Metabolic engineering of Ashbya gossypii for enhanced FAD production through promoter replacement of FMN1 gene

Journal Pre-proof Metabolic engineering of Ashbya gossypii for enhanced FAD production through promoter replacement of FMN1 gene Manan V. Patel, Chandra T.S.

PII:

S0141-0229(19)30193-0

DOI:

https://doi.org/10.1016/j.enzmictec.2019.109455

Reference:

EMT 109455

To appear in:

Enzyme and Microbial Technology

Received Date:

22 June 2019

Revised Date:

21 September 2019

Accepted Date:

19 October 2019

Please cite this article as: Patel MV, Chandra TS, Metabolic engineering of Ashbya gossypii for enhanced FAD production through promoter replacement of FMN1 gene, Enzyme and Microbial Technology (2019), doi: https://doi.org/10.1016/j.enzmictec.2019.109455

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Metabolic engineering of Ashbya gossypii for enhanced FAD production through promoter replacement of FMN1 gene. Authors: Manan V. Patel, Chandra T.S. Department of Biotechnology, Bhupat and Jyoti Mehta School of Biosciences, Indian Institute of Technology Madras, Chennai 600036, Tamil Nadu, India. Corresponding Author: T.S. Chandra, [email protected] Tel.+91-44-22574103 fax. +91 44

of

22574102

Highlights

Ashbya gossypii was engineered to overproduce Flavin Adenine Dinucleotide (FAD).



FMN1 gene encoded riboflavin kinase was found to be potential bottle-neck for FAD

ro



synthesis.

Integrative transformation of Promoter replacement cassette replaced native FMN1 gene

-p



promoter with GPD gene promoter.

A 35.67-fold increase in riboflavin kinase enzyme activity and 14.02-fold increase in FAD

lP

production were achieved.

re



Abstract

ur na

Riboflavin (vitamin B2), Flavin Mononucleotide (FMN), Flavin Adenine Dinucleotide (FAD) are essential biomolecules for carrying out various metabolic activities of oxidoreductases and other enzymes. Riboflavin is mainly used as food and feed supplement while the more expensive FAD has pharmacological importance. Although Ashbya gossypii has been metabolically engineered for industrial production of riboflavin, there are no reports on FAD production. In the present study,

Jo

a transcriptional analysis of the time course of flavin genes expression, indicated that riboflavin to FMN conversion by riboflavin kinase enzyme encoded by FMN1 gene could be the major rate limiting step in FAD synthesis. Overexpression of FMN1gene was attempted by placing the ORF of FMN1 under control of the stronger constitutively expressed GPD (Glyceraldehyde-3phosphate dehydrogenase) promoter replacing its native promoter. A 2.25Kb promoter replacement cassette (PRC) for FMN1 gene was synthesized from cloned pUG6-GPDp vector and used for transformation of Ashbya gossypii. Resultant recombinant strain CSAgFMN1 had 35.67fold increase in riboflavin kinase enzyme. A 14.02-fold increase in FAD production up to 1

86.56±3.88 mg L-1 at 120 h incubation was obtained compared to wild type. While there was a marginal increase in riboflavin synthesis by the clone, FMN accumulation was not detected and could be attributed to other metabolic fluxes channeling FMN. This is the first report on development of FAD overproducing strain in A.gossypii.

Keywords Flavin Adenine Dinucleotide (FAD); Ashbya gossypii; metabolic engineering; FMN1 promoter

Jo

ur na

lP

re

-p

ro

of

replacement cassette (PRC); Riboflavin kinase; FAD synthetase.

2

Introduction: Flavins are group of organic compounds possessing a common isoalloxazine moiety of triheterocyclic structure. They are vital compounds for certain key metabolic reactions. Riboflavin, FMN and FAD are the most prominent amongst the flavins. Riboflavin or Vitamin B2, is an obligatory dietary component for most animals including humans. FMN and FAD are co-enzymes for important oxidation/reduction metabolic reactions as well as regulatory and defensive response metabolic reactions [1]. FAD has a pharmacological importance as an ophthalmic agent and multi-

of

vitamin supplement and it is much more expensive than riboflavin. It is used in the treatment of genetically inherited diseases like Friedreich ataxia [2] and chronic granulomatosis [3]. FAD was majorly produced through biotransformation involving ATP (Adenosine triphosphate), FMN and

ro

riboflavin expensive precursors [4,5]. Annual production of FAD is reported to be 10 tons and it is ~1000 times more expensive than riboflavin [6].

-p

Ashbya gossypii (also known as Eremothecium gossypii) and Eremothecium ashbyi are filamentous ascomycetous fungi and natural overproducers of riboflavin [7]. While E.ashbyi

re

overproduces FAD along with riboflavin, A.gossypii overproduces only riboflavin [8]. A.gossypii was preferred to E.ashbyi for industrial microbial production of riboflavin due to higher titers and

lP

availability of annotated genome database as well as genetic engineering tools [9–11]. A.gossypii genome has a high level of gene synteny with Saccharomyces cerevisiae genome [12]. It has been explored for production of single cell oil, fatty acids, recombinant proteins and flavor compounds

ur na

[13]. Full genome sequencing and the ease of genetic engineering makes A.gossypii a model organism for studying fungal developmental biology and metabolic engineering [14]. Flavins biosynthesis involves two major precursors: GTP (Guanosine-5’-triphosphate) and Ribu5P (ribulose-5-phosphate) (Fig. 1). GTP is a purine nucleotide and Ribu5P is synthesized in Pentose Phosphate pathway. These are converted to riboflavin through a pathway involving six

Jo

enzymatic reactions encoded by six RIB genes (RIB1-5 and RIB7). Further, riboflavin kinase (E.C.2.7.1.26) encoded by FMN1 gene converts riboflavin to FMN and FAD synthetase (E.C.2.7.7.2) encoded by FAD1 gene converts FMN to FAD (Fig. 1). Significant increase in FAD was reported by overexpression of FAD1 gene alone and FMN1-FAD1 co-overexpression in Candida famata along with culture media optimization [15]. Metabolic engineering of Escherichia coli was performed to increase keto-acid production by enhancing FAD production [16]. Regulation of riboflavin and FAD synthesis was studied in 3

Bacillus subtilis [17]. However, there are no studies on FAD production and regulation in A.gossypii. The objective of the present study is to enhance FAD production in A.gossypii by overcoming the rate limiting steps towards this goal. Gene expression study and metabolites analysis demonstrated that the reaction catalyzed by riboflavin kinase enzyme encoded by AgFMN1 gene was rate-limiting. Thus, it was of interest to enhance expression of AgFMN1 gene. A promoter replacement cassette was synthesized for replacing native AgFMN1 gene promoter

of

with constitutively expressed AgGPD gene promoter. Flavins produced by cloned strains were compared to WT with analysis of associated genes expression level and enzymes specific activity.

ro

The present study is the first report on genetic engineering of A.gossypii for FAD production.

-p

Materials and Method

Cultivation media and conditions

re

A.gossypii (NRRL Y-1056 – obtained from NCAUR, Illinois, USA) was maintained on Yeast-Malt extract agar (YMA) consisting of in g L-1 - 5 g peptone, 3 g yeast extract, 3 g malt

lP

extract, 10 g glucose and agar agar 20g [18]. For biochemical and genetic studies mycelium was grown in Ashbya full medium (AFM) consisting of in g L-1 - 10 g casein peptone, 10 g yeast extract, 20 g glucose, 1 g myo-inositol [10]. Pre-inoculum was incubated for 48 h and inoculated

ur na

in 50 ml AFM broth in 250ml Erlenmeyer flask and incubated at 180 rpm at 30 ̊C. For enhanced sporulation, A.gossypii was grown on sporulation induction media consisting of in g L-1 - 20 g glucose, 1.7 g yeast nitrogen base without amino acids and ammonium sulphate (Himedia Cat. #M151), 0.69 g complete supplement mixture (Himedia Cat. #G100), containing 0.3 g L-1 myo-

Jo

inositol, 10 ml of 100 mg ml-1 sterile filtered asparagine [19].

Quantification of flavins by HPLC Flavins produced by A.gossypii were quantified by HPLC method because different flavins

had similar excitation-emission wavelength and they could not be distinguished by fluorometric analyses. The culture broth was treated with four volumes of 0.02N HCl followed by autoclaving at 121 ºC for 20 min. The above mixture was centrifuged and treated with equal volume of 10% tri-chloro acetic acid (TCA) to remove proteins and estimate total flavins. Riboflavin, FMN and 4

FAD were estimated through reverse phase HPLC gradient elution with column: HiQ Sil C18HS (4.6 mm X 250 mm, 5 µm). Solvent A: 100 % 50 mM Ammonium acetate (pH = 6.0), Solvent B: 50 mM Ammonium acetate (pH = 6.0): acetonitrile (30:70, v/v). Run parameters was set as T = 0 min: A = 90 %, T = 10 min: A = 40 %, T = 15 min: A = 40 %, T = 17 min: A = 90%, T = 25 min: A = 90 %, Flow rate- 1.0 ml min-1. Absorbance was measured at 450 nm. Distinct peaks of standards of FAD, FMN and riboflavin could be separated by above protocol (Fig. 2a).

of

Expression of FAD1, FMN1 and RIB3 genes involved in FAD synthesis in WT A.gossypii A time course analysis of semi-quantitative gene expression was conducted for FAD1, FMN1 and RIB3 genes against constitutively expressed TEF gene. The experiment was performed

ro

in triplicates with RNA extracted from three different flasks for each sample and statistical significance was measured with T-Test. Fungal mycelia grown on AFM were collected by

-p

filtration at interval of 24 h with Whatman filter paper No.1 and instantly frozen with liquid nitrogen. Cells were crushed with sterile mortar and pestle and total RNA was extracted using

re

Takara RNAiso-Plus following the standard kit protocol (Takara Cat. #9108). Nanodrop was used to quantify and check purity of RNA preparation. cDNA was synthesized from 300 ng total RNA

lP

in 10 µl reaction using Takara PrimeScript™ RT reagent Kit with oligo-dT and random hexamer (Takara Cat. #RR037A). The cDNA was amplified with Amplicon PCR master mix (Amplicon Cat. #A190303) with genes specific primers (Table-1) and loaded on 1.5 % agarose with 100 bp

ur na

ladder. All primers in this study were designed using Primer3 open access software [20] (Table1). For each of the genes, amplification at five different number of cycles (22, 24, 26, 28 and 30 cycles) were observed to confirm the expression in exponential phase. Agarose gel images with ethidium bromide stained DNA bands, were processed with Biorad Quantity One® 1-D analysis

Jo

software to find area under peak which was proportionate to gene expression level.

Construction of FMN1 promoter replacement cassette Vector pUG6-tTA’ obtained from Addgene had G418 resistance selection marker gene.

pUG6-tTA’ was digested by EcoRV restriction enzyme. AgGPD promoter was PCR amplified from -1 to -500 base with Phusion® High-Fidelity DNA polymerase (NEB cat. #M0530S) to achieve blunt end PCR product. pUG6-GPDp cloned vector was achieved following the digested vector and AgGPD promoter blunt end ligation with T4 DNA ligase. The resultant vector pUG65

GPDp now possesses the open end promoter flanked by selection marker. The orientation of the insert was confirmed by PCR with insert specific forward and vector specific reverse primer followed by sequencing. Vector pUG6-GPDp was further used to generate 2.25Kb of FMN1 promoter replacement cassette by PCR amplification with PRC-Fr and PRC-Re primers mentioned in Table-1 with 50 bp overhangs. Resultant amplified PRC was purified using Qiagen QIAquick PCR purification kit (Cat. #28104) and used for transformation (Fig. 3). The concentration of purified PRC was checked

of

through nanodrop and stored at -20 ̊C.

A.gossypii spore preparation and electroporation for PRC transformation

ro

A.gossypii spores were isolated using sporulation induction media described in Wasserstrom et al., 2013 [18] . A.gossypii was grown until maximum spores appeared as observed

-p

under microscope. Spores were isolated and counted with haemocytometer followed by resuspension to achieve 109 spores ml-1 in spore buffer (0.03 % (v/v) Triton X-100) containing 25

re

% glycerol and stored at –80 °C. A.gossypii was transformed with FMN1 PRC through electroporation as described by Wendland et al., 2000 [17]. Electrocuvettes (4 mm) were pre-

lP

chilled and Bio-rad gene-pulser at 1.5 kV, 100 Ω and 25 µF was used for electroporation. A.gossypii was also transformed with vectors pUG6-tTA’ and pUG6-GPDp to be used as controls. Transformation efficiency was low with PRC (60-70 colonies μg-1 of DNA) compared to vectors

ur na

(100-110 colonies μg-1 of DNA). Heterokaryotic primary transformants were tested for inserts via colony PCR with cloning specific primers mentioned in Table1. Eight of the primary transformants (heterokaryotic) were sub-cultured in sporulation induction media to obtain secondary transformants (homokaryotic) through spores isolation and serial dilution plating on selective media. The secondary transformants were re-confirmed by sequencing using VarGF primers

Jo

(Table-1).

FMN1 gene expression in transformants by qPCR FMN1 gene expression was analyzed with Real-Time qPCR. Eight secondary transformants were grown for 72 hour and c-DNA was prepared as described earlier. The PCR reactions were prepared using SYBR® Premix Ex TaqTM (Takara Cat. #RR041A) kit. Roche LightCycler® 96 Real-Time PCR System was used for PCR amplification and relative expression 6

was measured with ∆∆Ct method. PCR protocol was used with following conditions - Stage 1: First denaturation (cycle repeats: 1) - 95℃ for 2 min. Stage 2: PCR reaction (Cycle repeats: 40) 95℃ for 10 sec, 60℃ for 30 sec. TEF gene was used as internal reference and cDNA extracted from WT and transformant AG-pUG6tTA obtained with the vector pUG6-tTA’ and AGpUG6GPDp with vector pUG6-GPDp were used as controls to compare with the gene expression in the clones.

of

Riboflavin kinase and FAD synthetase assay Enzyme activity was measured in cell-free extract. Mycelia (1.0-1.5 grams of wet weight) were harvested by filtration and frozen at -20 °C. Cells were crushed over ice bath using mortar

ro

and pestle and re-suspended in 20mM potassium phosphate buffer (pH 8.0). Total volume was adjusted to 10 ml and centrifuged to remove cell debris. This cell-free extract (CFE) was assayed

-p

for the protein concentration using Lowry’s method [21] and diluted with buffer as per enzyme assay requirement.

re

For measuring riboflavin kinase activity, assay mixture was prepared as per Yatsyshyn et al., 2009 [22] containing 75 mM potassium phosphate buffer (pH 8.0), 1 mM MgSO4, 0.1 mM

lP

riboflavin, 1 mM ATP and CFE (0.2 mg ml-1 protein). The reaction mixture was incubated at 30 °C for 30 minutes. The reaction was stopped by incubating the assay mix at 65 °C for 10 min and immediately transferring to the ice. Flavins were quantified with reverse phase HPLC as stated

ur na

earlier. One Unit of enzyme activity was defined as 1 µmole of riboflavin utilized per min at 30 °C at pH 8.0. Similarly, the assay mixture for FAD synthetase reaction contained 75 mM potassium phosphate buffer (pH 7.5), 1.5 mM MgCl2, 0.065 mM FMN, 2 mM ATP and CFE (0.2mg ml-1 protein). One Unit of enzyme activity was defined as 1µmole of FAD produced per min at 30 °C at pH 7.5. pH values for enzyme assays were taken from literature. The optimum pH for FAD

Jo

synthetase in closely related sp. Saccharomyces cerevisiae was 7.5 [23]. Riboflavin kinase and FAD synthetase activity assays were performed at pH 8.0 and 7.5 respectively with yeast Candida famata. [15,22]. The enzyme assays were performed in triplicates with CFE prepared from three different flask for each sample and statistical significance was measured with T-Test.

Results and discussion

7

Transcriptional analysis of flavin genes in WT A.gossypii during growth A time course growth and metabolites production by A.gossypii showed that biomass growth phase comes to stationary phase corresponding to glucose utilization at 72 h whereas riboflavin overproduction continues beyond the growth phase (Fig. 4). This pattern of growth on AFM medium is in agreement with earlier reports [18] that the flavins stored inside vacuoles are secreted outside when the mycelia undergo autolysis. Riboflavin is a primary metabolite but it was observed to be over-produced in late log phase of growth post 48 h of incubation in A.gossypii.

of

This flavins production phase ends at 120 h of incubation when mycelia was in the auto-lysis phase.

A semi-quantitative gene expression analysis for FAD1, FMN1 and RIB3 genes were

5).

All

gene

sequences

were

obtained

from

ro

carried out against constitutively expressed TEF gene until 120 h at the interval of every 24 h (Fig. Ashbya

genome

database

-p

(http://agd.unibas.ch/index.html). RIB3 expression was higher at 48 h and 72 h of growth when riboflavin production starts. FAD1 gene expression also increased by 4.07-fold at 120 h compared

re

to 24 h growth. Increased FAD1 expression might be the outcome of stress experienced by the cells at auto-lysis stage as FAD plays a key-role in anti-stress responses and oxidative stress was

lP

reported to enhance flavins production [18]. RIB3 and FAD1 gene expression significantly increased during flavins production phase compared to growth phase but FMN1 gene expression remained almost constant throughout the time course. Metabolite analysis through HPLC in WT

ur na

A.gossypii showed high riboflavin peak and small FAD peak, but FMN was below the limit of detection (Fig. 2b, 2c). Absence of FMN in HPLC analysis suggest that FMN synthesis is tightly regulated and it is synthesized at very low rate resulting in higher accumulation and secretion of riboflavin by the cell. Further the FMN produced may be immediately convert to FAD by FAD synthetase encoded by FAD1 gene. These findings suggested FMN1 gene expression as a potential

Jo

bottleneck for enhancing FAD production. Therefore, PCR based gene targeting for replacement of FMN1 gene promoter in A.gossypii was planned. FMN synthesis was reported to be rate limiting at reaction catalyzed through riboflavin kinase in yeast Candida famata as well [22]. It may be noted that while prokaryotes have a single bifunctional RF kinase and FAD synthetase and flavins production is regulated through riboswitch mechanism which is controlled by intracellular FMN levels [24]. Such, control has not been found in yeast or fungi including A.gossypii.

8

FMN1 gene expression by transformants FMN1 gene PRC was obtained from constructed vector pUG6-GPDp and WT A.gossypii was transformed as mentioned in Methods. The transformation efficiency with PRC was lower than that obtained with vectors. Linear PRC DNA may be less efficiently transformed and has to be integrated in the genome for transformants to survive on antibiotic selection plate. Vectors due their supercoiled nature can be more efficiently transformed and genome integration is not required as they carry ARS element. (Autonomously replicating sequence).

of

Eight clones were screened for FMN1 gene expression through Real-Time qPCR against constitutively expressed TEF gene (Fig 6). FMN1 gene under the strong promoter of GPD gene showed increased transcription level in all the clones obtained. One of the clones (clone-1)

ro

showing high level of expression (6.85-fold compared to WT) was designated as CSAgFMN1 and used for further experiments on flavins production. DNA sequencing clearly indicated presence of

-p

GPD gene promoter in upstream of the FMN1 gene in this clone. GPD gene codes for glyceraldehyde-3-phosphate dehydrogenase enzyme which plays a central role in glycolysis and

re

gluconeogenesis. It is a house-keeping gene which is constitutively expressed under a strong

lP

promoter.

Flavins production by recombinant CSAgFMN1 Time course analysis of flavins production by the recombinant CSAgFMN1was carried out

ur na

through reverse phase HPLC and showed increased production of riboflavin and FAD (Fig. 2 & 4). FAD production was significantly increased by 4.31-fold in 72 h (8.85±0.62 mg L-1 in CSAgFMN1 clone vs. 2.05±0.15 mg L-1 in Ag WT) and 14.02-fold in 120 h grown culture (86.56±3.88 mg L-1 in CSAgFMN1 clone vs. 6.17±0.75mg L-1 in Ag WT) during autolysis phase (Fig. 4a). FMN level was below detection limits in WT and CSAgFMN1 clone. These findings

Jo

suggest that increased flux towards FMN might be pushed to FAD production by FAD synthetase. Minor increase in riboflavin production of 1.34-fold at 72 h (55.47±2.52 mg L-1 in

CSAgFMN1 clone Vs. 41.32±0.91 mg L-1 in Ag WT) and 1.18-fold was observed at 120 h (144.65±4.49 mg L-1 in CSAgFMN1 clone Vs. 122.53±5.4 mg L-1 in Ag WT). There was no significant change in biomass or glucose utilization pattern in CSAgFMN1 clone compared to WT (Fig. 4b).

9

Interestingly FMN level was below detection limits in WT and CSAgFMN1 clone. A possible explanation is that increased flux towards FMN might have pushed FAD synthetase to produce more FAD or FMN is converted back to riboflavin by phosphatases. This is further discussed below with reference to the increased riboflavin kinase activity in the clone.

Riboflavin kinase and FAD synthetase enzyme activity

of

For a better understanding of the effect of cloning, the specific enzyme activities of Riboflavin kinase and FAD synthetase were measured at 72 h and 120 h of growth. Time point of 72 h growth was chosen because as biomass reached maximum value and entered stationary phase

ro

all the glucose was consumed and flavins production rate increased, with maximum flavins observed at 120 h (Fig. 4a, 4b). 1

-p

Riboflavin kinase specific activity was increased by 35.67-fold at 72 h (1.32±0.06 mU mgin CSAgFMN1 clone Vs. 0.037±0.01 mU mg-1 in WT.) and 36.83-fold at 120 h (2.21±0.62 mU

re

mg-1 in CSAgMN1 clone Vs. 0.06±0.02 mU mg-1 in WT) (Fig. 7). FAD synthetase specific activity was not changed significantly in CSAgFMN1 compared to WT at both the time points.

lP

Interestingly FAD synthetase enzyme specific activity was 5-10 fold higher in A.gossypii WT and CSAgFMN1 clone compared to reported activities of enzyme in WT strains of Saccharomyces cerevisiae [25] and Candida famata [15]. Moreover, general phosphatases and

ur na

FMN phophohydrolase (EC 3.1.3.2) was reported to convert FMN back to riboflavin in S.cerevisiae [26]. Difficulty in measuring riboflavin kinase activity in CFE due to dynamic equilibrium of enzyme pool which converts FMN to riboflavin or FAD was also reported earlier [27].

In the present study both the expression of FMN1 gene and the activity of this enzyme

Jo

Riboflavin kinase were increased in the clone CSAgFMN1. However, while FAD production increased in the clone, the intermediate FMN could not be detected. This is unlike in the case of Candida famata where FMN was increased [22]. These results could be interpreted that the higher levels of specific activity of FAD synthetase in A.gossypii converts major intracellular FMN pool to FAD. FMN levels below detection limit could also be attributed to conversion of FMN back to riboflavin due to FMN phosphatase and phosphohydrolase. Based on the gene expression and metabolites analyses, it was postulated that FMN1 gene expression was likely to be the major 10

limiting factor for FAD production and it was first targeted for upregulation. For a further increase in FAD, either overexpression of FAD1 gene or suppression of FMN phosphatase gene can be considered after investigating which reaction is more responsible for driving the flux towards FAD. Availability of ATP can also be a rate-limiting factor as the CSAgFMN1 clone with FMN1 overexpression still accumulated riboflavin (Fig. 4a). These possibilities on the regulation of FAD may be explored in future studies with the leads obtained here. Chemical synthesis of flavins is a lengthy multi-step process. Industrial riboflavin

of

production has shifted from chemical synthesis to biotechnological process in a span of 22 years (1990 to 2012) due to advances in bioprocess and metabolic engineering. Discovery of PCR-based gene targeting method boosted metabolic engineering work on riboflavin production in A.gossypii

ro

through fermentative production [10]. Using this approach GFP and m-cherry fluorescent tagged RIB1 and RIB3 genes were cloned for live cell imaging localization study [28]. All six RIB genes

-p

were overexpressed individually and in combinations using the PCR based gene targeting to maximize riboflavin biosynthesis [29]. Similar approach of integrative transformation was adopted

re

here for enhancing FAD production by using constitutively expressed GPD gene promoter. The developed clone was stable and FAD production was consistent.

lP

Production of FAD from different fungi and bacteria reported in literature is compared in Table-2. It may be noted that “de novo” synthesis of FAD is possible only in the fungi explored so far which is confined to only E.ashbyi, Candida famata and A.gossypii (present study). E.ashbyi

ur na

is a natural producer of FAD but unfortunately as it is genetically uncharacterized, it will be difficult to pursue targeted genetic engineering to improve the yields. Metabolic engineering of Candida famata with overexpression of FMN1 and FAD1 genes, resulted in 0.070 g L-1 FAD titer on YPD broth compared to 0.004 g L-1 in WT and media optimization through Central Composite Design increased it to 0.451g L-1 FAD [15]. In the present study genetic engineering of A.gossypii

Jo

has yielded maximum titer of 0.087 g L-1 FAD compared to nearly nil production in wild type. This yield is higher than 0.07 g L-1 in E.ashbyii under un-optimized media conditions (Table-2). Hence, media optimization in A.gossypii clone may further improve the yield. In the case of bacteria, although genetic and metabolic engineering have yielded higher titers of FAD, this has been possible only with exogenous supplementation of expensive precursors like FMN and ATP which severely adds to the cost of production. The present study on FAD production from A.gossypii therefore gains importance that there is scope for further metabolic engineering for 11

driving the flux towards FAD synthesis, knock out of the genes involved in FMN/ FAD hydrolysis and statistical media optimization etc. to scale up to industrial level as shown in engineered bacteria but at a much lower cost.

Conclusion Transcriptional analyses of flavin genes expression identified riboflavin conversion to FMN by riboflavin kinase, encoded by FMN1, as the rate limiting step in FAD synthesis. The FMN1 gene

of

native promoter was replaced with stronger constitutively expressed GPD gene promoter to upregulate its expression. Cloned vector pUG6-GPDp was used for synthesizing PRC of 2.25kb with 50 bp homologous overhang to FMN1 gene. Integrative transformation of FMN1 PRC

ro

through electroporation yielded CSAgFMN1 clone. This clone showed 6.85-fold increase in FMN1 gene expression level and 35.67-fold increase in riboflavin kinase enzyme activity. FAD

-p

production increased by 14.02-fold in CSAgFMN1 compared to WT with maximum of 86.56 ± 3.88 mg L-1 FAD titer at 120 h on AFM broth. Here, integrative transformation offers advantage

re

of maximum stability and consistency of cloned organism. The constructed vector pUG6-GPDp can be used further for synthesizing promoter replacement cassette for any desired target gene

lP

using one step PCR reaction. Riboflavin increase was only marginal in the clone. FMN accumulation was not detected in either the clone or wildtype. This raises questions on whether all of the FMN was converted to FAD or whether FMN was converted back to riboflavin by

ur na

phosphatases. A better understanding of these metabolic fluxes can lead to further improvement in FAD production. A.gossypii is a natural overproducer of riboflavin but so far no studies were reported on the improvement of FAD production, which has higher commercial value than riboflavin.This is the first report in A.gossypii on genetic regulation of the biotechnological product

Jo

FAD.

12

AUTHOR DECLARATION We wish to draw the attention of the Editor to the following facts which may be considered as potential conflicts of interest and to significant financial contributions to this work. [OR] We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. We confirm that the manuscript has been read and approved by all named authors and that there are no other persons who satisfied the criteria for authorship but are not listed. We further confirm that the order of authors listed in the manuscript has been approved by all of us.

ro

of

We confirm that we have given due consideration to the protection of intellectual property associated with this work and that there are no impediments to publication, including the timing of publication, with respect to intellectual property. In so doing we confirm that we have followed the regulations of our institutions concerning intellectual property.

re

-p

We understand that the Corresponding Author is the sole contact for the Editorial process (including Editorial Manager and direct communications with the office). She is responsible for communicating with the other authors about progress, submissions of revisions and final approval of proofs. We confirm that we have provided a current, correct email address which is accessible by the Corresponding Author.

Acknowledgments

lP

The authors would like to acknowledge IIT Madras and the Department of Biotechnology, GoI for

Jo

ur na

the facility and funding provided which were useful for conducting the present work.

13

References [1]

L. De Colibus, A. Mattevi, New frontiers in structural flavoenzymology, Curr. Opin.

Struct. Biol. 16 (2006) 722–728. doi:10.1016/j.sbi.2006.10.003. [2]

P. Gonzalez-Cabo, S. Ros, F. Palau, Flavin adenine dinucleotide rescues the phenotype of

frataxin deficiency, PLoS One. 5 (2010) 1–10. doi:10.1371/journal.pone.0008872. [3]

Y. Huang, S. Liu, C. Yen, P. Yang, C. Shieh, Thapsigargin and flavin adenine dinucleotide

ex vivo treatment rescues trafficking-defective gp91phox in chronic granulomatous disease

S. Shimizu, K. Yamane, Y. Tani, H. Yamada, Enzymatic synthesis of flavin adenine

ro

[4]

of

leukocytes, Free Radic. Biol. Med. 47 (2009) 932–940. doi:10.1016/j.freeradbiomed.2009.06.037.

dinucleotide, Appl. Biochem. Biotechnol. 8 (1983) 237–247. doi:10.1007/BF02778261. T. Hagihara, T. Fujio, K. Aisaka, Cloning of FAD synthetase gene from Corynebacterium

-p

[5]

ammoniagenes and its application to FAD and FMN production, Appl. Microbiol. Biotechnol. 42

[6]

re

(1995) 724–729. doi:10.1007/BF00171952.

C.A. Abbas, A.A. Sibirny, Genetic Control of Biosynthesis and Transport of Riboflavin

lP

and Flavin Nucleotides and Construction of Robust Biotechnological Producers, Microbiol. Mol. Biol. Rev. 75 (2011) 321–360. doi:10.1128/MMBR.00030-10. [7]

T. Kato, E.Y. Park, Riboflavin production by Ashbya gossypii, Biotechnol. Lett. 34 (2012)

[8]

ur na

611–618. doi:10.1007/s10529-011-0833-z.

T. Ozbas, T. Kutsal, Comparative study of riboflavin production from two microorganisms:

Eremothecium ashbyii and Ashbya gossypii, Enzyme Microb. Technol. 8 (1986) 593–596. doi:10.1016/0141-0229(86)90116-X.

M.C. Wright, P. Philippsen, Replicative transformation of the filamentous fungus Ashbya

Jo

[9]

gossypii with plasmids containing Saccharomyces cerevisiae ARS elements, Gene. 109 (1991) 99–105. doi:10.1016/0378-1119(91)90593-Z. [10]

J. Wendland, Y. Ayad-Durieux, P. Knechtle, C. Rebischung, P. Philippsen, PCR-based

gene targeting in the filamentous fungus Ashbya gossypii, Gene. 242 (2000) 381–391. doi:10.1016/S0378-1119(99)00509-0.

14

[11]

S. Brachat, F. Dietrich, S. Voegeli, T. Gaffney, P. Philippsen, The genome of the

filamentous fungus Ashbya gossypii: Annotation and evolutionary implications, Top. Curr. Genet. 15 (2006) 197–232. doi:10.1007/4735_114. [12]

R. Ledesma-Amaro, E.J. Kerkhoven, J.L. Revuelta, J. Nielsen, Genome scale metabolic

modeling of the riboflavin overproducer Ashbya gossypii, Biotechnol. Bioeng. 111 (2014) 1191– 1199. doi:10.1002/bit.25167. [13]

T.Q. Aguiar, R. Silva, L. Domingues, Ashbya gossypii beyond industrial riboflavin

of

production: A historical perspective and emerging biotechnological applications, Biotechnol. Adv.

[14]

J. Wendland, A. Walther, Ashbya gossypii: a model for fungal developmental biology, Nat.

-p

Rev. Microbiol. 3 (2005) 421–9. doi:10.1038/nrmicro1148. [15]

ro

33 (2015) 1774–1786. doi:10.1016/j.biotechadv.2015.10.001.

V.Y. Yatsyshyn, D. Fedorovych, A.A. Sibirny, Metabolic and bioprocess engineering of

835. doi:10.1007/s10295-014-1422-7.

Y. Hou, G.S. Hossain, J. Li, H.D. Shin, G. Du, J. Chen, L. Liu, Metabolic engineering of

lP

[16]

re

the yeast Candida famata for Watanabe production, J. Ind. Microbiol. Biotechnol. 41 (2014) 823–

cofactor flavin adenine dinucleotide (FAD) synthesis and regeneration in Escherichia coli for production of α-keto acids, Biotechnol. Bioeng. 114 (2017) 1928–1936. doi:10.1002/bit.26336. M. Mack, A. Van Loon, H.P. Hohmann, Regulation of riboflavin biosynthesis in Bacillus

ur na

[17]

subtilis is affected by the activity of the flavokinase/flavin adenine dinucleotide synthetase encoded by ribC, J. Bacteriol. 180 (1998) 950–955. doi:0021-9193/98/$04.0010. [18]

S. Kavitha, T.S. Chandra, Oxidative Stress Protection and Glutathione Metabolism in

Jo

Response to Hydrogen Peroxide and Menadione in Riboflavinogenic Fungus Ashbya gossypii, Appl Biochem Biotechnol. (2014). doi:10.1007/s12010-014-1188-4. [19]

L. Wasserstrom, K.B. Lengeler, A. Walther, J. Wendland, Molecular determinants of

sporulation in Ashbya gossypii, Genetics. 195 (2013) 87–99. doi:10.1534/genetics.113.151019. [20]

T. Koressaar, M. Remm, Enhancements and modifications of primer design program

Primer3, Bioinformatics. 23 (2007) 1289–1291. doi:10.1093/bioinformatics/btm091.

15

[21]

O. Lowry, N. Rosebrough, A. Farr, R. Randall, Protein measurement with the Folin phenol

reagent.,

J.

Biol.

Chem.

193

(1951)

265–275.

http://www.jbc.org/content/193/1/265.citation%0AAlerts: [22]

V.Y. Yatsyshyn, O.P. Ishchuk, A.Y. Voronovsky, D. Fedorovych, A.A. Sibirny,

Production of flavin mononucleotide by metabolically engineered yeast Candida famata, Metab. Eng. 11 (2009) 163–167. doi:10.1016/j.ymben.2009.01.004. [23]

M. Wu, B. Repetto, D.M. Glerum, A. Tzagoloff, Cloning and characterization of FAD1,

of

the structural gene for flavin adenine dinucleotide synthetase of Saccharomyces cerevisiae., Mol.

[24]

ro

Cell. Biol. 15 (1995) 264–71. doi:10.1128/mcb.15.1.264.

V.A. García-Angulo, Overlapping riboflavin supply pathways in bacteria, Crit. Rev.

[25]

-p

Microbiol. 43 (2017) 196–209. doi:10.1080/1040841X.2016.1192578.

V. Bafunno, T.A. Giancaspero, C. Brizio, D. Bufano, S. Passarella, E. Boles, M. Barile,

re

Riboflavin uptake and FAD synthesis in Saccharomyces cerevisiae mitochondria. Involvement of the flx1p carrier in fad export, J. Biol. Chem. 279 (2004) 95–102. doi:10.1074/jbc.M308230200. M.L. Pallotta, Evidence for the presence of a FAD pyrophosphatase and a FMN

lP

[26]

phosphohydrolase in yeast mitochondria: a possible role in flavin homeostasis, Yeast. 28 (2011) 693–705. doi:10.1002/yea.1897.

A. Tzagoloff, J. Jang, D.M. Glerum, M. Wu, FLX1 codes for a carrier protein involved in

ur na

[27]

maintaining a proper balance of flavin nucleotides in yeast mitochondria, J. Biol. Chem. 271 (1996) 7392–7397. doi:10.1074/jbc.271.13.7392. [28]

S. Sengupta, A. Kaufmann, T.S. Chandra, Live cell fluorescence imaging for early

Jo

expression and localization of RIB1 and RIB3 genes in Ashbya gossypii, J. Basic Microbiol. 54 (2014) 81–87. doi:10.1002/jobm.201200292. [29]

R. Ledesma-Amaro, C. Serrano-Amatriain, A. Jiménez, J.L. Revuelta, Metabolic

engineering of riboflavin production in Ashbya gossypii through pathway optimization, Microb. Cell Fact. 14 (2015) 163. doi:10.1186/s12934-015-0354-x. [30]

K. Tsukihara, K. Minoura, M. Izumiya, Studies on the industrial production of flavin-

adenine dinucleotide. I. Preparation of mycelium of Eremothecium ashbyii as a raw material 16

containing

flavin-adenine

dinucleotide.

J.

Vitaminol.

(Kyoto).

6

(1960)

68–76.

doi:https://doi.org/10.5925/jnsv1954.6.68. [31]

T. Watanabe, T. Uchida, J. Kato, I. Chibata, Production of flavine-adenine dinucleotide

Jo

ur na

lP

re

-p

ro

of

from riboflavine by a mutant of Sarcina lutea., Appl. Microbiol. 27 (1974) 531–536.

17

lP

re

-p

ro

of

Figures caption

ur na

Fig.1 Biosynthesis of flavins from precursor GTP (Guanosine-5'-triphosphate) and Ribu5p (Ribulose-5-phosphate).

DHBP = 3, 4-Dihydroxy-2-Butanone 4-Phosphate Synthase, ARP = 5-amino- 6-ribitylamino-

Jo

2,4(1H,3H)-pyrimidinedione, DRL = 6,7-dimethyl-8-ribityllumazine

18

of ro -p re lP ur na Jo

Fig.2 HPLC detection of flavins in WT A.gossypii strain and CSAgFMN1 clone. (a) Standard peaks of Riboflavin (20 µM), FMN (20 µM) and FAD (2 µM) (b) Detection of flavins

in WT A.gossypii at 120 h (c) Detection of flavins in CSAgFMN1 at 120 h

19

of ro -p

ur na

lP

re

Fig.3 Schematic representation of PRC synthesis and homologous recombination in A.gossypii.

Fig.4 Time course analysis of CSAgFMN1 clone compared to WT. (a) Riboflavin and FAD production (b) Biomass production and glucose utilization (p-value:

Jo

*<0.05, **<0.01, ***<0.001).

20

of

Fig.5 Time course analysis of normalized expression of FAD1, RIB3 and FMN1 in WT A.gossypii. (a) Bars represent expression of gene at different time of growth normalized against constitutively

ro

expressed TEF reference gene (n=3 and p-value: *<0.05) (b) Gel electrophoresis image of ethidium bromide stained DNA bands from one set of samples showing different intensities

ur na

lP

re

-p

indicative of level of expression. Each lane represents the hours of culture growth.

Jo

Fig.6 Expression of FMN1 gene in 72 h grown clones compared to WT A.gossypii strain.

21

of ro -p

Fig.7 Specific activity of riboflavin kinase and FAD synthetase enzymes in wild type A.gossypii

Jo

ur na

lP

re

strain and CSAgFMN1 clone. (p - value: ***<0.001)

22

Table 1 Primers used in the study Sequence (5’ to 3’)

Purpose

RIB3 Fr

AAGCCCATGCACTGATATCG

RIB3 Re

GCAAGACCGTGCTTCTTGC

TEF Fr

GCCATCTTGATCATTGCTG

TEF Re

TTGACTTCAGTGGTGACACC

FMN1 Fr

TCACTGAGTATGTGGACATTGTA

FMN1 Re

GTGGTGTAGTTTAATTCGGG

FAD1 Fr

AGATCACAGAGTCGTACTTACTCAT

FAD1 Re

AATACAGAAGGAAGCTCCATATATT

GPDp Fr

CTCTCCTCGCTCTGCTCAAG

GPDp Re

TGTGCGGTGTGTATGTGTGG

VarPG Fr

CTCTCCTCGCTCTGCTCAAG

VarPG Re

GCCGATTCATTAATGCAGGT

RKPRC Fr

gcttgaatccccacgtgcgtttagcggactgcaaacacccgtt

Semi quantitative expression

of

analysis of RIB3, FMN1 and FAD1 gene in WT

ro

Primer

lP

re

-p

AgGPD promoter cloning with pUUG6-tTA’ vector pUG6GPDp vector verification

ttaagtgTGGATACAACGTATGCAATGG aacggcagtttttccacttggctatatattacgtaagccgatata

ur na

RKPRC Re

AgFMN1 gene PRC synthesis

catgggtgatggtggtgatgatgCATTGTGCGGTG TGTATGTGTGG

GGGCTCTCCTTACGATCTCC

Verification of CSAgFMN1

VarGF Re

ATACTCCTGTGGCCATTTCG

clone

FMN1RT Fr

GTGGACATTGTAGCGGGATT

FMN1RT Re

GACCTCGCTCCCATCATTTC

Jo

VarGF Fr

FMN1 gene qPCR

23

Table 2 Comparison of FAD production by yeast and bacterial strains reported in literature.

Candida famata T-FD-FM 27

0.060-0.120 g L-1, Highest yield was 0.194 g L-1 with media and culture conditions optimization. 0.070 g L-1 – with metabolic engineering, 0.451 g L-1 with media optimization in 40 h 0.7 g L-1 in 120 h.

Corynebacterium ammoniagenes

0.73 g L-1 (1.6 mM) in 45 h

Escherichia coli, DH5α/pFK5A

18.5 g L-1 in 20h

First FAD overproducing recombinant strain. Expression of FMN1 and FAD1 from the strong constitutive promoter TEF1 to increase FAD synthetase activity. De novo synthesis. First published process of FAD production by mutant of Sarcina lutea defective in adenosine deaminase in medium supplemented with exogenously added FMN (70% w/w molar yield). 20-fold dereppression of bifunctional riboflavin kinase /FAD synthetase With exogenously added 3.2mM FMN & ATP (50% w/w molar yield). Heterologous overexpression of bifunctional riboflavin kinase/FAD synthetase. Medium supplemented with 12 g L-1 FMN and 24 g L-1 ATP (77% w/w molar yield).

Reference Present study

Tsukihara et. al., 1960 [30]

Yatsyshyn et. al., 2014 [15]

Watanabe et. al., 1974 [31]

Hagihara et. al., 1995 [5]

US patent No. US5514574A

Jo

ur na

lP

re

-p

Sarcina lutea

Remarks CSAgFMN1 recombinant with overexpression of FMN1 gene with GPD promoter in shake flask. De novo synthesis of FAD Closely related to A.gossypii. FAD stored in wildtype mycelia by De novo synthesis.

of

Eremothecium ashbyi

FAD production 0.087 g L-1 in 120 h with metabolic engineering

ro

Ashbya gossypii

24