Metabolic engineering a yeast to produce astaxanthin

Accepted Manuscript Metabolic Engineering a Yeast to Produce Astaxanthin Yu-Ju Lin, Jui-Jen Chang, Hao-Yeh Lin, Caroline Thia, Yi-Ying Kao, ChiehChen Huang, Wen-Hsiung Li PII: DOI: Reference:

S0960-8524(17)31232-4 http://dx.doi.org/10.1016/j.biortech.2017.07.116 BITE 18536

To appear in:

Bioresource Technology

Received Date: Revised Date: Accepted Date:

27 June 2017 17 July 2017 21 July 2017

Please cite this article as: Lin, Y-J., Chang, J-J., Lin, H-Y., Thia, C., Kao, Y-Y., Huang, C-C., Li, W-H., Metabolic Engineering a Yeast to Produce Astaxanthin, Bioresource Technology (2017), doi: http://dx.doi.org/10.1016/ j.biortech.2017.07.116

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Metabolic Engineering a Yeast to Produce Astaxanthin Yu-Ju Lin 1, 2, §, Jui-Jen Chang3, §, Hao-Yeh Lin1, Caroline Thia1, Yi-Ying Kao 1, Chieh-Chen Huang2, Wen-Hsiung Li1, 2, 3, 4, *

1

Biodiversity Research Center, Academia Sinica, No. 128 Academia Road, Sec. 2,

Nankang, Taipei 115, Taiwan 2

Department of Life Sciences, National Chung Hsing University, No. 250, Kuo Kuang

Rd, Taichung 402, Taiwan 3

Department of Medical Research, China Medical University Hospital, China Medical

University, No.91 Hsueh-Shih Road, Taichung 402, Taiwan 4

Department of Ecology and Evolution, University of Chicago, Chicago. IL 60637

§

Equal Contribution

*

Corresponding Author

Wen-Hsiung Li, Ph.D. Distinguished Research Fellow, Biodiversity Research Center, Academia Sinica 128 Academia Road Sec. 2, Nankang Taipei 115 Taiwan Phone: +886-2-2787-2256 Fax: 886-2-2789-9624 E-mail: [email protected]

1

Abstract In this study, an astaxanthin-biosynthesis Kluyveromyces marxianus strain Sm23 was first constructed, which could produce 31 µg/g DCW astaxanthin. Then, repeated genome integration of the key astaxanthin biosynthesis genes Hpchyb and bkt was done to increase gene copy number and astaxanthin yield. Four improved strains were obtained and the yield of astaxanthin and the total yield of carotenoids in a strain increased with the copy numbers of Hpchyb and bkt. To improve the yield further, the gene Hpchyb from Haematococcus pluvialis was modified by site-directed mutagenesis to increase the enzyme efficiency or/and to prevent the heterologous protein degradation by ubiquitination. Using repeated-integration approach of bkt and the mutated Hpchyb into Sm23, the S3-2 strain was obtained and shown to produce the 3S, 3’S-astaxanthin at 9972 µg/g DCW in a 5 L fermentor.

Keywords: Kluyveromyces marxianus, astaxanthin-biosynthesis genes, repeated genome integration, astaxanthin, site-directed mutagenesis.

2

1. Introduction Astaxanthin (3, 3'-dihydroxy-β-carotene-4, 4'-dione), a carotenoid pigment, has much higher antioxidant activity than other carotenoids and vitamin E (Igielska-Kalwat et al., 2015). Many studies have shown that astaxanthin has health-promoting effects in the prevention or/and treatment of various diseases, especially human cancer and cardiovascular disease (Kidd, 2011; Tanaka et al., 2012). Therefore, astaxanthin has great commercial potential for use in aquaculture, pharmaceutical, cosmetics, and health supplement industries. To meet the increasing market demand of natural carotenoids by a sustainable approach, microorganisms are suitable hosts for mass production of carotenoids because their genome engineering is relatively simple and the cell cycle is short. Recently, heterologous construction of a metabolic pathway for producing astaxanthin by genetic engineering has been enthusiastically pursued. An astaxanthin biosynthesis pathway in Escherichia coli could accumulate 5.8 mg/g DCW astaxanthin by balanced expression of carotenoid genes with a compact set of ribosome binding sites (Wang et al., 1999; Zelcbuch et al., 2013). In the literature, the highest astaxanthin-producing fungal strain was Xanthophyllomyces dendrorhous, which could produce astaxanthin yield of 9.0 mg/g DCW (Gassel et al., 2014) in a shake-flask culture and 9.7 mg/g DCW (Gassel et

3

al., 2013) in a fermenter culture. However, there is no useful tool for metabolic engineering of this fungus, and its stereoisomerized form is 3R, 3’R-astaxanthin (Andrewes, 1976), which has less antioxidant activity than the 3S, 3’S form (Zhu et al., 2009). Yeast cells have been broadly applied to produce heterologous proteins or natural products. Saccharomyces cerevisiae (Ukibe et al., 2009; Zhou et al., 2015) and Pichia pastoris (Bhataya et al., 2009) have been reported as potential organisms to introduce the astaxanthin biosynthesis pathway. The astaxanthin yield of 4.7 mg/g DCW was achieved in S. cerevisiae by a shake-flask culture with 0.52 mM Fe2+ (Zhou et al., 2015), and another strain with overexpression of CrtE03M, CrtYB, CrtI, OCrtZ, and OBKTM resulted in accumulation of 8.10 mg/g DCW of astaxanthin in shake-flask cultures, which seems to be to date the highest astaxanthin content reported in S. cerevisiae (Zhou et al., 2017). However, hypermannosylated proteins produced by S. cerevisiae might be antigenic to humans (Ballou, 1990; Buckholz & Gleeson, 1991). Application of non-conventional yeasts (Spencer et al., 2002) such as Kluyveromyces marxianus for natural compound production, is an emerging trend. As a host, K. marxianus has several advantages over traditional yeasts. 1. K. marxianus is a Crabtree-negative yeast that can be enhanced for biomass production via supplying excessive carbon sources (Chang et

4

al., 2014). 2. Some K. marxianus strains are thermo-tolerant and able to ferment at a temperature from 25°C to 52°C (Banat et al., 1992). 3. K. marxianus has appropriate glycosylation and strong signal peptides, providing a relatively high secretory capacity compared to S. cerevisiae (Raimondi et al., 2013). To construct an efficient astaxanthin biosynthesis pathway, the serial reactions catalyzed by phytoene desaturase (crtI) and a bifunctional enzyme (crtYB) with both phytoene synthase and lycopene cyclase activities from X. dendrorhous were applied to convert geranylgeranyl pyrophosphate (GGPP) to phytoene or lycopene and finally to β-carotene in this study. Overexpression of geranylgeranyl diphosphate synthase (crtE), and an additional copy of a truncated 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene (tHMG1) can help to produce high levels of β-carotene (Verwaal et al., 2007), which can increase precursor accumulation for astaxanthin bioconversion. In this study, an efficient synthetic biology technique, named Promoter-based Gene Assembly and Simultaneous Overexpression (PGASO) (Chang et al., 2012; Chang et al., 2013), was employed to construct a carotenoids biosynthetic pathway (Fig. 1A) into K. marxianus. However, the expression of astaxanthin-biosynthesis genes is still a bottleneck to produce astaxanthin (Chang et al., 2015). Using a β-carotene ketolase (bkt) and hydroxylase (Hpchyb) with higher activity might efficiently promote the conversion

5

of β-carotene to astaxanthin. Canthaxanthin, an intermediate in the biosynthetic pathway of carotenoids, is also a potent lipid-soluble antioxidant, and is primarily used as a flesh colorant of foods. However, canthaxanthin uptake can cause a deposition in retina, which can cause visual problems (Hou et al., 2010). β-carotene ketolase converts β-carotene to canthaxanthin by adding a carbonyl group to carbon 4 and 4' of β-carotene and hydroxylase can further add a hydroxyl group to carbon 3 and 3' of canthaxanthin to generate astaxanthin (Fig. 1A). To increase the astaxanthin yield in K. marxianus, strategies of metabolic engineering and directed enzyme mutagenesis were employed. First, a repeated-integration approach was employed to increase the copies of two key astaxanthin-biosynthesis genes Hpchyb and bkt to enhance carbon flux from β-carotene toward astaxanthin. Second, the astaxanthin-biosythesis key enzyme Hpchyb from H. pluvialis was modified by site-directed mutagensis to increase the enzyme efficiency or/and to prevent the heterologous protein degradation by ubiquitination (Chen et al., 2011). By using repeated-integration approach of the bkt gene and the mutated Hpchyb gene into an astaxanthin-biosynthesis K. marxianus strain, a new strain that has the highest 3S, 3’S- astaxanthin yield in fermentor was obtained.

2. Materials and Methods

6

2.1. Construction of an astaxanthin-biosynthesis pathway in a yeast host Six astaxanthin biosynthesis genes were cloned or synthesized as follows. To create the metabolic flux toward a higher isoprenoid precursor, the tHMG1 gene (1500 bp) from K. marxianus and the crtE gene (1131 bp) from X. dendrorhous were cloned. The β-carotene producing genes crtYB (2022 bp) and crtI (1749 bp) from X. dendrorhous were DNA synthesized. To move toward the production of astaxanthin, the key astaxanthin synthase genes were synthesized based on the sequences of green algae, including the β-carotene ketolase gene of Chlamydomonas reinhardtii (bkt, 1335 bp) and the β-carotene hydroxylase gene of H. pluvialis (Hpchyb, 882 bp). All genes used in this study were codon optimized to K. marxianus (Table 1). To construct engineered strains, the transformation method of (Beggs, 1978) was used. The cells were spread onto YPL plates (1% BactoDifco-Yeast Extract, 1% BactoDifco-Peptone, and 2% Merck-lactose) containing G418 (200 µg/mL, InvivoGen, USA) and cultured in YPL broth for screening and comparing astaxanthin production rates. The engineered strain Sm23 was derived from the K. marxianus 4G5 wild type by introducing the astaxanthin-biosynthesis pathway using PGASO (Chang et al., 2012) to assemble eight gene cassettes in a pre-designated order (Fig. 1B). In the selection marker gene cassette, the kanMX gene and the KlGapDH promoter sequence were amplified and assembled

7

into a DNA fragment. Consecutive gene cassettes containing overlapping 55 bp regions on the border were used for recombination of gene assembly to designate as the first to the seventh of the gene cassettes. The seven gene cassettes were orderly constructed as promoter-gene-terminator, including KlPLac4-Hpchyb-KlTTLac4, ScPGapDH-crtE-ScTTGap, ScPGK-Hpchyb-ScTTPGK, KlPGapDH-kanMX-ScTTGap, ICL-crtI-35STT, KlPGK-bkt-ScTTPGK, KlPADHI-crtYB-ScTTGap, and ScPADHI-tHMG-ScTTADHI (Fig. 1B). These gene cassettes were co-transformed into the genome of K. marxianus 4G5 and by homologous recombination could assemble in the designated order Hpchyb-crtE-Hpchyb-kanMX-crtI-bkt-crtYB-tHMG. The selected yeast transformants were cultured for investigating carotenoid production. The cells were further induced by culturing in YPG broth (1% BactoDifco-Yeast Extract, 1% BactoDifco-Peptone, and 2% Merck-galactose) for producing a high amount of astaxanthin. The strain could produce astaxanthin was selected and denoted by Sm23.

2.2. Construction of astaxanthin yield-improved yeast strains To improve astaxanthin production, four astaxanthin yield-improved yeast strains ZBC-7, HZBC-4, AHZBC-13, and B-21 were derived from the Sm23 strain, which already has an upstream β-carotene producing pathway and astaxanthin-biosynthesis

8

pathway. The construction process of the improved strains is as follows (Fig. 2A). First, the two key astaxanthin-biosynthesis genes Hpchyb and bkt, each of which was driven by the Lac4 promoter, were transformed by SacII-linearized pKLAC2 vectors with the zeo selection marker to generate new strains and the best strain was denoted as the ZBC-7 strain. Second, the following improved strains, HZBC, AHZBC, and B were then derived ZBC-7 by repeated genomic insertions of Hpchyb and bkt each with the Lac4 promoter, by targeting the Lac4 promoter region by the selectable marker genes hph, aur, and bla sequentially. In each integration step, the best transformant for astaxanthin production was selected. Three astaxanthin-biosynthesis improved strains were selected and denoted by HZBC-4, AHZBC-13, and B-21.

2.3. RT-qPCR and qPCR quantification The engineered strains Sm23, ZBC-7, HZBC-4, AHZBC-13, and B-21 and the wild type strain 4G5 were incubated in 5 mL YPL medium at 30°C with shaking at 200 rpm for 48 h. The template DNA or RNA was purified from yeast cells using HiQ-Column 12 automated DNA/RNA Purification System (Protech, Taiwan) with AccuPure Yeast DNA mini kit or AccuPure Yeast RNA mini kit (AccuBioMed, Taiwan). The cDNA synthesis was conducted using a reverse transcription kit (SuperScript™ II kit,

9

Invitrogen, USA). The relative quantification of each gene was carried out via the Universal Probe Library Set (LightCycler® 480 Probes Master, Roche, Germany) on a LightCycler (LightCycler 480, Roche), following the protocol of the manufacturer, and the designer UPL primer sets were used to analyze the strength of each promoter (Table 2). Actin gene was used as the reference for quantitative PCR analysis, and each analysis was repeated three times. The relative mRNA expression levels and the copy numbers of the Hpchyb and bkt in each astaxanthin-improved strain compared to Sm23 are shown in Fig. 2B and 2C.

2.4. Site-directed mutagenesis To improve the key enzyme activity, the amino acid point mutation of Hpchyb enzyme was made by QuikChangeTM Site-Directed Mutagenesis Kit (Stratagene, USA). Briefly, the mutagenic primers, purified by HPLC grade (Table 3), containing the desired mutation site in the middle of the primers and annealed to the same sequence on opposite strands of the plasmid. After the thermocycler steps with annealing temperature 64 oC, the site-directed mutation of plasmids was generated. The unchanged templates were digested by adding 1 µL of DpnI endonuclease. The mutated sequences of Hpchyb were separately constructed with single amino acid mutation sites of pK90R

10

(K90R), pF203D (F203D), and pV257D (V257D); double mutation sites of pK+F (K90R+F203D), pK+V (K90R+V257D), and pF+V (F203D+V257D); or triple mutation sites of p3x (K90R+F203D+V257D). The mutations were confirmed by sequencing. All constructions were introduced into the strain Sm23 by electroporation to obtain the Hpchyb mutant strains K90R, F203D, V257D, K+F, K+V, F+V, and 3x.

2.5. High Pressure Liquid Chromatography (HPLC) The carotenoid profiles were analyzed by HPLC. The method was according to Sander et al. (1994) with the following modifications. Total carotenoids were extracted from freeze-dried yeast cells in acetone homogenized by MagNA Lyser Green Bead (Roche). Total carotenoids were quantified by measuring absorbance at 460 nm. For HPLC separation, the solvent was evaporated under a stream of N2 gas at room temperature and dissolved in 500 µL of acetone, and an aliquot of 100 µL was injected immediately. The Nomura Chemical Develosil C30-UG Column (Interlink Scientific Services, UK) was used with the following two buffers: A buffer, methanol/MtBE/Water (81:15:4 vol/vol/vol) and B buffer, methanol/MtBE/Water (7:90:3 vol/vol/vol). The flow rate of the mobile phase was 1 mL/ min., and the solvent gradient was as follows: from 0 to 25 min for 100% to 0% of A buffer and 0% to 100% of B buffer, and then from 26

11

to 30 min for 0% to 100% of A buffer and 100% to 0% of B buffer. Samples were monitored with a Jasco870-UV intelligent UV-VIS detector (JASCO International Co., Ltd., Japan). All carotenoids were identified by chromatography with commercial compounds including β-carotene, canthaxanthin, and astaxanthin as the reference standards (Sigma-Aldrich, USA). The standards were prepared by serial dilution to make standard curves for the following concentrations: 3.125, 6.25, 12.5, 25, 50, 100 mg/L. Each standard curve was used for quantitation in combination with the extinction coefficients. To identify the configurational stereoisomer of astaxanthin, the peaks of astaxathin were collected from the 3 samples as the standards: 1. one peak of astaxanthin extracted from H. pluvialis (Biomed, Taiwan), which has been saponified (0.03 M KOH, 40°C, 1 hours) and identified optically as the 3S, 3’S configurational stereoisomer (Lorenz & Cysewski, 2000); 2. one peak of astaxanthin extracted from X. dendrorhous BCRC22365, which has been identified optically as the 3R, 3’R configurational stereoisomer (Andrewes, 1976); 3. three peaks of chemically synthetic astaxanthin (Sigma-Aldrich), which have been identified as the 3S, 3’S, 3R, 3’R, and 3R, 3’S chirality. The peak of astaxanthin from the S3-2 strain (this study) was also extracted and astaxanthin was detected under absorbance at 460 nm. The CHIRALPAK®IC Column (Daicel, Japan) was used with mobile phases of MtBE/ ACN

12

= 35/ 65 (v/v), which was modified from Wang et al. (2008) for optical configuration separation of astaxanthin by HPLC.

2.6. 5 L fermentation A 5 L Winpact Bench Top Fermentor FS-01 (Major Science, Taiwan) was used for the mass-production of yeast with astaxanthin experiment. The astaxanthin biosynthesis key genes were driven by Lac4 promoter, which can be induced by lactose and galactose. As the galactose induction showed a higher astaxanthin yield, galactose was selected as the induction medium together with the basal nitrogen base of 1% yeast extract and 1% peptone, which was found to have the suitable induction concentration at 4% galactose in the 7 mL tube for pre-testing. The cultural temperatures at 25°C, 30°C and 37°C were pre-tested for the astaxanthin yield in the tube (data not shown). It was then scaled up for the 5 L fermenter. Batch cultures were carried out by adding a 5% inoculum to 4 L sterile medium, which is the induction medium consisting of YPG broth (1% BactoDifco-Yeast Extract, 1% BactoDifco-Peptone, and 4% Merck-galactose) in a pre-sterilized fermenter (121°C, 20 min). Although the fermentor was equipped with controllers for pH, temperature, agitation and dissolved oxygen (DO) concentration, the temperature was controlled at

13

30°C, while the agitation speed automatically varied at a fixed air flow rate during the culture to maintain the DO concentration above 20% air saturation (Lukondeh et al., 2005). The experiment was designed using the Winpact**EZScrip software (Major Science) to carry out batch fermentation for 72 h.

3. Results and Discussion 3.1. Construction of an astaxanthin-biosynthesis pathway in a yeast host In this study, a convenient and flexible synthetic biology tool, PGASO, was first applied to construct the astaxanthin-producing strain Sm23 from the K. marxianus 4G5 wild type. The gene cassettes were co-transformed into the genome of K. marxianus 4G5 and were assembled by themselves by homologous recombination in a designated order as Hpchyb-crtE-Hpchyb-kanMX-crtI-bkt-crtYB-tHMG (Fig. 1B). The DNA fragments were checked for length by gel electrophoresis (Fig. 1C). The result showed that the consecutive gene cassettes containing overlapping 55 bp regions on the border were indeed correctly recombined. Seven gene cassettes each arranged as promoter-gene-terminator were validated by PCR amplification, including KlPLac4-Hpchyb-KlTTLac4 (3229 bp), ScPGapDH-crtE-ScTTGap (3478 bp), ScPGK-Hpchyb-ScTTPGK (2173 bp), KlPGapDH-kanMX-ScTTGap (1955 bp),

14

ICL-crtI-35STT (4746 bp), KlPGK-bkt-ScTTPGK (2626 bp), KlPADHI-crtYB-ScTTGap (3323 bp), and ScPADHI-tHMG-ScTTADHI (3568 bp). The astaxanthin-producing strain Sm23 showed an astaxanthin yield of 31 µg/g DCW, and it contains the heterologous genes including phytoene desaturase (crtI), bifunctional enzyme (crtYB), geranylgeranyl diphosphate synthase (crtE) from X. dendrorhous, geranylgeranyl pyrophosphate (GGPP) from K. marxianus, β-carotene ketolase (bkt) from C. reinhardtii and β-carotene hydroxylase (Hpchyb) from H. pluvialis.

3.2. Construction of astaxanthin yield-improved yeast strains Since the astaxanthin yield of the Sm23 strain was too low and accumulated as beta-carotenes (603 µg/g), a higher astaxanthin-converting strain was needed. The majority of transformant strains contained 2-5 copies of pKLAC2 in a transformation experiment (Read et al., 2007), so when the procedure is repeated 5 times the transformants may contain up to 24 copies. The gene copy numbers after repeated integrations are shown in Fig. 2A and 2C. From the strain Sm23, Hpchyb and bkt were integrated one to four times to generate the strains ZBC-7, HZBC-4, AHZBC-13, and B-21, respectively (Fig. 2A). These

15

transformants showed different colors, and the B-21 strain exhibited the strongest red color (data not shown). The repeated gene integrations produced the relatively high Hpchyb and bkt copy numbers in each strain derived from Sm23, which has two copies of the Hpchyb cassette and one copy of the bkt cassette. Compared to Sm23, the numbers of Hpchyb cassettes and bkt cassettes were, respectively, increased approximately 1.3 and 2.0 times in ZBC-7, 2.8 and 3.3 times in HZBC-4, 3.5 and 4.0 times in AHZBC-13, and 6.9 and 8.5 times in B-21 (Fig. 2C). The copy numbers of Hpchyb and bkt increased their gene expression levels as shown in Fig. 2B. The mRNA levels of the Hpchyb gene were represented by the folds compared to Sm23 as 1.0 (Sm23) : 1.6 (ZBC-7) : 1.9 (HZBC-4) : 4.3 (AHZBC-13) : 8.6 (B-21) and those for the bkt gene were 1.0 (Sm23) : 4.5 (ZBC-7) : 5.0 (HZBC-4) : 6.5 (AHZBC-13) : 10.5 (B-21); for both genes the RNA levels were relative to that of the indigenous actin gene. All the introduced genes were not detectable in WT, and the astaxanthin yield-improved strain B-21, which was achieved by repeated integrations, showed the highest gene insertion and expression of Hpchyb and bkt. All the carotenoid profiles were analyzed by HPLC, and the result indicated that increasing the key astaxanthin-biosynthesis genes Hpchyb and bkt can increase astaxanthin and carotenoids production. The amount of astaxanthin was highly

16

correlated with the copy numbers of the key astaxanthin-biosynthesis genes integrated. The result showed astaxanthin yield (µg/g DCW)/ strain as 0/ WT : 31/ Sm23 : 185/ ZBC-7 : 1079/ HZBC-4 : 1711/ AHZBC-13 : 2307/ B-21 (Fig. 3). Compared to Sm23, the astaxanthin yields of ZBC-7, HZBC-4, AHZBC-13, and B-21 increased, respectively, 6, 35, 55, and 74-folds. Furthermore, all the engineered strains possessed only one copy of upstream β-carotene producing pathway, but their total carotenoid productivity was increased as their downstream astaxanthin-synthesis gene, Hpchyb and bkt, increased. The data also showed total carotenoids yield (µ g/g DCW)/ strain as 0/ WT : 67/ Sm23 : 1009/ ZBC-7 : 2003/ HZBC-4 : 2788/ AHZBC-13 : 3705/ B-21 (Fig. 3). These data suggests the potential for insertion of more astaxanthin-biosynthesis genes to produce higher astaxanthin and also to direct the carbon flow towards producing higher valuable carotenoids. In addition, although B-21 produced the highest astaxanthin amount, there also remained more cantaxanthin accumulation (Fig. 3). The reason might be that there is lack of β-carotene hydroxylase activity in this strain. The mRNA expression data indicated that the bkt expression in B-21 was increased only 1.6 times compared to AHZBC-13, while the Hpchyb expression was increased 2 times (Fig. 2B). These data suggested that the enzyme activity of BKT might be much better than HpChyb.

17

3.3. Improvement of HpChyb enzyme activity According to the HPLC result, strain B-21 was selected, which was able to produce higher astaxanthin, but there is much higher cantaxanthin accumulation (756 µ g/g DCW) in B-21, which might have resulted from the poor HpChyb enzyme activity (Fig. 3). To improve the HpChyb enzyme activity to efficiently convert canthaxathin to astaxanthin, protein engineering of this key enzyme was conducted. The mutations, which were made through site-directed mutagenesis of Hpchyb were confirmed by sequencing, and all constructions were introduced into the strain Sm23 by electroporation to generate 7 Hpchyb mutant strains K90R, F203D, V257D, K+F, K+V, F+V, and 3x, where K+F means K90R + F203D, K+V means K90R +V257D, and 3x means K90R + F203D + V257D. The single mutation K90R could enhance astaxanthin production by 1.34-fold compared to ZBC-7, but the other two single mutations appeared to damage the enzyme because they showed no enzyme activity. Therefore, K90R was selected. Previous studies have revealed that the site mutation of target protein sumoylation site can prevent the reduction of protease activity from sumoylation and led to ubiquitination failure (Chen et al., 2011). This process possibly prolongs the duration of Hpchyb single mutation K90R.

18

The Hpchyb single mutant K90R was used to construct a new astaxanthin yield-improved strain S3-2 through the above repeated-integration strategy. The S3-2 strain can increase astaxanthin yield to 3125 µ g/g (DCW) in YPL medium and 5701

µ g/g (DCW) in YPG medium, which is the highest astaxanthin content in an engineered host to date. The HPLC profile of the wild type strain was added as a control in this study, and there was no carotenoid peak detected under absorbance at 460 nm (data not shown). We further showed the inserted gene copy number data and gene expression data to support the assertion. The inserted gene copy number data indicated that the B-21 strain possessed a higher copy number of Hpchyb than the S3-2 strain (Fig. 2C). Although the Hpchyb expression level was higher in B-21 than in S3-2 (Fig. 2B), S3-2 had no accumulation of cantaxanthin. It reveals that there was higher β-carotene hydroxylase activity in S3-2 than B-21. Furthermore, the configurational stereoisomer of astaxanthin production from S3-2 was 3S, 3’S, which has the highest antioxidant activity as the H. pluvialis-derived natural astaxanthin (data not shown).

3.4. Validation by 5 L fermentor To do mass-production of S3-2 and an astaxathin yield investigation, a 5 L fermentor was applied in this study. The data showed in Fig. 4 that galactose was

19

exhausted at 12 h and the cell grew rapidly to the saturation cell density (OD600=40) within 24 h, and the astaxnthin yield was 9972 µg/g DCW. In this study, four interesting findings were observed: First, the data showed that astaxanthin was produced rapidly in the first 24 h and kept accumulated within 72 h, revealing the efficient induction of Lac4 promoter by galactose induction. Second, after 24 h fermentation, the carbon source was no longer supporting cell growth but bio-converting to astaxanthin continued, revealing the long duration of Hpchyb single mutation K90R. To increase the biomass and harvest a higher amount of astaxanthin, fed-batch or continuous fermentation strategies could be tested in the future. Third, the β-carotene yield decreased after 60 h fermentation but astaxanthin yield still increased, showing a pull-down effect to convert the residual precursor to final product. The result showed the possibility to accumulate a higher amount of astaxanthin by improving the fermentation parameters to elongate the astaxanthin-biosynthesis enzyme reaction. Fourth, efficient biosynthesis of astaxanthin might be assumed based on the complete bioconversion from a β-carotene hyperproducer to astaxanthin; however, S3-2 accumulated a low amount of β-carotene because of the improved downstream metabolic flux, and β-carotene hydroxylase and ketolase might play an important role to convert β-carotene to astaxanthin. Thus, K. marxianus is a potential host for

20

biosynthesis of astaxanthin, which can further increase the astaxanthin yield by enhancing the precursor amount and adjusting the fermentation strategy.

4. Conclusions An astaxanthin-biosynthesis pathway in the yeast Kluyveromyces marxianus was successfully constructed, which is a potential host for efficient bioconversion and may tolerate high accumulation of heterologous secondary metabolites. The repeated-integration approach of astaxanthin-biosynthesis key enzyme genes and site-directed enzyme modification approaches can efficiently bioconvert carbon sources to astaxanthin. In this study, a potential yeast strain was provided as a metabolically engineered yeast strain by synthetic biology tools and its metabolic engineering methods for increasing metabolite production.

Acknowledgements This work was supported by a contract from Intelligenomics Biotech. Co. Ltd., and by the Ministry of Science and Technology [MOST 104-2621-M-039-001 and MOST 104-2311-B-039-001-MY3], Academia Sinica, and China Medical University Hospital [DMR-104-090].

21

References

1.

Andrewes, A.G., Starr, M.P. 1976. (3R,3'R)-astaxanthin from the yeast Phaffia rhodozyma. Phytochemistry, 15(6), 1009-1011.

2.

Ballou, C.E. 1990. Isolation, characterization, and properties of Saccharomyces cerevisiae mnn mutants with nonconditional protein glycosylation defects. Methods

3.

Enzymol, 185, 440-70. Banat, I.M., Nigam, P., Marchant, R. 1992. Isolation of thermotolerant, fermentative yeasts growing at 52 degrees C and producing ethanol at 45 degrees C and 50 degrees C. World J Microbiol Biotechnol, 8(3), 259-63.

4.

Beggs, J.D. 1978. Transformation of yeast by a replicating hybrid plasmid. Nature, 275(5676), 104-9.

5.

Bhataya, A., Dannert, S.C., Lee, P.C. 2009. Metabolic engineering of Pichia pastoris X-33 for lycopene production. Process Biochem, 44(10), 1095-1102.

6.

Buckholz, R.G., Gleeson, M.A. 1991. Yeast systems for the commercial production of heterologous proteins. Biotechnology (N Y), 9(11), 1067-72.

7.

Chang, J.J., Ho, C.Y., Ho, F.J., Tsai, T.Y., Ke, H.M., Wang, C.H., Chen, H.L., Shih, M.C., Huang, C.C., Li, W.H. 2012. PGASO: A synthetic biology tool for

8.

engineering a cellulolytic yeast. Biotechnol Biofuels, 5(1), 53. Chang, J.J., Ho, C.Y., Mao, C.T., Barham, N., Huang, Y.R., Ho, F.J., Wu, Y.C., Hou, Y.H., Shih, M.C., Li, W.H., Huang, C.C. 2014. A thermo- and toxin-tolerant kefir yeast for biorefinery and biofuel production. Appl. Energy, 132, 465-474.

9.

Chang, J.J., Ho, F.J., Ho, C.Y., Wu, Y.C., Hou, Y.H., Huang, C.C., Shih, M.C., Li, W.H. 2013. Assembling a cellulase cocktail and a cellodextrin transporter into a

yeast host for CBP ethanol production. Biotechnol Biofuels, 6(1), 19. 10. Chang, J.J., Thia, C., Lin, H.Y., Liu, H.L., Ho, F.J., Wu, J.T., Shih, M.C., Li, W.H., Huang, C.C. 2015. Integrating an algal beta-carotene hydroxylase gene into a designed carotenoid-biosynthesis pathway increases carotenoid production in yeast. Bioresour Technol, 184, 2-8. 11. Chen, S.C., Chang, L.Y., Wang, Y.W., Chen, Y.C., Weng, K.F., Shih, S.R., Shih, H.M. 2011. Sumoylation-promoted enterovirus 71 3C degradation correlates with a reduction in viral replication and cell apoptosis. J Biol Chem, 286(36), 31373-84. 12. Gassel, S., Breitenbach, J., Sandmann, G. 2014. Genetic engineering of the complete carotenoid pathway towards enhanced astaxanthin formation in Xanthophyllomyces dendrorhous starting from a high-yield mutant. Appl Microbiol Biotechnol, 98(1), 345-50. 22

13. Gassel, S., Schewe, H., Schmidt, I., Schrader, J., Sandmann, G. 2013. Multiple improvement of astaxanthin biosynthesis in Xanthophyllomyces dendrorhous by a combination of conventional mutagenesis and metabolic pathway engineering. Biotechnol Lett, 35(4), 565-9. 14. Hou, X., Li, Y., Wu, G., Wang, L., Hong, M., Wu, Y. 2010. Determination of para red, Sudan dyes, canthaxanthin, and astaxanthin in animal feeds using UPLC. J Chromatogr Sci, 48(1), 22-5. 15. Igielska-Kalwat, J., Goscianska, J., Nowak, I. 2015. Carotenoids as natural antioxidants. Postepy Hig Med Dosw (Online), 69, 418-28. 16. Kidd, P. 2011. Astaxanthin, cell membrane nutrient with diverse clinical benefits and anti-aging potential. Altern Med Rev, 16(4), 355-64. 17. Lorenz, R.T., Cysewski, G.R. 2000. Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol, 18(4), 160-7. 18. Lukondeh, T., Ashbolt, N.J., Rogers, P.L. 2005. Fed-batch fermentation for production of Kluyveromyces marxianus FII 510700 cultivated on a lactose-based medium. J Ind Microbiol Biotechnol, 32(7), 284-8. 19. Raimondi, S., Zanni, E., Amaretti, A., Palleschi, C., Uccelletti, D., Rossi, M. 2013. Thermal adaptability of Kluyveromyces marxianus in recombinant protein production. Microb Cell Fact, 12, 34. 20. Sander, L.C., Sharpless, K.E., Craft, N.E., Wise, S.A. 1994. Development of engineered stationary phases for the separation of carotenoid isomers. Anal Chem, 66(10), 1667-74. 21. Spencer, J.F., Ragout de Spencer, A.L., Laluce, C. 2002. Non-conventional yeasts. Appl Microbiol Biotechnol, 58(2), 147-56. 22. Tanaka, T., Shnimizu, M., Moriwaki, H. 2012. Cancer chemoprevention by carotenoids. Molecules, 17(3), 3202-42. 23. Ukibe, K., Hashida, K., Yoshida, N., Takagi, H. 2009. Metabolic engineering of Saccharomyces cerevisiae for astaxanthin production and oxidative stress tolerance. Appl Environ Microbiol, 75(22), 7205-11. 24. Verwaal, R., Wang, J., Meijnen, J.P., Visser, H., Sandmann, G., van den Berg, J.A., van Ooyen, A.J. 2007. High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous. Appl Environ Microbiol, 73(13), 4342-50. 25. Wang, C., Armstrong, D.W., Chang, C.D. 2008. Rapid baseline separation of enantiomers and a mesoform of all-trans-astaxanthin, 13-cis-astaxanthin, adonirubin, and adonixanthin in standards and commercial supplements. J Chromatogr A, 1194(2), 172-7. 23

26. Wang, C.W., Oh, M.K., Liao, J.C. 1999. Engineered isoprenoid pathway enhances astaxanthin production in Escherichia coli. Biotechnol Bioeng, 62(2), 235-41. 27. Zelcbuch, L., Antonovsky, N., Bar-Even, A., Levin-Karp, A., Barenholz, U., Dayagi, M., Liebermeister, W., Flamholz, A., Noor, E., Amram, S., Brandis, A., Bareia, T., Yofe, I., Jubran, H., Milo, R. 2013. Spanning high-dimensional expression space using ribosome-binding site combinatorics. Nucleic Acids Res, 41(9), e98. 28. Zhou, P., Xie, W., Li, A., Wang, F., Yao, Z., Bian, Q., Zhu, Y., Yu, H., Ye, L. 2017. Alleviation of metabolic bottleneck by combinatorial engineering enhanced astaxanthin synthesis in Saccharomyces cerevisiae. Enzyme Microb Technol, 100, 28-36. 29. Zhou, P., Ye, L., Xie, W., Lv, X., Yu, H. 2015. Highly efficient biosynthesis of astaxanthin in Saccharomyces cerevisiae by integration and tuning of algal crtZ and bkt. Appl Microbiol Biotechnol, 99(20), 8419-28. 30. Zhu, C., Naqvi, S., Capell, T., Christou, P. 2009. Metabolic engineering of ketocarotenoid biosynthesis in higher plants. Arch Biochem Biophys, 483(2), 182-90.

24

Figure Captions Figure 1. (A) The astaxanthin-biosynthesis pathway. (B) The map of astaxanthin biosynthesis genes cassettes for the K. marxianus Sm23 strain construction by PGASO. (C) The confirmation of cassette sizes by PCR. Lane M: 1000 ladder marker; Lanes 1 to 7, the cassette size of DNA fragments 1 to 7: 3478 bp, 3229 bp, 2626 bp, 4746 bp, 3323 bp, 2173 bp, 1955 bp, respectively. Figure 2. (A) The repeated-integration approach of the key astaxanthin-biosynthesis genes Hpchyb and bkt into the Sm23 strain to generate four astaxanthin-biosynthesis improved strains. (B) The relative gene expression levels compared to the Sm23 strain was estimated by RT-qPCR. (C) The relative gene inserted copy number compared to the Sm23 strain was estimated by qPCR. The strains were including WT, Sm23, ZBC-7, HZBC-4, AHZBC-13, strain B-21, and S3-2. The housekeeping gene actin was employed as reference gene. Figure 3. Evaluation of carotenoids production from all astaxanthin yield-improved strains by HPLC. Figure 4. The fermentation of S3-2 in a 5 L fermentor. Galactose: residual sugar (%), AST: astaxanthin yield (mg/g DCW), OD: the cell density is measured under 600 nm wavelength, β-caro: β-carotene yield (mg/g DCW).

25

Tables Table 1. The astaxanthin biosynthesis genes used in this study. Gene

Accession number

Origin

CrtI

AAO53257

Xanthophyllomyces dendrorhous

CrtYB

CAB51949

Xanthophyllomyces dendrorhous

CrtE

AAY33921

Xanthophyllomyces dendrorhous

tHMG

7208

Kluveromyces marxianus

Hpchyb Q9SPK6 bkt

XP_001698699

Haematococcus pluvialis Chlamydomonas reinhardtii

26

Table 2. The designer UPL primer sets were used to analyze the strength of each promoter.

Primer name

Sequence

Kan-UPL #144F Kan-UPL #144R

5’- AGACTAAACTGGCTGACGGAAT-3’ 5’- CATCAGGAGTACGGATAAAATGC-3’

HpCHYb #139-F

5’- AACGACTTGTTCGCAATCATTA-3’

HpCHYb #139-R

5’- CCCAACACGTTTGGCAAC-3’

CrBKT-UPL #159-F

5’- GCTGCTGCAACTGGTTCAC-3’

CrBKT-UPL #159-R

5’- GCACTAGCGGAACTAGCAGAA-3’

Actin-UPL #9F

5’- GCGTAGATTGGAACAACGTG-3’

Actin-UPL #9R

5’- AGAACTACCGGTATTGTGTTGGA-3’

27

Table 3. The designer site-directed mutation primer sets were used to generate the Hpchyb mutants. Primer

Sequence (5’->3’)

Hpchyb-F CCATGCTTTCTAAGTTACAATCCAT Hpchyb-R GGTTATCTTTTTGACCAGTCAAGTT K90R-F

CTGAGAGAAGAGCTAGACGTAGAAGAGAACAATTGTCCTACC

K90R-R

GGTAGGACAATTGTTCTCTTCTACGTCTAGCTCTTCTCTCAG

F203D-F

GCCATGTTGTTGTGTACTGATGGCTTCTGGTTGCCAAACG

F203D-R

CGTTTGGCAACCAGAAGCCATCAGTACACAACAACATGGC

V257D-F

CCATACATGAAGAGATTGACTGATGCTCACCAGTTACACCATTC

V257D -R GAATGGTGTAACTGGTGAGCATCAGTCAATCTCTTCATGTATGG

28

29

30

31

32

33

34

35

36

Highlights • An astaxanthin-biosynthesis pathway was constructed in Kluyveromyces marxianus. • Repeated genome integration of bkt and Hpchyb increased astaxanthin yield. • Hpchyb was modified by site-directed mutagenesis to improve the enzyme activity. • Our newly constructed strain can produce 3S, 3’S-astaxanthin at a high rate.

37