) are close to each other (83, 149), suggesting their common phenotypes are due to similar biochemical defects. In this regard, the EnvZ11 protein is known to lack phosphatase activity yet retains its kinase activity (2). A similar defect may also apply for EnvZ473 because high intracellular levels of OmpR-P are found in both envZll as well as envZ473 strains (32, 149). Once again a relationship can be drawn between elevated OmpR-P levels and an F-C + phenotype. The envZll or envZ473 alleles characteristically depress the levels of a number of proteins that are not normally osmoregulated by EnvZ (19, 77, 147, 148). The affected proteins include the PhoA and PhoE proteins that constitute part of the pho regulon (148); MalE, MalT, and LamB proteins that are part of the real regulon (19); and several iron regulated proteins (77, 147). The pleiotropic effects of envZ473 are mediated through OmpR (124). This suggests that EnvZA73 (and EnvZll) modifies the DNA-binding properties of OmpR in a way that interferes with the normal transcription of other genes. In an envZll mutant, transcription of the malT gene, encoding the positive regulator MalT, is decreased (19), and this subsequently decreases the transcription of male and lamb genes. Reduced PhoA levels are not due to decreased phoA transcription but rather are caused by a post-transcriptional defect (I 48). On the other hand, rpoA mutants (encoding the 0~subunit of RNA polymerase) suppress the PhoA- phenotype of envZ473 (35, 125), presumably by affecting OmpR. One way of explaining these rather complicated results may be to consider that pleiotropic forms of OmpR interfere with the transcription of genes encoding posttranslational processing enzymes. For example, the dsbA gene, encoding the processing enzyme disulfide oxidoreductase (10a), has been shown to influence OmpF as well as PhoA production (lOa, 110), and its transcription could be affected by pleiotropic OmpR. A number of EnvZ missense mutants such as EnvZ(P41S) (136), EnvZ(PI85L) (136, 46), EnvZ(212K) (46), and EnvZ(G240E) (16) behave identically to EnvZ 11. All produce an F'C + porin phenotype, and most have been shown either directly or indirectly to lack phosphatase but have kinase activity (16, 46, 136). In some cases they have been shown to cause pleiotropic effects on Male production as well (136). One ompR mutant, ompR77, has been isolated for envZll; it not only restores the F+C+ phenotype but also suppresses pleiotropic effects (83). OmpR77 is allele-specific since it has no effect on wild-type envZ or another envZ mutant, envZl60, that produces a F'C + porin pattern (83). This was one of the first studies to indicate a functional interaction between EnvZ and OmpR. Sequencing of the ompR77 gene identified a point mutation that created a Gin replacement at Leu-16 in the protein (83). In vitro, OmpR77 protein is poorly phosphorylated by EnvZ11 but appears to be normally phosphorylated and dephosphorylated by wild-type EnvZ (2). The results suggest that OmpR77 is a poor in vivo substrate for EnvZl 1 (2).

234

ARFAAN A. RAMPERSAUD

The envZ250 and envZ247 alleles represent a new class of mutants that are characterized by their F-C- outer membrane phenotypes (118). They are not null mutants since they are codominant with either wild-type envZ or an envZ473 allele (118); null mutants such as envZ22 are completely recessive to all envZ alleles (36). Furthermore, strains missing the EnvZ protein (such as envZ22 or AenvZ) still produce low levels of OmpF and OmpC due to EnvZ-independent phosphorylation mechanisms (see below). Both EnvZ250 and EnvZ247 proteins have been shown to lack kinase but not phosphatase activity, and this activity results in the continuous dephosphorylation of OmpR. The lack of OmpR-P in these cells prevents expression of either porin gene (118). This is the one of the prime reasons for considering nonphosphorylated OmpR as nonfunctional.

IV. STRUCTURE OF OMPR AND ENVZ EnvZ and OmpR are related to other proteins involved with adaptive processes. These include the (sensor/response regulator) CheA/CheY proteins that facilitate chemotaxis; the NtrB/NtrC pair that mediates adaptation to nitrogen availability, and PhoR/PhoB proteins that mediate adaptations to phosphate availability (.5, 14, 101, 108, 131). There are residues or amino acid sequences that are common to most members of the sensor or response regulator classes. These are pointed out below along with current ideas about their potential function.

A. OmpR Structure Wild-type and mutant OmpRs as well as several N-terminal and C-terminal fragments have been purified to homogeneity (26, 63, 69, 103, 133) and the full length non-phosphorylated protein shown to be monomeric (63). OmpR has a modular organization with an N-terminal phosphorylation domain and a C-terminal DNA-binding domain (26, 69, 133, 142). In general, this modular organization is a recurring theme among response regulators (71, 101, 108, 131). A truncated OmpR protein, containing the first 122 amino acids (Met-1 to Arg-122), has been created through molecular cloning techniques and shown to be phosphorylated as well as dephosphorylated by EnvZ (69). This not only localizes the phosphorylation region to the amino terminus of OmpR but also shows that this domain folds independently of its C-terminus into a structure that interacts with EnvZ. N-terminal OmpR cannot directly regulate porin genes, because it does not have a DNA-binding domain, but it may do so indirectly. In an envZll strain, overproduction of N-terminal OmpR changes porin patterns from an F-C* to an W'C§ phenotype (94). The truncated OmpR is thought to compete with intact OmpR for phosphoryl groups on EnvZ11 (94) and thereby reduce the amount of full-length OmpR-P in the cell. Due to decreased levels of intact OmpR-P, ompF expression

TransmembraneSignaling in Osmoregulation

235

is subsequently restored in the envZll strain. A similar reasoning could explain the curious negative complementation data observed between ompRlOl and ompR4 (44, 75, 97). Since the ompRlOl gene product is probably only a truncated N-terminal molecule, it may compete nonproductively with OmpR4 for phosphoryl groups on EnvZ and reduce the levels of phosphorylated OmpR4 protein. The C-terminus of OmpR contains the DNA-binding domain (69, 133, 142). LacZ-OmpR fusions and purified C-terminal fragments inherently bind to OmpR target sites in ompF and ompC promoters (69, 133, 142). Sequential shortening of LacZ-OmpR fusions indicates that the DNA-binding domain lies between residues 123 and 239 of OmpR (117 amino acids) (142). In comparison to the full length OmpR, in vitro DNA binding by a purified C-terminal fragment is relatively weak (69, 133). Additionally, expression of LacZ-OmpR or C-terminal versions in cells do not activate either porin gene (94, 142). These studies indicate that the amino terminus of OmpR is needed for full activity and probably provides additional functions that not only enhance DNA binding activity but also stimulates gene expression.

B. Organization of EnvZ EnvZ is a transmembrane protein of the inner membrane (28). Its topology consists of a periplasmic (115 amino acids) and cytoplasmic domain (271 residues) separated by two transmembrane segments, TM 1 (approximately 32 amino acids) and TM2 (approximately 17 amino acids) (33). There is also a short 15 amino acid signal peptide-like region at the amino terminus (33). Membrane-bound forms of EnvZ have been studied in total or as purified inner membranes preparations (117, 136, 138, 151, 152), but purification of the intact protein and reconstitution of its catalytic activity has not yet been reported. Several truncated forms of EnvZ, lacking portions of the amino terminus, have been purified for biochemical analysis (1, 30, 54, 55). Recent studies show that the cytoplasmic domain (amino acid residues from Glu-106 to Gly-450) purifies as stable dimer (S. Forst, personal communication). The C-terminus of EnvZ undergoes phosphorylation and phosphate transfer to and from OmpR and is therefore considered to be the signaling domain (I, 30, 55). Overall, the topology of EnvZ is very similar to that of the bacterial chemoreceptor proteins Tar, Tsr, and Trg that have sensing and signaling functions at their periplasmic and cytoplasmic domains, respectively (28, 33). By analogy to these proteins, the osmosensing region of EnvZ might be located at the periplasmic region with the transmembrane region possibly assisting in the transduction of information from one side of the membrane to the other. However, the osmosensing role of the periplasmic region has not been clearly established.

236

ARFAAN A. RAMPERSAUD

C. Relationshipswith Other Proteins The N-terminal phosphorylation domain of OmpR (the first 125 amino acids) shows sequence similarities to other response regulators including the CheY protein that mediates chemotaxis (101, 108, 129-131). The three-dimensional structure of CheY (129 amino acids) has been elucidated (129) and reveals a doubly wound a/IS protein in which a core of 5 parallel ~-sheets are surrounded by 5 a-helices (129-131). The CheY phosphorylation site, Asp-57 (121), is in an acidic pocket formed at the top of the molecule where short loops connect the C-terminus of [}-sheets to the N-terminus of the following a-helices (129-131). Two additional aspartates, Aspl2 and 13, located at the C-terminal end of the ~51 strand, help form the acidic pocket and are involved in essential metal binding (129-131). A lysine residue at the C-terminal end of the ~5 strand Lys 109 may be close to Asp-57 and is thought to be displaced from its position by phosphorylation of Asp-S7. The movement may propagate or cause conformational transitions important to the function of CheY (108, 130). Virtually all response regulators, including OmpR, have aspartate and lysine residues that closely correspond to those mentioned in the CheY molecule (101, 108, 131). This is shown for OmpR in Figure 2 where the secondary structure of CheY (a pattern of alternating ~-sheets and o~-helices) is shown on top of the amino acid sequence of OmpR. In OmpR, Asp-S5 is the site of phosphorylation (16, 17, 26, 66) and lies at the C-terminal end of a putative ~3 strand (as in Asp-S7 of CheY). Three aspartate residues, Asp- 11, Asp- 12, and Asp- 13, are at the C-terminal end of the [31 strand and may help in forming an acidic pocket. Based on site-directed mutagenesis, Asp-11 and Asp-12 correspond to the relevant aspartate residues in CheY (Asp- 12 and Asp- 13) (5, 16, 17, 26, 66). Another highly conserved residue is Lys-105 (5, 101, 108, 130, 131) that, according to Figure 2, would be somewhere near the C-terminal end of the [55 strand. As will be discussed below, OmpR probably also undergoes conformational changes at its amino terminus upon phosphorylation, and this change might involve the Lys-105 residue. While the structure of CheY has provided insight into how the N-terminus of OmpR may look, the rest of OmpR is completely unknown. This makes it difficult to predict how phosphorylation and conformational transitions would influence other properties of OmpR such as, DNA-binding, OmpR subunit interactions, and RNA polymerase interactions. The DNA-binding region of OmpR does not have structural motifs characteristic of many transcription factors (helix-turn-helix or zinc fingers motifs) but the domain is related to a subset of response regulators having somewhat related DNA-binding regions (5, 108). These proteins include the PhoB and VirG proteins (for phosphate regulation and plant virulence, respectively) (5, 108). Based on the related sequence of their target promoters, they are proposed to share a common mechanism of transcriptional activation (8).

TransmembraneSignaling in Osmoregulation

237

EnvZ and other sensor/kinase proteins are related to each other through their signaling domains (5, 101, 108, 131). Segmented sequence similarities are found within a 200 amino acid stretch at the C-terminus and are separated by regions of poor homology (5, 101, 108, 131). These are shown in Figure 3 as Regions I, II, and III. Region I is short and contains a histidine residue that is totally conserved among all members of the kinase family. This is believed to be a site of phosphorylation, and in EnvZ the histidine residue occurs at position 243 (5, I01, 108, 131). It is interesting to note that many missense mutations in EnvZ occur near or within Region I (see Figure 3 and Table 3). The two remaining segments of sequence similarity are found near the C-terminal portion of EnvZ (Figure 3). In many sensor/kinase molecules Region II is located approximately 100 residues away from Region i and is characterized by at least one asparagine residue (101, 108, 131). In EnvZ the conserved residue is Asn-347, and in a chimeric signal transducer, Tar-EnvZ, it occurs at position 381 (see below). This amino acid has been extensively altered in Tar-EnvZ (see Table 3) where it has been shown to be essential for kinase activity but not for phosphatase activity (152). The Region IIl segment is a long glycine-rich stretch of residues characterized by the sequence motifs DXGXG and GXG (101, 108, 131). They may represent a potential nucleotide binding motif (101, 108, 131). These sequences have also been studied in the Tar-EnvZ molecule where they have been designated as G 1 and G2, respectively (Figure 3). They are also essential for kinase activity, but have different effects on phosphatase activity (152).

V. PHOSPHORYLATION STUDIES OF OMPR AND ENVZ Phosphorylation of OmpR is essential for porin gene expression. It occurs in both an EnvZ-dependent as well as EnvZ-independent fashion (crosstalk). EnvZ-dependent phosphorylation is the primary pathway for generating OmpR-P and is comprised of both kinase as well as phosphatase reactions. The ratio of these two activities is crucial for porin gene expression. Details of this process as well as crosstalk mechanisms are discussed below.

A. PhosphateTransfer Reactions EnvZ incorporates the terminal phosphate from ATP to form a stable phosphoprotein (1, 30, 55). This has been shown for several purified molecules lacking portions of their amino terminus as well as intact, membrane-bound forms of the enzyme (1, 30, 54, 55, 117, 138, 151, 152). Autophosphorylation of EnvZ has been reported for the truncated molecules (1, 53), while membrane-bound EnvZ and the related protein Tar-EnvZ undergo transphosphorylation reactions (151). The importance of auto- versus transphosphorylation reactions for in vivo function of EnvZ remains to be clarified.

238

ARFAAN A. RAMPERSAUD

Site-directed mutagenesis indicates EnvZ is phosphorylated at the conserved histidine residue, His-243, in Region I (30, 66). Phospho-EnvZ is reasonably stable with the phosphorylated amino acid residue having a pH-stability profile typical of a phosphoramidate linkage (30). More recently, the phospho-histidine residue has been directly identified by chemical methods (J. Delgado and M.I. Inouye, unpublished results, S. Forst, personal communication). Incubating phospho-EnvZ with purified OmpR results in the transfer of phosphate from EnvZ to OmpR (1, 26, 30, 54). The overall reaction is fast, exhibits a metal-dependence, and is affected by monovalent as well as divalent ions (I, 30, 54, 117, 138). The site of OmpR phosphorylation (by EnvZ) is Asp-55 (26). This has been shown by pH-stability studies, which characterized the linkage as an acyl phosphate bond (30), and site directed mutagenesis of the Asp-55 residue (see below). Newer studies employing HPLC of tryptic peptides fragments derived from [3H]borohydride-reduced phospho-OmpR and subsequent peptide sequencing demonstrates that the majority of phosphate is located on Asp-55 (26). Phospho-OmpR is labile but has a longer half life than most other phosphorylated response regulators (1, 54, 101). When incubated with either ATP or EnvZ, there is little loss of phosphate from OmpR-P (1, 54). However, when both EnvZ and ATP are present, OmpR-P is rapidly dephosphorylated with the subsequent release of inorganic phosphate (I, 54). ATP can be substituted with adenosine nucleotides such as ATP-7-S, AMP-PNP, and AMP-PCP without inhibiting the dephosphorylation reaction (I, 54). Thus, hydrolysis of nucleotide is not a mandatory step during the reaction. It has been proposed that the nucleotide component may serve as an allosteric effector for dephosphorylation (1, 54). While it is not yet clear whether dephosphorylation activity resides solely in EnvZ or occurs through some sort of EnvZ-OmpR interaction, it seems unlikely that dephosphorylation of OmpR is the reverse of the phosphorylation step. The reactions are mechanistically different since phosphorylation requires a phosphorylated EnvZ intermediate, while dephosphorylation liberates inorganic phosphate without the formation of a (stable) EnvZ-intermediate (1, 54, 65). Several EnvZ mutants have been isolated that have lost one but not both activities, implying that different portions of the molecule (different catalytic sites) are involved in the two reactions (2, 118, 46, 136). Some amino acids may participate in both reactions since it is possible to obtain EnvZ mutants that have lost both activities, such as EnvZ(H243R) and EnvZ(T35 IS) (65, 66). Thus, the regions for kinase and phosphatase activities may overlap to a certain degree.

B. PhosphorylationMutants of EnvZ and OmpR The EnvZ(H243V) and EnvZ(H243R) have amino acid replacements at His-243 and are not phosphorylated by ATP (30, 66). Subsequently they do not phosphorylate OmpR (30, 66). In the case of the His-to-Arg replacement, there is also a loss of OmpR-dephosphorylation activity (66). The outer membrane porin phenotype

TransmembraneSignaling in Osmoregulation

239

produced by both mutants closely resembles that of an envZ null mutant in that it produces low levels of OmpF at low osmolarity and a small amount of OmpC at high osmolarity (66; A. Rampersaud, unpublished observations). The results can be interpreted in a fashion similar to an envZ null mutant (see below). That is, while EnvZ is important for producing OmpR-P, it is not the only means by which OmpR-P is generated. The three aspartate residues that form the putative phosphorylation domain of OmpR, Asp- 11, Asp- 12, and Asp-55 have been studied by site-directed mutagenesis (16, 17, 66). Mutants having an asparagine substitution at Asp-I 1 (D 1IN) or glutamine substitution at Asp-55 (D55Q, the phosphate acceptor site) do not produce significant amounts of OmpF or OmpC in the outer membrane and cannot be phosphorylated by EnvZ in vitro (16, 66). They do not bind OmpR-target sites in the ompF promoter indicating that interactions with the ompF promoter requires OmpR-P (16). A different situation applies to ompC since it appears that both mutants bind to the ompC promoter (16). In this case OmpR-P may be needed for transcription of the ompC gene. Valine or glutamine replacements at Asp- 12 (D 12V and D12Q, respectively) are somewhat variable in their effects on porin gene expression, with the D 12V mutant shown to be phosphorylated (albeit poorly) by EnvZ (16, 66). The three aspartates have also been changed to alanine residues (26) as its smaller side chain avoids distortions of the acidic pocket that would otherwise be introduced by asparagine or glutamine residues. In vitro results with these mutants support the view that EnvZ phosphorylates OmpR at Asp-55, but in vivo results are somewhat different. In particular, an OmpR(D55A) mutant was found to produce both porins while a double mutant, OmpR(D55A, D 11A), produced none (26). Low but significant levels of phospho-OmpR(D55A) were also found in an in vivo phosphorylation experiment (26), and this led to the conclusion that Asp-11 is another site for OmpR phosphorylation. Presumably, this site is phosphorylated through an EnvZ-independent mechanism (crosstalk) (26).

C. Formsof OmpR-P Biochemical, genetic, and physiochemical studies demonstrate that EnvZ phosphorylates OmpR for ompF and ompC expression and that OmpR-P mediates ompF repression (16, 17, 26, 66, 126). Thus, porin genes are regulated through one or more phosphorylated species of OmpR rather than through an on/off switching mechanism between non-phosphorylated and phosphorylated forms (118). Two different models can explain the overall process: A quantitative one, involving changes in the total amount of a single phosphorylated form, or a qualitative model involving multiple phosphorylations on individual OmpR molecules (118, 126). In vivo phosphorylation studies have shown a significant increase in OmpR-P levels during an osmotic stress, and this is consistent with a quantitative model (32). However, multiple phosphorylations on OmpR could also produce the same results.

240

ARFAAN A. RAMPERSAUD

Mathematical modeling has led to the conclusion that a single species of OmpR-P can account for porin gene expression, provided that OmpR-P differentially binds to DNA target sites in ompFandompCpromoters (126). That is, there must be highaffinity activator and low-affinity repressor sites in ompF to rationalize how low levels of OmpR-P activate ompF while high levels of OmpR-P repress it. Intermediate affinity or similar low-affinity sites are needed in ompC to account for ompC expression at intermediate levels of OmpR-P (126). So far, DNA-binding studies, at least with the ompFpromoter, are consistent with this proposal (A. Rampersaud, S. Harlocker and M.I. Inouye, manuscript in preparation). This does not eliminate the possibility that qualitative changes in OmpR occur, and in fact, multiple phosphorylations of OmpR may explain pleiotropic effects (see below). The particular amounts of OmpR-P needed for a certain porin phenotype are unknown. According to the diagram shown in Figure 1B, the total amount of OmpR in the cell remains constant while the ratio of OmpR-P to OmpR varies. Upper limits of OmpR-P levels can be set that separate one phenotype from another. Between these boundaries, levels of OmpR-P can vary without significantly altering phenotype. Whether such threshold levels actually exist remains to be determined, but the graph provides a useful picture of the dynamic fluctuations in OmpR-P levels.

D. Importance of a Phosphate Relay Cycle for Porin Gene Expression The relative phosphorylated state of OmpR is determined by EnvZ through a combination of its kinase and phosphatase activities (89, 118, 126). These opposing activities form a phosphate relay cycle in which both activities seem to operate simultaneously. Phosphatase activity prevents the build-up of excessive OmpR-P levels, while kinase activity provides a continuous supply of OmpR-P. Low levels of OmpR-P are produced when these activities differ slightly. Larger differences in the ratio of kinase to phosphatase activities cause more substantial changes in OmpR-P levels (89, 118, 126). Several EnvZ mutants have already been mentioned that are disrupted for a portion of their phosphate relay cycle. The EnvZ11 mutant does not have phosphatase but retains kinase activity (2), while the gene products of the envZ250 and envZ247 mutants, EnvZ(Pl59S) and EnvZ(A239T), respectively, are both defective in their kinase but not phosphatase activity (126). These mutants represent the two extremes of the cycle where the kinase/phosphatase ratio is either very high (EnvZ l 1) or very low [EnvZ(P159S) and EnvZ(A239T)]. The corresponding porin phenotypes are F-C+ for EnvZl I and F C - for the other two. The low osmolarity F'C- porin pattern is absent as an extreme phenotype indicating that it cannot be made by one activity alone. Thus, the phosphate relay cycle may be particularly important for sustaining low enough levels of OmpR-P so as to activate ompF expression without activating ompC.

Transmembrane Signaling in Osmoregulation

241

In addition to EnvZl 1, OmpR36 is also disrupted in the dephosphorylation part of the cycle (see the earlier section on ompB mutants) and suppressors for both mutants, ompR77 for envZll (2) and envZ30 for ompR36 (65), have been isolated. The suppressors compensate for lost dephosphorylation activity by reducing the accumulation of OmpR-P and thereby restore OmpF expression as well as a certain degree of osmoregulation (2, 65). OmpR77 has been shown to be a poor substrate for EnvZ11 while EnvZ30 is completely nonfunctional, leaving OmpR36 protein to be phosphorylated through crosstalk mechanisms (2, 65).

E. Alternative Routes of OmpR Phosphorylation EnvZ-minus strains such as envZ22 and AenvZ make low amounts of OmpF and OmpC in the outer membrane and elevate OmpC levels further at high osmolarity conditions (29, 36, 88, 146). In an in vivo phosphorylation study, low but significant amounts of OmpR-P were found in the envZ22 strain with further increases in OmpR-P levels occurring at high osmolarity conditions (32). These results are explained on the basis of an EnvZ-independent phosphorylation mechanism that produces enough OmpR-P for porin gene expression. While the responsible components of this pathway have not been identified, related crosstalk or cross-regulatory phosphorylation pathways have been reported for other response regulators such as CheY and PhoB (102, 148a). One way OmpR can be phosphorylated in the absence of EnvZ is through related sensor proteins. In vitro studies have shown that OmpR can be phosphorylated by the CheA protein, which is the kinase for the CheY molecule (54). Furthermore, a gene designated barA, has been isolated, which in multiple copies complements an envZ deletion strain (93). The BarA protein has sequence similarities to conserved regions in both EnvZ as well as OmpR and is suspected to use its kinase activity to phosphorylate OmpR (93). While it seems clear that OmpR can be phosphorylated by related sensors, the reactions require high levels of either OmpR or the kinase (54, 93). This raises the question of whether the cellular levels of these kinases are high enough to be physiologically relevant for OmpR. An alternative and more attractive means of OmpR phosphorylation may be through the direct abstraction of phosphate from a high energy phosphate donor. The related proteins CheY and CheB can catalyze their own phosphorylation when provided with high energy substrates such as phosphoramidate, acetyl phosphate, or carbamoyl phosphate (76). In this same study OmpR was mentioned as being capable of similar phosphorylations. Regardless of how it happens, studies of the OmpR(D55A) mutant indicate that phosphorylation through crosstalk pathways takes place on Asp-I 1 (26). Under normal circumstances this phosphate group may be removed by the phosphatase activity of EnvZ. Evidence for this is indirect and is based on the envZ250 and envZ47 alleles, which code for mutants having phosphatase but not kinase activity.

242

ARFAAN A. RAMPERSAUD

Crosstalk does not occur in these strains presumably because the mutants are removing phosphate at Asp-11. It is intriguing to ask whether crosstalk contributes to the pleiotropic effects observed in EnvZ phosphatase mutants (e.g., EnvZ11 or EnvZ473). Such mutants may be unable to dephosphorylate any aspartyl-phosphate residue on OmpR. Hence, OmpR could acquire two phosphate groups: one at Asp-55 from the EnvZ mutant and the other at Asp- 11 through crosstalk. The double phosphorylation event would then convert OmpR into a pleiotropic regulator. VI.

ENVZ S I G N A L I N G

While the role of EnvZ as a kinase/phosphatase for OmpR is well established, evidence that would associate these activities with environmental sensing remains elusive. This link is essential to the model of osmoregulation since environmental conditions are proposed to be responsible for fluctuations in OmpR-P levels. In this section, information concerning the role of EnvZ as a sensory molecule is summarized.

A. Osmosensingby EnvZ A portion of the amino terminus of EnvZ projects into the periplasmic space and may receive an environmental signal. While the nature of the signal is unknown, one model suggests that environmental stimuli cause conformational changes at the periplasmic domain, which then modulates the cytoplasmic signaling domain (137). According to this model, the two transmembrane segments TM1 and TM2 would be important for transmitting information from one side of the membrane to the other (137). EnvZ has been compared to hypothetical osmosensor proteins such as turgor pressure sensors, wall stretch receptors, and stretch receptors in order to more clearly define its function (24). It was pointed out that model osmosensors detect transient osmotic signals, such as ion fluxes, pressure differentials, cell wall or membrane stretching, for short term activation events, while porin gene regulation continues well after cells have adapted to an osmotic stress (24, 64). It therefore seems unlikely that transient physiochemical events activate EnvZ for signaling (24). Another way that EnvZ might work would be by indirectly detecting osmotic conditions, perhaps by responding to a long lived signal that is itself sensitive to osmolarity. In this regard the levels ofperiplasmic membrane~erived oligosaccharides (MDO) change dramatically during an osmotic stress, and these have been considered as potential signals for EnvZ (27a). However, recent studies have challenged this idea by showing that OmpF and OmpC production as well as osmoregulation are not significantly affected in strains having an mdoA mutation (which encodes one of the MDO biosynthetic enzymes) (38). Thus, it is unlikely that MDOs are signals for EnvZ.

TransmembraneSignaling in Osmoregulation

243

B. The Amino Terminus as the Sensor Domain

While osmosensing activity of EnvZ remains unclear, the general importance of the amino terminus for proper osmoregulation has been established through several indirect studies. For example, truncated EnvZ fragments missing substantial portions of the first transmembrane segment (TMI) (53) or regions further into the N-terminus (88) produce a constitutive F+C+ phenotype. While these C-terminal domains can still transmit information to OmpR, their unregulated porin phenotype indicates that they have lost their ability to respond to osmotic changes. This suggests that a C-terminal fragment of EnvZ by itself cannot account for all of the functions of the intact protein and implies that the amino terminus of EnvZ contains a region necessary for osmoregulation. EnvZ mutants having amino acid replacements in TM 1 and at positions flanking the second transmembrane segment (TM2) are shown in Table 3 and provide insight into the role of the transmembrane regions for signaling. Amino acid replacements in TM1 include LI8F, L35Q, P41S, and P41L while two mutations, P159 and R180C, immediately flank TM2 (83, 118, 136). The EnvZproteins that carry these missense mutations exhibit a variety of altered osmoregulatory porin phenotypes with several of them showing significant changes in their phosphorylation or dephosphorylation properties towards OmpR (136). These experiments demonstrate that mutations in or near the transmembrane region of EnvZ affect the cytoplasmic signaling domain. Point mutations in the periplasmic region proper that affect EnvZ signaling have not been reported, and this has made it difficult to assign a functional role to this domain. However, EnvZ molecules deleted for portions of their periplasmic domain have been created and analyzed (see Table 3). They produce an OmpC constitutive phenotype and in biochemical tests have greatly reduced dephosphorylation activity (137). Furthermore, they become pleiotropic and decrease the production of Male and PhoA proteins (137). While this is consistent with the view that alterations at the N-terminus affect signaling at the C-terminus, the deletions are somewhat difficult to clearly interpret. They could alter the conformation of the periplasmic region, or alternatively, affect the orientation of transmembrane segments. The latter possibility could be rationalized by considering that a shortened periplasmic region might return to the membrane sooner than the full periplasmic region. This may disrupt an alignment of transmembrane segments, and in turn would disrupt transmembrane signaling.

C. The Hybrid Tar-EnvZ Sensor A significant amount of knowledge has come from the analysis of a chimeric molecule in which the C-terminus of EnvZ was fused to the amino terminus of the chemoreceptor protein Tar (143). Tar is one of the chemoreceptors mentioned earlier and binds the ligand aspartate at its periplasmic domain to activate its

244

ARFAAN A. RAMPERSAUD

cytoplasmic signaling domain (130). In the chimeric Tar-EnvZ receptor, binding of an aspartate signal by the Tar portion of the molecule transduces a signal across the membrane to affect the cytoplasmic EnvZ domain. In turn, this domain phosphorylates OmpR for ompC expression (143). These studies indicate that EnvZ and chemoreceptors share similar features of transmembrane signaling and, as compared with truncated EnvZ molecules, demonstrate how the cytoplasmic signaling domain of EnvZ can be brought under direct control by a receptor domain (143). Novel intermolecular complementation studies have been shown with the TarEnvZ receptor (151, 152). Truncated Tar-EnvZ mutants lacking portions of the C-terminal signaling domain, and fuU-length mutants having point mutations at critical residues in EnvZ, are defective in OmpR phosphorylation or dephosphorylation (151, 152) (Table 3). Yet, when particular combinations of mutants are coexpressed in the same cell, certain aspects of signaling are restored. The complementation approach has provided evidence for transphosphorylation of EnvZ, presumably through the association of EnvZ as multimers (152). Other experiments indicate that ligand-dependent (aspartate) regulation of the signaling domain requires both kinase as well as phosphatase activities. It was proposed that in the absence of aspartate, the kinase/phosphatase ratio of Tar-EnvZ favors phosphatase activity (152). Aspartate binding is thought to decrease phosphatase without affecting kinase activity (152).

D. Activation of EnvZ by Local Anesthetics Another aspect of EnvZ signaling relates to how the molecule responds to membrane perturbants. At low concentrations, agents such as procaine or phenethyl alcohol act at the transcriptional level to decrease OmpF and increase OmpC (36, 41, 107, 111, 135). This is similar to high osmolarity conditions, but procaine and phenethyl alcohol also reduce the levels of PhoA and Male proteins (19, 107, 146). Thus, their phenotypes are more closely related to that produced by the pleiotropic envZll and envZ473 mutants (19). Two envZ missense mutants have been identified, env7_3 and envZ6, that are resistant to the effects of procaine for changes in porin patterns (135). Additionally, envZ null strains (envZ22 and AenvZ) do not respond to procaine for either changes in porin profiles or pleiotropic effects on other genes (115, 146). These results demonstrate that EnvZ directly or indirectly mediates the effects of procaine. Procaine prevents the in vitro phosphatase activity of membrane-bound EnvZ but is reported not to influence dephosphorylation activity of a C-terminal EnvZ molecule (138). The anesthetic also has no effect on the signaling properties of the Tar-EnvZ protein that lacks the amino terminus of EnvZ (115). These experiments suggest that procaine acts somewhere at the amino terminus. As procaine affects the fluidity of the bacterial membrane (41a, 62) it is reasonable to suspect that its mechanism of action involves some sort of disruption of the transmembrane segments. Interestingly, lowering of lipid fluidity has been shown

Transmembrane Signaling in Osmoregulation

245

to affect porin production in the outer membrane (27, 41). These data indicate that the physiochemical properties of the inner membrane could have a profound influence on the signaling activity of EnvZ.

VII. MULTIFUNCTIONAL PROPERTIESOF OMPR Mutations in OmpR occur throughout the molecule with a number of them localized to the N-terminus (Figure 2). Relative to the structure shown in Figure 2, N-terminal amino acid replacements are frequently found between the C-terminal portion of 13-sheets and the N-terminal portion of a-helices. They are spatially within the vicinity of the phosphorylation domain, with many of them affecting the production of OmpR-P. Obvious phosphorylation mutants are the various Asp-55 and Asp-I 1 mutants (16, 17, 26, 66). The L 16Q (ompR77) and R 15C (ompR36) replacements also affect phosphorylation by altering EnvZ-OmpR interactions (2, 83, 96, 97). Mutants tentatively proposed to affect interactions between OmpR subunits or interactions with RNA-polymerase are also located within the N-terminus (18, 57, 95, 120). Other amino acid replacements are thought to change OmpR conformation, with three occurring away from the phosphorylation domain between the N-terminal portion of 13-sheets and the C-terminal portion of co-helices (16, 17, 67). Within the C-terminal region, several mutations appear to specifically affect DNA-bincling (96, 120), but it is not known whether they do this through conformational defects or through defective interactions between amino acid side chains and base pairs.

A. Conformational Changes in OmpR Phosphorylation of OmpR may drive conformational changes in the molecule necessary for porin gene expression. Alternatively, the phosphate group could participate in an essential interaction between OmpR subunits, DNA target sites, or RNA-polymerase interactions. A phosphorylation mutant, OmpR(D55Q), has been overproduced from a high copy number vector and shown to osmoregulate porin genes, due to its latent DNA-binding activity (67). This result along with the mutants discussed below make it unlikely that the phosphate group is directly involved with protein-protein or protein-DNA contacts. Three second-site suppressors of OmpR(D55Q) (expressed from pBR322 or low copy number plasmids) have been isolated that allow porin gene expression despite the D55Q replacement (17, 67). They contain either a T83A, G94S, or TI02C replacement (! 7, 67). While they do not restore phosphorylation activity, they allow DNA-binding to both ompF and ompC promoters (17, 67). The suppressors are independent of the original D55Q mutation and regulate porin production even in the absence of the envZ gene (17, 67). The most likely explanation for them is that they permit OmpR to adopt a structure or Conformation that mimics the phospho-

246

ARFAAN A. RAMPERSAUD

rylated state of the protein (17). This would be consistent with the view that phosphorylation drives some sort of conformational change in OmpR structure that is important for gene expression. The three mutations cluster in the middle of the OmpR molecule with T102C lying close to Lys- 105. As mentioned earlier, Lys- 105 is a highly conserved residue thought to be involved with conformational transitions in the CheY protein (108, 130). It is possible that the T I02C substitution may influence this lysine residue. Another amino acid replacement PI06L is adjacent to Lys-105, but is still subject to regulation by envZ (120). An intriguing aspect of D55Q mutants containing T83A, G94S, or T102C suppressors is their osmoregulation of OmpF and OmpC porins (17, 67). EnvZindependent means of osmoregulation might explain these results, and these would be different than the previously mentioned crosStalk mechanisms. Examples of these would include osmotically regulated changes in DNA topology and/or the participation of general transcription factors, such as integration host factor or the histone-like protein H-NS (12, 17, 40, 67). A somewhat different conformational mutant of OmpR is a $48F replacement (16). In combination with a DI 1N mutation, $48F partially restores porin expression and osmoregulation that was lost by D 11N (16). It has been proposed that the conformation of OmpR is distorted by D 1IN, resulting in poor interaction and/or phosphate transfer with EnvZ (16). The $48F mutation allows the protein to serve as a (weak) substrate for EnvZ and thus restores some of its structure. As the $48F replacement by itself produces an F-C-phenotype, the two mutations essentially complement each other.

B. Multimerization of OmpR Multimers of OmpR were originally proposed as part of a regulatory mechanism for ompB (44, 45). This was supported by negative complementation results between an ompR4 strain and an ompRl01 allele (10, 44, 75) (although another explanation for OmpR 101 was mentioned in an earlier section of this chapter). However, when OmpR (the non-phosphorylated form) was purified in later studies, evidence for a multimeric state of OmpR was not found (63). Size exclusion chromatography of the purified protein showed it to be a monomer, which did not form multimers even when treated with the crosslinking agent, dimethyl subermidate (63). Recently, experiments have shown that if OmpR is phosphorylated by EnvZ and ATP, oligomers corresponding to OmpR dimers and trimers are readily detected by dimethyl suberimidate crosslinking (95). Two OmpR mutants, OmpR(E96A) and OmpR(R115S), that do not form phosphorylation induced multimers in crosslinking experiments have been isolated and show a dramatic reduction in their phosphorylation enhanced DNA-binding activity (95). As neither mutant produces any porin protein in the outer membrane, OmpR multimerization may be important for gene expression (9.$). It is possible

Transmembrane Signaling in Osmoregulation

247

that phosphorylation brings about changes in OmpR, followed by oligomerization of subunits. This may be important for DNA-binding and subsequent regulation of porin gene expression. Two other mutants, OmpR(G94D) and OmpR(E 111K), have amino acid replacements close to Glu-96 and Arg-115, respectively, and are thought to affect OmpR multimerization (18). In a wild-type ompR background, they prevent the expression of both ompF and ompC genes (18). OmpRX6 produces a similar dominant negative phenotype (57) and may represent yet another such mutant.

C. Additional OmpR Mutants Analysis of a collection of mutants broadly classified as ompR2 (low OmpC and normal OmpF levels) indicate several functions of OmpR can be disrupted independently of one another (120). One set, exemplified by OmpR(V203M) and OmpR(R220C) (products of the ompR472 and ompR324 alleles, respectively), are apparent DNA-binding mutants that prevent both ompF repression and ompC expression (120). Others interfere with repression of ompF but not with the activation of ompC. These include OmpR(GI29D) and OmpR(P131S) and are thought to bind to repressor sites in the ompF promoter but do not proceed further in the repression mechanism (120). Interestingly, an Ala-to-Thr replacement at position 130 (between Gly- 129 and Pro- 131) is one of the two differences between the ompR genes of E. coli B and E. coli K12 (91). A repression-type mutation in OmpR of E. coil B could explain why these cells make OmpF constitutively. A final set of mutants bind normally to both promoters but reduce expression of both genes proportionately (120). The amino acid replacements cluster in two regions of the molecule, around positions 90 and 190. Representative examples of this class include the OmpR(E87K), OmpR(G 19 IS), and OmpR(E193K). They are thought to specifically affect gene activation, possibly by influencing OmpROmpR or OmpR-RNA polymerase interactions (120).

VIII. DNA-BINDING AND TRANSCRIPTIONAL PROPERTIES OF OMPR OmpR binds to the upstream region of both ompFand ompCgenes to regulate their expression. Most, if not all, of the major OmpR binding sites in ompF and ompC have been identified. In this section the involvement of these sites for both activation and repression are discussed, as is the role of phosphorylated OmpR for these processes.

248

ARFAAN A. RAMPERSAUD A.

Binding

to the

ompFP r o m o t e r

Figure 4 shows several features of the ompF regulatory region that includes at least three OmpR binding sites, two binding sites for IHF, a-35 and- 10 region, and a transcriptional start site 100-bp upstream to the initiation codon. The binding sites

9lot)

-80

-00

.4O

o

O

O

o

TTTTA(,-I-rrrGGTTACATA']TrrI't*C-rrrrk'GAAACCAAA~ATCTt'rGTAGCACTTTC pl

-380 o

- mo

T

TGTTACGG~ATATTACATTGCAA - m -10 +I

[

,

I> Mer (Omp~

- Im licit

.100

-m

.00

.40

O

O

O

O

CATTTACATTTTG~CATCTATAO CGATAAATGAAACATCTTAAAA~AG'rATCATAT a

"-

'

'

' o i

. . . . . .

'~-

-

cm

.......

".

i s

~.~. . . .

.

.

.

.

.

I

_ _

T . . . . I ..... I

-? -I0 +Im-i -

(omit)

188~-178 FiBure4. Organization of OmpR-binding sites in the upstream regulatory region of ompF and ompC. The region upstream to both ompF(A) and ompC (B) are diagrammed. The diagram is not to scale. OmpR binding sites in both promoters are shown as filled boxes, (me)with the DNA sequences shown above. The half arrowhead ( ) indicates potential OmpR-binding sites as 20-bp motifs, (FI, FII, Fill, CI, CII, and CIII) while the boxes below show OmpR binding sites as 10-bp motifs, (F- and C-boxes). The unfilled boxes (D) represent high affinity OmpR target sites while the stippled boxes (n) represent target sites of lower affinity. IHF binding sites (IHF), the -35, -10 regions, transcriptional start site (), and the first residue of both proteins (Met) are indicated.

TransmembraneSignaling in Osmoregulation

249

for OmpR and IHF are positioned upstream to the transcriptional start site (+1) between -380 and -40. Deletion analysis of plasmid-borne ompF-lacZ fusions shows that DNA sequences essential for ompF activation are located around -100 (relative to the transcriptional start site) (59). Downstream deletions past-100 severely depress ompF expression (68, 116). Specialized transducing phage carrying ompF-lacZ operon fusions have demonstrated that osmoregulation (i.e., repression) requires a further upstream region, between -1400 and -240 (104). Based on DNase I footprinting experiments, OmpR recognition sites are between -100 and -40 and between -360 and -380. The OmpR binding site between -100 and -70 is the activator site in ompF (68, 116) and is large enough to accommodate at least two OmpR molecules (87, 103). This 30-bp element can be divided into three juxtaposed lO-bp sequences, termed F-boxes, having the consensus sequences TITAC(AfF)TIT (103, 142). Three larger 20-bp elements have also been found between - 100 and -40 and define larger OmpR recognition sequences (shown in Figure 4 as FI, FH, and FHI) (81). While it is not clear which of these DNA motifs represent actual OmpR-binding sites, an in vivo chemical footprinting study noted that a 10-bp sequence between -51 to -42 was more like OmpR-binding sequences in the ompC promoter than F-boxes (142). It was designated Cd-box to call attention to this relationship (142). The F- and C-boxes differ in terms of their DNA-binding affinities (31). Mobility shift experiments using short sequences representing the -100 to -70 or-52 to -40 regions demonstrate that the -100 to -70 region (F-boxes) is readily recognized by OmpR in crude cellular extracts (31). In contrast, the region between -51 to -42 (Cd-box) is poorly bound unless the F-boxes are also present (31). These results demonstrate that OmpR binds with greater affinity to the -100 to -70 region than the -51 to -42 sequence. This can be explained on the basis of different nucleotide sequences in the F- versus C-boxes, the placement of multiple target sites close to each other (F-boxes), or a combination of these features. In vitro and in vivo footprinting experiments have shown that the OmpR472 protein binds the F-box region but not the Cd-box sequence (and also fails to recognize similar C-boxes in the ompC promoter) (87, 142). Recent studies have also shown that OmpR472 binds poorly to the upstream repressor site between -380 to -360 (A. Rampersaud, S. Harlocker & M.I. Inouye, manuscript in preparation). The inability of this mutant to bind to these sequences can be directly correlated with the F+C- phenotype of an ompR472 strain. A segment of the ompF promoter migrates anomalously in polyacrylamide gels and led to the discovery of an intrinsic curvature or bend in the ompF regulatory region (85). The major determinants for the DNA bending are four short runs of peri•193193 dA" dT tracts, designated T 1 through T4. The tracts overlap the OmpR recognition site with T1 and T2 tracts occurring between -111 and-92, while T3 and T4 tracts are between -83 and -70 (68, 85). Nucleotide replacements in one tract alone do not significantly affect OmpR binding but do change ompF expres-

250

ARFAAN A. RAMPERSAUD

sion, as well as the characteristic mobility of the promoter fragment (68). A severe reduction in OmpR-DNA interactions is observed when two tracts are simultaneously mutated (68). Deletion of a T residue within the T3 or T4 tract also affects ompF expression, as well as the migration of ompF promoter fragments (127). These results suggest that curvature or structure of the ompF promoter is important for proper ompF regulation. Most of the early DNA binding studies with purified OmpR probably used the dephosphorylated form of the protein, with the results representing specific but latent DNA-binding activity (63, 103, 116).Later experiments employing OmpR-P have shown that, relative to the non-phosphorylated species, about 10-fold less OmpR-P is needed for optimal DNA-binding at both ompF and ompC promoters (4). Thus, it can be concluded that phosphorylation of OmpR increases its affinity for DNA target sites. Recently completed studies have further clarified the relationship between OmpR-P levels and DNA-binding at the ompF promoter (A. Rampersaud, S. Harlocker and M.I. Inouye, manuscript in preparation). The results indicate that when OmpR-P levels are low, DNA-binding occurs preferentially at the high at~nity site between -100 and -70 (F-boxes). As OmpR-P levels increase, there is increased occupancy of the -40 to -50 region (Cd-box), which is closely followed by binding at the -360 to -380 repressor site. The overall process appears cooperative; OmpR interactions at the high affinity site promote (or stabilize) binding interactions at lower affinity sites. These results are consistent with the current model of osmoregulation and fulfill the expectations of a quantitative model for OmpR-P. At low osmolarity, low levels of OmpR-phosphate stimulate ompF expression by binding to the high-affinity activator site. At high osmolarity, the buildup of OmpR-P allows binding at low-affinity sites and eventually leads to ompF repression. The -360 to-380 repressor site is distantly positioned from the -100 to -40 regulatory sites (104, 127). In order for it to act as a repressor site, it needs to be brought close to the other sites. A DNA looping model has been proposed as one way to achieve this (127). Interestingly, genetic studies suggest that the actual block in transcription by such a repression loop may not be due to steric effects (e.g., occlusion ofRNA polymerase from its binding site) (35, 84, 125). Rather, a direct interaction may occur between OmpR and RNA polymerase (125). Details of the repressor loop are not yet clear, but several biochemical results are entirely consistent with such a repression mechanism. Cooperative binding and OmpR-OmpR interactions (OmpR multimerization) would be important for stabilizing OrnpR bound at low-affinity sites, and both have already been mentioned. The inherent bend in the ompF promoter also supports a repression loop model as the DNA needs to bend in order for target sites to come close to each other. Indeed, putative bending mutations have been found in the - 100 to -70 region that prevent repression of ompF (127).

TransmembraneSignaling in Osmoregulation

B. Binding to the

251

ompCPromoter

The ompC promoter has a somewhat different organization than ompF (Figure 4B). Upstream deletions of plasmid-based ompC-lacZ fusions initially identified sequences starting from -100 as essential for OmpR-dependent regulation (90). Soclium-bisulfite-generated point mutations of similar fusions identified sets of base pairs between - 100 and -40 that reduced LacZ production (90). These mapped into three 10-bp elements designated sequences a, b, and c and were shown later to be OmpR-binding sites (63, 78, 80, 81, 90, 103, 142). Sequences a and b are identical to each other, and all are separated by multiples of 10 or 11 bp (90, 142). Thus, they occur on the same side of the DNA helix (90). In other studies, sequences a, b, and c have also been designated Ca-, Cb-, and Cc-boxes, respectively (Figure 4B) (142). A consensus sequence can be defined for all C-boxes, TG(A/I')NCATNT, and this is different from that of the F-boxes (142). As in ompF, they are within three large 20-bp regions designated CI, CII, and CIII (Figure 413) (81). For the remainder of this section the C-box notation will be used to refer to OmpR-binding sites in the ompC promoter. In vitro and in vivo studies clearly demonstrate that OmpR binds to the Ca, Cb, and Cc boxes (63, 78, 80, 81, 90, 103, 142). Another OmpR binding site has also been identified and termed the Fd-box (103, 142). This is a 10-bp region that overlaps the Ca box and shows similarities to the F-boxes in the ompF promoter (142). In vivo dimethyl-sulfate-protection studies reveal that OmpR protects several guanine residues within the Fd- and C-box regions (142). Not surprisingly, the protected bases are in register with each other by multiples of 10- or ll-bp, indicating that DNA-binding occurs on the same side of the DNA helix (142). OmpR binding to the ompC promoter appears to be cooperative, with the highest affinity site being Ca (80). Protection of the Ca region occurs at a lower OmpR concentration than the downstream sequence Cb or Cc regions (80). Although the Ca and Cb boxes are identical in sequence, the Fd box overlaps the Ca box and probably contributes to the enhanced OmpR-binding (142). Removal of the Ca sequence also causes significant loss in ompC-lacZ expression and reduces binding to the remaining regions (80). More recently, On~R has been shown to directly bind DNA sequences containing just the Ca as well as flanking sequences, but does not bind the other two elements (81). This region also drives ompC.lacZ expression in the absence of the Cb and Cc regions (81). The fact that the Ca, Cb, and Cc boxes are in phase by integrals of 10 or 1l-bp suggests that the positioning of OmpR may be important for transcription (78, 79). Insertion of different lengths of DNA oligomers between Cc and the -35 region causes periodic variations in ompC-lacZ expression, with insertions of half-integral turns having the largest reduction in lacZ expression (79). Similar results have also been reported for the ompF promoter, but in this case there is an additional contribution of DNA curvature (132). The region between -107 and-35 can also be

ARFAAN A. RAMPERSAUD

252

completely inverted without affecting ompC expression, but requires correct phasing of the binding sites on the DNA-helix (78). C. Transcriptional Activation at

ompFand ompC

The -10 and -35 regions of both ompF and ompC promoters are poorly related to their canonical consensus sequences, indicating that RNA polymerase by itself does not efficiently recognize these promoters (25, 90, 105, 141). Point mutations have been identified in the -35 region of both promoters, which make it more similar to the consensus sequence, and these subsequently allow OmpR-independent expression of both genes (25, 90, 105). In a related study, OmpR binding sites were fused to other poor -35 and -10 regions and shown to enhance transcription of a lacZ reporter gene in an OmpR-dependent fashion (141). These studies support the view that OmpR facilitates ompF and ompC transcription by improving or enhancing recognition of ~e -35 and -10 sequences by RNA polymerase (141). In vitro, both ompF and ompC transcripts can be made using OmpR and RNA polymerase holoenzyme as sole protein components (3, 15, 48, 53, 103, 113). Both linear (3, 15, 48, 53, 103, 113) as well as supercoiled templates (48) have been used for this purpose, but the phosphorylated state of OmpR was not reported in all cases (48, 103, 113). A few studies have directly examined the involvement of OmpR-P for in vitro transcription and have shown significant stimulation by OmpR-P (3, 48). In one set of experiments, differential transcription of ompF and ompC promoters was studied by providing both promoters in single round transcription experiments (3). OmpF transcription was favored at low OmpR-P, while high OmpR-P favored ompC transcription over ompF (3). This is entirely consistent with the current model of osmoregulation. The OmpR phosphorylation requirement for in vitro transcription is not absolute. As mentioned earlier T83A and G94S replacements in OmpR suppress the phosphorylation defect caused by D55Q. The double mutants OmpR(D55Q, T83A) and OmpR(D55Q, G94S) are fully active for the in vitro transcription of the ompF promoter (15). This means that the phosphate on OmpR is not intimately involved with interactions between OmpR and RNA p o l y p . The results add further supl~rt to the view that the primary role of phosphorylation is for a conformational change.

IX. OTHER FACTORS A. The (xSubunit of RNA-polymerase The a subunit of RNA polymerase is encoded at the rpoA gene and is important for proper assembly of the core RNA polymerase enzyme (a2[3[Y)(60, 119). Genetic studies indicate that OmpR interacts with the a-subunit for porin gene expression (35, 84, 125) and is part of a growing body of evidence indicating an impc~ant role

TransmembraneSignaling in Osmoregulation

253

of this factor for proper interactions with positive-acting transcriptional regulators (60, 119). In the case of OmpR, the a-subunit is suspected to influence both positive and negative regulation. Genetic evidence for an a-subunit-OmpR interaction came originally from the isolation of the rpoA77 mutant, which suppressed the porin phenotype of an envZll/ompR77 double mutant (84) and rpoA85, which suppressed the pleiotropic phenotype caused by envZ473 (35). In later studies, localized mutagenesis of the rpoA gene led to the identification of four additional rpoA mutants designated rpoASO, rpoA52, rpoA53, and rpoA54 (125). These four mutants were shown to not only affect porin gene expression but also the pleiotropic phenotype of envZ473

(125). In general, rpoA mutants are remarkably limited in the types of genes they affect (60, 119); the ones changing porin production or suppressing pleiotropic envZ mutants seem to be specific for OmpR (125). A given rpoA allele is also strain dependent for its action, and when different rpoA alleles are tested in the same strain background, such as envZ473, they cause different porin and/or pleiotropic phenotypes. The complexity is thought to reflect the highly specific nature of OmpR-~ interactions with variable phenotypes attributed to different states or functional forms of OmpR (125). The amino acid replacements of several rpoA mutants cluster at the C-terminus of the a-subunit and are thought to represent potential sites for OmpR interaction (125). Support for an OmpR-a-subunit interaction has come from functional studies of a-subunits missing portions of their carboxyl-terminus (52). Truncated a-subunits allow assembly of a 2 ~ ' RNA core particles when provided with o 7~ facilitate transcription of the lacUV5 promoter (52). However, the modified RNA polymerase holoenzyme does not provide for OmpR-dependent (OmpR-P) transcription of the ompC promoter (52).

B. Integration Host Factor Integration host factor (IHF) is a dimeric molecule composed of subunits encoded at the himA and hip (hireD) genes (34). It has an important role in site specific recombination events, DNA bending, and DNA packaging (34) and was mentioned earlier to affect ompB expression (49, 140). IHF also binds to two sites in the ompF promoter (between -199 and -159 and between -80 and -42) and one site in the ompC promoter (between - 193 and - 158). In the ompF promoter the - 199 and - 159 region is a high-affinity site for IHF, as well as a DNA bending center for the promoter (113). It is not clear how this bending region is related to that reported between -100 and -70 (85). IHF negatively regulates both ompF and ompC promoters since purified protein prevents OmpR-dependent transcription of ompF as well as RNA polymerase mediated transcription of ompC (48, 113, 139). Both himA and hired mutants increase the amount of OmpF protein produced at high osmolarity (113). One

254

ARFAAN A. RAMPERSAUD

explanation for this result may be that IHF helps form the negative repression loop in the ompF promoter through its DNA-bending activity. The loss of bending activity in IHF mutants may make it more difficult to adopt the looped structure and thus allows for continued expression of ompF. An IHF mutant also allows OmpC expression in an ompR472 strain (139). Possibly, IHF acts as a negative regulatory at ompC or influences the DNA binding properties of OmpR. As IHF also has general pleiotropic effects on a host of other genes, it is also possible that the effects of IHF mutants are indirect.

X. FUTURE STUDIES Over the last few years extensive studies have shed new light on the mechanism of porin gene regulation by OmpR and EnvZ. As a result, several new features can be added to the model discussed at the beginning of this chapter. These include potential dimerization of EnvZ, interactions between OmpR subunits, cooperative DNA-binding by OmpR, formation of a negative repression DNA-loop in the ompF promoter, and interactions between OmpR and the 0c-subunit of RNA polymerase. This new information also raises new questions as to the molecular details of osmosensing, pleiotropic effects, transcriptional activation, and the role of other proteins in the regulatory process. Several aspects regarding EnvZ and OmpR function remain to be determined. Details concerning the discrete DNA-binding mechanism of OmpR need to be clarified, as well as how various protein-protein interactions contribute to transcriptional regulation. This information should provide new insight into the molecular events occurring at both ompF and ompC promoters and contribute to our present understanding of gene regulation. Deducing the signals for EnvZ and how they modulate the kinase and phosphatase activities is also necessary to clearly define the sensing mechanism. Structural studies with OmpR and EnvZ would also be extremely helpful in elucidating the nature of these molecules.

ACKNOWLEDGMENTS I am grateful to Drs. M.I. Inouye, T.J. Silhavy,T. Mizuno, and S. Forst for providing reprints and preprints of their work. I thank S. Forst and S. Harlocker for reviewing the manuscript and for their helpful comments. I also owe a special thanks to E. Borem and J. Hutchison for their excellent secretarial assistance.

REFERENCES 1. Aiba, H., Mizuno, T., & Mizushima,S. (1989). 'rramfer of phosphorylgroups between two regulatory proteins involved in osmoregulatoryexpression of the ompFand ompCgenes in Escherichiacoli.J. Biol. Chem.264,8563-8567.

TransmembraneSignaling in Osmoregulation

255

2. Aiba, H., Nakasai, F., Mizushima, S., & Mizuno, T. (1989). Evidence for the physiological i ~ e of the phosphotransfer between the two regulatory compo~nts, EnvZ and OmpR in Escherichio coil J. Biol. Chem. 264, 14090-14094. 3. Aiba, H., & Mizuno, T. (1990). Phosphorylation of a bacterial activator protein, On~R, by a protein kinase, EnvZ, stimulates the transcription of the ompF and ompC genes in E$cherichia coli. FEBS Lett. 261, 19-22. 4. Aiba, H., Nakasai, E, Mizushima, S., & Mizuno,'T. (1989). Phosphorylation of a bacterial activator protein, OmpR, by a protein kinase, EnvZ, results in stimulation of its DNA-binding ability. J. Biochem. 106, 5-7. 5. Albright, L. M., Huala, E., & Ausbel, E M. (1989). Prokaryotic signal transduction mediated by sensor and regulator protein pairs. Annu. Reg Genet. 23, 311-336. 6. Anderson, J., Forst, S. A., Zhao, K., & Inouye, M. I. (1989). The function of micF RNA: micF PdqA is a major factor in the thermal regulation of OmpF protein in Escherichia coil J. Biol. Chem. 264, 17961-17970. 7. Anderson, J., Delihas, N., Ikenaka, K., Green, P. J., Pines, O., llercil, O., & Inouye, M. I. (1987). The isolation and characterization of RNA coded by the micF gene in Escherichia coli. Nucleic Acids. Res. 15, 2089-2101. 8. Aoyama, T., & Oka, A. (1990). A c o ~ mechanism of transcriptional activation by the three positive regulators, VirG, PhoB, and OmpR. FEBS Lett. 263, 1-4. 9. Bachmann, B. J. Linkage map of Escherichia coll. In E C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, & H. E. Umbarger (Eds.) Escherichia coli and salmonella t)phimurium: cellular and molecular biology, vol. 2 (pp. 807-876). Washington, DC: American Society for Microbiology. 10a.Bardwell, J. C., McGovern, K., & Beckwith J. (1991). Identification of a protein required for disulfide bond formation in viva. Cell. 67, 581-589. 10. Berman, M. L., & Jackson, D. E. (1984). Selection ofloc gene fusions in viva: ompR-lacZ fusions that define a functional domain of the ompR gene product. J. Bacterial. 159, 750-756. 11. Bernardini, M. L., Fontaine, A., & Sansonetti, P. J. (1990). The two-component regulatory system OmpR-EnvZ controls the virulence of Shigellafle.meri. J. Bacterial. 172, 6274-6281. 12. Bhriain, N. N., Dorman, C. J., & Higgins, C. E (1989). An overlap between osmotic and anaerobic stress responses: a potential role for DNA supercoiling in the coordinate regulation of gene expression. MoL Microbial. 3, 933-942. 14. Bourret, R. B., Hess, J. E, Borkovich, K. A., Pakula, A. A., & Simon, M. I. (1989). Protein phosphorylation in chemotaxis and two-component regulatory systems of bacteria. J. Biol. Chem. 264, 7085-7088. 15. Bowfin, V., Brissette, R. E., & Inouye, M. I. (1992). Two transcriptionally active OmpR mutants that do not require phosphorylation by EnvZ in an Escherichia coli cell-free system. J. Bacterial. 174, 6685--6687. 16. Bfissette, R. E., ~ung, K., & Inouye, M. I. (1991). Suppression of a mutation in OmpR at the putative phosphorylation center by a mutant EnvZ protein in Escherichia coil J. Bacterial. 173, 601-608. 17. Brissette, R. E., Tsung, K., & lnouye, M. I. (1991). Intramolecular second-site revertants to the phosphorylation site mutation in OmpR, a kinase-dependent transcriptional activator in Escherichio coil J. Bacterial 173, 3749-3755. 18. Bfissette, R. E., Tsung, K., & lnouye, M. I. (1992). Mutations in a central highly conserved non-DNA binding region of OmpR, an Eschericlda coil transcriptional activator, influence its DNA-binding ability. J. Bacterial. 174, 4907-4912. 19. Case, C. C., Bukau, B., Villarejo, M., & Boos, W. (1986). Contrasting mechanisms of envZ control of real and pho regulon genes in Escherichio coil. J. Bacterial. 166, 706-712.

256

ARFAAN A. RAMPERSAUD

20. Comeau, D. E., Ikenaka, K., Tsung, K., & lnouye, M. I. (1985). Primary characterization of the protein products of the Escherichia coli ompB locus: structure and regulation of synthesis of the OmpR and EnvZ proteins../. Bacteriol. 164, 578-584. 25. Collado-Vides, J., Magasanik, B., & Gralla, J. D. (1991). Control site location and transcriptional regulation in Escherichia coll. Microbiol. Reu 55, 371-394. 20 Coyer, J., Anderson, J., Forst, S. A., Inouye, M. I., & Delihas, N. (1990). micF RNA in ompB mutants of Escherichia coli: different pathways regulate micF RNA levels in response to osmolarity and temperature change. J. Bacteriol. 172, 4143-4150. 23. Csonka, L. N. (! 989). Physiological and genetic responses of bacteria to osmotic stress. Microbiol. Rev. 53, 121-147. 24. Csonka, L. N. (1991). ~ o t i c osmoregulation: genetics and physiology. Annu. Rev. Microbiol. 45, 569--606. 25. Dairi, T., lnokuchi, K., Mizuno, T., & Mizushima, S. (1985). Positive control of transcription initiation in Escherichia coil A base substitution at the Pribnow box renders ompF expression independent of a positive regulator. J. biol. Biol. 184, 1--6. 6Q Delgado, J., Forst, S. A., Harlocker, S., & lnouye, M. I. (1993) Identification of a phosphorylation site and functional analysis of conserved aspartic acid residues of OmpR, a transcriptional activator for ompF and ompC in Escherichia coil Mol. Microbiol. (in press). 27. DiRienzo, J. M., and lnouye, M. I. (1979). Lipid fluidity-dependent biosynthesis and assembly of the outer membrane prc~ins of E. coll. Cell 17, 155-161. 27a.Fiedler, W., & Rottering, M. (1988). Properties of Escherichia coil mutants lacking membranederived oligosaccharides. J. Biol. Chem. 263, 14684-14689. 28. Forst, S. A., Comcath D. E., Norioka, S., & Inouye, M. I. (1987). Localization and membrane topology of EnvZ, a protein involved in osmoregulation of OmpF and OmpC in Escherichia coll. J. Biol. Chem. 262, 16433-16438. 29. Forst, S. A., Delgado, J., Ramakrishnan, G. R., & Inouye, M. I. (1988). Regulation of ompC and ompF expression in Escherichia coil in the absence of envZ. I. Bacteriol. 170, 5080-5085. 30. Forst, S. A., Delgado, J., & lnouye, M. I. (1989). Phosphorylation of OmpR by the osmosensor EnvZ modulates the expression of the ompF and ompC genes of Escherichia coll. Proc. Natl. Acad. Sci. USA 86, 6052--6056. 31. Forst, S. A., Delgado, J., & Inonye, M. I. (1989). DNA-binding properties of the transcription activator (OmpR) for the upstream sequences of ompF in Escherichia coil are altered by envZ mutations and medium osmolarity. J. Bacteriol. 171, 2949-2955. 32. Font, S. A., Delgudo, J., Rampersaud, A., & lnouye, M. I. (1990). In vivo phosphorylation of OmpR, the transcriptional activator of the ompF and ompC genes in Escherichia coll. J. Bacteriol. 172, 3473-3477. 33. Foist, S. A., & lnouye M. I. (1988). Environng~tally regulated gene expression for membrane proteins in Escherichia coll. Annu. Rev. Cell Biol. 4, 21-42. 34. Freundlich, M., Ramani, N., Matthew, E., Sirko, A., & Tsui, P. (1992). The role of integration host factor in gene expression in Eschedchia coll. Mol. Microbiol. 6, 2557-2563. 35. Garrett, S., & Silhavy, T. J. (1987). Isolation of mutations in the a operon of Escherichia coil that suppress the transcriptional defect conferred by a mutation in the porin regulatory gene envZ. J. Bacteriol. 169, 1379-1385. 36. Garrett' S., Taylor, R. K., & Silhavy, T. J. (1983). Isolation and characterization of chain-terminating nonsense mutations in a porin regulator gene, em,Z. J. Bacteriol. 156, 62-69. 37. Garrett' S., Taylor, R. K., Silhavy, T. J., & Berman, M. L. (1985). Isolation and characterization of AompB strains of Escherichia coli by a general method based on gene fusions. J. BacterioL 162, 840-844. 38. Geiger, O., Russo, E, Silhavy, T. J., & Kennedy, E. P. (1992). Membrane-derived oligosaccharides affect porin osmoregulation only in media of low ionic strength. J. Bacteriol. 174, 1410--1413.

Transmembrane Signaling in Osmoregulation

257

39. Gibson, M. M., Ellis, E. M., Graeme-Cook, K. A., & Higgins, C. E (1987). OmpR and EnvZ are pleiotropic regulatory proteins: positive regulation of the tripeptide permease (rppB) of Salmonella typhimurium. Mol. Gen. Genet. 207, 120-129. 40. Graeme-Cook, K. A., May, G., Bremmer, E., & Higgins, C. E (1989). Osmotic regulation of pot'in gene expression: a role for DNA supercoifing. Mol. Microbiol. 3, 1287-1294. 41. Granett, S., & Villarejo, M. (1982). Regulation of gene expression in Escherichia coli by the local anesthetic procaine. J. Mol. Biol. 160, 363-367. 41a.Halegoua, S., & Inouye, M. I. (1979). Translocation and assembly of outer membrane proteins of Escherichia coil. Selective accumulation of precursors and novel assembly intermediates caused by phenethyi alcohol. J. Mol. Biol. 130, 39-61. 42. Hall, M. N., & Silhavy, T. J. (1979). Transcriptional regulation of EschericMa coil K-12 mjor outer membrane protein lb. J. BocterioL 140, 342-350. 43. Hail, M. N., & Silhavy T. J. (1981). The ornpB locus and the regulation of the major outer membrane porin proteins of Escherichia coli K-12. J. Mol. Biol. 146, 23--43. 44. Hail, M. N., and Silhavy T. J. (1981). Genetic analysis of the ompB locus in Escherichia coli K-12. J. Mol. Biol. 151, 1-15. 45. Hall, M. N., & Silhavy T. J. (1981). Genetic analysis of the major outer membrane proteins of Escherichia coil. Annu. Rev. Genet. 15, 91-142. 46. Harlocker, S., Rampersaud, A., Yang, W-P., & Inouye, M. I. (1993). Phenotypic reverent mutations of a new OmpR2 mutant (V203Q) of Escherichia coli lie in the envZ gene which encodes the OmpR kinase. J. Bacteriol. 175, 1956--1960. 47. Hemandez-Chico, C., San Millan, J. L., Koiter, R., & Moreno, E (1986). Growth phase and OmpR regulation of transcription of Microcin BIT genes. J. Bocteriol. 167, 1058-1065. 48. Huang, L., Tsui, P., & Freundlich, M. (1990). Integration host factor is a negative effector of in vivo and in vitro expression of ompC in Escherichia coll. J. Bacteriol. 172, 5293-5298. 49. Huang, L., Tsui, P., & Freundlich, M. (1992). Positive and negative control ofompB transcription in Eschet~chia coli by cyclic AMP and the cyclic AMP receptor protein. J. Bacteriol. 174, 664-67O. 50. Heyde, M., Coil, J-L., & Portafier, R. (1991). Identification of Escherichia coli genes whose expression increases as a function of external pH. Mol. Gen. Genet. 229, 197-205. 51. Heyde, M., & Portalier, R. (1987). Regulation of major outer membrane porin proteins of Escherichio coli KI2 by pH. Mol Gen. Genet. 208, 511-517. 52. Igarashi, K., Hanamura, A., Makino, K., Aiba, H., Mizuno, T., Nakata, A., & lshihama, A. (1991). Functional map of the tx subunit of Escherichia coli RNA polymerase: Two modes of transcription activation by positive factors. Proc. Natl. Acad. Sci. USA 88, 8958--8962. 53. Igo, M. M., Ninfa, A. J., & Silhavy, T. J. (1989). A bacterial environmental sensor that functions as a protein kinase and stimulates transcriptional activation. Genes Dev. 3, 598--605. 54. Igo, M. M., Ninfa, A. J., Stock, J. B., & Silhavy, T. J. (1989). Phosphorylation and dephosphorylation of a bacterial transcriptional activator by a transmembrane receptor. Genes Dev. 3, 1725-1734. 55. Igo, M. M., and Silhavy, T. J. (1988). EnvZ, a transmembrane environmental sensor of Escherichia coli, is phosphorylated in vitro. J. Bacteriol. 170, 5971-5973. 56. Igo, M. M., Slauch, J. M., & Silhavy, T. J. (1990). Signal transduction in bacteria: kinases that control gene expression. Nature New Biol. 2, 5-9. 57. Ikenaka, K., Tsung, K., Comeau, D., & Inouye M. I. (1988). A dominant mutation in Escherichia coil OmpR lies within a domain which is highly conserved in a large family of bacterial regulatery proteins. Mol. Gen. Genet. 21 I, 538-540. 58. Inokuchi, K., Furukawa, H., Nakamura, K., & Mizushima, S. (1984). Characterization by deletion mutagenesis in vitro of the promoter region of ompF, a positively regulated gene of Escherichia. J. MoL Biol. 178; 653--668.

258

ARFAAN A. RAMPEI~AUD

9. Inokuchi, K., Itoh, M., & Mizushima, S. (1985). Domains involved in osmoregulation of the

ompF gene in Escherichia coil J. Bacteriol. 164, 585-590. 60. Ishihama, A. (1992). Role of the RNA polymerase a subunit in transcription activation. Mol. Microbiol. 6, 3283-3288. 61. Jamieson, D. J., & Higgins, C. E (I 984). Anaerobic and leucine-dependentexpression of a peptide transport gene in Salmonella typhimurium. J. Bacteriol. 160, 131-136. 20 Janoff, A. S., Haug, A., & M ~ , E. J. (I 980). Anesthetics alter outer membrane architectme and temlg~ture range growth of Eschen'chio coll. Biochem. Biophys. Re$. Comm. 95, 1364-1371. 3. Jo, Y., Nara, F., Ichihara, S., Mizuno, T., & Mizushima, S. (1986). Purification and characterization of the OmpR protein, a positive regulator involved in osmoregulatory expression of the ompF and ompC genes in Escherichia coll. J. Biol. Chem. 261, 15252-15256. 4. Jovanovich. S. B., Martin, U, M., Record, M. T., & Burgess R. R. (1988). Rapid response to osmotic upshift by osmoregulated genes in Escherichia coil and Salmonella typhimurium. J. Bacteriol. 170, 534-539. Kanamaru, K., Aiba, H., Mizushima, S., & Mizuno, T. (1989). Signal transduction and osmoregulation in Escherichia coil, a single amino acid change in the protein kinase, EnvZ, results in loss of its phosphorylation and dephosphorylation abilities with respect to the activator protein, OmpR. J. Biol. Chem. 264, 21633--21637. 60 Kanama~m,K., Aiba, H., & Mizuno, T. (1990). Trammembrane signal transduction and osmoreguiation in Escherichia coil: 1. Analysis by site directed mutagenesis of the amino acid residues involved in phosphotransfer between the two regulatory components EnvZ and OmpR. J. Biochem. 108, 483--487. 67. Kanamaru, K., & Mizuno, T. (1992). Signal transduction and osrnoregulation in Escherichia coli: a novel mutant of the positive regulator OmpR that functions in a ~phorylation-independent manner. J. Biochem. I I I, 4 ~ 3 0 . 68. Kato, M., Aiba, H., & Mizuno, T. (1989). Molecular analysis by deletion and site-directed mutagenesis of the cis-acting upstream sequence involved in activation of the ompF promoter in Escherichio coll. J. Biochem. 105, 341-347. 90 Kato, M., Aiba, H., Tat,, S-I., Nishimura, Y., & Mizuno, T. (1989). Location of phosphorylation site and DNA-binding site of a positive regulator, OmpR, involved in activation of the osmoregulatory genes of Escherichia coll. FEBS Lett. 249, 168-172. 70. Kawaji, H., Miztmo, T., & Mizushima, S. (1979). Influence of molecular size and osmolarity of sugars and dextrans on the synthesis of outer membrane proteins O-8 and O-9 of Escherichia coll. J. Bacteriol. 140, 843-847. 71. Kofoid, E. C., & Parkinson, J. S. (1988). Transmitter and receiver modules in bacterial signaling proteJns. Proc. Natl. Acad. Sci. USA 85, 4981--4985. 72. LiljestrOm, P., Mlittlnen, P. L., & Palva, E. T. (1982). Cloning of the regulatory locus ompB of Salmonella t3,phimwium LT-Z I. Isolation of the ompR gene and identification of its gene product. Mol. Gen. Genet. 188, 184--189. 73. Liijestr0m, P., MiUitttnen, P. L.,& Palva, E. T. (1982). Cloning of the regulatory locus ompB of Salmonella typhimurium LT-2. ii. Identification of the envZ gene product, a protein involved in the expression of the porin wc~ins. MoL Gen. Genet. 188, 190-194. 4Q Liljestr0m, P., Laamanen, I., Pairs, E. T. (1988). Structure and expression of the ompB operon, the regulatory locus for the outer membrane porin regulon in Salmonella typhimurium LT-2. J. Mol. Biol. 201,663-673. 75. Liljestr0m, P., Luokkangtki, M., & Palva, E. T. (1987). Isolation and characterization of a substitution mutation in the ompR gone of Salmonella typhimurium. J. Bacteriol. 169, 438--441. 76. Lukat, G., McCleary, W. R., Stock, A. M., & Stock, J. B. (1992). Phosphorylation of bacterial response regulator proteins by low molecular weight phospho-dono~. Proc. Natl. Acad. Sci. USA 89, 718-722.

TransmembraneSignaling in Osmoregulation

259

77. Lundrigan, M., & Earhart, C. E (1981). Reduction in three iron-regulated outer membrane proteins and protein a by the Escherichia coil K-12 perA mutation. J. Bocteriol. 146, 804-807. 78. Maeda, S., & Mizuno, T. (1988). Activationof the ompC gene by the OmpR protein in Escherichia coli . J. Biol. Chem. 263, 14629-14633. 79. Maeda, S., Ozawa, Y., Mizuno, T., & Mizushima, S. (1988). Stereospecific positioning of the c/s-acting sequence with respect to the canonical Womoteris required for activation of the o m ~ gene by a positive regulator, OmpR, in Escherichia coll. J. Mol. Biol. 202, 433-441. 80. Maeda, S., & Mizuno, T. (1990). Evidence for multiple OmpR-binding sites in the upstream activation sequence of the ompC promoter in Escherichia coil: a single OmpR-binding site is capable of activating the promoter. J. Bacteriol. 172, 501-503. 81. Maeda, S., Takayanagi, K., Nishimura, Y., Maruyama, T., Sato, K., & Mizuno, T. (1991). Activation of the osmoregulated ompC gene by the OmpR protein in Escherichia coil: a study involving synthetic OmpR-binding sequences. J. Biochem. 110, 324--327. 82. Matsuyama, S-I., Mizuno, T., & Mizushima, S. (1984). Promoter exchange between ompF and ompC, genes for osmoregulated major outer membrane proteins of Escherichia coil K-12. J. Bacterioi. 158, 1041-1047. 83. Matsuyama, S-I., Mizuno, T., & Mizushima, S. (1986). Interactions between two regulatory proteins in osmoregulatory expression of ompF and ompC genes in Escherichia coli: a novel ompR mutation suppresses pleiotropic defects caused by an envZ mutation. J. Bacteriol. 168, 1309-1314. 84. Matsuyama, S-I., & Mizushima, S. (1987). Novel rpoA mutation that interferes with the function of OmpR and EnvZ, positive regulators of the ompF and ompC genes that code for outer-membrane woteins in Escherichia coil KI2. J. Mol. Biol. 195, 847-853. 85. Mizuno, T. (1987). Static bend of DNA helix at the activatorrecognition site of the ompF promoter in Escherichia coll. Gene. 54, 57-64. 6. Mizuno, T. (1991). Control of envelope protein synthesis in bacteria. In A. lshihama & H. Yoshikawa (Eds.) Control ofcell growth and division (pp. 141-159). Tokyo: Japan Sci. Soc. Press. 87. Mizuno, T., Kato, M., Jo, Y-L., & Mizushima, S. (1988). InteractionofOmpR, a positive regulator, with the osmoregulated ompC and ompF genes of Escherichia coll. J. Biol. Chem. 263, 1008-1988. 88. Mizuno, T., & Mizushima, S. (1987). Isolation and characterization of deletion mutants OfompR and envZ, regulatory genes for expression of the outer membrane proteins O n ~ and OmpF in Escherichia coll. J. Biochem. 101,387-396. 89. Mizuno, T., & Mizushima, S. (1990). Signal transduction and gene regulation through the phosphorylation of two regulatory components: the molecular basis for the osmotic regulation of the porin genes. Mol. Micmbiol. 4, 1077-1082. 0. Mizuno, T., & Mizushima, S. (1986). Characterization by deletion and localized mutagenesis in vitro of the pron~ter region of the Escherichia coil ompC gene and imlx~ance of the upstream DNA domain in positive regulation by the OmpR prc~in. J. Bacteriol. 168, 86-95. 91. Mizuno, T., Shinkai, A., Matsui, K., & Mizushima, S. (1990). Osmoregulatory expression of podn genes in Escherichia coil: a comparative study on strains B and K-12. FEMS MicmbioL Lett. 68, 289-294. 2. Mizuno, T., Chou, M-Y., & Inouye, M. I. (1983). A comparative study on the genes for three porins of the Escherichia coli outer membrane. DNA sequence of the osmoregulated ompC gene. J. Biol. Chem. 258, 6932-6940. 93. Nagasawa, S., Tokishita, S., Aiba, H., & Mizuno, T. (1992). A novel sensor-regulatorprotein that belongs to the homologous family of signal-transduction proteim involved in adaptive responses in Escherichia coll. Mol. Microbiol. 6, 799-807. 94, Nakashima, K., Kanamaru, K., Aiba, H., & Mizuno, T. (1991). Osmoregulatoryexpression of the porin genes in Escherichia coil: Evidence for signal titration in the signal transduction through EnvZ-OmpR phosphotransfer. FEMS Microbiol. Left. 82, 43-48.

260

ARFAAN A. RAMPERSAUD

95. Nakashima, K., Kanamaru, K., Aiba, H., & Mizuno, T. (1991). Signal transduction and osmoregu-

lation in Escherichia coll. A novel type of mutation in the phosphorylation domain of the activator protein. OmpR, results in a defect in its phosphorylation-dependent DNA binding. J. Biol. Chem. 266, 10775--10780. 6. Nara, E, Matsuyama S-I., Mizuno, T., & Mizushima, S. (1986). Molecular analysis of mutant ompR genes exhibiting different phenotypes as to osmoregulation of the ompF and ompC genes of Escherichia coll. MOl. Gen. Genet. 202, 194-199. 97. Nara, E, Mizuno, T., & Mizushima, S. (1986). Complementation analysis of the wild-type and mutant ompR genes exhibiting different phenotyig~ of osmoregulation of the ompF and ompC genes of Escherichia coil MOl Ge~ Genet. 205, 51-55. 98. Neidhardt, E C. (1987). Multigene systems and regulom. In E C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter & H. E. Umbarger (Eds.) Escherichia coli and salmonella typhimurium: Cellular and molecular biology, vol. 2 (pp. 1313-1317). Washington, DC: American Society for Microbiology. 9. Nikaido, H., & Vaara, M. (1985). Molecular basis of bacterial outer membrane permeability. Microbial. Reu 49, 1-32. 100. Nikaido, H., & Vaara, M. (1987). Outer membranes. In E C. Neidhardt, J. L. lngraham, K. B. Low, B. Magasanik, M. Scbaechter and H. E. Umbarger (Eds.) Escherichia coli and salmonella tsphimurium: Cellular and molecular biology, vol. 1 (pp. 7-22). Washington, DC: American Society for Microbiology. 101. Ninfa, A. (1991). Protein phosplgxylatiou and the regulation of cellular processes by the homologous two-comgonent regulatory systems of bacteria. In J. K. Setiow (Ed.) Genetic engineering (pp. 39--72), New York: Plenum Press. 102. Ninfa, A. J., Ninfa, E. G., Lupas, A. N., Stock. A., Magasanik, B., & Stock, J. (1988). Crosstalk between bacterial chemotaxis signal transduction proteins and regulators of Iran~ription of the Ntr regulon: evidence that nitrogen assimilation and chemotaxis are controlled by a common phos~fer mechamsm. Proc. Natl. Acad. Sci. USA 85, 5492-5496. 103. Noriokg S., Ramak~shnan. G., lkenaka, K., & Inoeye, M. I. (1986). Interaction of a transcriptional activator, OmplL with reciprocally osmoregulated genes, ompF and ompCo of Escherichia coli. J. Biol. Chem. 261, 17113-17119. 104. Ostrow, K. S., Silbavy, T. J., & Garrett, S. (1986). c/s-Acting sites required for osmoregulation of ompF expression in Escherichia coli K-12. J. Bacteriol. 168, 1165-1171. 105. Ozawa, Y., Mimno, T., & Mizushima, S. (1987). Roles of the Pribnow box in posRive regulation of the ompC and ompF genes in Escherichia coil J. Bacterial. 169, 1331-1334. 106. Ozawa, Y., Mizmhima, S., & Mizuno, T. (1990). Osmon~gulatoryexpression of the ompC gene in Escherichia coli K-12; ISI insertion in the upstream regulatory region results in constitutive activation of the promoter. FEMS Microbial. Lett. 68, 295-300. 107. Pages, J-M., & Lazdunski, C. (1982). Transcriptional regulation of ompF and lamB genetic expression by local anesthetics. FEM$ Microbial. Lett. 15, 153-157. 108. Parkimon, J. S., & Kofoid, E. C. (1992). Cmnmunication modules in bacterial signaling proteins. Annu. Rev. Genet. 26, 71-112. 109. Pidamen. M., Saarilahti, H. T, Kurkela,S., & Palva, E. T. (1986).In viva cloning and ~mracterization of abe regulatory locus ompR of Escherichia coll. MOl. C,eat Genet. 203, 520-523. II0. Pugsley, A. P. (1993). Ammtion in the dsbA gene coding for periplasmir disulfide oxidoreductase reduces t r a n s c r i ~ of the Escherichia call ompF gene. MOl. Gen. Genet. 237, 407-411. 111. Pugsley, A. P., Conrad, D. J., Sr C. A., & Gregg, T. I. (1980). In viva effects of local anesthetics on the production of major outer membrane proteins by Escherichia coli. Biochim. Biophys. Acta 599, 1-12. 113. Ramani, N., Huang, L., & Freundlich, M. (1992). In vilro interactions of integration host factor with the ompF Immmter-regulatory region of Escherichia coll. Mol. GetL Genet. 231,248-255.

TransmembraneSignaling in Osmoregulation

261

114. Ramakrishnan G., Comeau, D., lkenaka, K., & Inouye, M. I. (1986). Transcriptional control of gene expression: osmoregulation of porin protein synthesis. In M. Inouye (Ed.) Bacterial outer membranes (pp. 3-I 5). New York: John Wiley and Sons, Inc. 115. Rampersaud, A., & Inouye, M. I. (1991). Procaine, a local anesthetic, signals through the EnvZ receptor to change the DNA-binding affinity of the transcriptional activator OmpR. J. Bacteriol. 173, 6882-6888. 116. Rampersaud, A., Norioka, S., & Inouye, M. I. (1989). Characterization of OmpR binding sequences in the upstream region of the ompF promoter essential for transcriptional activation. J. Biol. Chem. 264, 18693-18700. 117. Rampersaud, A., Utsumi, R., Deigado, J., Forst, S., & Inouye, M. I. (1991). Ca2+-enhanced phosphorylation of a chimeric protein kinase involved with bacterial signal transduction. J. Biol. Chem. 266, 7633-7637. 118. Russo, E D., & Silhavy, T. J. (1991). EnvZ controls the concentration of phosphorylated OmpR to mediate o s ~ g u l a t i o n of porin genes. J. Mol. Biol. 222, 567-580. 119. Russo, E D., & Silhavy, T. J. (1992). Alpha: the Cinderella subunit ofRNA polymerase. J. Biol. Chem. 267, 14515-14518. 120. Russo, E D., Slauch, J. M., & Silhavy, T. J. (1993). Mutations that affect separate functions of OmpR, the phosphorylated regulator of porin transcription in Escherichia coil J. Mol. Biol. 231(2), 261-273. 121. Sanders, D. A., Castro, B. L., Stock, A. M., Burlingame, A. L., & Koshland, D. E. (1989) Identification of the site of phosphorylation of the chemotaxis response regulator, CheY. J. Biol. Chem. 264, 21770--21778. 122. Sarma V., & Reeves, P. (1977). Genetic locus (ompB) affecting a major outer-membrane protein in Escherichia coli. J. Bacteriol. 132, 23-27. 123. Scott, N. W., & Harwood, C. R. (1980). Studies on the influence of the cyclic AMP system on major outer membrane proteins of Escherichia coli K 12. FEMS Microbiol. Letts. 9, 95-98. 124. Slauch, J. M., Garrett, S., Jackson, D. E., & Silhavy, T. J. (1988). EnvZ functions through OmpR to control porin gene expression in Escherichia coil K-12. J. Bacteriol. 170, 439-441. 125. Slauch, J. M., Russo, E D., & Silhavy, T. J. (1991). Suppresser mutations in rpoA suggest that OmpR controls transcription by direct interaction with the ot subunit of RNA polymerase. J. Bocterioi. 173, 7501-7510. 126. Slauch, J. M., & Silhavy, T. J. (1989). Genetic analysis of the switch that controls porin gene expression in Escherichio coli K-12. J. Mol. Biol. 210, 281-292. 127. Slauch, J. M., & Silhavy, T. J. (1991). cis-acting ompF mutations that result in OmpR-dependent constitutive expression. J. Bacteriol. 173, 4039-4048. 128. Silhavy, T. J., Berman, M. L., & Enquist, L. W. (1984). Experiments with genefusions. Cold Swing Harbor, NY: Cold Swing Harbor Laboratory. 129. Stock, A. M., Mottonen, J. M., Stock, J. B., & Schutt, C. E. (1989). Three-dimensional structure of CheY, the response regulator of bacterial chemotaxis. Nature 337, 745-749. 130. Stock, J. B., & Lukat, G. S. (1991). Bacterial chemotaxis and the molecular logic of intracellular signal transduction networks.Annu. R~. Biophys. 20, 109-136. 131. Stock, J. B., Ninfa A. J., & Stock, A. M. (1989). Protein phosplggylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53, 450-490. 132. Takayanagi, K., & Mizuno, T. (1992). Activation of the osmoregulated ompF and ompC genes by the OmpR protein in Escherichia coli: A study involving chimeric Wonders. J. Biochem. 112, 1-6. 133. Tate, S-I., Kato, M., Nishimura, Y., Anita, Y., & Mizuno, T. (1988). Location of DNA-binding segment of a positive regulator, OmpR, involved in activation of the ompF and ompC genes of Escherichia coli. FEBS Len. 242, 27-30. 134. Taylor, R. K., Garrett, S., Sodergren, E., & Silhavy, T. J. (1985). Mutations that define the promoter of ompE a gene specifying a major outer membrane porin protein. J. Bacteriol. 162, 1054--1060.

262

ARFAAN A. RAMPERSAUD

135. Taylor, R. K., Hall, M. N., & Silhavy, T. J. (1983). Isolation and characterization of mutations altering expression of the major outer membrane porin proteins using the local anesthetic procaine. J. MOI. Biol. 166, 273-282. 136. Tokishita, S-l., Kojirna, A., & Mizuno, T. (1992). Transmembrane signal transduction and osmoregulation in Escherichia coil Functional imcotxm~e of the transmembrane regions of membrane-located protein kinase, EnvZ. J. Biochm. I I I, 707-713. 137. Tokishita, S-I., Kojirrm, A., Aiba, H., & Mizuno, T. (1991). Transmembrane signal transduction and osmoregulation in Escherichia coil Functional importance of the periplasmic region of membrane-located protein kinase, EnvZ. J. Biol. Chem. 266, 6780-6785. 138. Tokishita, S-I., Yamada, H. A., Aiba, H., & Mizuno, T. (I 990). Transmembrane signal transduction and osmoregulmion in Escherichia coli: II. The osmotic sensor, EnvZ, located in the isolated cytoplasmic membrane displays its phosphorylation and dephosphorylation abilities as to the activator protein, OmpR. J. Biochem. 108, 488-493. 139. Tsui, P., Helu, V., & Freundlich, M. (1988). Altered osmoregulation of ompF in integration host factor mutants of Escherichia coil J. Bacteriol. 170, 4950-4953. 140. Tsui, P., Huang, L., & Freundlich, M. (1991). Integration host factor binds specifically to multiple sites in the ompB promoter of Escherichia coli and inhibits transcription. J. Bacterial. 173, 5800--5807. 141. Tsung, K., Brissette, R. E., & Inouye, M. I. (1990). Enhancement ofRNA polymerase binding to promoters by a transcriptional activator, OmpR, in Esclnerichia coil: its positive and negative effects on ~ranscription. Proc. Natl. Acad. Sci. USA 87, 5940-5944. 142. Tsung, K., Brissette, R. E., & Inouye, M. I. (1989). Identification of the DNA-binding domain of the OmpR protein required for transcriptional activation of the ompF and ompC genes of Escherichia coli by in vivo DNA footprinfing. J. Biol. Chem. 264, 10104-10109. 143. Utsumi, R., Brissette R. E., Rmnpersaud, A., Forst, S. A., Oosawa, K., and Inouye, M. I. (I 989). Activation of a bacterial porin gene expression by a chimeric signal transducer in response to aspartate. Science 245, 1246-1249. 144. Van Aiphen, W., & Lugtenberg, B. (1977). Influence of osmolarity of the growth medium on the outer membrane protein pattern of Escherichia coll. J. Bacteriol. 131,623-630. 145. Verhoef, C., Lugtenberg, B., van Boxtel, R., deGraaff, P., & Verheij, H. (1979). Genetics and biochemistry of the peptidoglycan-associated proteins b and c of Escherichia coli K-12. Mol. Gen. Genet. 169, 137-1383. 146. Villarejo, M., & Case, C. (1984). envZ mediates transcriptional control by local anesthetics but is not required for osmoregulation in E. coll. J. Bacteriol. 159, 883-887. 147. Wandersman, C., Moreno, E, & Schwartz, M. (1980). Pleiotropic mutations rendering Es. cherichia coli K-12 resistant to bacteriophage TPl. J. Bacteriol. 143, 1374-1383. 148. Wanner, B. L., Smhy, A., & Beckwith, J. (1979). Escherichia coli pleiotropic mutant that reduces amounts of several periplasmic and outer membrane protmns. J. Bacteriol. 140, 229-239. 148a.Warmer, B. L. (1992). Is cross regulation by phosp~lation of two-component response regulator proteins important in bacteria? J. Bacteriol. 174, 2053-2058. 149. Waukau, J., & Forst, S. A. (1992). Molecular analysis of the signaling pathway between EnvZ and OmpR in Escherichia coli. J. Bacteriol. 174, 1522-1527. 1.50. Wurtzei, E. T., Chon, M-Y., & Inouye, M. I. (1982). Osmoregulation of gene expression, I. DNA sequence of the ompR gene of the ompB ~ of Escherichia coil and characterization of its gene product. J. Biol. Chem. 257, 13685-13691. 151. Yang, Y., & Inouye M. I. (1991). Intermolecular cmnplementation between two defective mutant signal-transducing receptors of Escherichia coli. Proc. Natl. Acad. Sci. USA 88, 11057-11061. 152. Yang, Y., & Inouye M. I. (1993). Requirement of hoth Idnase and phosphatase activities of an Escherichia coli receptor (Tazl) for ligand-dependent signal transduction. J. MOl. Biol. 231 (2), 261-273.