Messenger RNA expression for the follicle-stimulating hormone receptor and luteinizing hormone receptor in human oocytes and preimplantation-stage embryos

FERTILITY AND STERILITY威 VOL. 79, NO. 5, MAY 2003 Copyright ©2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A.

Messenger RNA expression for the folliclestimulating hormone receptor and luteinizing hormone receptor in human oocytes and preimplantation-stage embryos Eleni Patsoula, Ph.D., Dimitris Loutradis, M.D., Peter Drakakis, M.D., Lina Michalas, M.D., Ritsa Bletsa, R.N., and Stylianos Michalas, M.D. Division of Human Reproduction, IVF Unit, First Department of Obstetrics and Gynaecology, Athens University Medical School, Athens, Greece

Received July 1, 2002; revised and accepted October 14, 2002. This work was supported in part by a grant from the Special Research Account of the National Kapodestrian University of Athens (no. 70/4/4778). Reprint requests: Eleni Patsoula, 48 Kefallinias Street, A. Ilioupoli, Athens, Greece (FAX: 30106458578; E-mail: [email protected]). 0015-0282/03/$30.00 doi:10.1016/S0015-0282(03) 00071-2

Objective: To study the expression of the FSH and LH receptors in human oocytes and preimplantation embryos and their potential roles in early human development. Design: Clinical and molecular studies. Setting: University hospital IVF center. Patient(s): Female volunteers undergoing intracytoplasmic sperm injection at the IVF unit of the Athens University Hospital. All patients gave written informed consent. Intervention(s): Ovarian stimulation was performed with exogenous gonadotropin administration. Intracytoplasmic sperm injection was performed on mature oocytes. Main Outcome Measure(s): Unfertilized oocytes and zygotes and embryos at the 2-cell, 4-cell, morula, and blastocyst stage were selected for study. A polymerase chain reaction methodology was used to analyze human oocytes and embryos. Messenger RNA was reverse transcribed and amplified with FSH and LH receptor specific primers. Result(s): Transcripts for the FSH receptor were detected in oocytes and zygotes and embryos at the 2-cell, morula, and blastocyst stage, while no message was detected in embryos at the 4-cell stage. Transcripts for the LH receptor were observed in oocytes and zygotes and morula- and blastocyst-stage embryos, whereas no message was detected in embryos at the 2-cell and 4-cell stage. Conclusion(s): Messenger RNA for the FSH and LH receptors was observed in oocytes and preimplantation embryos at different stages, indicating a physiological role in the oocyte maturation process and early embryonic development in the human. (Fertil Steril威 2003;79:1187–93. ©2003 by American Society for Reproductive Medicine.) Key Words: Intracytoplasmic sperm injection, FSH and LH receptors, messenger RNA, reverse transcription–polymerase chain reaction

The pituitary glycoprotein hormones, FSH and LH, are essential for normal development and function of the gonads. They coordinate to regulate gonadal growth, differentiation, endocrine function, and gametogenesis in both sexes (1, 2). The actions of gonadotropins are mediated through binding to specific cell surface receptors. Receptors for FSH (FSHRs) have been localized to the Sertoli cells and the granulosa and luteal cells of some species (3). In the

female, FSH acts through its receptor to stimulate ovarian follicular development and granulosa cell function (4); therefore, FSH indirectly affects oogenesis by exerting its influence on the corresponding cells. It is also known that FSHRs are present in the granulosa cells of growing follicles at the preantral and Graafian stages (5). Furthermore, primary, twolayer, and multilaminar follicles have been shown to express FSHR mRNA (6), indicating that FSH may have a physiological role in preantral follicular development. 1187

Receptors for LH (LHRs) have been localized to the Leydig cells and the theca, granulosa, and luteal cells (7, 8). In theca cells, LH elicits the production of aromatizable androgens (9), while in granulosa cells, LH triggers ovulation by inducing the rupture of the follicular wall, and thereafter it stimulates luteinization and P production of the corpus luteum (10). FSHR and LHR belong to the large family of G-protein– coupled receptors, which span the plasma membrane seven times and are responsible for the transduction of the biological actions of FSH and LH to their specific target cells, using cAMP as the main intracellular messenger (11, 12). The FSHR gene contains a single large exon, which encodes the transmembrane and intracellular domains, and nine smaller exons, which encode the extracellular domain, while the LHR gene contains a large exon encoding the transmembrane and intracellular domains and 10 exons encoding the extracellular domain (13). The complementary DNA encoding the FSHR (14, 15) and LHR (16) have been cloned in several species, including the human. We have previously demonstrated the presence of the mRNA for the FSHR and LHR in mouse oocytes and preimplantation embryos (17), indicating a possible role of the gonadotropins in the resumption of meiosis and development in early embryonic stages. In the present study, we examined whether the two gonadotropin receptors are expressed in human oocytes and preimplantation embryos at various developmental stages, using sensitive and specific nested polymerase chain reaction (PCR) based on the knowledge of the human FSHR and LHR gene sequences.

MATERIALS AND METHODS Human Oocytes and Embryos The surplus human oocytes and embryos used in this study were voluntarily donated by patients undergoing intracytoplasmic sperm injection (ICSI) at the IVF unit of the Alexandra Maternity Hospital. Written informed consent and Institutional Review Board approval were obtained. Women were superovulated with exogenous gonadotropin administration. The stimulation protocol is described briefly as follows (18). On day 21 of the previous cycle, a baseline ultrasound scan was performed and buserelin acetate intranasal spray was begun at a dose of 100 ␮g five times per day. GnRH agonist administration was continued until hCG administration. For all patients, the extent of ovarian suppression was evaluated by ultrasound scan and serum E2 levels (40 pg/mL) before starting exogenous gonadotropin administration (about 15 days after administering the spray). After gonadotropin administration and follow-up, hCG was given when at least two follicles were ⬎17 mm and serum estrogen levels were ⬎400 pg/mL. Oocytes were retrieved 34 hours after administration of hCG (10,000 IU hCG). Follicular aspiration and oocyte 1188 Patsoula et al.

FSH, LH receptors in human pre-embryos

retrieval were performed by transvaginal ultrasound– guided puncture. Approximately 4 hours after oocyte collection, removal of the cumulus and corona cells was performed by incubation in Ham’s F-10 medium (Invitrogen Life Technologies, Paisley, UK) with 80 IU/mL hyaluronidase (type VII, 320 IU/mg; Sigma-Aldrich, Dorset, UK) for 30 seconds. The oocytes were then transferred to fresh medium, and adhering corona cells were further removed by mechanical pipetting. Several microscopic examinations were performed to ensure complete removal of cumulus cells before ICSI took place. ICSI was performed only on mature oocytes that had extruded the first polar body (metaphase II). The ICSI procedure was performed following conventional techniques (19). Embryos were cultured in 1 mL of Ham’s F-10 medium without hypoxanthine (Invitrogen Life Technologies) and supplemented with 4% w/v bovine serum albumin (BSA; Sigma), at 37°C with a humidified atmosphere of 95% air and 5% CO2. Oocytes that were not fertilized on day 2 after insemination, and fertilized developing embryos at the zygote, 2-cell, 4-cell, morula, and blastocyst stages from days 1 to 6 were selected for study. Morphologic determination of the zygotes was performed by microscopic observation of the male and female pronuclei in the center of the fertilized oocyte. Two-cell embryos were collected on day 1 after fertilization, 4-cell embryos on day 2, and morula-stage (10 –30 cells) embryos on days 3 and 4. Blastocysts and expanded blastocysts were collected on days 5 and 6 after fertilization. Oocytes and embryos were washed through three changes of Dulbecco’s phosphate-buffered saline (DPBS; Invitrogen Life Technologies) containing 4 mg/mL BSA and microscopically examined to ensure complete removal of cumulus cells before any experimental procedure took place.

Reverse Transcription–Polymerase Chain Reaction (RT-PCR) Analysis Groups of five oocytes and embryos from the zygote, 2-cell, 4-cell, morula, and blastocyst stages were examined by RT followed by two rounds of nested PCR for FSHR mRNA and hypoxanthine guanine phosphoribosyl transferase (HPRT) mRNA, that was used as an internal control, and a semi-nested PCR for LHR mRNA. The sequences of complementary DNA (cDNA) clones for the mRNAs that are to be detected have already been published: FSHR (15) and LHR (16). The inner primer pairs for the FSHR and LHR have been previously described by Zheng et al. (20) and Venencie et al. (21), respectively. To increase sensitivity, outer primer pairs were constructed with the help of the Primer 3 program (Whitehead Institute, Cambridge, MA; and Howard Hughes Medical Institute, Chevy Chase, MD) (22). Nested primer pairs used in this study for amplification of HPRT mRNA have been described elsewhere (23). To ensure that the products deVol. 79, No. 5, May 2003

TABLE 1 Oligonucleotide primers used for reverse transcription–polymerase chain reaction (PCR) assays. mRNA FSH receptor:

PCR primer pair Outer: Inner:

LH receptor:

Outer:

HPRT

Inner: Outer: Inner:

P450

Primer sequence

Annealing temperature (°C)

CATCATCGGATCTGTCACTG CAGCCCCACGAAAGAATTTC GAGAGCAAGGTGACAGAGATTCC CCTTTTGGAGAGAATGAATCTT CACTTGCCTACCTCCCTGTCA CTGATGCCTGTGTTACAGAT TGCTCCGGGCTCAATGTATCT CTCCGCCTCCTCCTCTGCT GCCTGACCAAGGAAAGCAAAG GCCGGCTCCGTTATGGCG AGCCCCCCTTGAGCACACAGA TTGTTGTTAAATATGATGCC ATACCAGGTCCTGGCTACTG

55 55 58 58 55 55 55 50 50 55 55 48 48

Primers 5⬘–3⬘ 5⬘ 3⬘ 5⬘ 3⬘ 5⬘ 3⬘ 3⬘ 5⬘ 3⬘ 5⬘ 3⬘ 5⬘ 3⬘

end end end end end end end end end end end end end

Product size (bp)

450 340 244 191 528 226 272

Note: HPRT ⫽ hypoxanthine guanine phosphoribosyl transferase. Patsoula. FSH, LH receptors in human pre-embryos. Fertil Steril 2003.

tected resulted from amplification of cDNA rather than genomic DNA, oligonucleotide primers were designed to cross intron/exon boundaries. The regions to be amplified share less than 50% homology with other members of the G-protein– coupled receptor family; therefore, the possibility of cross-hybridization is excluded. For the FSHR, the first-round PCR was performed with a forward 5⬘ primer derived from nucleotides 121–140 in exon 1 and a reverse 3⬘ primer representing nucleotides 551–570 in exon 5. Nesting was performed by combining a forward 5⬘ primer representing nucleotides 166 –188 in exon 1 and a reverse 3⬘ primer derived from nucleotides 484 –505 in exon 5. For the LHR, the first-round PCR was performed with a forward 5⬘ primer derived from nucleotides 172–192 in exon 2 and a reverse 3⬘ primer representing nucleotides 396 – 415 in exon 4. By combining the same forward 5⬘ primer and a reverse 3⬘ primer derived from nucleotides 342–362, nesting was performed. All primers were ordered from MWG Biotech (High Point, NC). As negative controls for specific primers, DNA-free samples were run, as well as a defined volume of culture medium in which the embryos were cultured, processed in parallel, and subjected to the same RT-PCR reaction. Cumulus cells surrounding oocytes known to express FSHR and LHR mRNA were used as a positive control. The primer cDNA sequences and the sizes of the amplified products are listed in Table 1. Oocytes were carefully washed as previously described and microscopically examined to ensure complete removal of cumulus cells before ICSI took place. However, to ensure that no remnants from the cumulus cells were present, the cumulus-specific gene of cytochrome P450 aromatase was FERTILITY & STERILITY威

included in the study. The sense and antisense oligonucleotides used for amplification were described by Bulun et al. (24) and are presented in Table 1. This primer pair amplifies a 272-bp DNA fragment, and the P450 aromatase RT-PCR reaction was performed as described elsewhere (24). Groups of five oocytes or embryos at the same stage in 10 ␮L of DPBS were placed in a 0.5-mL thin-walled PCR tube. Oocytes and embryos were lysed by addition of 10 ␮L of lysis buffer (0.5% v/v NP40, 10mM Tris [pH 8.0], 10 mM NaCl, and 3 mM MgCl2) (25). Medium (10 ␮L) from each embryo collection was processed in parallel as a negative control. Cumulus cells were lysed, and RNA was isolated as well; the samples were processed at the same time as a positive control, as cumulus cells are known to express both gonadotropin receptors. The tubes were spun for 1–2 minutes, and 5 ␮L of the supernatant containing crude RNA was used for cDNA synthesis in the presence (RT⫹) and in the absence (RT⫺) of RT. RNA samples were denatured at 70°C for 5 minutes and cooled to 30°C. DNA was degraded by incubating the samples with 1 U of DNase I (Invitrogen Life Technologies) for 30 minutes at 37°C. DNAse was subsequently inactivated after the RT reaction by heating at 70°C for 10 minutes. The reaction mixture in a 20-␮L volume containing 5 ␮L of crude RNA, 10⫻RT buffer, 10 mM DTT, 0.5 ␮g of oligo (dt)12-18 primer (Invitrogen Life Technologies), 1 U RNase inhibitor, 1 mM each dNTP with (RT⫹) or without (RT⫺) 100 U of M-MLV RT (Invitrogen Life Technologies) was incubated at 37°C for 1 hour. The reaction was terminated by heating at 95°C for 5 minutes then cooling at 4°C. Products were stored at ⫺20°C until PCR was performed. For the first PCR reaction, 3 ␮L of RT cDNA was added to the 47 ␮L PCR reaction mixture. PCR reactions were 1189

FIGURE 1

FIGURE 2

FSHR mRNA expression in human oocytes and preimplantation embryos. M: 100 bp DNA marker; lane 1: unfertilized oocytes with and without RT, respectively (⫾); lane 2: zygotes (⫾); lane 3: 2-cell embryos (⫾); lane 4: 4-cell embryos (⫾); lane 5: morula-stage embryos (⫾); lane 6: blastocyststage embryos (⫾).

RT-PCR amplification of LHR mRNA in human oocytes and preimplantation embryos. M: 100 bp DNA marker; lane 1: unfertilized oocytes with and without RT, respectively (⫾); lane 2: zygotes (⫾); lane 3: 2-cell embryos (⫾); lane 4: 4-cell embryos (⫾); lane 5: morula-stage embryos (⫾); lane 6: blastocyst-stage embryos (⫾).

Patsoula. FSH, LH receptors in human pre-embryos. Fertil Steril 2003. Patsoula. FSH, LH receptors in human pre-embryos. Fertil Steril 2003.

performed as described elsewhere (17). PCR cycling conditions were 94°C denaturation, the temperature of annealing specific for primers (as in Table 1), 72°C extension, and each step took 1 minute. The PCR reaction was carried out for 30 cycles. The reaction was terminated at 72°C for 10 minutes. First-round PCR products were cooled at 4°C and stored at ⫺20°C until the second round of PCR. For the second-round PCR, 3 ␮L of the primary product was added to 47 ␮L of freshly prepared PCR reaction mixture containing 0.2 ␮M of each 3⬘- and 5⬘- inner primer. All reactions were overlaid with light white oil, and PCR was carried out for 30 cycles with inner primer pairs using the same program at the annealing temperature specific for inner primers (as in Table 1). Samples were stored at ⫺20°C until electrophoresis. The PCR products were analyzed by electrophoresis using a 2% agarose gel (Gibco, BRL, Gaithersburg, MD) and stained with ethidium bromide (Sigma). Agarose gels were visualized under UV light and photographed with a Polaroid camera (Polaroid Ltd, Dumbarton, Scotland, UK). RT-PCR experiments for the FSHR and LHR genes and for the control HPRT gene were repeated three times with lysates from different batches of oocytes and embryos to ensure reproducibility. 1190 Patsoula et al.

FSH, LH receptors in human pre-embryos

Verification of RT-PCR Products The identities of RT-PCR products were verified by restriction enzyme analysis and sequencing. The bands were excised from the agarose gel and purified using the QIAquick gel extraction kit (QIAGEN, Valencia, CA). After purification, they were subjected to digestion. Ten microliters of the secondary FSHR and LHR PCR products were digested with 10 U Hind III (Invitrogen Life Technologies) in a final reaction volume of 20 ␮L and then incubated overnight at 37°C. Digestion would yield two fragments of 70 bp and 270 bp for the FSHR and two fragments of 37 bp and 154 bp for the LHR. Digested DNA was separated on 2% agarose gel containing ethidium bromide. For sequence analysis, the secondary PCR products for FSHR and LHR were purified using a commercial kit (Wizard PCR Preps DNA Purification System, Promega, Madison, WI). DNA was sequenced with dye-labeled dideoxy terminators in a VGI automated sequencer (Visible Genetics, Inc., Toronto, Ontario, Canada).

RESULTS All experiments were performed three times with different groups of oocytes and embryos at all stages, and the same results were always obtained. Vol. 79, No. 5, May 2003

FIGURE 3 (A) Gel electrophoresis of RT-PCR products for FSHR with mRNA from cumulus cells and with mRNA from culture medium. FSHR RT-PCR analysis with mRNA from cumulus cells surrounding oocytes (lane 1) and with mRNA from cumulus cells surrounding zygotes (lane 2). RT-PCR analysis with culture medium of 2-cell embryos (lane 3), 4-cell embryos (lane 4), morulae (lane 5), and blastocysts (lane 6). (B) Gel electrophoresis of RT-PCR products for LHR with mRNA from cumulus cells and with mRNA from culture medium. LHR RT-PCR analysis with mRNA from cumulus cells surrounding oocytes (lane 7) and with mRNA from cumulus cells surrounding zygotes (lane 8). RT-PCR analysis with culture medium of 2-cell embryos (lane 9), 4-cell embryos (lane 10), morulae (lane 11), and blastocysts (lane 12). A 100-bp molecular size marker was used.

Patsoula. FSH, LH receptors in human pre-embryos. Fertil Steril 2003.

After two PCR rounds (nested PCR), the HPRT message was detected in oocytes and zygotes and embryos at the 2-cell, 4-cell, morula, and blastocyst stage, yielding a 226-bp product (data not shown) and confirming the integrity of the RNA isolation procedure and the RT-PCR process.

In control samples of medium alone in which the embryos at the 2-cell, 4-cell, morula, and blastocyst stage were cultured and subjected to the same RT-PCR reactions with specific oligonucleotides, no amplification of the FSHR and LHR mRNA was observed (Fig. 3B).

RT-PCR with specific oligonucleotides for the P450 aromatase gene in oocytes and preimplantation-stage embryos failed to amplify the expected DNA fragment. When samples of cumulus cells from oocytes and zygotes were used as the target in the PCR procedure, the specific 272-bp product was observed (data not shown).

Restriction enzyme digest of the second-round FSHR and LHR PCR products with the Hind III enzyme yielded fragments of the expected sizes (Fig. 4).

In oocytes and zygotes and embryos at the 2-cell, morula, and blastocyst stage, a 340-bp band (Fig. 1) was amplified corresponding to the FSHR mRNA. No FSHR message was detected in embryos at the 4-cell stage. A 191-bp band (Fig. 2), corresponding to the LHR mRNA, was detected in oocytes and zygotes and morulaand blastocyst-stage embryos. The LHR message was not detected in embryos at the 2-cell and 4-cell stage. Complementary DNA from cumulus cells was subjected to the same RT-PCR reaction for both FSHR and LHR, always providing a positive signal specific for the FSHR and LHR DNA fragments, thus confirming the functionality of the primers and the entire experimental procedure (Fig. 3A). FERTILITY & STERILITY威

Sequencing of the second-round PCR products for both receptors showed that the 340-bp RT-PCR product for the FSHR and the 191-bp RT-PCR product for the LHR corresponded to the published GenBank sequences (from nucleotides no. 166 to 505, GenBank accession no. M65085 for the FSHR; from nucleotides no. 172 to 362, GenBank accession no. M63108 for the LHR).

DISCUSSION This study demonstrates the mRNA expression of the FSHR and LHR in human oocytes and preimplantation embryos at specific developmental stages. A sensitive nested PCR technique was used in this analysis. Although gene expression does not necessarily imply that transcripts are translated in protein or that the receptors are functionally involved in signal transduction, the presence of FSHR and 1191

FIGURE 4 Restriction enzyme digest of the second-round 340-bp FSHR PCR product (A) and the 191-bp LHR PCR product (B) with the Hind III enzyme. Restriction products are indicated with arrows. A 100-bp molecular size marker was used.

Patsoula. FSH, LH receptors in human pre-embryos. Fertil Steril 2003.

LHR transcripts in the human preimplantation embryo indicates that the receptors, and therefore the hormones themselves, may have a physiological role at these early stages. FSH and LH receptors are expressed in mouse oocytes and preimplantation embryos at the zygote, 2-cell, 4-cell, morula, and blastocyst stage, indicating a beneficial effect on the early embryonic development in mice (17). In the human, FSHR mRNA was observed in oocytes and zygotes and embryos at the 2-cell, morula, and blastocyst stage and LH mRNA was detected in oocytes and zygotes and morula- and blastocyst-stage embryos. The presence of transcripts for FSHR in unfertilized oocytes, zygotes, and 2-cell embryos suggests that maternal transcripts occur in the oocyte and these transcripts are present at early cleavage stages before the embryonic genome is activated. Transcripts of the FSHR are not detected at the 4-cell stage but are present at the morula and blastocyst stages, suggesting activation of the embryonic genome. Transcripts of the LHR are present in oocytes and zygotes representing the maternal genome and appear again from the morula stage onward, representing the embryonic genome. It is known that zygotic gene expression is initiated in humans between the 4- and 8-cell stages, after which the embryo starts using its own genes (26, 27). Quantitative PCR studies would provide more data on the timing of the activation of the embryonic genome for the FSHRs and LHRs. Several alternate transcripts encoding FSHRs and LHRs have been described. In the rat ovary, truncated transcripts encoding only the extracellular domain of the LHR (28, 29) and three alternate transcripts for the FSHR have been de1192 Patsoula et al.

FSH, LH receptors in human pre-embryos

scribed (30). The RT-PCR products for the FSHR and LHR in human oocytes and preimplantation-stage embryos that were observed in this study arise from the extracellular portion of the receptors, which has been shown to appear earlier than the transcripts for the full-length receptor protein (30, 31). However, as it has been observed in other cell types, it can be estimated that oocytes and preimplantationstage embryos will eventually express the full-length receptors (29). FSHR mRNAs have been detected in 33% of the primary and two-layer follicles and in all of the multilaminar follicles, implying that these follicles are responsive to the hormone. In the female, the FSHR is expressed in granulosa cells from the secondary stage onward (7, 8) and is thought to regulate the various phases of follicular maturation. Zheng et al. (20) demonstrated that FSHR mRNA is expressed in the human ovary, fallopian tissues, follicles of all maturation stages, and theca interna and externa layers, suggesting that gonadotropins may directly regulate the physiological functions of the fallopian tube as well as initial embryonic development. LH promotes the maturation of the follicular cells in the ovary. The expression of LHRs in thecal cells is detected by autoradiography and immunocytochemistry with anti-LH antibodies at preantral stages (7, 8). The binding of the hormone increases during follicular maturation, and responsiveness to gonadotropins increases progressively from the preantral to the preovulatory stage. Gonadotropin receptors are expressed in preimplantation mouse embryos (17), which suggests a direct effect of the gonadotropins on the reversal of the in vitro 2-cell block via increasing the cAMP level. Compounds that elevate cAMP are involved in the reversal of the 2-cell block (32–34). The presence of the LH and FSH mRNA transcripts in oocytes and cleavage-stage mouse embryos might provide a possible mechanism for the involvement of gonadotropins in the reversal of the 2-cell block through the existence of receptors. The cytoplasmic and nuclear maturation of the oocyte are two separate processes. However, the intrafollicular mechanisms involved in the regulation of these processes is not well known (35, 36), although intracellular concentrations of cAMP play a major role. It has been shown that supplementing the culture medium with gonadotropins has a beneficial effect on embryo development and pregnancy rate (37). In addition, primary germinal vesicle–stage oocytes recovered from ovaries with no prior stimulation with exogenous gonadotropins are in vitro matured with the supplementation of gonadotropins (38). The presence, therefore, of FSHRs and LHRs in human oocytes and preimplantationstage embryos offers new perspectives not only for improving embryo development in vitro but also for the treatment of immature oocytes with FSH and LH during in vitro maturation. This is of particular importance in ICSI procedures, Vol. 79, No. 5, May 2003

where the morphologic structure of denuded oocytes can be assessed in a more detailed and precise manner (39). A significant part of the data that we have on mechanisms of oocyte maturation and early embryo development comes from species other than human, thus the expression of FSHR and LHR mRNA in human oocytes and preimplantationstage embryos is a finding that can directly elucidate the possible interactions involved in the role of gonadotropins in oocyte maturation and in preimplantation embryonic development. As our knowledge regarding gonadotropin receptors in early developmental stages increases with further studies, we may be able to fully explain the mechanism underlying their expression in the early cleavage stages. References 1. Gharib SD, Wierman ME, Shupnik MA, Chin WW. Molecular biology of pituitary gonadotrophins. Endocrinol Rev 1990;11:177–99. 2. Moyle WR, Campbell RK. Gonadotrophins. In: Reproductive endocrinology, surgery and technology, EY Adashi EY, JA Rock JA, Z, Rosenwaks, eds. Philadelphia: Lippincott-Raven: 1996:683–724. 3. O’Shaugnessy PJ, Dudley K, Rajapaksha WR. Expression of follicle stimulating hormone receptor mRNA during gonadal development. Mol Cell Endocrinol 1996;125:169 –75. 4. Richards JS, Jahnsen T, Hedin L, Lifka J, Ratoosh S, Durica JM, et al. Ovarian follicular development: from physiology to molecular biology. Rec Prog Horm Res 1987;43:231–76. 5. Peters H. Some aspects of early follicular development. In: Ovarian follicular development and function. AR Midgley Jr., WA Sandler, eds. New York: Raven Press: 1979:1–13. 6. Oktay K, Briggs D, Gosden RG. Ontogeny of follicle-stimulating hormone receptor gene expression in isolated human ovarian follicles. J Clin Endocrinol Metabol 1997;82:3748 –51. 7. Kobayashi M, Nakano R, Ooshima A. Immunocytochemical localization of pituitary gonadotrophins and gonadal steroids confirms the ‘two-cell, two gonadotrophin’ hypothesis of steroidogenesis in the human ovary. J Endocrinol 1990;126:483–8. 8. Yamoto M, Shima K, Nakano R. Gonadotrophin receptors in human ovarian follicles in human ovarian follicles and corpora lutea throughout the menstrual cycle. Horm Res 1992;37(Suppl1):5–11. 9. Hillier SG, Whitelaw PF, Smyth CD. Follicular oestrogen synthesis: the ‘two-cell, two-gonadotropin’ model revisited. Mol Cell Endocrinol 1994;100:51–4. 10. Richards JS, Hedin L. Molecular aspects of hormone action in ovarian follicular development, ovulation and luteinization. Ann Rev Physiol 1988;50:441–63. 11. Segaloff DL, Ascoli M. The lutropin/choriogonadotropin receptor . . . 4 years later. Endocrinol Rev 1993;14:324 –42. 12. Dufau ML. The luteinizing hormone receptor. Ann Rev Physiol 1998; 60:461–96. 13. McFarland KC, Sprengel R, Phillips HS, Kohler M, Rosemblit N, Nikolics K, et al. Lutropin-choriogonadotropin receptor: an unusual member of G-protein receptor family. Science 1989;245:494 –528. 14. Sprengel R, Braun T, Nicolics K, Segaloff DL, Seeburg PH. The testicular receptor for follicle-stimulating hormone: structure and functional expression of the cloned cDNA. Mol Endocrinol 1990;4:525–30. 15. Minegishi T, Nakamura K, Takakura Y, Ibuki Y, Igarashi M. Cloning and sequencing of human FSH receptor cDNA. Biochem Biophys Res Commun 1991;173:1125–30. 16. Minegishi T, Nakamura K, Takakura Y, Miyamoto K, Hasegawa Y, Ibuki Y, et al. Cloning and sequencing of human LH/hCG receptor cDNA. Biochem Biophys Res Commun 1990;172:1049 –54. 17. Patsoula E, Loutradis D, Drakakis P, Kallianidis K, Bletsa R, Michalas S. Expression of mRNA for the LH and FSH receptors in mouse oocytes and preimplantation embryos. Reproduction 2001;121:455–61.

FERTILITY & STERILITY威

18. Loutradis D, Drakakis P, Kallianidis K, Patsoula E, Bletsa R, Michalas S. Birth of two infants who were seronegative for human immunodeficiency virus type 1 (HIV-1) after intracytoplasmic injection of sperm from HIV-1 seropositive men. Fertil Steril 2001;75:210 –4. 19. Van Steirteghem AC, Liu Z, Joris H, Nagy Z, Janssenswillen C, Tournaye H, et al. Higher success rate by intracytoplasmic sperm injection than by subzonal insemination. Report of a series of 300 consecutive treatment cycles. Hum Reprod 1993;1:1055–60. 20. Zheng W, Magid MS, Kramer EE, Chen YT. Follicle-stimulating hormone receptor is expressed in human ovarian surface epithelium and fallopian tube. Am J Pathol 1996;148:47–53. 21. Venencie PY, Meduri GM, Pissard S, Jolivet A, Loosfelt H, Milgrom E, et al. Luteinizing hormone/human chorionic gonadotrophin receptors in various epidermal structures. Br J Dermatol 1999;141:438 –46. 22. Rozen A, Skaletsky HJ. Primer 3. Code available at http://wwwgenome.wi.mit.edu/genome_software/other/primer3.html 1996, 1997. 23. Ao A, Erickso RP, Winston RML, Handyside AH. Transcription of paternal Y-linked genes in the human zygote as early as the pronucleate stage. Zygote 1994;2:281–7. 24. Bulun SE, Mahendroo MS, Simpson ER. Polymerase chain reaction amplification fails to detect aromatase cytochrome P450 transcripts in normal human endometrium or decidua. J Clin Endocrinol Metab 1993;76:1458 –63. 25. Gilliland G, Perrin S, Bunn HF. PCR protocols: a guide to methods and applications. New York: Academic Press: 1990:66 –9. 26. Braude P, Bolton V, Moore S. Human gene expression first occurs between the four-and eight-cell stages of preimplantation development. Nature 1988;31:459 –61. 27. Heikinheimo O, Gibbons WE. The molecular mechanisms of oocyte maturation and early embryonic development are unveiling new insights into reproductive medicine. Mol Hum Reprod 1998;4:745–56. 28. Sokka T, Hamalainen T, Huhtaniemi I. Functional LH receptors appear in the neonate rat ovary after changes in the alternate splicing pattern of the LH receptor mRNA. Endocrinol 1992;130:1738 –40. 29. Sokka T, Hamalainen TM, Kaipia A, Warren D, Huhtaniemi I. Development of luteinizing hormone action in the perinatal rat ovary. Biol Reprod 1996;55:663–70. 30. O’Shaugnessy PJ, Marsh P, Dudley K. FSH receptor mRNA in the mouse ovary during postnatal development in the normal mouse and in the adult hypogonadal mouse: structure of alternative transcripts. Mol Cell Endocrinol 1994;101:197–201. 31. O’Shaugnessy PJ, McLelland D, McBride MW. Regulation of luteinizing hormone receptor and follicle stimulating hormone receptor mRNA levels during development in the neonate mouse ovary. Biol Reprod 1997;59:602–8. 32. Fissore R, O’Keefe S, Kiessling AA. Purine-induced block to mouse embryo cleavage is reversed by compounds that elevate cyclic adenosine monophosphate. Biol Reprod 1992;47:1105–12. 33. Nurreddin A, Epsaro E, Kiessling AA. Purines inhibit the development of mouse embryos in vitro. J Reprod Fertil 1990;90:455–64. 34. Loutradis D, John D, Kiessling AA. Hypoxanthine causes a 2-cell block in random-bred mouse embryos. Biol Reprod 1987;37:311–6. 35. Trounson A, Anderiesz C, Jones GM, Kausche A, Lolatgis N, Wood N. Oocyte maturation. Hum Reprod 1998;13(Suppl3):52–62. 36. Trounson A, Anderiesz C, Jones G. Maturation of human oocytes in vitro and their developmental competence. Reproduction 2001;121:51– 75. 37. Loutradis D, Drakakis P, Michalas S, Hatzaki C, Kallianidis K, Aravantinos L, et al. The effect of compounds altering to the cAMP level on reversing the 2-cell- block induced by hypoxanthine in mouse embryos in vitro. Eur J Obstet Gyn Reprod Biol 1994;57:195–9. 38. Anderiesz C, Ferrarett AP, Magli C, Fiorentino A, Fortini D, Gianaroli L, et al. Effect of recombinant human gonadotrophins on human, and murine oocyte meiosis, fertilization and embryonic development in vitro. Hum Reprod 2000;15:1140 –8. 39. Loutradis D, Drakakis P, Kallianidis K, Milingos S, Dendrinos S, Michalas S. Oocyte morphology correlates with embryo quality and pregnancy rate after intracytoplasmic sperm injection. Fertil Steril 1999;72:240 –4.

1193