Membrane attack complex of complement is not essential for immune mediated demyelination in experimental autoimmune neuritis

Journal of Neuroimmunology 229 (2010) 98–106

Contents lists available at ScienceDirect

Journal of Neuroimmunology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j n e u r o i m

Membrane attack complex of complement is not essential for immune mediated demyelination in experimental autoimmune neuritis Giang T. Tran a,b, Suzanne J. Hodgkinson a,b,⁎, Nicole M. Carter a,b, Murray Killingsworth c, Masaru Nomura a,b, Nirupama D. Verma a,b, Karren M. Plain a,b, Rochelle Boyd a,b, Bruce M. Hall a,b a b c

Immune Tolerance Laboratory, Faculty of Medicine, University of New South Wales, National Innovation Centre, Australian technology Park, Eveleigh, NSW 2015, Australia Department of Neurology, Liverpool Hospital, Liverpool, NSW, Australia Department of Anatomical Pathology, Liverpool Hospital, Liverpool, NSW, Australia

a r t i c l e

i n f o

Article history: Received 8 February 2010 Received in revised form 24 June 2010 Accepted 14 July 2010 Keywords: Complement Experimental allergic neuritis Membrane attack complex Demyelination EAN GBS Lewis/C6− MAC PNM

a b s t r a c t Antibody deposition and complement activation, especially membrane attack complex (MAC) formation are considered central for immune mediated demyelination. To examine the role of MAC in immune mediated demyelination, we studied experimental allergic neuritis (EAN) in Lewis rats deficient in complement component 6 (C6) that cannot form MAC. A C6 deficient Lewis (Lewis/C6−) strain of rats was bred by backcrossing the defective C6 gene, from PVG/C6− rats, onto the Lewis background. Lewis/C6− rats had the same C6 gene deletion as PVG/C6− rats and their sera did not support immune mediated haemolysis unless C6 was added. Active EAN was induced in Lewis and Lewis/ C6− rats by immunization with bovine peripheral nerve myelin in complete Freund's adjuvant (CFA), and Lewis/ C6− rats had delayed clinical EAN compared to the Lewis rats. Peripheral nerve demyelination in Lewis/C6− was also delayed but was similar in extent at the peak of disease. Compared to Lewis, Lewis/C6− nerves had no MAC deposition, reduced macrophage infiltrate and IL-17A, but similar T cell infiltrate and Th1 cytokine mRNA expression. ICAM-1 and P-selectin mRNA expression and immunostaining on vascular endothelium were delayed in Lewis C6− compared to Lewis rats' nerves. This study found that MAC was not required for immune mediated demyelination; but that MAC enhanced early symptoms and early demyelination in EAN, either by direct lysis or by sub-lytic induction of vascular endothelial expression of ICAM-1 and P-selectin. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Immune mediated demyelination is a major pathological feature of a number of diseases including multiple sclerosis (MS) (Raine, 1994), Guillain–Barre Syndrome (GBS) (Hartung et al., 2002) and chronic inflammatory demyelinating polyneuropathy (CIDP) (Hahn, 1996). Antibody activation of MAC is widely considered to mediate demyelination in these diseases and deposits of antibody and complement components, including MAC, are present in areas of demyelination in multiple sclerosis (Compston et al., 1989; Lucchinetti et al., 2000; Prineas and Graham, 1981; Storch et al., 1998), GBS (HaferMacko et al., 1996; Koski, 1987; Lu et al., 2000; Putzu et al., 2000; Wanschitz et al., 2003) and CIDP (Daeron, 1997; Dalakas and Engel, 1980). MAC has been found in CSF (Mollnes et al., 1987; Yam et al., 1980), at sites of active demyelination, on oligodendrocytes as well as degraded myelin (Lucchinetti et al., 2000; Storch et al., 1998). A role for ⁎ Corresponding author. Department of Neurology, Liverpool Health Service, Locked Bag 7017, Liverpool BC 1871, NSW, Australia. Tel.: +61 2 96164689; fax: +61 2 92094957. E-mail address: [email protected] (S.J. Hodgkinson). 0165-5728/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jneuroim.2010.07.010

antibody-mediated injury is supported by the ability of antibodies from patients with GBS and CIDP to induce peripheral nerve injury in animals either by systemic (Yan et al., 2000) or local injection (Pollard et al., 1995). Antibody activation of MAC is considered a major mediator of demyelination in animal models such as experimental autoimmune encephalomyelitis (EAE) (Pender, 1988) and experimental autoimmune neuritis (EAN) (Lampert, 1969; Wisniewski et al., 1969). Deposition of MAC preceded demyelination in EAN (Stoll et al., 1991). While EAE and EAN are studied as models of multiple sclerosis and GBS respectively, the active forms of these models are principally CD4+T cell and macrophage mediated, and may not replicate the antibody component of demyelination seen in human diseases. Even so, there is debate about whether MAC is essential for induction of demyelination in active EAE and EAN. The complement system is activated via the lectin, classical and alternate pathways (Barnum, 2002; Morgan, 1999), that converge to activate C5 to C5a and C5b (Guo and Ward, 2005). C5b sequentially binds C6, C7, C8 and multiple C9 molecules to form the C5b-9 complex, known as MAC (Barnum, 2002; Morgan, 1999; Turner, 1996). C8 and C9 insertion into lipid bi-layers causes cell lysis (Hadders et al., 2007). Absence of any components of MAC prevents its assembly and function.

G.T. Tran et al. / Journal of Neuroimmunology 229 (2010) 98–106

Host cells, including oligodendrocytes (Zajicek et al., 1995), are protected from MAC mediated injury by CD59, which binds to C8 and C9 and prevents pore formation (Hadders et al., 2007), so that EAE is more severe with CD59 deficiency (Mead et al., 2004). MAC also has sub-lytic actions including pro-inflammatory activation of vascular endothelium that promotes T cell and macrophage infiltrate (Kilgore et al., 1995; Tedesco et al., 1997; Tran et al., 2002). In immune mediated models of neurological disease MAC also has neuro-protective actions, including induction of cell cycle (Rus et al., 1996) and prevention of oligodendrocyte apoptosis (Soane et al., 1999). Animals deficient in C6, such as the PVG/C6− (Leenaerts et al., 1995) and Lewis/C6− strains (Chamberlain-Banoub et al., 2006) do not form MAC, and allow direct examination of the role of MAC without the confounding effects of loss of earlier components of complement that occurs in C3 (Calida et al., 2001; Nataf et al., 2000) and C5 (Weerth et al., 2003) deficient animals. Severity of active EAE in PVG/C6− rats is reduced (Tran et al., 2002), as sub-lytic MAC does not activate endothelial cells to express P-selectin and ICAM-1, which are required to promote T cell and macrophage migration (Tran et al., 2002). Demyelination is not a prominent feature of active EAE unless anti-MOG antibodies are present, and anti-MOG antibodies do not induce demyelination in PVG/C6− rats (Mead et al., 2002; Tran et al. unpublished data). In this study, we examined the role of MAC in the active EAN model, because in EAN marked demyelination of peripheral nerves occurs without transfer of anti-MOG antibodies or other antibodies (Wisniewski et al., 1969). Antibody and MAC deposits appear on myelin and Schwann cells before cellular infiltrate in EAN (Stoll et al., 1991). Peripheral nerve demyelination can be induced by intraperitoneal injection of EAN serum and complement (Harvey et al., 1995; Harvey and Pollard, 1992), or intraneural injection of EAN serum combined with activated T cells (Harvey and Pollard, 1992). These findings can be interpreted as auto-antibody activation of MAC playing a central role in the demyelination of nerves in EAN. Not all strains of rat are susceptible to EAN (Steinman et al., 1981) and we found that PVG and PVG/C6− rats developed a milder form of EAN compared to Lewis rats. Thus, we backcrossed PVG/C6− to Lewis rats and bred a Lewis/C6− strain. We induced active EAN in Lewis/C6− and demonstrated marked demyelination in the peripheral nerves. These studies demonstrated that MAC is not the sole or essential mediator of demyelination in EAN and that there are other immune mediators of demyelination. 2. Materials and methods

99

produced by immunization of Sprague Dawley rats and had been inactivated of complement at 56° for 60 min, as described (Tran et al., 2002; Spicer et al., 2007). 50 μl sera from individual rats were plated in triplicate to the wells of 96 well round bottom microtiter plates (Bio-Rad) and 150 μl of the RBC anti-red blood cell sera preparations was added to each well, before incubation at 37 °C for 1 h. Controls included known normal rat sera and C6− sera, and lysis was mediated by addition of 5% Triton X-100, which lysed all cells. Lysis was detected by red coloration of the supernatant and lack of a red cell pellet at the bottom of the well. With C6− sera there was a red blood cell pellet at the bottom of the well and no discoloration of the supernatant, as described (Tran et al., 2002; Spicer et al., 2007). 2.3. Experimental design Bovine peripheral nerve myelin (PNM) was prepared as described (Norton and Poduslo, 1973). Ten to twelve week old female Lewis rats and Lewis/C6− were immunized in the footpads with 200 μl of emulsion containing 4 mg PNM and 1.5 mg of complete Freund's adjuvant (CFA) prepared by emulsifying heat killed Mycobacterium tuberculosis (strain H37RA; Difco, Detroit, MI) in 100 μl saline and 100 μl incomplete Freund's adjuvant (Difco). Animals were monitored daily for weight and clinical disease activity scored as: 1+ limp tail, 2+ hind leg weakness, 3+ paraplegia, and 4+ quadriplegia. In each experimental group, extra rats were immunized to be used at days 14 and 21 post-immunization to obtain cauda equina for histology, ultrastructure, immunopathology and mRNA extraction as described (Tran et al., 2002). The samples were taken at day 14 as this is shortly after onset of clinical disease and demyelination is first evident. Day 21 is post peak of clinical disease and when demyelination is maximal. Combining animals from four experiments there were 5–6 rats in each group for these analyses including immunostaining, ultrastructure and RT-PCR analysis. 2.4. Anti-PNM antibody assay Serum collected at day 14 post-immunization was assayed in an ELISA essentially as described (Tran et al., 2001) except that PNM antigen was used at a concentration of 25 μg/ml in coating buffer. Control serum was from a hyper-immunized Lewis rat that had recovered from EAN and had been re-immunized with PNM in incomplete Freund's adjuvant at day 30 and had sera collected 14 days later. Results were expressed as a percentage of the control hyperimmune sera.

2.1. Animals 2.5. Preparation of nerve specimens for light and electron microscopy PVG, PVG/C6− (Merten et al., 1998), Lewis, and Lewis/C6− were bred at the Animal House of Liverpool Hospital. All experiments were approved by the University of New South Wales Animal Ethics Committee. Lewis rats deficient in C6 (Lewis/C6−) were bred by backcrossing PVG/C6− to Lewis rats once. The progeny were inbred and those homozygous for C6 deficiency were then cross-bred with normal Lewis. This cycle of inbreeding then crossing with Lewis was repeated 11 times. To establish their genetic identity skin grafts were exchanged between Lewis/C6− and Lewis rats, as described (Roser and Ford, 1972). Skin grafts were observed for over 100 days, and were healthy with normal hair growth. 2.2. Haemolytic assay Haemolytic complement assay was as described (Tran et al., 2002; Spicer et al., 2007) and to confirm C6 deficiency, human C6 (Sigma) was added (Spicer et al., 2007). Briefly, human red blood cells were incubated with rat anti-human red blood cell antibody that had been

Cauda equina segments 5 mm in length were fixed for 15 h in 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer pH 7.4. They were then embedded in epoxy resin. Transverse semi-thin 0.5 micron sections were cut for light microscopy and corresponding ultra-thin sections (130 nm) were cut for transmission electron microscopy. Sections for light microscopy were stained with 2% methylene blue in 1% borax and were examined with an Olympus BH-2 microscope (Olympus Corporation, Tokyo, Japan) fitted with a Spot RT Slider digital camera (Diagnostic Instruments Inc., Sterling Heights, MI). Digital images of nerve fibre bundles were taken at ×20 objective and areas of demyelination in nerves were quantified using computerbased image analysis (Image-Pro Plus, Media Cybernetics, Silver Spring, MD). Processing for electron microscopy was as described (Spicer et al., 2007). Briefly, ultra-thin sections were stained with uranyl acetate 2% and Reynolds' lead citrate 2.6% and samples were viewed with an FEI Morgagni 268D transmission electron microscope (FEI, Eindhoven, The Netherlands) at 80 kV.

100

G.T. Tran et al. / Journal of Neuroimmunology 229 (2010) 98–106

2.6. Immunohistology Five micron sections of cauda equina (5 μm thickness) were cut and indirect immunostaining was performed as described (Spicer et al., 2007; Tran et al., 2002). Antibodies used were R7.3 (TCRα/β chain), W3/25 (CD4), MRCOx8 (CD8), IA29 (ICAM1) (BD BiosciencesPharmingen, San Diego, CA), ED1 (macrophage) (Serotec, Oxford, UK), 2A1 (rat C5-9 neoantigen) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and Psel.KO.2.12 (P-selectin) (Thermo Scientific, Rochford, IL). Stained cells were counted as cells per high-powered fields (×40) and data expressed as mean ± SD. 2.7. cDNA preparation and real-time PCR (RT-PCR) and sequencing of C6 mRNA extraction and cDNA synthesis were performed as described (Penny et al., 1998; Tran et al., 2002). Specific primers for rat IL-2, IFNγ, TNF-α, IL-10, TCR-α, P-selectin, and ICAM-1 were described (Penny et al., 1998; Tran et al., 2002). Primers for C6 complement were forward 5′-atgctcacggacatacactcctat; reverse 5′-agagctgcaggtctgtcggtt and for IL-17A forward 5′-atgtgcctgatgctgttgctgc; reverse 5′taggacgcatggcggacaatag. RT-PCR was performed using a Rotorgene (Corbett Research, Sydney, Australia) and SensiMix DNA (Quantace, London, UK) according to the manufacturer's instructions. Copy numbers were derived from a known standard curve performed in parallel. The house-keeping gene GAPDH was used to compare cDNA levels between samples. PCR products were generated using the forward primer 5′cgaatgtcttctctgagtggt and the reverse 5′-tccttgacctcctataagcagc and sequenced by Westmead DNA Facility (Westmead, NSW, Australia).

Fig. 1. Comparison of clinical course of EAN in PVG and PVG/C6− rats. Active EAN was induced in PVG (■) and PVG/C6− (○) rats by immunization with PNM in CFA. Clinical disease was scored with a semi-quantitative scale and was plotted as means and standard deviations. Mean maximal clinical score of 0.5 ± 0.4 (n= 11) in PVG and 0.6 ± 0.4 (n = 11) in PVG/C6−. PVG strains were resistant to induction of severe clinical EAN.

Quantitative RT-PCR of C6 mRNA expression in liver found abundant levels in Lewis but not Lewis/C6− rats (Fig. 2C), similar to that described for PVG and PVG/C6− (Bhole and Stahl, 2004). All skin grafts between Lewis/C6− and wild-type Lewis (n = 3) were accepted more than 100 days, whereas all grafts between Lewis/

2.8. Statistics Data was compared with either a two-tailed Student t-test or Mann Whitney U test, which was only used for clinical disease scorer analysis, because the data is not parametric. ≤ 0.05 was considered significant. 3. Results 3.1. Induction of active EAN in PVG and PVG/C6− rats In two separate experiments, immunization with PNM/CFA induced EAN in 72% of PVG rats, with an average maximal clinical score of 0.5 ± 0.4 (n = 11), compared to 62% PVG/C6−, with an average maximal clinical score of 0.6 ± 0.4 (n = 11) (Fig. 1). There was no difference between the time of onset of clinical disease in PVG to 16.1 ± 3.0 days (n = 8) and PVG/C6− at 16.4 ± 2.1 days (n = 7, p = NS). Clinical disease lasted longer in the PVG (8 ± 2.4 days) compared to PVG/C6− (2.6 ± 2.1 days, p = 0.0001) (Fig. 1). In the third experiment the doubled dose of PNM also induced mild EAN (data not shown). PVG rats had a very mild form of EAN that made it impossible to examine for differences in disease severity and demyelination. Thus we bred the Lewis/C6− strain, as the Lewis strain is the usual strain for examination of EAN in rats. 3.2. Characterization of Lewis/C6− rats Serum from these Lewis/C6− rats did not lyse red cells in the haemolytic complement assay, whereas Lewis rat sera supported haemolysis (Fig. 2A). Addition of human C6 restored the capacity of Lewis/C6− sera to induce haemolysis, indicating that they had a selective C6 deficiency. Exon 10 of C6 in the Lewis/C6− rats had a deletion of 31 base pairs identical to that in PVG/C6− rats (Bhole and Stahl, 2004), which caused premature translation of 194 bp down stream (Fig. 2B).

Fig. 2. Characterization of the Lewis/C6− rat strain. A. Haemolytic complement assay, showing Lewis/C6− rats sera did not lyse red cells, leaving a pellet of red blood cell in the centre of the well (bottom row), whereas normal Lewis sera fully lysed the red cells leaving no pellet and a red tinge to the supernatant (top row). Addition of human C6 to Lewis/C6− sera, resulted in red cell lysis (middle row) and demonstrated C6 deficiency. B. Base sequence of exon 10 of the C6 gene in Lewis (top line) and Lewis/C6− strain (bottom line). The C6 gene from Lewis/C6− rats had a deletion of 31 base pairs, which resulted in premature translation of 194 bp down stream. This is the same deletion as described in PVG/C6− rats by Bhole and Stahl (2004) and confirmed that Lewis/C6− shared the same genetic defect as PVG/C6− strain. C. Quantitative RT-PCR of C6 mRNA in livers of Lewis and Lewis/C6− rats showed a marked reduction in C6 mRNA in Lewis/C6−.

G.T. Tran et al. / Journal of Neuroimmunology 229 (2010) 98–106

101

C6− and PVG/C6− (n = 3) were rejected within 10 days. This confirmed that Lewis/C6− had the same genetic background as Lewis. 3.3. Comparison of induction of EAN in Lewis/C6− and Lewis rats Lewis/C6− rats were susceptible to EAN. In three experiments 95% of Lewis/C6− developed clinical signs with a mean maximal clinical score of 1.8 ± 0.3 (n = 19) (Fig. 3A). 100% of Lewis immunized with the same batch of PNM developed clinical symptoms and their mean maximal clinical score were significantly higher, 2.3 ± 0.4 (n = 20, p ≤ 0.001) (Fig. 3A). Clinical severity in Lewis/C6− was significantly less than Lewis at all days during the clinical phase; which is from onset to recovery at day 21. This includes significant differences at days 13 (p = 0.004), 14 (p = 0.0008), 15 (p = 0.0009), 16 (p = 0.0002), 17 (p = 0.002), 18 (p = 0.005), and 20 (p = 0.02). The time of onset of clinical disease at day 12 was identical in both groups. There were no differences in early weight loss but there was slower weight recovery in Lewis/C6− (Fig. 3B). Lewis/C6− and Lewis had similar levels of complement activating IgG2a and 2b isotype antibodies to PNM (Fig. 3C). There was a trend to lower IgG1 response to PNM in Lewis/C6− rats. 3.4. Peripheral nerve morphology in Lewis/C6− and Lewis rats with EAN Cauda equina nerves from both Lewis/C6− and Lewis had demyelination of nerves at both days 14 and 21. At day 14 the majority of fibres in Lewis/C6− rats had normal myelin, whereas nerves in Lewis rats had small perivascular patches of demyelinated nerves. At day 21 larger areas of demyelinated nerves were obvious in both groups (Fig. 4A). At day 14, the average percentage area of demyelinated nerves in Lewis/C6− was 8.2 ± 8.0% (n = 9) and in Lewis was 28 ± 13% (n = 9; p = 0.002) (Fig. 4B). At day 21 there was no significant difference in the percentage of the area of demyelinated nerves between Lewis (30.2 ± 17.3%, n = 11) and Lewis/C6− (22.5 ± 14.3%, n = 8) (Fig. 4B). This was because the area of demyelination increased in Lewis/C6− but not in Lewis. Staining with a mAb specific for rat C5b-9 neoantigen, identified MAC in Lewis rats' nerves with EAN (Fig. 4A lower panels) around the perivenular areas where there was most demyelination. The nerves from Lewis/C6− rats with demyelination, had no staining of C5-9 neoantigen, confirming that there was no MAC deposition. Ultra-structural studies demonstrated demyelinated nerve fibres, and infiltration of macrophages and lymphocytes throughout the nerve sections of both Lewis/C6− and Lewis nerves at both days 14 and 21 post-immunization (Fig. 5). At day 14 isolated demyelinated nerves were seen in Lewis/C6− rats, with infiltration of macrophages and some lymphocytes. In Lewis rats at day 14, there were more fully and early demyelinated nerves, with more obvious macrophage and lymphocyte infiltrate. Later at day 21, the changes in both groups were similar, with many nerves fully demyelinated, undergoing demyelination or with axonal degeneration. Phagosomes full of lipid breakdown products of myelin were present in macrophages in infiltrating the nerves of both Lewis and Lewis/C6− rats.

Fig. 3. Comparison of clinical course of EAN in Lewis and Lewis/C6− rats. A. Clinical disease activity score, showed reduced severity at all time points at days 13 (p = 0.004), 14 (p = 0.0008), 15 (0.0009), 16 (p = 0.0002), 17 (p = 0.002), 18 (p = 0.005), and 20 (p = 0.02) in Lewis/C6− rats, even though animals in both groups had significant clinical paralysis. Lewis/C6− n = 19 and Lewis n = 20 per group. B. Percentage weight loss was similar in both Lewis and Lewis/C6− during onset of disease, but there was slower recovery of weight in Lewis/C6− rats. C. Antibody to PNM measured by ELISA. Sera were taken at day 14 post-immunization (n = 3 per group). There was no significant difference in antibody titer of IgG1, IgG2a and IgG2b between Lewis and Lewis/C6−.

3.5. Cellular infiltrate and inflammatory marker expression in peripheral nerves Because our studies on EAE in PVG/C6− rats had found a reduced T cell and macrophage infiltrate together with reduced induction of P-selectin and ICAM-1 on endothelial cells (Tran et al., 2002), we examined the same markers in the cauda equina nerves. Macrophage infiltrate was less in Lewis/C6− compared to Lewis (n = 5/group); at day 14 (123 ± 24.4 cells per high field vs 191.3 ± 44.3 (p = 0.0005)) and at day 21 (70.3 ± 25.9 vs 141.3 ± 56.6 (p = 0.002)). There was no difference in T cell infiltrate either at day

14 (67 ± 31 vs 66 ± 35 cells (NSD)) or at day 21 (31 ± 13 vs 26 ± 27 (NSD)). RT-PCR of cDNA prepared at day 21 post-immunization showed no differences in the mRNA levels for TCR-α or the Th1 cytokines IL-2 and IFN-γ (Fig. 6A). There was a reduced level of IL-17A mRNA, a marker of Th17 cells, in Lewis/C6− compared to Lewis. The reduced IL-17 mRNA in nerve was not due to reduced induction of Th17 cells, as in the regional node of the site of immunization there was a similar level of mRNA for IL-17 (10 ± 6.4 copies) in Lewis as compared to

102

G.T. Tran et al. / Journal of Neuroimmunology 229 (2010) 98–106

G.T. Tran et al. / Journal of Neuroimmunology 229 (2010) 98–106

103

Fig. 5. Comparison of ultrastructure of peripheral nerves from cauda equina in Lewis/C6− and Lewis rats. Electron micrographs at 14 days (upper panels) and 21 days after immunization with PNM and CFA (lower panels). Sections show demyelinated nerves (*), infiltrating macrophages (M) and lymphocytes (T).

Lewis/C6− (14.1 ± 7.5). The macrophage cytokine TNF-α mRNA expression tended to be lower in Lewis/C6− (p = 0.06). In Lewis/C6− rats both P-selectin and ICAM-1 mRNA expression was significantly lower than in Lewis (Fig. 6A). The expression of these proteins was delayed and in nerves taken at day 14 postimmunization there was significant staining for P-selectin and ICAM1 on vascular endothelium, in Lewis but not Lewis C6− rats (Fig. 6B). Staining of nerves taken at 21 days showed induction of P-selectin and ICAM1 on vascular endothelial cells in nerves from both Lewis and Lewis C6− (data not shown). Taken together, these findings suggest that the absence of MAC which resulted in reduced endothelial cell activation and expression of P-selectin and ICAM-1, leads to reduced infiltration of macrophages into the nerves. 4. Discussion Here we showed that Lewis/C6− rats that lack C6 and cannot form MAC, developed EAN with typical immune mediated demyelination of peripheral nerves. Lack of MAC was confirmed by the absence of C5b9 neoantigen in Lewis/C6− while C5b-9 neoantigen was abundant in Lewis. These findings established that MAC formation is not essential for immune mediated demyelination. The PVG strain, for which there was the PVG/C6− strain, only developed very mild clinical signs of EAN, thus a Lewis strain that had the same C6 gene deficiency PVG/C6− rats was bred. Serum of the Lewis/C6− did not support lysis of red cells in a complement dependent haemolysis assay unless human C6 was added. The deletion in exon 10 of the C6 gene in Lewis/C6− was identical to that in PVG/C6− (Bhole and Stahl, 2004). Lewis/C6− demyelinated

nerves had no MAC deposition detected by immunostaining, confirming the absence of MAC. In the Lewis/C6− rats, there was slower onset and reduced severity of clinical EAN compared to Lewis rats. Although there was also delayed demyelination in the Lewis/C6− rats, demyelination 21 days after immunization was similar to that in Lewis controls. This was confirmed in ultra-structural studies where there was evidence of nerve demyelination, associated with a macrophage and lymphocyte infiltrate. The delay in demyelination was not due to differences in induction of complement fixing IgG2a and IgG2b isotype anti-PNM antibodies, as these were similar in Lewis and Lewis/C6−. The trend to reduced IgG1 anti-PNM level, was similar to our finding in EAE with lower IgG1 levels in PVG/C6− compared to PVG (Tran et al., 2002). IgG1 is a non-complement fixing isotype and would not account for the reduced demyelination in Lewis/C6− rats, unless there was antibody dependent cell mediated cytotoxicity that was independent of complement activation. These findings unequivocally demonstrate that in EAN, antibody activation of MAC is not essential for immune mediated demyelination of peripheral nerves. This indicated that other mechanisms mediated demyelination in EAN. Our findings suggested that antibody independent mechanisms, including T cells and macrophages mediated demyelination. This is supported by the ability of PNM reactive CD4+T cell and T cell lines or clones reactive to induce EAN with peripheral nerve demyelination (Izumo et al., 1985). It is also supported by the ability of T cells, especially CD4+T cells from rats with EAN, to induce demyelination at the site of injection into nerves of normal rats (Hodgkinson et al., 1994). Antibody mediated demyelination by complement independent pathways such as

Fig. 4. Comparison of demyelination in nerves of Lewis and Lewis/C6− rats with EAN. A. Histology of peripheral nerve from cauda equina stained with toluene blue to identify myelin. Upper panels from nerves taken at day 14 after induction of disease, (magnification ×20) show small areas of demyelinated nerves in Lewis/C6− rats compared to larger patches of demyelinated nerves in Lewis rats. At 21 days, (middle panels) there were larger patches of demyelination in both Lewis/C6− and Lewis rats with isolated demyelinated nerves scattered throughout the sections (magnification ×40). Lower panels show immunostaining of frozen sections of nerves at day 21, with a monoclonal antibody to rat C5b-9 neoantigen (magnification ×40). There was clear perivenular staining in Lewis rats with EAN, whereas the Lewis/C6− rats' nerves had no staining indicating the absence of MAC in these nerves. B. Representation of the percentage area of nerve demyelination in cauda equina, as assessed by a computer-based image analysis. At day 14 the area of demyelination was less in the Lewis/C6− than in Lewis (p = 0.002 n = 9/ group), but at day 21 the area of demyelination was not different between the Lewis/C6− and Lewis rats (p = 0.30; n = 8 and 11 respectively). 4 to 5 sections per rat were examined.

104

G.T. Tran et al. / Journal of Neuroimmunology 229 (2010) 98–106

Fig. 6. Examination of cytokine and adhesion molecule expression in peripheral nerves from cauda equina in Lewis and Lewis/C6− rats. A. RT-PCR of mRNA. Samples were taken 21 days after immunization with PNM and CFA and data expressed as means and standard deviations. Black bars are for Lewis and white bars are for Lewis C6− (n = 4 per group). There was no difference in the mRNA for TCR-α, nor the Th1 cytokines IL-2 and IFN-γ. In Lewis/C6− rats there was less mRNA expression of the Th17 cytokine, IL-17A (p = 0.05) as well as a trend for lower expression of the macrophage derived cytokine TNF-α (p = 0.06) compared to Lewis. There was also less mRNA for P-selectin (p = 0.01) and ICAM-1 (p = 0.04) in Lewis/C6− rats compared to Lewis controls. B. Immunostaining of ICAM-1 and P-selectin. Immunoperoxidase stains of nerves at 14 days post-immunization, show vascular staining for P-selectin and ICAM1 in Lewis but not Lewis C6− rats. This is consistent with the reduced mRNA for ICAM-1 and P-selectin observed with RT-PCR.

antibody dependent cell mediated cytotoxicity may also occur (Martin et al., 1992). In the absence of C6 and MAC formation, there is less severe EAN and delayed demyelination. This could be due to lack of MAC formation to effect antibody-mediated injury early in the disease. If this were the case the antibody-mediated injury would be early in the disease and the T cell and macrophage mediated injury would follow. Another possibility is that MAC has sub-lytic actions that may contribute to the early phase of EAN and to nerve demyelination. Relevant to this study, sub-lytic MAC activates vascular endothelium to promote inflammatory cell infiltrate to tissues, by induction of ICAM-1 and P-selectin which are required for mononuclear cells to migrate into tissue (Kilgore et al., 1995). In PVG/C6− rats with EAE the reduced expression of ICAM-1 and P-selectin, delayed T cell and macrophage infiltrate into the brain stems (Tran et al., 2002). In this study the delay in demyelination in Lewis/C6− was also associated

with reduced macrophage infiltrate and vascular expression of Pselectin and ICAM-1 in nerves at 14 days post-immunization but not at 21 days post-immunization. This reduced induction of ICAM1 and P-selectin was identified by reduced mRNA expression and by reduced staining of the proteins on immunohistology. These findings suggested that the induction of ICAM-1 and P-selectin expression on endothelial cells by MAC was required to facilitate mononuclear cell infiltrate into nerves. ICAM1 was observed on vascular endothelium and infiltrating mononuclear cells. By day 21 post-immunization, there was a similar intensity of infiltrate of T cells in the nerves, but less macrophage infiltrate. This may be due to the macrophage infiltrate following the T cell infiltrate. More detailed serial studies are required to observe the reasons and significance of the reduced macrophage infiltrate. An alternate explanation is that MAC has a role in augmenting T cell and other effectors of demyelination. Such a possibility is supported by

G.T. Tran et al. / Journal of Neuroimmunology 229 (2010) 98–106

the findings of Spies et al. who found that injection of activated effector T cells and antibody led to greater demyelination in EAN (Spies et al., 1995), albeit that intraneural injection of CD4+T cells, from rats with EAN could mediate demyelination and cause nerve conduction block without adding antibody (Hodgkinson et al., 1994). They proposed that the T cells opened the blood brain barrier allowing antibody and complement to effect injury. An alternate explanation, in the light of our findings, may be that the injected antibody activated MAC on endothelial cells to induce ICAM-1 and P-selectin. These adhesion ligands would promote migration of T cells and macrophages to increase the injury mediated by the injected CD4+T cells. In Lewis/C6− rats, there was no reduction in mRNA for the Th1 cytokines IL-2 and IFN-γ, but there was a trend for less TNF-α. Th17 cells also mediate autoimmune inflammation, especially in EAE (Batten et al., 2006). These Th17 cells express IL-17A, IL-22 IL-6, TNF-α and GM-CSF but not IFN-γ, IL-4 or IL-2 (Harrington et al., 2005). The reduced expression of IL-17A mRNA in demyelinated nerves in Lewis/C6− suggested that infiltration of Th17 cells was impeded without MAC and this may have accounted for the delayed demyelination and reduced clinical severity of EAN. The regional nodes of Lewis/C6− rats had similar expression of IL-17A to that of Lewis rats, suggesting that there was no reduced induction of Th17 cells at the site of immunization. Our findings do not exclude a role for MAC in the mediation of demyelination, but established that extensive demyelination was induced in the absence of MAC. In EAE, demyelination occurs when complement fixing MOG monoclonal antibodies are given to PVG rats, but not PVG/C6− (Piddlesden et al., 1993). However, complement independent anti-MOG antibody does not cause demyelination (Piddlesden et al., 1993) and both PVG and PVG/C6− have equivalent severity of EAE (Tran et al. unpublished data). These studies using different isotypes of monoclonal antibodies, establish that MAC mediates demyelination when activated by complement fixing antiMOG antibodies (Tran et al., 2002), but do not exclude other mechanisms of demyelination. Our current study demonstrated that MAC independent demyelination occurs, and suggested that T cells and macrophages also mediated demyelination in the absence of MAC. Much attention has been focussed on therapies to deplete antibody or to interfere with complement activation in the treatment of demyelinating diseases, especially GBS (Halstead et al., 2005). While there is evidence that antibodies and monoclonal antibodies to gangliosides can directly mediate nerve injury with or without MAC (O'Hanlon et al., 2001; Paparounas et al., 1999), and can transfer injury to animal models, the findings in this study raise the possibility that these antibodies may not be the sole mediators of demyelination. Our data shows that MAC activation is not essential for peripheral nerve demyelination but MAC accelerates onset of demyelination probably by sub-lytic actions such as activation of endothelial cells, especially the expression of P-selectin and ICAM1, leading to enhanced migration of activated T cells and macrophages. Acknowledgements This study was supported by the SWSAHS Research Foundation and Professor Rory Hume, Vice Chancellor of UNSW. The NH&MRC of Australia supported the breeding of the Lewis/C6− rats. We thank Mr Moheb Botros for breeding and caring for the rats and SWSAHS Pathology at Liverpool Hospital for processing tissues for histology and ultrastructure. References Barnum, S.R., 2002. Complement in central nervous system inflammation. Immunol. Res. 26, 7–13. Batten, M., Li, J., Yi, S., Kljavin, N.M., Danilenko, D.M., Lucas, S., Lee, J., de Sauvage, F.J., Ghilardi, N., 2006. Interleukin 27 limits autoimmune encephalomyelitis by

105

suppressing the development of interleukin 17-producing T cells. Nat. Immunol. 7, 929–936. Bhole, D., Stahl, G.L., 2004. Molecular basis for complement component 6 (C6) deficiency in rats and mice. Immunobiology 209, 559–568. Calida, D.M., Constantinescu, C., Purev, E., Zhang, G.X., Ventura, E.S., Lavi, E., Rostami, A., 2001. Cutting edge: C3, a key component of complement activation, is not required for the development of myelin oligodendrocyte glycoprotein peptide-induced experimental autoimmune encephalomyelitis in mice. J. Immunol. 166, 723–726. Chamberlain-Banoub, J., Neal, J.W., Mizuno, M., Harris, C.L., Morgan, B.P., 2006. Complement membrane attack is required for endplate damage and clinical disease in passive experimental myasthenia gravis in Lewis rats. Clin. Exp. Immunol. 146, 278–286. Compston, D.A., Morgan, B.P., Campbell, A.K., Wilkins, P., Cole, G., Thomas, N.D., Jasani, B., 1989. Immunocytochemical localization of the terminal complement complex in multiple sclerosis. Neuropathol. Appl. Neurobiol. 15, 307–316. Daeron, M., 1997. Fc receptor biology. Annu. Rev. Immunol. 15, 203–234. Dalakas, M.C., Engel, W.K., 1980. Immunoglobulin and complement deposits in nerves of patients with chronic relapsing polyneuropathy. Arch. Neurol. 37, 637–640. Guo, R.-F., Ward, P., 2005. Role of C5a in inflammatory responses. Ann. Rev. Immunol. 23, 821–852. Hadders, M.A., Beringer, D.X., Gros, P., 2007. Structure of C8α-MACPF mechanism of membrane attack complex in complement immune defense. Science 317, 1552–1554. Hafer-Macko, C.E., Sheikh, K.A., Li, C.Y., Ho, T.W., Cornblath, D.R., McKhann, G.M., Asbury, A.K., Griffin, J.W., 1996. Immune attack on the Schwann cell surface in acute inflammatory demyelinating polyneuropathy. Ann. Neurol. 39, 625–635. Hahn, A.F., 1996. Experimental allergic neuritis (EAN) as a model for the immunemediated demyelinating neuropathies. Rev. Neurol. (Paris) 152, 328–332. Halstead, S.K., Humphreys, P.D., Goodfellow, J.A., Wagner, E.R., Smith, R.A., Willison, H.J., 2005. Complement inhibition abrogates nerve terminal injury in Miller Fisher syndrome. Ann. Neurol. 58, 203–210. Harrington, L.E., Hatton, R.D., Mangan, P.R., Turner, H., Murphy, T.L., Murphy, K.M., Weaver, C.T., 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat. Immunol. 6, 1123–1132. Hartung, H.P., Willison, H.J., Kieseier, B.C., 2002. Acute immunoinflammatory neuropathy: update on Guillain–Barre syndrome. Curr. Opin. Neurol. 15, 571–577. Harvey, G.K., Pollard, J.D., 1992. Peripheral nervous system demyelination from systemic transfer of experimental allergic neuritis serum. J. Neuroimmunol. 41, 159–166. Harvey, G.K., Gold, R., Hartung, H.P., Toyka, K.V., 1995. Non-neural-specific T lymphocytes can orchestrate inflammatory peripheral neuropathy. Brain 118, 1263–1272. Hodgkinson, S.J., Westland, K., Pollard, J.D., 1994. Transfer of experimental allergic neuritis by intraneural injection of sensitised lymphocytes. J. Neurol. Sci. 123, 162–172. Izumo, S., Linington, C., Wekerle, H., Meyermann, R., 1985. Morphologic study on experimental allergic neuritis mediated by T cell line specific for bovine P2 protein in Lewis rats. Lab. Invest. 53, 209–218. Kilgore, K.S., Shen, J.P., Miller, B.F., Ward, P.A., Warren, J.S., 1995. Enhancement by the complement membrane attack complex of tumor necrosis factor-alpha-induced endothelial cell expression of E-selectin and ICAM-1. J. Immunol. 155, 1434–1441. Koski, C.L., 1987. Complement-fixing antiperipheral myelin antibodies and C9 neoantigen in serum of patients with Guillain–Barre syndrome: quantitation, kinetics, and clinical correlation. Ann. N. Y. Acad. Sci. 505, 319–325. Lampert, P.W., 1969. Mechanism of demyelination in experimental allergic neuritis. Electron microscopic studies. Lab. Invest. 20, 127. Leenaerts, P.L., Hall, B.M., Van, D.B., Daha, M.R., Vanrenterghem, Y.F., 1995. Active Heymann nephritis in complement component C6 deficient rats. Kidney Int. 47, 1604–1614. Lu, J.L., Sheikh, K.A., Wu, H.S., Zhang, J., Jiang, Z.F., Cornblath, D.R., McKhann, G.M., Asbury, A.K., Griffin, J.W., Ho, T.W., 2000. Physiologic–pathologic correlation in Guillain–Barre syndrome in children. Neurology 54, 33–39. Lucchinetti, C., Bruck, W., Parisi, J., Scheithauer, B., Rodriguez, M., Lassmann, H., 2000. Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. Ann. Neurol. 47, 707–717. Martin, R., McFarland, H.F., McFarlin, D.E., 1992. Immunological aspects of demyelinating diseases. Annu. Rev. Immunol. 10, 153–187. Mead, R.J., Singhrao, S.K., Neal, J.W., Lassmann, H., Morgan, B.P., 2002. The membrane attack complex of complement causes severe demyelination associated with acute axonal injury. J. Immunol. 168, 458–465. Mead, R.J., Neal, J.W., Griffiths, M.R., Linington, C., Botto, M., Lassmann, H., Morgan, B.P., 2004. Deficiency of the complement regulator CD59a enhances disease severity, demyelination and axonal injury in murine acute experimental allergic encephalomyelitis. Lab. Invest. 84, 21–28. Merten, S., Chen, J.C., Ha, H., Plain, K., Boyd, R.A., Penny, M.J., Leenaerts, P., Hall, B.M., 1998. The cellular basis of cardiac allograft rejection: VIII. Mechanisms underlying delayed allograft rejection in PVG C6-deficient rats. Transplantation 65, 1152–1158. Mollnes, T.E., Vandvik, B., Lea, T., Vartdal, F., 1987. Intrathecal complement activation in neurological diseases evaluated by analysis of the terminal complement complex. J. Neurol. Sci. 78, 17–28. Morgan, B.P., 1999. Regulation of the complement membrane attack pathway. Crit. Rev. Immunol. 19, 173–198. Nataf, S., Carroll, S.L., Wetsel, R.A., Szalai, A.J., Barnum, S.R., 2000. Attenuation of experimental autoimmune demyelination in complement-deficient mice. J. Immunol. 165, 5867–5873. Norton, W.T., Poduslo, S.E., 1973. Myelination in rat brain: method of myelin isolation. J. Neurochem. 21, 749–757. O'Hanlon, G.M., Plomp, J.J., Chakrabarti, M., Morrison, I., Wagner, E.R., Goodyear, C.S., Yin, X., Trapp, B.D., Conner, J., Molenaar, P.C., Stewart, S., Rowan, E.G., Willison, H.J.,

106

G.T. Tran et al. / Journal of Neuroimmunology 229 (2010) 98–106

2001. Anti-GQ1b ganglioside antibodies mediate complement-dependent destruction of the motor nerve terminal. Brain 124, 893–906. Paparounas, K., O'Hanlon, G.M., O'Leary, C.P., Rowan, E.G., Willison, H.J., 1999. Antiganglioside antibodies can bind peripheral nerve nodes of Ranvier and activate the complement cascade without inducing acute conduction block in vitro. Brain 122, 807–816. Pender, M.P., 1988. The pathophysiology of myelin basic protein-induced acute experimental allergic encephalomyelitis in the Lewis rat. J. Neurol. Sci. 86, 277–289. Penny, M.J., Boyd, R.A., Hall, B.M., 1998. Permanent CD8(+) T cell depletion prevents proteinuria in active Heymann nephritis. J. Exp. Med. 188, 1775–1784. Piddlesden, S.J., Lassmann, H., Zimprich, F., Morgan, B.P., Linington, C., 1993. The demyelinating potential of antibodies to myelin oligodendrocyte glycoprotein is related to their ability to fix complement. Am. J. Pathol. 143, 555–564. Pollard, J.D., Westland, K.W., Harvey, G.K., Jung, S., Bonner, J., Spies, J.M., Toyka, K.V., Hartung, H.P., 1995. Activated T cells of nonneural specificity open the blood–nerve barrier to circulating antibody. Ann. Neurol. 37, 467–475. Prineas, J.W., Graham, J.S., 1981. Multiple sclerosis: capping of surface immunoglobulin G on macrophages engaged in myelin breakdown. Ann. Neurol. 10, 149–158. Putzu, G.A., Figarella-Branger, D., Bouvier-Labit, C., Liprandi, A., Bianco, N., Pellissier, J.F., 2000. Immunohistochemical localization of cytokines, C5b-9 and ICAM-1 in peripheral nerve of Guillain–Barre syndrome. J. Neurol. Sci. 174, 16–21. Raine, C.S., 1994. The Dale E. McFarlin Memorial Lecture: the immunology of the multiple sclerosis lesion. Ann. Neurol. 35, 561–572. Roser, B., Ford, W.L., 1972. Prolonged lymphocytopenia in the rat. The immunological consequences of lymphocyte depletion following injection of 185W tungston trioxide into spleen and lymph nodes. Aust. J. Biol. Med. Sci. 50, 185–190. Rus, H.G., Niculescu, F., Shin, M.L., 1996. Sublytic complement attack induces cell cycle in oligodendrocytes. J. Immunol. 156, 4892–4900. Soane, L., Rus, H., Niculescu, F., Shin, M.L., 1999. Inhibition of oligodendrocyte apoptosis by sublytic C5b-9 is associated with enhanced synthesis of bcl-2 and mediated by inhibition of caspase-3 activation. J. Immunol. 163, 6132–6138. Spicer, S.T., Tran, G.T., Killingsworth, M.C., Carter, N., Power, D.A., Paizis, K., Boyd, R., Hodgkinson, S.J., Hall, B.M., 2007. Induction of passive Heymann nephritis in complement component 6-deficient PVG rats. J. Immunol. 179, 172–178. Spies, J.M., Westland, K.W., Bonner, J.G., Pollard, J.D., 1995. Intraneural activated T cells cause focal breakdown of the blood–nerve barrier. Brain 118, 857–868. Steinman, L., Smith, M.E., Forno, L.S., 1981. Genetic control of susceptibility to experimental allergic neuritis and the immune response to P2 protein. Neurology 31, 950–954.

Stoll, G., Schmidt, B., Jander, S., Toyka, K.V., Hartung, H.P., 1991. Presence of the terminal complement complex (C5b-9) precedes myelin degradation in immune-mediated demyelination of the rat peripheral nervous system. Ann. Neurol. 30, 147–155. Storch, M.K., Piddlesden, S., Haltia, M., Iivanainen, M., Morgan, P., Lassmann, H., 1998. Multiple sclerosis: in situ evidence for antibody- and complement-mediated demyelination. Ann. Neurol. 43, 465–471. Tedesco, F., Pausa, M., Nardon, E., Introna, M., Mantovani, A., Dobrina, A., 1997. The cytolytically inactive terminal complement complex activates endothelial cells to express adhesion molecules and tissue factor procoagulant activity. J. Exp. Med. 185, 1619–1627. Tran, G.T., Carter, N., He, X.Y., Spicer, T.S., Plain, K.M., Nicolls, M., Hall, B.M., Hodgkinson, S.J., 2001. Reversal of experimental allergic encephalomyelitis with non-mitogenic, non-depleting anti-CD3 mAb therapy with a preferential effect on T(h)1 cells that is augmented by IL-4. Int. Immunol. 13, 1109–1120. Tran, G.T., Hodgkinson, S.J., Carter, N., Killingsworth, M., Spicer, S.T., Hall, B.M., 2002. Attenuation of experimental allergic encephalomyelitis in complement component 6-deficient rats is associated with reduced complement C9 deposition, P-selectin expression, and cellular infiltrate in spinal cords. J. Immunol. 168, 4293–4300. Turner, M.W., 1996. The lectin pathway of complement activation. Res. Immunol. 147, 110–115. Wanschitz, J., Maier, H., Lassmann, H., Budka, H., Berger, T., 2003. Distinct time pattern of complement activation and cytotoxic T cell response in Guillain–Barre syndrome. Brain 126, 2034–2042. Weerth, S.H., Rus, H., Shin, M.L., Raine, C.S., 2003. Complement C5 in experimental autoimmune encephalomyelitis (EAE) facilitates remyelination and prevents gliosis. Am. J. Pathol. 163, 1069–1080. Wisniewski, H., Prineas, J., Raine, C.S., 1969. An ultrastructural study of experimental demyelination and remyelination. I. Acute experimental allergic encephalomyelitis in the peripheral nervous system. Lab. Invest. 21, 105–118. Yam, P., Petz, L.D., Tourtellotte, W.W., Ma, B.I., 1980. Measurement of complement components in cerebral spinal fluid by radioimmunoassay in patients with multiple sclerosis. Clin. Immunol. Immunopathol. 17, 492–505. Yan, W.X., Taylor, J., Andrias-Kauba, S., Pollard, J.D., 2000. Passive transfer of demyelination by serum or IgG from chronic inflammatory demyelinating polyneuropathy patients. Ann. Neurol. 47, 765–775. Zajicek, J., Wing, M., Skepper, J., Compston, A., 1995. Human oligodendrocytes are not sensitive to complement. A study of CD59 expression in the human central nervous system. Lab. Invest. 73, 128–138.