MEFV mutations and their relation to major clinical symptoms of Familial Mediterranean Fever

Accepted Manuscript MEFV mutations and their relation to major clinical symptoms of Familial Mediterranean Fever

Nilgun Cekin, Murat Eser Akyurek, Ergun Pinarbasi, Filiz Ozen PII: DOI: Reference:

S0378-1119(17)30337-2 doi: 10.1016/j.gene.2017.05.013 GENE 41913

To appear in:

Gene

Received date: Revised date: Accepted date:

31 March 2017 28 April 2017 4 May 2017

Please cite this article as: Nilgun Cekin, Murat Eser Akyurek, Ergun Pinarbasi, Filiz Ozen , MEFV mutations and their relation to major clinical symptoms of Familial Mediterranean Fever, Gene (2017), doi: 10.1016/j.gene.2017.05.013

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT MEFV Mutations and Their Relation to Major Clinical Symptoms of Familial Mediterranean Fever Nilgun Cekin1, Murat Eser Akyurek2, Ergun Pinarbasi1*, Filiz Ozen3 1

Department of Medical Biology, Faculty of Medicine, Cumhuriyet University, Sivas, Turkey

2

Atlas Biotechnology Company, Ankara, Turkey

3

PT

Medeniyet University, Ministry of Health, Goztepe Training and Research Hospital, Istanbul, Turkey

*

RI

Corresponding author

SC

Address: Cumhuriyet University, Department of Medical Biology,

NU

Faculty of Medicine, 58140, Sivas, Turkey

AC

CE

PT E

D

MA

[email protected]

1

ACCEPTED MANUSCRIPT Abstract

Familial Mediterranean fever is a common hereditary disease in Turkey. To date, different mutational spectrum of MEFV gene was observed in studies carried out in different regions of Turkey but in most of these studies association of clinical symptoms of FMF to mutant genotypes have not been investigated in details. Here we report the MEFV gene variations in exons 2, 3, 5 and 10 and their relations to major clinical symptoms of FMF in 514 unrelated

PT

(245 males and 269 females) Turkish patients. MEFV mutations were found in 45% (n=230) of patients and 55% (n=284) of patients did not have any mutations. One hundred and thirty-

RI

seven (60%) patients were heterozygous, 57 (24.7%) patients were compound heterozygous,

SC

33 (14%) patients were homozygous and 3 (1.3%) patients were having a complex genotype. Allele frequencies of MEFV mutations were M694V (48%), E148Q (18%), M680I (15%),

NU

V726A (12.5 %), P369S (3.3%), R761H (0.9), K695R (0.9), E148V (0.9) and A744S (0.5%). Abdominal pain (76%) and fever (58%) were two most seen complications among patients followed by arthritis (28%) and chest pain (19%). Almost all major clinical symptoms of FMF

MA

were higher in patients with one or more M694V or M680I mutant allele. In contrast, patients having E148Q or V726A mutant allele showed fewer clinical FMF symptoms. Patients with

D

P369S have higher abdominal pain, chest pain and fever than expected. Arthritis was high in K695R heterozygous genotype. One hundred and eighteen patients were carrying more than

PT E

one polymorphic allele. The most common polymorphism was R202Q (13%). In addition, a novel heterozygous polymorphism at 564th nucleotide (C>T) of exon2 were found in 2 patients.

AC

correlation.

CE

Keywords: Familial Mediterranean Fever; MEFV mutation; Turkey; genotype-phenotype

2

ACCEPTED MANUSCRIPT 1.Introduction Familial Mediterranean Fever (FMF) is an autosomal recessive inherited disease commonly seen in Arabs, Jews, Armenians and Turks (Ben-Chetrit and Touitou, 2009; Sohar et al., 1967; Touitou I, 2001). High fever episodic self-limiting attack of fever along with abdominal pain, arthritis and serositis are characteristics of the disease. Long term complication is amyloid A amyloidosis (Ben-Chetrit and Touitou, 2011; Touitou I, 2001). FMF gene, MEFV, is located

PT

on chromosome 16.p13.3 and encodes a 781 amino acids protein called pyrin or marenostrin (Consortium, F.F., 1997; Bernot et al., 1998). The gene has 10 exons which encodes a protein

SC

(Touitou et al., 2004; French FMF Consortium, 1997).

RI

that regulates the activity of several target proteins involved in apoptosis and inflammation

More than 300 sequence variations in MEFV gene were found to be associated with FMF

NU

phenotype. Some of these mutations were pathogenic but most of them seem to be unconfirmed nonpathogenic variants (Fujikura K., 2015, Lazarin et al., 2013, Touitou et al.,

MA

2004, Infevers database, 2017)

Five of the most commonly found mutations; M680I, M694V, M694I and V726A, and

D

E148Q account for 65-95% of the cases. Rest of the mutations are very rare in different populations (reviewed in Kallinich et al., 2017; Sonmez et al., 2016; Ben-Chetrit E. and

PT E

Touitou I., 2009). Carrier frequency of FMF vary significantly by ethnic and racial groups. The estimated carrier rate and prevalence of FMF in Turkey is 1/5 and 1/1,000 respectively ( Aksentijevic et al., 1999; Lazarin et al., 2013; Yilmaz et al., 2001; Tunca et al, 2005; Dundar

CE

et al., 2011; Akin et al., 2010)

AC

Previous FMF researches in patients from various regional parts of Turkey mainly concentrated on common MEFV mutations and the relations of these variations to FMF phenotype has not been investigated in details (Sayin Kocakap et al., 2014; Gunesacar et al., 2014; Dogan et al., 2015; Coskun et al., 2015; Kilinc et al., 2016). In this study by sequencing exons 2, 3, 5 and 10 of MEFV gene in 514 unrelated FMF patients we aimed to investigate all variations in these exons including common, rare and polymorphic changes and to find out the role of genotypes on major clinical symptoms of FMF including abdominal pain, fever, chest pain and arthritis.

3

ACCEPTED MANUSCRIPT 2. Material and methods. 2.1. Patients A total of 514 clinically suspected FMF patients (245 males, 269 females, aged between 5 and 42) referred to Medeniyet University, Ministry of Health, Department of Genetics, Goztepe Training and Research Hospital, Istanbul, Turkey, were enrolled in this study. All patients

PT

were clinically diagnosed with FMF according to Tel-Hashomer criteria or showed symptoms of FMF (Livneh et al., 1997). The study has been approved by the ethics committee of Zekai

RI

Tahir Hospital, Turkey (No: 42/2014) and informed consent was obtained from all patients

SC

who participated in the study.

Table 1: Amplicon size and primer sequences used in this study Primer Sequence (5’-3’)

EXON 2.2F EXON 2.2R

GAGCCTGAAGACTCCAGAC) TCGTTTATAGAGATGGCGGG

EXON 3F EXON 3R

TAACTGAGAACTCGCACATCTC CTTGTGTTCCAGGGCGACCTC

532

EXON 5F EXON 5R

TATCGCCTCCTGCTCTGGAATC CACTGTGGGTCACCAAGACCAAG

526

CCAGAAGAACTACCCTGTCCC CGTGACTATTGAGTGTGAATGCA

720

CE

PT E

D

MA

ATCTTGGGCCCTAAACGTGG TTCTAGTCGCATCTTTCCCGAG

Amplicon size (bp) 499

742

AC

EXON 10F EXON 10R

NU

EkzonNo/Forward (F)/Reverse (R) EXON 2.1F EXON 2.1R

2.2. Amplification and direct sequencing of MEFV exons 2, 3, 5 and 10. Genomic DNA was isolated from peripheral blood samples using ExgeneTM Cell SV Kit (Geneall) according to the manufacturer’s instructions. MEFV gene exons were amplified using primers that were designed using primer 3 program (http://bioinfo.ut.ee/primer30.4.0/primer3/). Primer sequences and amplicon sizes are given in Table 1. Exon 2 was 4

ACCEPTED MANUSCRIPT amplified as two fragments since the size of this exon is too big. Sequencing PCR was done with BigDye® Terminator v3.1 Cycle Sequencing Kit (Life Technologies) and amplified products were run on an automated Applied Biosystems 3130xl Genetic Analyzer. 2.3 .Statistical analysis Data were analyzed using SPSS 23.0 (SPSS, Chicago, IL, USA) program. Chi square or

PT

Fisher’s exact test were used for comparison of data. Means were compared with Student’s ttest. For all tests p<0.05 was considered as significant.

SC

RI

3. Results

Mutation spectrum of MEFV gene and distribution of mutant genotypes among gender in 514 Turkish patients is given in Table 2. Mean age of 514 patients were 15.04±8.4 years.

NU

According to our molecular analysis while 45% (230/514) of the patients had mutations in MEFV gene, 55 % (284/514) of the patients did not have any mutations. Out of 230 patients

MA

with mutations, 128 (56%) were males and 102 (44%) were females.

There were no

statistically significant difference between males and females for carrying a MEFV mutation (p>0.05). Out of 230 mutation detected patients, 137 (60%) were heterozygous, 57 (25%)

D

were compound heterozygous, 33 (14%) were homozygous, and 3 (1%) were having a

PT E

complex genotype (Table 3). When we compared the mutation frequency by gender, there were no statistically significant difference between genders and heterozygous, compound heterozygous and homozygous genotypes (Table 3, p=0.85).Distribution of patients’ major

CE

clinical features including abdominal pain, fever, chest pain and arthritis among genetic variations is given in Table 4. According to our data, the most common clinical feature was

AC

abdominal pain (76%) and fever (58%) followed by arthritis (28%) and chest pain (19%). Although abdominal pain was higher in patients carrying M694V or M680I homozygous or heterozygous genotypes, it is found to be a common clinical symptom for almost all mutant genotypes detected in our cohort ranging from 25 to 100% frequency. It was lower in E148Q and V726A genotypes. The rate of chest pain was higher in patients with M680I allele followed by M694V and P369S. While the rate of fever was high in patients with M694V, M680I, P369S, R761H alleles, it was lower in patients with E148Q and V726A mutations.

5

ACCEPTED MANUSCRIPT Table 2: MEFV gene mutations and their distrubution in male and female FMF patients Patients n

MA

Homozygous

D

Complex

52 31 16 11 20 3 2 2 137 18 12 14 9 3 1 57 26 4 2 1 33 3

SC

Compound Heterozygous

M694V E148Q V726A P369S M680I K695R R761H A744S TOTAL M694V/M680I M694V/V726A M694V/E148Q M680I/V726A M694V/E148V M694V/R761H TOTAL M694V E148Q V726A M680I TOTAL E148QHomozy gous/M694V heterozygous TOTAL TOTAL

NU

Heterozygous

Gender (n) % Male Female 22.60 30 22 13.47 20 11 6.95 8 8 4.78 6 5 8.69 11 9 1.30 1 2 0.86 1 1 0.86 2 60 77 60 7.82 11 7 5.21 5 7 6.08 8 6 3.91 6 3 1.30 1 2 0.43 1 24.7 32 25 11.30 14 12 1.73 3 1 0.86 1 1 0.43 1 14 18 15 1.30 1 2

PT

Genotype

RI

Mutation Type

PT E

3 230 230(45) 284(55) 514

1 128 128(56) 126(52) 245(47)

2 102 102(44) 158(58) 269(53)

CE

Patient with Mutation, n (%) Patient W/O Mutation, n, (%) Total Number of Patient, n, (%)

1.3 100

Table:3: Comparison of MEFV genotype in gender Het CH Hom p (n) (n) (n) male 77 32 18 0.85 female 60 25 15 Total 137 57 33 Het:Heterozygous;CH:compound heterozygous; Hom:Homozygous

AC

gender

As M694V was the most common mutant allele in our cohort we evaluated the phenotypegenotype relationship of M694V mutation using chi square or Fisher’s exact test where appropriate (Table 6). For this purpose M694V homozygous patients’ (group1) clinical features was compared with M694V heterozygous (Group2) and other genotypes (Group 3) found in our cohort. We have also compared M694V heterozygous patients’ characteristics 6

ACCEPTED MANUSCRIPT with other genotypes’. While we did not detect any statistical significance between groups 2 and 3 for abdominal pain (p=0.07) we found a strong relationship for groups 1 &2 and 1&3 (p<0.05). There were no statistical significance among all three groups for fever (p>0.05). For arthritis there were no statistical difference between group 1 and 2 (p>0.05). It was significant in groups 1&3 and 2&3 (p<0.05). For chest pain only in groups 2 and 3 statistical significance was detected (p=0.02). We have also statistically evaluated clinical symptoms in compound heterozygous and heterozygous groups (Table 6). We found no statistically significant

PT

difference among these two groups for respective clinical features (p>0.05).

CE

AC

FV n (%)

SC

48/92 15/48 6/37 8/72 16/80 2/66 2/100 1/50

11/21 2/6 1/6 2/18 5/25

MA

52 31 16 11 20 3 2 2

ART n (%)

40/76 4/13 2/12 8/72 16/80 1/33 2/100 1/50

20/38 5/16 1/6 1/9 3/15 3/100 1/50

18 12 14 9 3 1

16/88 10/83 11/78 6/66 2/66 1/100

7/38 2/16 2/14 2/22 1/33

14/77 9/75 8/57 6/67 1/33

8/44 4/33 3/21 1/11 1/33

26 4 2 1

25/96 1/25 2/100 1/100

8/30

20/76

13/50

1/100

1/100

1/100

3

2/66

PT E

Heterozygous M694V/wt E148Q/wt V726A/wt P369S/wt M680I/wt K695R/wt R761H/wt A744S/wt Compound Heterozygous M694V/M680I M694V/V726A M694V/E148Q M680I/V726A M694V/E148V M694V/R761H Homozygous M694V E148Q V726A M680I Complex E148QHomozygous/M694V heterozygous TOTAL

CP n(%)

NU

n AP n (%)

D

Mutation/Genotype

RI

Table 4: Distribution of major FMF clinical symptoms in different MEFV genotypes

1/33

230

175 44 76 19 AP:Abdominal pain, CP:Chest pain, FV, Fever, ART:Arthritis

135 58

65 28

Other genetic variations we found in the present study are given in Table 7. R202Q was the most common polymorphism in our study group. Fifty four (36 males, 18 females) patients were heterozygous and 16 (11 males, 5 females) were homozygous for R202Q polymorphism. Heterozygosity for R314R, D103D, G138G was also identified in 18 patients. Complex 7

ACCEPTED MANUSCRIPT polymorphic genotypes such as R314R and G138G heterozygous but D103D homozygous or D103D homozygous but R313R heterozygous genotypes were detected in 28 patients. In addition, a novel heterozygous polymorphism at 564th nucleotide (C>T) of exon2 (P188P) were found in 2 female patients. Overall polymorphic genotypes were identified in 118 patients. Seventy one of them were males (60%) and 47 (40%) were females. While there was no statistically significant difference between males and females for complex polymorphic variants (p=0.9), both homozygous and heterozygous R202Q polymorphism were

PT

significantly seen higher in males (p<0.05).

M694V/M694V M694V/others Other Group (Gr) 1 Gr2 genotypes n=26 n=103 n/% n(%) n(%) Gr 3 AP 25(96) 90(87) 60(59) FV 20(77) 73(71) 42(41) CP 8(30) 23(22) 13(13) ART 13(50) 37(36) 16(15) AP:Abdominal pain, CP:Chest pain, FV, Fever, ART:Arthritis

p Gr1/2

P Gr1/3

P Gr2/3

0.00001 0,07 0.80 0.5

0.0001 0,09 0.08 0.016

0.07 0.19 0.02 0016

MA

NU

SC

Clinical symptoms

RI

Table 5:Genotype-pheotype correlations of M694V mutation

D

Table 6: Genotype-phenotype correlations in heterozygous genotypes Compound Heterozygous p Heterozygous n (%) n(%) AP 46(80) 98(71) 0.6 FV 38(66) 74(54) 0.41 CP 14(24) 21(15) 0.22 ART 17(58) 34/(24) 0.58 AP:Abdominal pain, CP:Chest pain, FV, Fever, ART:Arthritis

AC

CE

PT E

Clinical symptoms

The overall allelic frequency of MEFV mutations in our cohort of 325 unrelated alleles is illustrated in Table 8. The most frequent alleles were M694V (48%) followed by E148Q (18%), M680I (15%), V726A (12.5%), P369S (3.3%) R761H, K695R and E148V (0.9%) and A744S (0.5%).

8

ACCEPTED MANUSCRIPT

R202QHET R202QHOM R314RHET/D103DHET/G138GHET R314RHET/D103DHOM/G138GHOM R314RHET/D103DHET R314RHET/D103DHOM/ P188PHET R314RHET/G138GHOM TOTAL, n (%) Heterozygous:HET, Homozygous:HOM

Gender (n) p Males Females 36 18 0.02 11 5 8 10 0.9 9 7 4 2 2 2 2 1 1 71 (14) 47(9)

RI

Polymorphic variants

NU MA D

PT E

Number of Frequency alleles (%) 155 48 59 18 49 15 40 12.5 11 3.3 3 0.9 3 0.9 3 0.9 2 0.5 325 100

SC

Table 8: Overall allel frequencies of MEFV mutations. Mutation type M694V E148Q M680I V726A P369S R761H K695R E148V A744S TOTAL

PT

Table 7: Distribution of polimorphic variants among FMF patients

CE

4. Discussions

There has been varying results about the distribution of MEFV mutation in different

AC

populations, even in the population of different regions of the same country. In addition there are only a little data about genotype-phenotype relationship of the disease (Ozen S and Batu ED., 2015). Therefore identifying MEFV mutations and detecting their relation with clinical symptoms are important both in diagnosis and severity of the disease. In our study, we identified MEFV mutations in 514 FMF patients and then looked for a correlation between these mutations and major clinical symptoms of the disease. Our patients were from Istanbul which is the most populated city of Turkey. As it receives migration from all parts of the country our cohort could be a good example of representing the general population.

9

ACCEPTED MANUSCRIPT A total of 245 males and 269 females enrolled in our study. Although we found MEFV gene mutations slightly high in males, we could not find statistically significant difference in MEFV mutation profile of females and males (p>0.05). Our results are supported by previous works indicating that the disease affect both sex equally (Saatci et al., 1997) despite female predominance was reported in a few studies (Ece et al., 2014; Oztuzcu et al., 2014). When ordered from high to low the most frequently observed MEFV mutations in various

PT

ethnic groups were found to be M694V, M680I, V726A, E148Q in Turks and Armenians,; V726A, M680I, M694V, M694I, E148Q in Arabs,; E148Q, V726A in Ashkenazi Jews and

RI

V726A, M694V, E148Q and M680I in Jews (reviewed in Ben-Chetrit E., 2009). We obtained

SC

similar result to studies carried out with Turkish patients but E148Q was the second most common mutation in our cohort, which is also reported to be a second most common mutation in some studies (Etem et al., 2010; Gulec et al., 2012; Pasa et al., 2008). Moreover previous

NU

studies demonstrate that E148Q is not likely to be a disease causing mutation and high E148Q mutation in this study is consistent with previous data (Fujikura K., 2015; Tchernitchko et al.,

MA

2003).

In many studies, M694V was shown to be the most common MEFV mutation with a

D

frequency range of 35 to 60% in almost all regions of Turkey except southern part (18%) in

PT E

which E148Q was the commonest (Akin et al., 2010; Dundar et al., 2011; Coskun et al., 2015; Dogan et al. 2012; Gunesacar et al., 2014; Evliyaoglu et al., 2009). We also found M694V as the most common mutation with a frequency of 48%. In addition, we found E148Q, M680I

CE

and V726A with a frequency of 18, 15 and 12% respectively. Varying mutation frequencies were obtained for these three mutations in different geographical regions of Turkey. For

AC

example, V727A, E148Q and M680I mutation frequency ranged from 3 to 14 %, 3 to 19% and 1 to 25% respectively in 25 studies (summarized in Coskun et al., 2015). The difference in the methods used to identify mutations, varying cohort size or regional genetic heterogeneity could be the cause of these incompatible results. Despite these incompatible results, these three mutations are highly represented in Turkish patients. Patients with heterozygous, compound heterozygous, homozygous and complex genotype frequencies in our study was 60, 25, 14 and 1% respectively. In previous studies from different regions of Turkey these were reported to be between 54-80% for heterozygous, 718% for homozygous, 11-26% for compound heterozygous and 0-10% for complex genotypes. Our result is similar to that of patients from Central part of Turkey in which 10

ACCEPTED MANUSCRIPT heterozygous, compound heterozygous, homozygous and complex genotype frequencies were 58, 24, 18 and 0 % respectively (Dogan et al., 2012). It is possible to think that our patients migrated from central part of Turkey. In our study we found overall rare mutation allele frequency as 3%. It was reported to be between 0-5% in different populations (Touitou 2001). It was 3% in a study from North-East region of Turkey (Dogan et al., 2015). When data analyzed from different studies, rare

PT

mutation types and frequencies increase with larger cohort size. It could be the reason we did

RI

not detect other types of rare mutations.

Major clinical symptoms of FMF has been reported previously. Studies correlating phenotype

SC

severity-genotype relationship of FMF mainly used two different scoring systems developed by Pras and Mor (Pras et al., 1998; Mor et al., 2005). But studies raised the concerns about the

NU

reliability of these two systems as lack of correlation and inconsistencies between them (Kalkan et al., 2012). Therefore we did not use any of these systems when identifying Frequency of abdominal pain, fever, chest pain and

MA

genotype-phenotype relationships.

arthritis varies in different studies for Arabs, Jews, Armenians and Turks but the most prevalent clinical features were abdominal pain and fever for all ethnic groups (Tunca et al.,

D

2005). We also found these two clinical symptoms quite high in our patients. When we

PT E

compared heterozygous and compound heterozygous patients for 4 clinical features we found no difference (p>0.05). As the number of patients with homozygous genotypes were very low in our study we did not compared patients with homozygous genotype. But when we

CE

compared M694V homozygous and heterozygous genotypes for genotype-phenotype correlations with other genotypes, we found that abdominal pain and arthritis were two

AC

important symptoms for M694V genotype. These two clinical features were also found to be characteristics of M694V related genotypes in other studies except for Japanese population in which fever and arthritis were found to be higher ( Olgun et al., 2005; Coskun et al., 2015; Migita et al 2016; Atoyan et al., 2016; Battal et al., 2017). When we evaluated genotypephenotype relationship in general, we can see that among all genotypes E148Q and V726A were two milder genotypes in our cohort. It has been proposed that E148Q is likely to be a polymorphism, not a disease-causing mutation, and has low penetrance (Tchernitchko et al., 2003), but no consensus has yet been reached. It could be one of the reason that E148Q has milder phenotype. Conversely patients with M694V and M680I allele showed increased

11

ACCEPTED MANUSCRIPT level of clinical symptoms. Our findings is in agreement with previous reports (Coskun et al., 2015). One of the important findings in our study is that the high frequency of fever, chest pain and abdominal pain in p369S heterozygous genotype and high frequency of arthritis in K695R heterozygous genotype. The results of a recent study by Battal et al., in which frequency of especially arthritis found to be very high in these genotypes, support our results for these two

PT

genotypes. Although number of patients in these two groups are low in both studies, we think

RI

that these two genotypes are also severe genotypes and should be investigated further. We identified several SNPs in homozygous and heterozygous state. The most common SNP

SC

in our sequencing analysis was R202Q. It is also found to be a common SNP even in healthy population (Yigit et al., 2012; Giaglis et al., 2007). Overall frequency of this SNP was 13%

NU

in our study. It was found between 5-34 % in Turkish population. In some studies it was still listed as a most common seen mutations in FMF but in most studies it is accepted as a

MA

polymorphism (Gunesacar et al., 2012; Yilmaz et al., 2015). The high rate of polymorphic variants seen in FMF may contribute the development of by means of additive effect.

D

We detected no mutations in 55% of the patients. This frequency is in the range of previous findings that calculated this frequency to be between 40-65% in Turkish patients (Gunesacar

PT E

et al., 2014). There could be many reasons for high no mutation rate for FMF. For example gene regulation defects or mutations in noncoding regions as well as additive effects of silent

CE

variations which has not yet been investigated, may cause the FMF pehotype. Relatively small number of patients in rare and homozygous mutation groups and the lack of

our study.

AC

recorded other clinical symptoms seen in FMF such as amyloidosis are major limitations of

5. Conclusions

In summary we confirmed that M694V is the most common genotype. M680I, p369S and K695R are severe genotypes and they are sharing FMF related symptoms almost at similar degree. Patients carrying E148Q or V726A related genotypes have milder form of the disease. Further studies with more patients and full exom sequencing of the MEFV gene including noncoding regions is necessary in order to correlate FMF symptoms and genotypes accurately. 12

ACCEPTED MANUSCRIPT 6. Conflict of interest The author declare that there is no conflict of interest. 7. Acknowledgement Funding: this work was partly supported by TUBITAK, Ankara, Turkey (grant number:

PT

1130074, 2014).

RI

6.References

Akin, H., Onay, H., Turker, E., Cogulu, O., Ozkinay, F. 2010. MEFV mutations in patients

SC

with Familial Mediterranean Fever from the Aegean region of Turkey. Mol Biol Rep. 37(1),

NU

93-8. doi: 10.1007/s11033-009-9543-1.

Aksentijevich, I., Torosyan, Y., Samuels, J., Centola, M., Pras, E., Chae, J.J., Oddoux, C., Wood, G., Azzaro, M.P., et. al. 1999. Mutation and Haplotype Studies of Familial

MA

Mediterranean Fever Reveal New Ancestral Relationships and Evidence for a High Carrier Frequency with Reduced Penetrance in the Ashkenazi Jewish Population. Am. J. Hum. Genet.

D

64, 949-962.

PT E

Atoyan, S., Hayrapetyan, H., Sarkisian, T., Ben-Chetrit, E. 2016. MEFV and SAA1 genotype associations with clinical features of Familial Mediterranean Fever and amyloidosis in

CE

Armenia. Clin Exp Rheumatol. 34, 72-76. Battal, F., Silan, F., Topaloğlu, N., Aylanç, H., Yıldırım, Ş., Köksal, Binnetoğlu F., Tekin,

AC

M., Kaymaz, N., Ozdemir O. 2017. The MEFV gene pathogenic variants and phenotypegenotype correlation in children with familial Mediterranean fever in the Çanakkale population. Balkan J Med Genetics 5;19(2), 23-28. doi: 10.1515/bjmg-2016-0032. Ben-Chetrit, E., Touitou, I., 2011. The impact of MEFV gene identification on FMF: an appraisal after 15 years. Clin. Exp. Rheumatol. 30, S3–S6. Ben-Chetrit, E., and Touitou, I. 2009. Familial Mediterranean Fever in the world. Arthritis Rheum. 61, 1447-53. doi: 10.1002/art.24458.

13

ACCEPTED MANUSCRIPT Bernot, A., da Silva, C., Petit, J.L., Cruaud, C., et. al. 1998. Non-founder mutations in the MEFV gene establish this gene as the cause of familial Mediterranean fever (FMF). Hum Mol Genet., 7, 1371-25. Coskun, S., Kurtgöz, S., Keskin, E., Sönmez, F., Bozkurt, G. 2015. Frequency of mutations in Mediterranean fever gene, with gender and genotype-phenotype correlations in a Turkish

PT

population. J Genetics 94, 629-35. Dogan, H.O., Koca, Y., Erden, G., Karaaslan, Y., Bozat, H., 2012. Evaluating MEFV

RI

mutation frequency in Turkish familial Mediterranean fever suspected patients and gender

SC

correlation: a retrospective study. Mol. Biol. Rep. 39, 6193–6196.

Dogan, H., Faruk, Bayrak, O., Emet, M., Keles, M., Gulluoglu, S., Gul, Z., Pirim, I. 2015.

NU

Familial Mediterranean fever gene mutations in north-eastern part of Anatolia with special respect to rare mutations. Gene 568(2),170-5. doi: 10.1016/j.gene.2015.05.045.

MA

Dundar, M., Emirogullari, E.F., Kiraz, A., Taheri, S., Baskol, M. 2011. Common Familial Mediterranean Fever gene mutations in a Turkish cohort. Mol. Biol. Rep. 38, 5065–5069.

D

Ece, A., Cakmak, E., Uluca, U., Kelekci, S., Yolbas, I., Gunes, A., Yel, S., Tan, I., Sen, V.,

PT E

2014. The MEFV mutations and their clinical correlations in children with familial Mediterranean fever in southeast Turkey. Rheumatol. Int. 34, 207–212. Etem, E. 2010. Familial Mediterranean fever: a retrospective clinical and molecular study in

CE

the east of Anatolia Region of Turkey. Open Rheumatol. J. 4, 1–6.

AC

Evliyaoglu, O., Bilici, S., Yolbas, I., Kelekci, S., Sen, V., 2009. Diyarbakir Yoresi Ailevi Akdeniz Atesli Cocuklarda MEFV Gen Mutasyon Sıklıkları. Dicle Tıp Dergisi, 36, 80–84. French FMF Consortium. 1997. A candidate gene for familial Mediterranean fever. Nat Genet. 17, 25-31. Fujikura, K., 2015. Global epidemiology of Familial Mediterranean fever mutations using population exome sequences Mol Genet Genomic Med.; 3, 272–282. doi: 10.1002/mgg3.140

14

ACCEPTED MANUSCRIPT Giaglis, S., Papadopoulos, V., Kambas, K., Doumas, M., Tsironidou, V., Rafail, S., et al. 2007. MEFV alterations and population genetics analysis in a large cohort of Greek patients with familial Mediterranean fever. Clin. Genet. 71, 458–467. Gulec, D., Celebiler, A., Karaca, B. 2012. The distribution of MEFV gene mutations in patients pre-diagnosed as FMF in Izmir region. Türk Klin. Biyokimya Dergisi 10, 95–101.

PT

Gunesacar, R., Celik, M.M., Arica, V., Elmacioglu, S., Ozturk, O.H. 2014. Frequency of MEFV gene mutations in Hatay province, Mediterranean region of Turkey and report of a

RI

novel missense mutation (I247V). Gene 546, 195–199.

SC

Infevers. 2013. The registry of familial Mediterranean fever (FMF) and hereditary autoinflammatory disorders mutations. http://fmf.igh.cnrs.fr/ISSAID/infevers.

NU

Kalkan, G., Demirkaya, E., Acikel, C.H., Polat, A., Peru, H., Karaoglu, A., Sari, E., Dursun, I., Gok, F., Ozen, S. 2012. Evaluation of the current disease severity scores in paediatric FMF:

MA

is it necessary to develop a new one? FMF Arthritis Vasculitis and Orphan Disease Research in Paediatric Rheumatology (FAVOR). Rheumatology (Oxford). 51(4), 743-8. doi:

D

10.1093/rheumatology/ker421.

PT E

Kallinich, T., Orak, B., Wittkowski, H., 2017. Role of genetics in Mediterreanean fever. Z.Rheumatol. doi: 10.1007/s00393-017-0265-9 Kilinc, M., Ganiyusufoglu, E., Sager, H., Celik, A., Olgar, S., Cetin, G.Y., Davutoglu, M.,

CE

Altunoren, O. 2016. The report of sequence analysis on familial Mediterranean fever gene (MEFV) in South-eastern Mediterranean region (Kahramanmaraş) of Turkey. Rheumatol Int.

AC

36(1), 25-31. doi: 10.1007/s00296-015-3329-7. Lazarin, G.A., Haque, I.S., Nazareth, S., Iori, K., Patterson, A.S., Jacobson, J.L, et al. 2013. An empirical estimate of carrier frequencies for 400+ causal Mendelian variants: results from an ethnically diverse clinical sample of 23,453 individuals. Genet. Med. 15,178–186. Livneh, A., Langevitz, P., Zemer, D., Zaks, N., Kees, S., Lidar, T., et al. 1997. Criteria for the diagnosis of familial Mediterranean fever. Arthritis Rheum., 40,1879–85. Migita, K., Uehara, R., Nakamura, Y., Yasunami, M., Tsuchiya-Suzuki, A., Yazaki, M., et al., 2012. Familial Mediterranean fever in Japan. Medicine 91, 337–343. 15

ACCEPTED MANUSCRIPT Mor, A., Shinar, Y., Zaks, N., Langevitz, P., Chetrit, A., Shtrasburg, S. et al. 2005. Evaluation of disease severity in familial Mediterranean fever. Semin Arthritis Rheum. 35(1), 57–64. Olgun, A., Akman, S., Kurt, I., Tuzun, A., Kutluay, T. 2005. MEFV mutations in familial Mediterranean fever: association of M694V homozygosity with arthritis. Rheumatol Int. 25(4), 255-9.

PT

Ozen, S. and Batu, E.D. 2015. The myths we believed in familial Mediterranean fever: what have we learned in the past years? Semin Immunopathol. 37(4), 363-9. doi: 10.1007/s00281-

RI

015-0484-6.

SC

Oztuzcu, S., Ulasli, M., Ergun, S., Igci, Y.Z., Igci, M., Bayraktar, R., Nacarkahya, G., Tamer, A., Cevik, M.O., Cakmak, E.A., Arslan, A., 2014. Screening of common and novel familial

NU

Mediterranean fever mutations in south-east part of Turkey. Mol. Biol. Rep. 41, 2601–2607. Pasa, S., Altintas, A., Devecioglu, B., Cil, T., Danis, R., Isi, H. et al. 2008. Familial

MA

Mediterranean fever gene mutations the southeastern region of Turkey and their phenotypical features. Amyloid. 15, 49–53.

D

Pras, E., Livneh, A., Balow, J.E. Jr, Pras, E., Kastner, D.L., Pras, M., Langevitz, P. 1998.

PT E

Clinical differences between North African and Iraqi Jews with familial Mediterranean fever. Am J Med Genet, 75, 216–219.

Saatçi, U., Ozen, S., Ozdemir, S., Bakkaloglu, A., Besbas, N., Topaloglu, R., Arslan, S. 1997.

CE

Familial Mediterranean fever in children: report of a large series and discussion of the risk

AC

and prognostic factors of amyloidosis. Eur J Pediatr., 156(8), 619-23. Sayin, Kocakap, D.B., Gunel, Ozcan, A., Cabuk, F., Ensari, C. 2014. The frequency of familial Mediterranean fever gene mutations and genotypes at Kirikkale and comparison with the mean of regional MEFV mutation frequency of Turkey. Mol. Biol. Rep. 41,1419–1426. Sohar, E., Gafni, J., Pras, M., Heller, H. 1967. Familial Mediterranean fever: a survey of 470 cases and review of the literature. Am J Medicine 43,227–253. Sonmez, H.E., Batu, E.D., Ozen, S. 2016. Familial Mediterranean fever; current perspective. J.Inflamm.Res. 17:9, 13-20.doi:10.2147/JIR.S91352

16

ACCEPTED MANUSCRIPT Tchernitchko, D., Legendre, M., Cazeneuve, C., Delahaye, A., Niel, F., Amselem S. 2003. The E148Q MEFV allele is not implicated in the development of familial Mediterranean fever. Hum. Mutation 22, 339–340. Touitou, I. 2001. The spectrum of familial Mediterranean fever (FMF) mutations. Eur J Hum Genet., 9,473–483.

PT

Touitou, I., Lesage, S., McDermott, M., Cuisset, L., Hoffman, H., Dode, C., Shoham, N., Aganna, E., Hugot, J.P., Wise, C., Waterham, H., Pugnere, D., Demaille, J., Sarrauste de

RI

Menthiere, C. 2004. Infevers: an evolving mutation database for autoinflammatory

SC

syndromes. Hum. Mutat. 24,94-198.

Tunca, M., Akar, S., Onen, F., Ozdogan, H., Kasapcopur, O., Yalcinkaya, F., Tutar, E., Ozen,

NU

S., Topaloglu, R., Yilmaz, E. et al. 2005. Familial Mediterranean fever (FMF) in Turkey: results of a nationwide multicenter study. Medicine. 84, 1–11.

MA

Yigit, S., Karakus, N., Tasliyurt, T., Kaya, S.U., Bozkurt, N., Kisacik, B., 2012. Significance of MEFV gene R202Q polymorphism in Turkish familial Mediterranean fever patients. Gene

D

506, 43–45.

PT E

Yilmaz, E., Ozen, S., Balci, B., Duzova, A., Topaloglu, R., Besbas, N., Saatci, U., Bakkaloglu, A., Ozguc, M. 2001. Mutation frequency of familial Mediterranean fever and

AC

CE

evidence for a high carrier rate in the Turkish population. Eur J Hum Genet. 9, 553–555.

17