Melatonin protective effect against amyloid β-induced neurotoxicity mediated by mitochondrial biogenesis; involvement of hippocampal Sirtuin-1 signaling pathway

Physiology & Behavior 204 (2019) 65–75

Contents lists available at ScienceDirect

Physiology & Behavior journal homepage: www.elsevier.com/locate/physbeh

Melatonin protective effect against amyloid β-induced neurotoxicity mediated by mitochondrial biogenesis; involvement of hippocampal Sirtuin1 signaling pathway

T

⁎

Mitra Ansari Dezfoulia, Maryam Zahmatkesha,b, , Maryam Farahmandfara, Fariba Khodagholic a

Department of Neuroscience and Addiction Studies, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Tehran, Iran Research Center for Cognitive and Behavioral Sciences, Tehran University of Medical Sciences, Tehran, Iran c Neuroscience Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran b

A R T I C LE I N FO

A B S T R A C T

Keywords: Alzheimer's disease Melatonin Sirtuin-1 Mitochondrial biogenesis

Melatonin has a potential therapeutic value in Alzheimer's disease (AD), a disease that is associated with a dramatic decline in memory and cognitive abilities. The aggregation of the amyloid β (Aβ) peptide, a hallmark of AD, deactivates mitochondrial biogenesis and antioxidant defenses. Melatonin as an endogenous antioxidant, decreases in plasma and cerebrospinal fluid of AD patients. Even though several experimental studies have demonstrated the melatonin neuroprotection in AD, clinical trials of melatonin therapy have not yet confirmed outstanding results in AD patients. Better understanding of the molecular mechanisms involved in melatonin neuroprotective effects may pave the way for an efficient therapy. Hence, we investigated the involvement of silent information regulator 1 (SIRT1) signaling and mitochondrial biogenesis in melatonin neuroprotection in a rat model of cognitive impairment induced by intra-hippocampal Aβ injection. Animals assigned to melatonin treatment in the presence or absence of SIRT1 inhibitor (EX527), for 14 consecutive days. Spatial working memory and anxiety level were examined with Y-maze and elevated plus maze tests respectively. Hippocampal SIRT1, transcription factor-A mitochondrial (TFAM) and mitochondrial DNA (mtDNA) copy number were measured. We observed a decrease in hippocampal SIRT1, which accompanied with reduction in TFAM and mtDNA copy number in the Aβ-injected rats. Melatonin treatment increased hippocampal SIRT1 and TFAM expression and enhanced mtDNA copy number in the hippocampus. It also improved memory, ameliorated the anxiety, and attenuated hippocampal cell damage in the Aβ-injected animals. These effects were blocked by EX527 administration, suggesting SIRT1 signaling involvement in melatonin neuroprotective effect. This mechanism may introduce a new promising strategy in battle against AD.

1. Introduction Alzheimer's disease (AD) is a progressive cognitive disorder, characterizes by amyloid-beta (Aβ) aggregation and neurofibrillary tangles, especially in the hippocampus [1]. The hippocampus is an important brain region involved in spatial learning and memory function. The hippocampus region is a key structure affected by neuronal loss during AD progression [2]. Although multiple mechanisms involve in the etiology of AD, oxidative stress seems to be the major process in AD pathophysiology [3]. Melatonin (N-acetyl-5-methoxytryptamine) which

has been well-recognized as an endogenous antioxidant, decreases in circulation [4], and cerebrospinal fluid of AD patients [5,6]. This neurohormone has a potential therapeutic value in AD [7]. Moreover, disturbance in melatonin diurnal rhythm has been reported in AD patients [8]. In addition, melatonin has higher preference in compare to other available antioxidants in the therapeutic strategy of AD [9] due to its inhibitory effect on amyloid aggregation, low toxicity effect in high doses, and readily passage through blood brain barrier [10]. Furthermore, melatonin administration has shown protective effects against neurodegenerative disorders [11–14], Aβ aggregation, and

Abbreviations: AD, Alzheimer's disease; Aβ, Amyloid beta; COX II, Cytochrome c oxidase II; EPM, Elevated plus maze; F, Forward primer; GAPDH, Glyceraldehyde 3phosphate dehydrogenase; Mel, Melatonin; mtDNA, Mitochondrial DNA; OAE, Entrance to the open arm; OAT, Time spent in the open arms; PCR, polymerase chain reaction; R, Reverse primer; SIRT1, Silent information regulator 1; TFAM, Transcription factor A mitochondrial ⁎ Corresponding author at: Department of Neuroscience and Addiction Studies, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Tehran, Iran. E-mail address: [email protected] (M. Zahmatkesh). https://doi.org/10.1016/j.physbeh.2019.02.016 Received 15 August 2018; Received in revised form 3 February 2019; Accepted 11 February 2019 Available online 12 February 2019 0031-9384/ © 2019 Elsevier Inc. All rights reserved.

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

2.3. Experimental groups

neurotoxicity [7,15]. Furthermore, impaired mitochondrial biogenesis in hippocampal neurons has been observed in primary hippocampal cell culture treated with Aβ [16], animal model of AD, and postmortem studies on affected AD patients [17,18]. Aβ progressively accumulates in the mitochondria [19], prevents its DNA replication and impairs the process of mitochondrial biogenesis [16]. Ultimately, damage to mitochondrial biogenesis causes neuronal metabolic insufficiency, excesses reactive species production, provokes neurodegeneration [20] and ultimately leads to progressive memory impairment and cognitive decline. Previously, the neuroprotective effects of melatonin on mitochondrial function [21], and memory [12] have been reported in animal studies. Nevertheless, the clinical trials of melatonin therapy have not yet confirmed outstanding results on AD patients [22]. Keeping in view of this, we can deduce that better understanding of the molecular mechanisms of melatonin neuroprotective effect may pave the way for a more efficient therapy. Therefore, we investigated the involvement of mitochondrial biogenesis in the molecular mechanism of melatonin neuroprotection in the Aβ injected rat model. Silent information regulator 1 (SIRT1) increases the level of mitochondrial transcription factor A (TFAM) and promotes mitochondrial biogenesis [23]. TFAM protein level is a crucial controller of mitochondrial DNA (mtDNA) copy number [24]. Both TFAM and mtDNA copy number consider as ultimate markers for mitochondrial biogenesis. Melatonin is expected to promote the mitochondrial biogenesis. As a result, the expression levels of both hippocampal SIRT1 and TFAM were evaluated by western blot analysis. The mtDNA copy number was evaluated via real time polymerase chain reaction (PCR) technique. In order to confirm the involvement of SIRT1 signaling, we evaluated the protective effects of melatonin in the presence of EX527, which acts as a SIRT1 inhibitor [25]. Moreover, since the alteration in SIRT1 gene expression has been reported to be accompanied with the risk of anxiety [26], we used elevated plus maze (EPM) test for monitoring the anxiety level. Spatial working memory was evaluated via the Y-maze test and histological studies performed to monitor the changes in the cellular morphology of hippocampus tissue.

Animals were randomly divided in eight groups (eight rats in each group). A) Control group: remained intact during the experiment. B) Saline + DMSO group received intra-CA1 saline on the first day of the experiment and daily intraperitoneal 1%DMSO injection for 14 days. C) Saline + Mel group received intra-CA1 saline on the first day of the experiment and daily intraperitoneal melatonin injection (10 mg/kg) for 14 days. D) Aβ + DMSO group received intra-CA1 Aβ1–42 (1 μl per side, 50 ng/μl) and daily intraperitoneal 1% DMSO injection for 14 days. E) Aβ + Mel group received intra-CA1 Aβ and daily intraperitoneal melatonin injection for 14 days. F) Aβ + Mel + EX527 group received intra-CA1 Aβ and daily intraperitoneal melatonin injection for 14 days. Animals in this group also received intra-CA1 EX527 (1 μl per side, 5 μg/μl) every 3 days for total 5 times during the experiment. G) Saline + EX527 group received intra-CA1 saline and daily intraperitoneal 1% DMSO and intra-CA1 EX527 every 3 days during the experiment. H) Aβ + EX527 group received intra-CA1 Aβ and daily intraperitoneal 1% DMSO and intra-CA1 EX527 every 3 days during the experiment. All hippocampal injections were bilateral. A schematic diagram of the experimental procedure has been presented in figure1. 2.4. Stereotaxic surgery The intraperitoneal administration of ketamine (60 mg/kg) and xylazine (15 mg/kg) were performed for induction of anesthesia. Then, anesthetized rats were fixed on the stereotaxic instrument (Stoelting Inc., USA). Based on Paxinos and Watson's rat brain atlas [27], two steel guide cannulas with the size of 22-gauge were fixed on CA1 region of the dorsal hippocampi with the coordinates of ± 2.2 mm lateral to sagittal suture; 3.6 mm posterior to Bregma; and 2.5 mm below the surface of skull. The tip of the guide cannula was positioned 1 mm above the injection site and the injector syringe extended 1 mm beyond the end of the guide cannula. A heating pad was used below the anesthetized animals to keep body temperature at 36 ± 0.5 °C. The duration of recovery period was five days and thereafter, we assessed the locomotor activity through the open field test. Implantation of cannula was performed in 67 rats and three animals were excluded from the study; two animals had no locomotion in open filed test and one of them showed unilateral hit. Rats with normal locomotor activity, lack of unilateral hits, and normal weight gain were included in the experiments. The location of guide cannula in the CA1 region of dorsal hippocampus was illustrated in Fig. 2.

2. Material and methods 2.1. Drugs and chemicals ketamine and xylazine were purchased from Alfasan (Woerden, Holland). Melatonin and EX527 (6-Chloro-2,3,4,9-tetrahydro-1H-carbazole-1-carboxamide) were purchased from Santa Cruz biotechnology (California, US). Aβ1-42 was obtained from Tocris (Bristol, UK). Primary antibodies including SIRT1 and β-actin were from Cell Signaling Technology (Beverly, MA, US) and TFAM was purchased from Abcam (Cambridge, UK).

2.5. Drug administration Aβ1-42 peptide was dissolved in normal saline to the concentration of 50 ng/μl. Aβ1-42 solution or saline was injected into the CA1 region of hippocampus by a 5 μl Hamilton syringe (Hamilton, Reno, Nevada) using a polyethylene tube (1 μl per side) in freely moving animals. Animals received Aβ1-42 in the morning and duration of injection was about 1–3 min and after infusion, the needle was kept in the injection place for 2 min later. Melatonin freshly dissolved in 1%DMSO and diluted with normal saline to the final concentration of 2 mg/ml. Then melatonin (10 mg/kg body weight/day) was injected into the peritoneum for 14 days (Fig. 1). Melatonin injections were started 8 h after Aβ1-42 administration. To avoid the interference with ordinary circadian rhythm in animals, melatonin injections were performed in the afternoon between 4 p.m. and 6 p.m. Pharmacokinetic studies have revealed that melatonin easily crosses the blood-brain barrier and 8 min after systemic administration could be detected in the brain [28]. To inhibit SIRT1, rats received EX527, 20 min before melatonin injection. The SIRT1 inhibitor, EX527 dissolved in DMSO then diluted to the final concentration of 5 μg/μl in 1% DMSO. Intra-CA1 injection of

2.2. Animals Experimental protocols in the current study were executed based on the research protocols for handling and use of laboratory animals, accepted by the research and ethics committee of Tehran University of Medical Sciences and guide for the experiments on laboratory animals introduced by the National Institute of Health. Animals were male rats (obtained from Royan Institute, Tehran) of Wistar species with the weight range of 220–260 g. The condition of animal keeping was 12 h light beginning at 7:00 a.m. and 12 h dark. They were housed four in each cage at the temperature of 22 ± 2 °C. They had access to rat chow and water with no limitation. Animals were brought to the laboratory, one week prior the beginning of the experiments to habituate with the experimental environment. All behavioral tests were completed between 9 a.m. and 12 p.m. 66

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

Fig. 1. A schematic diagram of the experimental design. Animals received bilateral intra-CA1 injection of Saline/Aβ1-42. Melatonin was administrated (10 mg/kg/BW) for consecutive 14 days. The open field test was performed after recovery and before behavioral tests. Working memory and anxiety-related behavior were assessed 13 and 14 days after Aβ injection. Animals were sacrificed on days 14 after behavioral tests, and the hippocampus tissues were harvested for molecular studies.

and locomotor evaluation, simultaneously [32]. Hence, this behavioral test has been suggested for assessing cognition in dementia [33]. Furthermore, many recent studies have used the Y-maze as a precious cognitive test to evaluate memory [34–38]. Y-maze test was performed 14 days after Aβ injection. The instrument had three symmetrical acrylic arms. Dimension of each arm was 50 × 10 cm and the height of 20 cm. The animals were free to move through the maze during 8 min [31]. The sequence of arm entries were monitored by a video camera placed above the maze. The arm entry was defined as the entry of all four paws into the arm. Spontaneous alteration was considered as the successive entries into three arms without duplication. The percentage of alteration behavior was recorded using following calculation:

EX527 was performed every 3 days. 2.6. Behavioral tests 2.6.1. Open field The locomotor and exploration activity of animals were monitored by open field test as described previously [29]. The apparatus was a box with 80 × 80 cm field which was surrounded by 40-cm-high walls. Animals were put on the middle point of the box and had 5 min time to move freely in the apparatus. The number of line crosses and the frequency of rearing were monitored to calculate the locomotor activity. After each session, the floor and walls of field were cleaned with 70% ethanol.

Entries into three different arms consecutively × 100 Number of total arm entries − 2

2.6.2. Y-maze The Y-maze as a relatively simple behavioral test in rodents [30], was used to quantify working memory [31]. The continuous spontaneous alternation in Y-maze test has the advantage of eluding redundant stressful handling of animals along with providing memory

2.6.3. Elevated plus maze The elevated plus maze (EPM) behavioral test was done 14 days

Fig. 2. The location of guide cannula in the CA1 region of dorsal hippocampus. Amyloid β (Aβ), the SIRT1 inhibitor (EX527) and their solvents were injected into the CA1 region. The tip of the guide cannula was positioned 1 mm above the injection site. 67

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

Fig. 3. Evaluation of spatial working memory in the Y-maze test. The percentage of spontaneous alternation (A) and the number of arm entries in the Y-maze (B), were measured (n = 8 in each group). Each value represents as mean ± SEM. +/– means that animals in the mentioned groups have/have not received the drug of each row.

after Aβ injection. The EPM apparatus consists of a central platform (10 × 10 cm), two closed arms (50 × 10 cm, 40 cm high), and two open arms (50 × 10 cm) applied for monitoring of anxiety-like behavior [39]. The floor of the apparatus was 50 cm high and a video recording camera was used to record the activity of rats. Animal was placed in the central part facing the open arm to explore the apparatus for 5 min. Anxiety level was assessed by the percentage of entrance to open arms (%OAE) and the time that animal spent in the open arms (%OAT). Total arm entries considered as an index of locomotor activity.

Fig. 4. Evaluation of anxiety-related behavior in the EPM test. The percentage of open arm entries (%OAE) (A), the percentage of time spent in the open arms (%OAT) (B) and the number of total arm entries(C) were reported (n = 8 in each group). Each value represents as mean ± SEM. +/– means that animals in the mentioned groups have/have not received the drug of each row.

2.7. Hippocampus tissue collection for molecular analysis reduce nonspecific binding. Then, the membranes were incubated with primary antibodies including SIRT1, TFAM and β-actin. Washing with TBS-Tween 80 was done. Then, incubation with secondary antibody (horseradish peroxidase-conjugated) was executed. ECL reagents (Amersham Bioscience, Piscataway, NJ, USA) were used for immunoreactive polypeptides detection. After exposure to X-ray films, the visualized bands were analyzed. TFAM and SIRT1 bands in each group were normalized to their related beta actin bands. The intensity of blots was evaluated by Imagej software.

After behavioral assessment, rats were decapitated and the brains were rapidly rinsed in ice-cold PBS. The hippocampi were dissected and flash-frozen in liquid nitrogen for 48 h then stored at −80 °C. 2.8. Immunoblotting analysis The tissues were homogenized in a buffer comprising Tris-HCl, SDS, Triton X-100 and protease inhibitor (Roche, Penzberg, Germany). Using Bradford assay equal amounts of protein for each run were loaded. The extracted protein was loaded in 12.5% (SDS)-PAGE gel and then moved to polyvinylidene difluoride paper (Merk Millipore, US). We did our best to minimize the loading error. The 2% skim milk was used to 68

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

Fig. 6. Mitochondrial DNA copy number was determined using real-time PCR by the ratio of cytochrome oxidase II to GAPDH (CA1 region of hippocampus tissue from 3 animals in each group were prepared for the real-time PCR). The gel electrophoresis of PCR products of COXII and GAPDH (A) and mtDNA relative amount (B) in different groups has been presented. Each value represents as mean ± SEM. +/– means that animals in the mentioned groups have/have not received the drug of each row.

2.10. Histological studies After anesthesia, animals were perfused with PBS and subsequently with ice-cold 4% paraformaldehyde through ascending aorta. The brains were removed and fixed by overnight incubation in 4% paraformaldehyde, then embedded in paraffin. The blocks were cut with the 10 μm thick coronal sections. The selected sections were embedded in different concentrations of xylene and alcohol, rinsed with water and stained with 0.1% cresyl violet acetate for 15 min (Sigma-Aldrich, USA). Then, slides were washed in xylene and cover slipped using resin for permanent preservation. The prepared slides were evaluated using the morphometric software (Optikavision pro, Italy). The dorsal hippocampal cells were counted under × 200 magnifications. Three randomly selected fields of CA1 region of hippocampus were counted and the average number of cells were calculated for analysis as previously described [40].

Fig. 5. Western blot analysis of SIRT1 and TFAM in the CA1 region of hippocampus. (A) the representation of bands related to each protein in different groups, (B) the ratio of SIRT1/β-actin, (C) the ratio of TFAM/β-actin (hippocampus tissue from 3 animals in each group were prepared for western blot analysis). Each value represents as mean ± SEM. +/– means that animals in the mentioned groups have/have not received the drug of each row.

2.11. Statistical analysis 2.9. Mitochondrial DNA quantification All data were processed by SPSS 16.0 software and illustrated by way of mean ± standard error of mean (SEM). Comparison between groups was done by one-way analysis of variance (ANOVA) and Tukey post hoc test. Significant difference was set as p-value < .05.

Total DNA was extracted from dorsal hippocampus by QIAamp DNA mini kit (Qiagen, Germany) based on the instructions. The copy number of mtDNA was measured by real-time PCR technique using the SYBR Green detection method as previously described [18]. In brief, mtDNA was quantified using PCR Master Mix reagents (Ampliqon, Denmark) by the following cycling conditions; activation 7 min in 95 °C, denaturation 30 s in 95 °C, annealing 30 s in 61 °C, extension 50 s in 72 °C for 37 cycles with the following 7 min in 72 °C in ABI System (USA). The primers for mitochondrial gene, cytochrome c oxidase II (NC-001665.2) and nuclear gene, GAPDH (NC-005103.4) were listed in Table 1.

3. Results 3.1. The effect of melatonin on spontaneous locomotor activity and body weight gain As it has been represented in Table 2, no significant difference was found among groups regarding the number of line crosses (F(7, 56) = 0.14, P > .05). Moreover no significant difference was detected in the number of rearing behavior among different groups (F(7, 69

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

Fig. 7. Morphological evaluation of hippocampal CA1 region in different groups. Sections of control (A) and Saline + DMSO group (B) and Saline + Mel (C) groups had healthy cells with densely packed arrangement. Damaged cell bodies observed in Aβ + DMSO group (D). In Aβ + Mel group morphological features and cellular arrangement of the hippocampus were almost similar to those observed in the control group (E). Moreover EX527 administration in the Aβ + Mel + EX527 group suppressed the protective effect of melatonin on hippocampus tissue (F). There was no significant damage to hippocampal cells in the Saline + EX527 group (G) and cellular morphology in Aβ + EX527 group was almost similar to those observed in the Aβ + DMSO group (H). Four hippocampus in each group were counted (I). Each value represents as mean ± SEM. 200× magnifications, Scale bar, 200 μm.

total locomotor activity in the Y-maze has not been affected (Fig. 3B). Therefore, the decrease in alternation behavior was not related to the changes in general activity of rats that reflected the decline in memory function.

56) = 0.43, P > .05, Table 2). The data implies that the procedure of the stereotaxic surgery and injection of drugs had no significant effect on locomotion. Animals were weighed on the first day of the experiment and at the end of the study. The data of body weight has been displayed in Table 3. There was no significant difference in body weight gain among different groups (F(7,56) = 0.64; p > .05).

3.3. The effect of melatonin on anxiety-related behavior The elevated plus-maze (EPM) behavioral test was used to measure the anxiety level. Animals with higher anxiety level spend less time in the open arms (OAT) and less entries to the open arm (OAE) of the apparatus. As it has been shown in Fig. 4, data analysis of EPM test indicated a significant difference among different groups in %OAE (F (7,56) = 9.6, p < .001, Fig. 4A) and percentage of time spent in the open arms (%OAT) (F(7,56) = 38.2 p < .001, Fig. 4B). Data analysis revealed that %OAE and %OAT significantly decreased in Aβ + DMSO in comparison to the control and Saline + DMSO groups (16.7 ± 2.0 vs. 38.3 ± 3.7, 39.6 ± 2.7, p < .05 and 4.3 ± 0.84 vs. 23.8 ± 1.4, 23.6 ± 1.5, p < .001). Melatonin administration prevented the decrease of both %OAE (37.2 ± 4.2 vs. 16.7 ± 2.0, p < .05) and %OAT (22.6 ± 1.8 vs. 4.3 ± 0.84, p < .001) in Aβ + Mel group in comparison with Aβ + DMSO group. This result implies the anxiolytic effect of melatonin. Moreover injection of EX527 significantly reduced %OAE (21.3 ± 3.5 vs. 37.2 ± 4.2, p < .05) and %OAT (6.7 ± 1 vs. 22.6 ± 1.8, p < .001) in Aβ + Mel + EX527 in comparison with Aβ + Mel group. According to this result, EX527 inhibited the anxiolytic effect of melatonin. No significant difference was observed in the

3.2. The effect of melatonin on spatial working memory The spontaneous alternation behavior in the Y-maze apparatus was considered for evaluation of spatial working memory. We found significant changes among different groups regarding the spontaneous alternation behavior (F(7,56) = 24.0, p < .001). The percent of alternative behavior significantly decreased in Aβ + DMSO group in comparison to the control and Saline + DMSO groups (44.3 ± 2.8 vs. 69.2 ± 2.2 and 73.0 ± 3.9, p < .001, Fig. 3A). The spatial working memory improved by intraperitoneal melatonin administration in Aβ + Mel group in comparison to Aβ + DMSO group (67.8 ± 2.5 vs. 44.3 ± 2.8, p < .001). Moreover EX527 administration prevented the improving effect of melatonin on spatial working memory in Aβ + Mel + EX527 group compared with Aβ + Mel group (48.1 ± 1.8 vs. 67.8 ± 2.5, p < .001). There was no significant difference between Aβ + EX527 and Aβ + DMSO group (44.3 ± 2.8 vs. 40.8 ± 2.4, p = .97). The number of total arm entries showed no significant change among experimental groups (F(7,56) = 0.58, p = .76), implying that 70

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

Fig. 8. Probable molecular mechanism of melatonin neuroprotection in Aβ–induced cognitive decline. The Aβ increases oxidative stress and impairs mitochondrial function and biogenesis (1) in the hippocampus which leads to the cell metabolic insufficiency. The redox chemistry of Aβ also inhibits the SIRT1 protein expression and suppresses its signaling pathway (2). Melatonin increases the SIRT1 (3) and subsequently the TFAM expression (4) which leads to the mitochondrial biogenesis (5). Finally, improvement in cellular morphology, decrease of neuronal damage, improvement of memory and protection against Aβ-induced anxiety were observed (6).

total arm entries, indicating that locomotor activity was not significantly changed among groups in the EPM test (F(7,56) = 1.0, p > .05, Fig. 4C).

Table 2 Alteration in locomotor activity in open field test. The first and second columns respectively, represents the number of line crosses and rearing behavior in different groups (n = 8 in each group). No significant difference was seen among groups. Values are expressed as mean ± SEM.

3.4. The effect of melatonin on SIRT1 and TFAM proteins in the hippocampus tissue

Groups

SIRT1 is a crucial protein for promotion of mitochondrial biogenesis. We found a significant difference among different groups in the SIRT1 expression level (F(7,16) = 56.4, p < .001, Fig. 5B). The densitometry analysis revealed that Aβ injection reduced SIRT1 in Aβ + DMSO group in comparison to the control and Saline + DMSO groups (0.20 ± 0.005 vs. 0.44 ± 0.02, 0.45 ± 0.02 p = .0001). Melatonin administration prevented the decrease in the SIRT1 level in Aβ + Mel group in comparison to Aβ + DMSO group (0.43 ± 0.01 vs. 0.20 ± 0.005, p < .001). Moreover injection of EX527 significantly prevented the increase of SIRT1 in Aβ + Mel + EX527 group in comparison to Aβ + Mel group (0.22 ± 0.01 vs. 0.43 ± 0.01, P < .001). According to this result, administration of melatonin inhibited the

Open-field test

Control Saline + DMSO Saline + Mel Aβ + DMSO Aβ + Mel Aβ + EX527 + Mel Saline + EX527 Aβ + EX527

Number of line crosses

Frequency of rearing

81.8 80.0 85.8 84.8 82.0 83.3 85.8 83.1

12 ± 0.92 12.6 ± 0.86 11.5 ± 0.70 12.8 ± 0.81 12.5 ± 0.73 12.5 ± 0.98 11.8 ± 0.74 13.1 ± 0.78

± ± ± ± ± ± ± ±

4.20 5.95 5.91 5.65 6.19 4.22 4.4 6.82

Mel, Melatonin; DMSO, dimethyl sulfoxide.

Table 1 The list of primer sequences for COXII and GAPDH in real-time PCR for quantification of mtDNA relative to nuclear DNA. Gene name

Abbreviation

Primer direction

Sequence(5′–3′)

Amplicon size (bp)

Cytochrome c oxidase II

COX II GAPDH

ATAGGACACCAATGATACTGAAGC CATTGGCCATAGAATAGACCTGG TTGACCTCAACTACATGGTCTAC CGAAGTACCCTGTGCATGTTTC

314

Glyceraldehyde 3-phosphate dehydrogenase

F R F R

F, Forward primer; R, Reverse primer. 71

155

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

observed a significant reduction of cell count in Aβ + DMSO group in comparison with the control and Saline + DMSO groups (35.2 ± 2.3 vs. 79.8 ± 2.1, 79.0 ± 2.4, P = .0001). Melatonin administration prevented the decrease in cell count in Aβ + Mel + DMSO group compared with the Aβ + DMSO group (83.0 ± 3.5 vs. 35.2 ± 2.3, P = .0001). Moreover, EX527 in Aβ + Mel + EX527 group prevented the protective effect of melatonin on cell count in comparison with the Aβ + Mel + DMSO group (33.7 ± 1.7 vs. 83.0 ± 3.5, P = .0001, Fig. 7I).

Table 3 Alteration in animal body weight during the experiment. The first and second columns represent the data of body weight in different groups, before and after the experiment (n = 8 in each group). No significant difference was seen among groups. Values are expressed as mean ± SEM. Groups

Control Saline + DMSO Saline + Mel Aβ + DMSO Aβ + Mel Aβ + EX527 + Mel Saline + EX527 Aβ + EX527

Body Weight Gain Before

After

235.3 ± 2.8 233.6 ± 2.2 231.8 ± 3.3 231.1 ± 2.9 231.7 ± 2.0 232 ± 2.8 231.0 ± 1.9 232.0 ± 2.3

266.3 264.6 262.8 264.0 263.8 263.1 263.6 260.5

± ± ± ± ± ± ± ±

3.1 2.2 3.2 2.1 1.6 3.1 1.9 2.2

4. Discussion The data of current study showed that treatment with melatonin exerted protective effects against memory impairment induced by Aβ, through increase in expression of SIRT1 and TFAM and mitochondrial DNA replication in the dorsal hippocampus tissue. This mechanism may be considered as a promising strategy in battle against AD. We demonstrated significant working memory impairment in the Aβ-injected group as indicated by reduced alternation behavior in compare with the sham group. We also observed increased anxiety-like behavior in the Aβ-injected group that was shown by reduction in both the entries and time spent in open arms in the EPM test. These data are in line with previous finding about working memory decline and anxiogenic effect of Aβ [41]. The presence of cells with shirked nucleus in the hippocampus sections also confirmed the induction of model in Aβinjected group. In the current research, we examined the morphology of dorsal hippocampal cells using cresyl violet, a standard histological stain [42] which labels all cells in the brain [43]. It has been determined that Aβ induces oxidative stress in cellular environment [44]. Oxidation of proteins provides a redox signal for transcription of target genes [45,46]. In the present study, injection of Aβ decreased the hippocampal SIRT1 level (Fig. 8). SIRT1 is a cell survival protein protects cells against oxidative stress through stimulation of genes are involved in antioxidant defenses [47]. Oxidative stress inhibits the SIRT1 protein expression and suppresses its signaling pathway [48]. Previously, it has been shown that SIRT1 level decreased in hippocampus of AD patients [49]. SIRT1 is prominently expressed in neurons of the hippocampus and prefrontal cortex, special brain regions susceptible to neurodegeneration [50]. Moreover, studies demonstrated that variations in SIRT1 gene are associated with the risk of anxiety and mood disorders [26]. Furthermore, decrease in the SIRT1 expression level induces anxiety-related behavior in rats [51]. As a result, we can infer that increased anxiety-like behavior in Aβ-injected group may be in part related to the decrease of dorsal hippocampal SIRT1 level. In the current study, decrease in SIRT1 level in dorsal hippocampus was accompanied with reduction in TFAM expression and mtDNA copy number. These data imply the impairment of mitochondrial biogenesis in the Aβ-injected rats which causes neuronal metabolic insufficiency, and reactive oxygen species production [20]. TFAM is a nuclear-encoded protein that synthesized in the cytoplasm and imported into the mitochondria for initiation of mtDNA replication [24]. TFAM stabilizes and enhances mitochondrial DNA replication [23]. Our results are in line with a previous in vitro study which showed reduction in SIRT1 and TFAM expression levels after Aβ treatment in cultured hippocampal neurons, and subsequently suppression of mitochondrial biogenesis [16]. Sheng et al. reported 50% reduction in expression level of TFAM protein in the hippocampus tissue which was associated with impairment of mitochondrial biogenesis in AD patients [18]. Moreover, reduction in TFAM protein levels in the hippocampus tissue was also shown in transgenic AD mice [52]. While, a great quantity of melatonin is synthesized by pineal gland and is secreted into the cerebrospinal fluid, almost all tissues have the ability to synthesize melatonin, [10]. In this study, we selected the dose of 10 mg/kg/day of melatonin based on our preliminary studies. We observed that 10 mg/kg of melatonin improved Aβ induced cognitive

Mel, Melatonin; DMSO, dimethyl sulfoxide.

reduction of hippocampal SIRT1 about 2.1 folds in Aβ injected rats. TFAM is an important mitochondrial biogenesis marker which is essential for mtDNA amplification. We found a significant difference among different groups in TFAM expression level. (F(7,16) = 30.7, p < .001). Data analysis revealed that Aβ injection reduced TFAM level in Aβ + DMSO group in comparison with the control and Saline + DMSO groups (0.44 ± 0.02 vs. 0.72 ± 0.03, 0.70 ± 0.03, p < .001, Fig. 5C). Melatonin administration prevented the reduction of TFAM in Aβ + Mel group compared with Aβ + DMSO group (0.69 ± 0.01 vs. 0.44 ± 0.02, p < .001). Moreover injection of EX527 inhibited the increase of TFAM level in Aβ + Mel + EX527 group in comparison with Aβ + Mel group (0.41 ± 0.02 vs. 0.69 ± 0.01, p < .001). According to this results, in Aβ injected rats, administration of melatonin increased the level of hippocampal TFAM (1.5 fold) in Aβ injected rats. 3.5. The effect of melatonin on mtDNA copy number in the hippocampus tissue To evaluate mtDNA copy number in the hippocampus tissue, we measured the ratio of mtDNA to nDNA by real-time PCR. We found a significant difference among different groups (F(7,16) = 43.0, p < .001, Fig. 6). Aβ injection reduced mtDNA copy number in Aβ + DMSO group in comparison to control and Saline + DMSO groups (0.58 ± 0.03 vs. 1.02 ± 0.05, 0.99 ± 0.0, p < .001). Melatonin administration prevented the decrease of mtDNA copy number in Aβ + Mel group compared with Aβ + DMSO group (0.96 ± 0.03 vs. 0.58 ± 0.03, p < .001). Moreover injection of EX527 significantly reduced the copy number of mtDNA in Aβ + Mel + EX527 group in comparison to Aβ + Mel group (0.61 ± 0.003 vs. 0.95 ± 0.03, p < .001). This result demonstrated that melatonin administration increased mtDNA copy number (1.6 fold) in hippocampus tissue of Aβ injected rats and EX527 administration suppressed the improving effect of melatonin on mtDNA copy number. 3.6. The effect of melatonin on cellular morphology in the hippocampus tissue As it has been represented in Fig. 7, cells in the CA1 region of hippocampus tissues in the control (A) and Saline + DMSO (B) and Saline + Mel groups (C) had normal morphology with regular and condensed arrangement. Damaged cells with abnormal cell bodies noted in the CA1 sections of Aβ + DMSO group (D). Moreover normal cell bodies with packed arrangement observed in CA1 of Aβ + Mel group (E). Damaged cells with abnormal morphology and arrangement also observed in Aβ + Mel + EX527 and Aβ + EX527 groups (F). There was a significant alteration in the cell count of dorsal hippocampus region in different groups (F(7,24) = 105.0, P = .0001). We 72

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

number of intra-mitochondrial crista has been shown following melatonin administration [76]. In the current study, we monitored TFAM expression level and mtDNA copy number as biomarkers of mitochondrial biogenesis. Dong et al.; 2016 and Steiner et al.; 2011 also used the same molecular markers to evaluate mitochondrial biogenesis [16,77]. However, further studies are needed to monitor the ultrastructure of mitochondria to reinforce the conclusion. In this study, we injected 5 μg EX527 in CA1 region of the hippocampus to inhibit SIRT1 in dorsal hippocampus. The selected dose was based on our initial studies and pervious report [21]. This dose of EX527 did not exert serious damage to the hippocampal neurons and subsequently did not make memory impairment in animal group which received EX527, alone. The aim of this design was to refer all damages to Aβ aggregation and AD model. Therefore, EX527 alone showed no deleterious effect on behavioral tasks, however, reversed the melatonin effect on SIRT1 in the Aβ + Mel group. The mitochondrial biogenesis was also abolished in the Aβ + Mel + EX527 group. These data indicated that SIRT1 protein plays a key role in melatonin neuroprotective effect. Thus, we concluded that melatonin administration elevated mitochondrial biogenesis through SIRT1 pathway. These data are in line with the previous study that reported the neuroprotective effects of melatonin on mitochondrial function in the ischemia context [21]. Moreover, It has been shown that melatonin administration prevents mitochondrial fission in central nervous system [78]. Similarly, it has been demonstrated that melatonin administration reduces mitochondrial fission and fragmentation in methamphetamine induced toxicity in neuroblastoma cell culture [79]. Recently, Ding et al., also reported that melatonin prevents mitochondrial fission and mitochondrial fragmentation in mice heart cells through SIRT1 pathway [80]. Therefore, we can justify that activation of SIRT1 pathway in our experiment maybe act as a factor to prevent mitochondrial fission and fragmentation.

impairment and had no harmful effect on general health and locomotor activity. Moreover, pervious reports have also shown the neuroprotective [53] and anxiolytic effects [54] of 10 mg/kg of melatonin. Melatonin, a small amphiphilic molecule, quickly enters the brain [55] and has an access to all compartments due to its both lipid and water solubility [56,57]. Therefore, melatonin can demonstrate neuroprotective effects on several regions of brain. We injected the Aβ in CA1 region of hippocampus and the neurotoxicity of Aβ was mainly induced in the CA1 region; hence, we assessed the protective effect of melatonin in the CA1 region of the hippocampus. The MT1 and MT2 melatonin receptors which are coupled with G proteins, have been identified in CA1, CA3 and dentate gyrus of hippocampus [58,59]. Nonetheless, the neuroprotective effects of melatonin have been reported in the absence of melatonin membrane receptors. For instance, Kilic et al. reported that melatonin administration exerts significant neuroprotective effects against cerebral ischemia in MT1 and MT2 knockout mice. They provided evidence that membrane melatonin receptors MT1 and MT2 are not involved in the neuroprotective effects of melatonin [60]. Similarly, Pappola et al. reported that melatonin administration protected neuroblastoma cells and hippocampal neurons in amyloid beta-containing culture media but no neuroprotection against amyloid beta toxicity was observed when they used melatonin membrane receptor agonists [61]. We observed that melatonin administration prevented the deleterious effect of Aβ on working memory and anxiety that was evidenced by enhancement in percent of alternation behavior in the Y-maze and reduction in both the percent of open arm entries and time spent in open arms in the EPM test. Our results are consist with the report of Shen et al. about melatonin effect on memory in Aβ-injected rats [62]. Moreover, it has been shown that melatonin administration ameliorated chronic stress-induced behavioral dysfunctions in mice [63]. Histological studies also confirmed the protective effect of melatonin against neuronal damage in the CA1 region of hippocampus. It has been shown that melatonin prevents oxidative damage in central nervous system through direct free radical scavenging function as well as indirect antioxidant effects [10,64,65]. Melatonin inhibits amyloidogenic pathway in hippocampal cells of aged mice [66] and also stimulates the nonamyloidogenic pathway [67]. Previously, it has been reported that the long term administration of melatonin in transgenic AD mice was resulted to learning and memory improvement, and decrease of extracellular beta amyloid deposition [12]. Studies have shown that enhancement in mitochondrial biogenesis attributed to SIRT1 protein, could be considered as a new strategy against aging-related disorders [68]. Moreover, there are several evidence of melatonin-sirtuins relationship [69]. Here, melatonin administration increased the hippocampal level of SIRT1 and TFAM (Fig. 8). It has been demonstrated that melatonin protects central nervous system against oxidative stress and metabolic dysfunction by increase in SIRT1 expression level [21]. SIRT1 activates PGC-1 alpha which could activate proteins governing mitochondrial biogenesis [70] including TFAM, a main mitochondrial transcription factor and controller of mtDNA copy number [71]. It has been shown that melatonin attenuated Aβinduced mitochondrial impairment and enhanced neuronal survival pathways and mitochondrial integrity in rats [72]. In the current study it has been shown that Aβ impaired mitochondrial biogenesis. Moreover Studies showed Aβ damaged to mitochondrial function and cellular metabolism. Ultimately, impairment in mitochondrial related metabolic pathways, energy inefficiency, and ATP depletion in the cell lead to increased oxidative stress caused by reactive species, which can initiate caspases activity and apoptosis [73]. Moreover we showed that melatonin administration activates SIRT1 pathway and mitochondrial biogenesis. It has been demonstrated that increased mitochondrial content protects cells against apoptotic death [74]. Recently Zhou et al. demonstrated that activation of SIRT1 improved mitochondrial function and reduced apoptosis [75]. Previously, the improvement in mitochondrial ultrastructure in pyramidal neurons of the CA1 region as indicated by increasing in the

5. Conclusion Findings of this study indicate that 14 days intraperitoneal melatonin administration in Aβ-injected rats, improves memory, ameliorates the anxiety, and improves the neuronal morphology in CA1 region of the hippocampus. Here we suggest that neuroprotective effects of melatonin at least in part are related to the SIRT1 signaling in mitochondrial biogenesis pathway. This mechanism has important implications for introducing new solution against cognitive decline in AD. Acknowledgment This article is extracted from M A.'s Ph.D. dissertation and supported by grant No. 95-02-87-32122 from Tehran University of Medical Sciences. Conflict of interests The authors declare that they have no conflict of interest. References [1] J. Pozueta, R. Lefort, M. Shelanski, Synaptic changes in Alzheimer's disease and its models, Neuroscience 251 (2013) 51–65. [2] B.R. Postle, The Hippocampus, Memory, and Consciousness. The Neurology of Conciousness, Second edition, Elsevier, 2016, pp. 349–363. [3] W.J. Huang, X. Zhang, W.W. Chen, Role of oxidative stress in Alzheimer's disease, Biomed. Rep. 4 (2016) 519–522. [4] R. Ozcankaya, N. Delibas, Malondialdehyde, superoxide dismutase, melatonin, iron, copper, and zinc blood concentrations in patients with Alzheimer disease: crosssectional study, Croatian Med. J. 43 (2002) 28–32. [5] R.-Y. Liu, J.-N. Zhou, J. van Heerikhuize, M.A. Hofman, D.F. Swaab, Decreased melatonin levels in postmortem cerebrospinal fluid in relation to aging, Alzheimer's disease, and apolipoprotein e-ε4/4 genotype 1, J. Clin. Endocrinol. Metabol. 84 (1999) 323–327. [6] Y.-H. Wu, M.G. Feenstra, J.-N. Zhou, R.-Y. Liu, J.S. Toranõ, H.J. Van Kan, et al.,

73

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

[7] [8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23] [24]

[25]

[26]

[27] [28]

[29] [30]

[31]

[32]

[33]

[34]

Molecular changes underlying reduced pineal melatonin levels in Alzheimer disease: alterations in preclinical and clinical stages, J. Clin. Endocrinol. Metabol. 88 (2003) 5898–5906. Y.H. Wu, D.F. Swaab, The human pineal gland and melatonin in aging and Alzheimer's disease, J. Pineal Res. 38 (2005) 145–152. Y. Ohashi, N. Okamoto, K. Uchida, M. Iyo, N. Mori, Y. Morita, Daily rhythm of serum melatonin levels and effect of light exposure in patients with dementia of the Alzheimer's type, Biol. Psychiatry 45 (1999) 1646–1652. M. Pappolla, Y.J. Chyan, B. Poeggeler, P. Bozner, J. Ghiso, S. LeDoux, et al., Alzheimer β protein mediated oxidative damage of mitochondrial DNA: prevention by melatonin, J. Pineal Res. 27 (1999) 226–229. D. Acuña-Castroviejo, G. Escames, C. Venegas, M.E. Díaz-Casado, E. Lima-Cabello, L.C. López, et al., Extrapineal melatonin: sources, regulation, and potential functions, Cell. Mol. Life Sci. 71 (2014) 2997–3025. P. Delagrange, J. Atkinson, J. Boutin, L. Casteilla, D. Lesieur, R. Misslin, et al., Therapeutic perspectives for melatonin agonists and antagonists, J. Neuroendocrinol. 15 (2003) 442–448. Z. Feng, Y. Chang, Y. Cheng, B.l. Zhang, Z.w. Qu, C. Qin, et al., Melatonin alleviates behavioral deficits associated with apoptosis and cholinergic system dysfunction in the APP 695 transgenic mouse model of Alzheimer's disease, J. Pineal Res. 37 (2004) 129–136. Z. Ma, Z. Xin, W. Di, X. Yan, X. Li, R.J. Reiter, et al., Melatonin and mitochondrial function during ischemia/reperfusion injury, Cell. Mol. Life Sci. 74 (2017) 3989–3998. E. Taniguti, Y. Ferreira, I. Stupp, E. Fraga-Junior, C. Mendonça, F. Rossi, et al., Neuroprotective effect of melatonin against lipopolysaccharide-induced depressivelike behavior in mice, Physiol. Behav. 188 (2018) 270–275. M. Ionov, V. Burchell, B. Klajnert, M. Bryszewska, A. Abramov, Mechanism of neuroprotection of melatonin against beta-amyloid neurotoxicity, Neuroscience 180 (2011) 229–237. W. Dong, F. Wang, W. Guo, X. Zheng, Y. Chen, W. Zhang, et al., Aβ25–35 suppresses mitochondrial biogenesis in primary hippocampal neurons, Cell. Mol. Neurobiol. 36 (2016) 83–91. A.C. Rice, P.M. Keeney, N.K. Algarzae, A.C. Ladd, R.R. Thomas, J.P. Bennett Jr., Mitochondrial DNA copy numbers in pyramidal neurons are decreased and mitochondrial biogenesis transcriptome signaling is disrupted in Alzheimer's disease hippocampi, J. Alzheimers Dis. 40 (2014) 319–330. B. Sheng, X. Wang, B. Su, H.g. Lee, G. Casadesus, G. Perry, et al., Impaired mitochondrial biogenesis contributes to mitochondrial dysfunction in Alzheimer's disease, J. Neurochem. 120 (2012) 419–429. M. Manczak, M.J. Calkins, P.H. Reddy, Impaired mitochondrial dynamics and abnormal interaction of amyloid beta with mitochondrial protein Drp1 in neurons from patients with Alzheimer's disease: implications for neuronal damage, Hum. Mol. Genet. 20 (2011) 2495–2509. M.R. Smith, J. Fernandes, Y.-M. Go, D.P. Jones, Redox dynamics of manganese as a mitochondrial life-death switch, Biochem. Biophys. Res. Commun. 482 (2017) 388–398. Y. Yang, S. Jiang, Y. Dong, C. Fan, L. Zhao, X. Yang, et al., Melatonin prevents cell death and mitochondrial dysfunction via a SIRT1-dependent mechanism during ischemic-stroke in mice, J. Pineal Res. 58 (2015) 61–70. Y.Y. Wang, W. Zheng, C.H. Ng, G.S. Ungvari, W. Wei, Y.T. Xiang, Meta-analysis of randomized, double-blind, placebo-controlled trials of melatonin in Alzheimer's disease, Int. J. Geriatric Psychiatry 32 (2017) 50–57. P.A. Li, X. Hou, S. Hao, Mitochondrial biogenesis in neurodegeneration, J. Neurosci. Res. 95 (10) (2017) 2025–2029. I. Kang, C.T. Chu, B.A. Kaufman, The mitochondrial transcription factor TFAM in neurodegeneration: Emerging evidence and mechanisms, FEBS Lett. 592 (5) (2018) 793–811. M. Gertz, F. Fischer, G.T.T. Nguyen, M. Lakshminarasimhan, M. Schutkowski, M. Weyand, et al., Ex-527 inhibits Sirtuins by exploiting their unique NAD+-dependent deacetylation mechanism, Proc. Natl. Acad. Sci. 110 (2013) E2772-E81. S. Libert, K. Pointer, E.L. Bell, A. Das, D.E. Cohen, J.M. Asara, et al., SIRT1 activates MAO-A in the brain to mediate anxiety and exploratory drive, Cell 147 (2011) 1459–1472. G. Paxinos, C. Watson, Atlas of the Rat Brain in Stereotaxic Coordinates, Academic, New York, 1986. D. Le Bars, P. Thivolle, P. Vitte, C. Bojkowski, G. Chazot, J. Arendt, et al., PET and plasma pharmacokinetic studies after bolus intravenous administration of [11C] melatonin in humans, Int. J. Radiation Appl. Instrument. B Nuclear Med. Biol. 18 (1991) 357–359. R.E. Brown, S.C. Corey, A.K. Moore, Differences in measures of exploration and fear in MHC-congenic C57BL/6J and B6-H-2K mice, Behav. Genet. 29 (1999) 263–271. D. Wahl, S.C. Coogan, S.M. Solon-Biet, R. de Cabo, J.B. Haran, D. Raubenheimer, et al., Cognitive and behavioral evaluation of nutritional interventions in rodent models of brain aging and dementia, Clin. Interv. Aging 12 (2017) 1419. R.N. Hughes, The value of spontaneous alternation behavior (SAB) as a test of retention in pharmacological investigations of memory, Neurosci. Biobehav. Rev. 28 (2004) 497–505. L. Kokkinidis, Neurochemical and neuroanatomical correlates of behavioral habituation and sensitization: an overview and elaboration of animal experimentation, Spontaneous Altern. Behav. (1989) 109–130. Z. Goodarzi, B. Mele, S. Guo, H. Hanson, N. Jette, S. Patten, et al., Guidelines for dementia or Parkinson's disease with depression or anxiety: a systematic review, BMC Neurol. 16 (2016) 244. M. Okamoto, J.D. Gray, C.S. Larson, S.F. Kazim, H. Soya, B.S. McEwen, et al., Riluzole reduces amyloid beta pathology, improves memory, and restores gene

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42] [43]

[44] [45] [46]

[47]

[48] [49]

[50]

[51]

[52]

[53]

[54]

[55] [56] [57] [58]

[59]

[60]

[61]

[62]

[63]

74

expression changes in a transgenic mouse model of early-onset Alzheimer's disease, Transl. Psychiatry 8 (2018). E. Zenaro, E. Pietronigro, V. Della Bianca, G. Piacentino, L. Marongiu, S. Budui, et al., Neutrophils promote Alzheimer's disease–like pathology and cognitive decline via LFA-1 integrin, Nat. Med. 21 (2015) 880. T.B. Bassani, J.M. Turnes, E.L. Moura, J.M. Bonato, V. Cóppola-Segovia, S.M. Zanata, et al., Effects of curcumin on short-term spatial and recognition memory, adult neurogenesis and neuroinflammation in a streptozotocin-induced rat model of dementia of Alzheimer's type, Behav. Brain Res. 335 (2017) 41–54. L. Hritcu, R. Ionita, D.E. Motei, C. Babii, M. Stefan, M. Mihasan, Nicotine versus 6hydroxy-l-nicotine against chlorisondamine induced memory impairment and oxidative stress in the rat hippocampus, Biomed. Pharmacother. 86 (2017) 102–108. S. Aminyavari, M. Zahmatkesh, M. Farahmandfar, F. Khodagholi, L. Dargahi, M.R. Zarrindast, Protective role of Apelin-13 on amyloid β25–35-induced memory deficit; involvement of autophagy and apoptosis process, Prog. NeuroPsychopharmacol. Biol. Psychiatry 89 (2019) 322–334. S. Pellow, P. Chopin, S.E. File, M. Briley, Validation of open: closed arm entries in an elevated plus-maze as a measure of anxiety in the rat, J. Neurosci. Methods 14 (1985) 149–167. Z. Zhang, T. Sun, J.-g. Niu, Z.-q. He, Y. Liu, F. Wang, Amentoflavone protects hippocampal neurons: anti-inflammatory, antioxidative, and antiapoptotic effects, Neural Regen. Res. 10 (2015) 1125. Z. Bahaeddin, A. Yans, F. Khodagholi, H. Hajimehdipoor, S. Sahranavard, Hazelnut and neuroprotection: improved memory and hindered anxiety in response to intrahippocampal Aβ injection, Nutr. Neurosci. 20 (2017) 317–326. P.P. Ostrowski, G.D. Fairn, S. Grinstein, D.E. Johnson, Cresyl violet: a superior fluorescent lysosomal marker, Traffic 17 (2016) 1313–1321. M.Á. García-Cabezas, Y.J. John, H. Barbas, B. Zikopoulos, Distinction of neurons, glia and endothelial cells in the cerebral cortex: an algorithm based on cytological features, Front. Neuroanat. 10 (2016) 107. A.B. Reiss, H.A. Arain, M.M. Stecker, N.M. Siegart, L.J. Kasselman, Amyloid toxicity in Alzheimer's disease, Rev. Neurosci. 28 (29(6)) (2018) 613–627. H.E. Marshall, K. Merchant, J.S. Stamler, Nitrosation and oxidation in the regulation of gene expression, FASEB J. 14 (2000) 1889–1900. S. Adeli, M. Zahmatkesh, G. Tavoosidana, M. Karimian, G. Hassanzadeh, Simvastatin enhances the hippocampal klotho in a rat model of streptozotocin-induced cognitive decline, Prog. Neuro-Psychopharmacol. Biol. Psychiatry 72 (2017) 87–94. Y. Olmos, F.J. Sánchez-Gómez, B. Wild, N. García-Quintans, S. Cabezudo, S. Lamas, et al., SirT1 regulation of antioxidant genes is dependent on the formation of a FoxO3a/PGC-1α complex, Antioxid. Redox Signal. 19 (2013) 1507–1521. A. Salminen, K. Kaarniranta, A. Kauppinen, Crosstalk between oxidative stress and SIRT1: impact on the aging process, Int. J. Mol. Sci. 14 (2013) 3834–3859. M.I. Lutz, I. Milenkovic, G. Regelsberger, G.G. Kovacs, Distinct patterns of sirtuin expression during progression of Alzheimer's disease, NeuroMolecular Med. 16 (2014) 405–414. S.M. Zakhary, D. Ayubcha, J.N. Dileo, R. Jose, J.R. Leheste, J.M. Horowitz, et al., Distribution analysis of deacetylase SIRT1 in rodent and human nervous systems, Anat. Rec. 293 (2010) 1024–1032. L. Xu, S. Xu, L. Lin, X. Gu, C. Fu, Y. Fang, et al., High-fat diet mediates anxiolyticlike behaviors in a time-dependent manner through the regulation of SIRT1 in the brain, Neuroscience 21 (372) (2018) 237–245. H. Sasaguri, P. Nilsson, S. Hashimoto, K. Nagata, T. Saito, B. De Strooper, et al., APP mouse models for Alzheimer's disease preclinical studies, EMBO J. 36 (2017) 2473–2487. T. Ali, M.O. Kim, Melatonin ameliorates amyloid beta-induced memory deficits, tau hyperphosphorylation and neurodegeneration via PI3/Akt/GSk3β pathway in the mouse hippocampus, J. Pineal Res. 59 (2015) 47–59. A.M. Gomaa, H.M. Galal, A.T. Abou-Elgait, Neuroprotective effects of melatonin administration against chronic immobilization stress in rats, Int. J. Physiol. Pathophysiol. Pharmacol. 9 (2017) 16. J. Johns, Estimation of melatonin blood brain barrier permeability, J. Bioanal. Biomed. 3 (2011) 064–069. P. Wongprayoon, P. Govitrapong, Melatonin as a mitochondrial protector in neurodegenerative diseases, Cell. Mol. Life Sci. 74 (2017) 3999–4014. J. Stehle, C. Von Gall, H.W. Korf, Melatonin: a clock-output, a clock-input, J. Neuroendocrinol. 15 (2003) 383–389. U. Musshoff, D. Riewenherm, E. Berger, J.D. Fauteck, E.J. Speckmann, Melatonin receptors in rat hippocampus: molecular and functional investigations, Hippocampus 12 (2002) 165–173. B. Lacoste, D. Angeloni, S. Dominguez-Lopez, S. Calderoni, A. Mauro, F. Fraschini, et al., Anatomical and cellular localization of melatonin MT 1 and MT 2 receptors in the adult rat brain, J. Pineal Res. 58 (2015) 397–417. U. Kilic, B. Yilmaz, M. Ugur, A. Yüksel, R.J. Reiter, D.M. Hermann, et al., Evidence that membrane-bound G protein-coupled melatonin receptors MT1 and MT2 are not involved in the neuroprotective effects of melatonin in focal cerebral ischemia, J. Pineal Res. 52 (2012) 228–235. M.A. Pappolla, M.J. Simovich, T. Bryant-Thomas, Y.J. Chyan, B. Poeggeler, M. Dubocovich, et al., The neuroprotective activities of melatonin against the Alzheimer β-protein are not mediated by melatonin membrane receptors, J. Pineal Res. 32 (2002) 135–142. Y. Shen, S. Xu, W. Wei, X. Sun, L. Liu, J. Yang, et al., The protective effects of melatonin from oxidative damage induced by amyloid beta-peptide 25–35 in middle-aged rats, J. Pineal Res. 32 (2002) 85–89. S. Haridas, M. Kumar, K. Manda, Melatonin ameliorates chronic mild stress induced behavioral dysfunctions in mice, Physiol. Behav. 119 (2013) 201–207.

Physiology & Behavior 204 (2019) 65–75

M. Ansari Dezfouli, et al.

[73] L. Pagani, A. Eckert, Amyloid-Beta interaction with mitochondria, Int. J. Alzheimers Dis. 2011 (2011). [74] A.D. Dam, A.S. Mitchell, J. Quadrilatero, Induction of mitochondrial biogenesis protects against caspase-dependent and caspase-independent apoptosis in L6 myoblasts, Biochim. Biophys. Acta Mol. Cell Res. 1833 (2013) 3426–3435. [75] Y. Zhou, S. Wang, Y. Li, S. Yu, Y. Zhao, SIRT1/PGC-1α signaling promotes mitochondrial functional recovery and reduces apoptosis after intracerebral hemorrhage in rats, Front. Mol. Neurosci. 10 (2018) 443. [76] E.A. Rudnitskaya, K.Y. Maksimova, N.A. Muraleva, S.V. Logvinov, L.V. Yanshole, N.G. Kolosova, et al., Beneficial effects of melatonin in a rat model of sporadic Alzheimer's disease, Biogerontology 16 (2015) 303–316. [77] J.L. Steiner, E.A. Murphy, J.L. McClellan, M.D. Carmichael, J.M. Davis, Exercise training increases mitochondrial biogenesis in the brain, J. Appl. Physiol. 111 (2011) 1066–1071. [78] J.I. Chuang, I.L. Pan, C.Y. Hsieh, C.Y. Huang, P.C. Chen, J.W. Shin, Melatonin prevents the dynamin-related protein 1-dependent mitochondrial fission and oxidative insult in the cortical neurons after 1-methyl-4-phenylpyridinium treatment, J. Pineal Res. 61 (2016) 230–240. [79] A. Parameyong, P. Govitrapong, B. Chetsawang, Melatonin attenuates the mitochondrial translocation of mitochondrial fission proteins and Bax, cytosolic calcium overload and cell death in methamphetamine-induced toxicity in neuroblastoma SH-SY5Y cells, Mitochondrion 24 (2015) 1–8. [80] M. Ding, N. Feng, D. Tang, J. Feng, Z. Li, M. Jia, et al., Melatonin prevents D rp1mediated mitochondrial fission in diabetic hearts through SIRT 1-PGC 1α pathway, J. Pineal Res. (2018) e12491.

[64] G. Escames, M. Macias, J. Leon, J. Garcia, H. Khaldy, M. Martin, et al., Calciumdependent effects of melatonin inhibition of glutamatergic response in rat striatum, J. Neuroendocrinol. 13 (2001) 459–466. [65] M. Bazrgar, I. Goudarzi, T. Lashkarbolouki, M.E. Salmani, Melatonin ameliorates oxidative damage induced by maternal lead exposure in rat pups, Physiol. Behav. 151 (2015) 178–188. [66] S. Mukda, J. Panmanee, P. Boontem, P. Govitrapong, Melatonin administration reverses the alteration of amyloid precursor protein-cleaving secretases expression in aged mouse hippocampus, Neurosci. Lett. 621 (2016) 39–46. [67] M. Shukla, H.H. Htoo, P. Wintachai, J.F. Hernandez, C. Dubois, R. Postina, et al., Melatonin stimulates the nonamyloidogenic processing of βAPP through the positive transcriptional regulation of ADAM10 and ADAM17, J. Pineal Res. 58 (2015) 151–165. [68] S.Y. Wong, B.L. Tang, SIRT1 as a therapeutic target for Alzheimer's disease, Rev. Neurosci. 27 (2016) 813–825. [69] J.C. Mayo, R.M. Sainz, P. González Menéndez, V. Cepas, D.X. Tan, R.J. Reiter, Melatonin and sirtuins: a ‘not-so unexpected’ relationship, J. Pineal Res. 62 (2) (2017) 1–17. [70] J.T. Rodgers, C. Lerin, Z. Gerhart-Hines, P. Puigserver, Metabolic adaptations through the PGC-1α and SIRT1 pathways, FEBS Lett. 582 (2008) 46–53. [71] B.L. Tang, Sirt1 and the mitochondria, Mol. Cell 39 (2016) 87. [72] W. Dong, F. Huang, W. Fan, S. Cheng, Y. Chen, W. Zhang, et al., Differential effects of melatonin on amyloid-β peptide 25–35-induced mitochondrial dysfunction in hippocampal neurons at different stages of culture, J. Pineal Res. 48 (2010) 117–125.

75