Metabolic engineering of Clostridium carboxidivorans for enhanced ethanol and butanol production from syngas and glucose

Bioresource Technology 284 (2019) 415–423

Contents lists available at ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Metabolic engineering of Clostridium carboxidivorans for enhanced ethanol and butanol production from syngas and glucose

T

Chi Chenga,b, Weiming Lib,c, Meng Linb, Shang-Tian Yangb,

⁎

a

Department of Life Science and Biotechnology, Dalian University of Technology, Dalian 116024, China William G. Lowrie Department of Chemical & Biomolecular Engineering, The Ohio State University, 151 West Woodruff Ave, Columbus, OH 43210, USA c State Key Laboratory of Urban Water Resource and Environment, School of Environment, Harbin Institute of Technology, Harbin 150090, China b

GRAPHICAL ABSTRACT

ARTICLE INFO

ABSTRACT

Keywords: Aldehyde/alcohol dehydrogenase Aldehyde:ferredoxin oxidoreductase Clostridium carboxidivorans Ferredoxin-NAD+ reductase Syngas fermentation Metabolic engineering

Clostridium carboxidivorans can convert CO2, CO and H2 to ethanol and n-butanol; however, its industrial application is limited by the lack of tools for metabolic pathway engineering. In this study, C. carboxidivorans was successfully engineered to overexpress aor, adhE2, and fnr together with adhE2 or aor. In glucose fermentation, all engineered strains showed higher alcohol yields compared to the wild-type. Strains overexpressing aor showed CO2 re-assimilation during heterotrophic growth. In syngas fermentation, compared to the wild-type, the strain overexpressing adhE2 produced ∼50% more ethanol and the strain overexpressing adhE2 and fnr produced ∼18% more butanol and ∼22% more ethanol. Interestingly, both strains showed obvious acid re-assimilation, with < 0.15 g/L total acid remaining at the end of fermentation. Overexpressing fnr with adhE2 enhanced butanol production compared to only adhE2. This is the first report of overexpressing homologous and heterologous genes in C. carboxidivorans for enhancing alcohols production from syngas and glucose.

1. Introduction The global energy crisis has aroused enormous attention to the production of biofuels as renewable energy. Compared to other renewable energy sources such as solar energy and H2, liquid fuels, such as ethanol and butanol, are energy dense and compatible with current petroleum-based energy infrastructure (Lee et al., 2008; Zhao et al., 2013). The cost of bio-butanol and bio-ethanol production is relatively high compared to petrochemical production due to the high substrate cost of conventional feedstock (Lee et al., 2016; Wang et al., 2014). In recent years, biofuels production from syngas (CO2, CO, and H2) has

⁎

attracted more and more attention (Jones et al., 2016; Marcellin et al., 2016; Maru et al., 2018). Compared to conventional acetone-butanolethanol (ABE) fermentation by solventogenic Clostridium, ethanol and butanol production from syngas can utilize low-cost feedstocks, such as gasification products of municipal solid wastes and lignocellulosic biomass, and waste gases from coal-based power plants and steel mills (Liew et al., 2016). However, gas fermentation usually suffers from low productivity due to low solubility of H2 and CO in water and poor cell growth on gaseous substrates (Klasson et al., 1993). Furthermore, the majority of the carboxydotrophs are acetogens producing mainly acetic acid with little alcohols, although there have been numerous attempts

Corresponding author. E-mail address: [email protected] (S.-T. Yang).

https://doi.org/10.1016/j.biortech.2019.03.145 Received 31 January 2019; Received in revised form 28 March 2019; Accepted 29 March 2019 Available online 30 March 2019 0960-8524/ © 2019 Elsevier Ltd. All rights reserved.

Bioresource Technology 284 (2019) 415–423

C. Cheng, et al.

to engineer acetogens for alcohol and solvent production (Charubin et al., 2018; Köpke et al., 2010; Liew et al., 2016). Clostridium carboxidivorans is one of a few microorganisms that can produce n-butanol and ethanol autotrophically from syngas. However, only small amounts of ethanol and butanol were produced in fermentation even after optimization in medium composition (Phillips et al., 2015; Shen et al., 2017; Zhang et al., 2016), pH (Fernández-Naveira et al., 2016), temperature (Ramió-Pujol et al., 2015), and bioreactor design (Shen et al., 2014). Although the full genome sequence is available for C. carboxidivorans P7 (Li et al., 2015), to date no metabolic engineering studies for enhancing ethanol and butanol production by C. carboxidivorans have been reported due to the lack of well-established metabolic engineering tools for this clostridia (Charubin et al., 2018), which hampers its industrial applications. There exist two alcohol production routes in acetogens: one is the direct, aldehyde dehydrogenase (ALD) and alcohol dehydrogenase (ADH) based route, in which acetyl-CoA is converted to acetaldehyde and then to ethanol; the other is the indirect route of alcohol production via the reduction of corresponding acid to aldehyde with aldehyde:ferredoxin oxidoreductase (AOR) and then to alcohol by ADH (Liew et al., 2017). ALD and ADH are well known for their significant roles in ethanol and butanol production by solventogenic and acetogenic clostridia (Ou et al., 2015; Ukpong et al., 2012). A bifunctional aldehyde/ alcohol dehydrogenase encoded by adhE2 has been cloned from Clostridium acetobutylicum and overexpressed in several acidogenic clostridia, including Clostridium tyrobutyricum and cellulovorans, for n-butanol production from sugars and cellulose (Du et al., 2015; Yang et al., 2015a,b; Yu et al., 2011, 2015; Zhang et al., 2017a). AOR plays an important role in ATP generation under energy-limited conditions in acetogens (Mock et al., 2015), but its potential role in alcohol production is ill-understood. In solventogenic clostridia, ferredoxin-NAD+ reductase (FNR), which catalyzes the electron transfer from reduced ferredoxin (FdH2) to NAD+, plays an important role in balancing redox and alcohol biosynthesis (Girbal and Soucaille, 1994). Therefore, it is hypothesized that overexpressing these genes in C. carboxidivorans may greatly increase its alcohol production by directing carbon flux from acids toward ethanol and butanol biosynthesis. In this study, C. carboxidivorans was successfully transformed with clostridial shuttle plasmid pMTL82151 to overexpress a homologous AOR gene (aor), heterologous adhE2 and FNR gene (fnr) from C. acetobutylicum and evaluated their effects on alcohol production. Recombinant strains overexpressing aor or adhE2 showed increased alcohol production in glucose fermentation. Meanwhile, the strains overexpressing adhE2 showed enhanced acid re-assimilation in syngas fermentation. This is the first metabolic engineering study of C. carboxidivorans demonstrating the potential of increasing alcohol production by overexpressing homologous and heterologous genes in two different pathways.

coli strains were grown and maintained aerobically at 37 °C in LuriaBertani (LB) medium or LB agar plates. E. coli strains were maintained in media supplemented with 35 µg/ml chloramphenicol and/or 40 µg/ ml kanamycin. 2.2. Plasmids construction and transformation Plasmids pMTL82151-aor, pMTL82151-aor-fnr, and pMTL82151adhE2-fnr were constructed from pMTL82151-adhE2 (Yu et al., 2011). The aor (Ccar_RS12720) gene was amplified from C. carboxidivorans genomic DNA, while adhE2 (CA_P0035) and fnr (CA_C0764) genes were amplified from C. acetobutylicum ATCC 824 genomic DNA by PCR with primers listed in Table 1. Plasmid 82151-adhE2 was digested with restriction endonuclease SacII and BamHI to get a linearized vector. Corresponding genes were ligated to the linearized vector to construct 82151-aor, 82151-aor-fnr, and 82151-adhE2-fnr using In-fusion HD cloning kit (Clontech, Mountain View, CA). Cells were transformed with plasmids via conjugation following the procedures described previously (Williams et al., 1990; Yu et al., 2011). Positive transformants were confirmed by extracting plasmids from cells and analyzing for their sizes by gel electrophoresis. The transformants carrying plasmid pMTL82151-aor, pMTL82151-adhE2, pMTL82151-aor-fnr, and pMTL82151-adhE2-fnr were named as Cc (aor), Cc(adhE2), Cc(aor-fnr), and Cc(adhE2-fnr), respectively. 2.3. Enzyme activity assays C. carboxidivorans wild-type and transformants cells (10 mL each) grown under 100% CO (1 atm) for 2 days were collected and used for enzyme activity assays. Ethanol dehydrogenase and butanol dehydrogenase activities were assayed by monitoring NADH consumption at 365 nm, following the procedures described previously (Yang et al., 2015a). One unit of dehydrogenase activity is defined as the amount of enzyme converting 1 μmol NADH per minute. 2.4. RT-PCR analysis of gene expression RNAs were extracted from cells (1 mL) grown under 100% CO (1 atm) for 2 days and purified using an RNeasy Mini Kit (Qiagen, cat. no. 74104). Purified RNAs were then used for RT-PCR with the primers shown in Table 1. Finally, gel electrophoresis of the RT-PCR products was used to confirm the expression of aor, adhE2, and fnr in C. carboxidivorans. Details of these procedures can be found elsewhere (Zhang et al., 2017b). 2.5. Fermentation kinetics studies Batch fermentations were carried out in 160-mL serum bottles each containing 50 mL medium with samples withdrawn at regular intervals. Glucose fermentation was carried out with 10 g/L glucose as substrate, and pH was manually adjusted to 5.75 after taking each sample. Syngas fermentation was carried out in serum bottles filled with the gas mixture (20% CO2, 40% CO, and 40% H2 at 1 atm) and purged every two days. After inoculation at 5% (v/v), the serum bottle cultures were incubated at 37 °C with shaking at ∼150 rpm. Unless otherwise noted, all seed cultures were prepared and maintained under autotrophic growth conditions in a sugar-free medium containing 5 μg/ml thiamphenicol and a headspace gas of 100% CO at 1 atm.

2. Materials and methods 2.1. Bacterial strains, plasmids and culture media All bacterial strains, plasmids, and PCR primers used in this study are listed in Table 1. C. carboxidivorans P7 (DSM 15243) was obtained from German Collection of Microorganisms and Cell Cultures (DSMZ). C. acetobutylicum ATCC 824 was used to amplify adhE2 (CA_P0035) and fnr (CA_C0764) genes from its genome. E. coli DH5a (Invitrogen, Carlsbad, CA) was used as the host for plasmid amplification. E. coli CA434 (Williams et al., 1990; Yu et al., 2012) was used as the donor cell in conjugation. C. carboxidivorans wild-type and engineered strains were cultured in a modified ATCC 1754 medium (PETC medium) at 37 °C with 5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) as the buffer instead of NaHCO3. All engineered strains were maintained in medium with 15 μg/ml thiamphenicol (for heterotrophic growth condition) or 5 μg/ml thiamphenicol (for autotrophic growth condition). E.

2.6. Analytical methods Cell density (optical density at 600 nm) was monitored with a spectrophotometer (UV-16–1, Shimadzu, Columbia, MD). Alcohols (mainly ethanol and butanol) and acids (mainly acetic and butyric acids) were analyzed with either a gas chromatograph (GC-2014 Shimadzu, Columbia, MD) or a high-performance liquid chromatograph 416

Bioresource Technology 284 (2019) 415–423

C. Cheng, et al.

Table 1 Strains, plasmids and primers used in this study. Relevant Characteristics

Reference/Source

Bacterial strains E. coli DH5ɑ E. coli CA434 Clostridium carboxidivorans Cc(aor) Cc(adhE2) Cc(aor-fnr) Cc(adhE2-fnr)

Host cells for plasmids amplification Donor cells for conjugative transfer of plasmids Carboxydotroph, autotrophic growth on CO, CO2 and H2 DSMZ 15243 with 82151-aor DSMZ 15,243 with 82151-adhE2 DSMZ 15,243 with 82151-aor-fnr DSMZ 15,243 with 82151-adhE2-fnr

Clonetech Williams et al. (1990) DSMZ 15243 This work This work This work This work

Plasmids pMTL82151-adhE2 pMTL 82151-aor pMTL 82151-adhE2-fnr pMTL 82151-aor-fnr

ColE1 ori; Cmr ; pBP1 ori, From pMTL 82151-adhE2; From pMTL 82151-adhE2; From pMTL 82151-adhE2;

Yu et al. (2011) This work This work This work

PCR primers aor For aor Rev aorfnr For aorfnr Rev adhE2 For adhE2 Rev

ATTTAAATTTGGATCCGGATCCATAAATATTTAGGAGGATGTACGGATATAATGG ATATAAATTTAGATTTTTCCAATATACTCTTCTAATCCAAGCT AATCTAAATTTATATGAGGAGGAATTTCAATGGATAACCC GAAACAGCTATGACCGCGGGCTAGCGCCATTCGC TTTGCTTCATTATCCATTTATATGAGGAGGAATTTCAATGGATAACC GAAACAGCTATGACCGCGGGCTAGCGCCATTCGC

RT-PCR primers RT-aor-For RT-aor-Rev RT-adhE2-For RT-adhE2-Rev RT-fnr-For RT-fnr-Rev

GGACGTAGAGAAGGATTTGGAGAC CTGGAACTGGTTCCTCAAGC TGGTGGATCGCCAATGGATG ACCGGTACCAGCAGTTGTAG CAGAAGAGGCAAACAGATGCC TGCTGGACCTCCTCCAACTA

TraJ; P-thl adhE2 Pthl-aor Pthl-adhE2-fnr Pthl-aor-fnr

(HPLC) with an organic acid analysis column (Rezex ROA-Organic Acid H+, Phenomenex, Torrance, CA) as described elsewhere (Yang et al., 2015b; Zhang et al., 2017a). 3. Results and discussion 3.1. Overexpression of aor, adhE2, and fnr in C. carboxidivorans Restriction-modification systems are the most important factor in influencing the transformation efficiency in clostridia (Pyne et al., 2014; Roberts et al., 2015). Based on genome sequence analysis, C. carboxidivorans contains type I, II, III, and IV restriction modification (RM) systems; however, their specificities have not been characterized. Despite extensive attempts, no transformants were obtained by electroporation, regardless of the conditions used (data not shown). Since most RM systems only recognize unmethylated double-stranded DNA, conjugation, which delivers plasmids as single-stranded DNAs, may provide a better way to bypass RM systems. After optimizing conjugation conditions, positive transformants of C. carboxidivorans were obtained and confirmed by extracting plasmids from cells and analyzing their sizes by gel electrophoresis. Reverse transcriptional analysis was performed using One-Step RTPCR to analyze the presence of messenger RNAs (mRNAs) for aor, adhE2, and fnr in the transformants. Gel electrophoresis images confirmed aor expression in C. carboxidivorans wild-type, Cc(aor), and Cc (aor-fnr). As expected, the mRNAs for adhE2 and fnr were undetectable in the total RNA of C. carboxidivorans wild-type, whereas the mRNA for adhE2 was detected in both Cc(adhE2) and Cc(adhE2-fnr), and the mRNA for fnr was detected in Cc(aor-fnr) and Cc(adhE2-fnr). These results confirmed that aor, adhE2, and fnr in the recombinant plasmids were transcribed in their corresponding transformants. Ethanol and butanol dehydrogenase activities in cells were assayed to confirm the functional expression of adhE2 in C. carboxidivorans. As shown in Fig. 1, compared to the wild-type, Cc(adhE2) and Cc(adhE2fnr) showed significantly higher specific alcohol dehydrogenase activities. Cc(adhE2) showed ethanol dehydrogenase and butanol

Fig. 1. Specific enzyme activities of adhE2 in C. carboxidivorans wild-type and recombinant strains overexpressing adhE2. Each assay was carried out in triplicates with mean and standard deviation reported.

dehydrogenase activity of 0.15 U/mg and 0.24 U/mg, respectively, and Cc(adhE2-fnr) gave 0.10 U/mg and 0.16 U/mg, respectively, compared to 0.08 U/mg and 0.12 U/mg for the wild-type. These results indicated that the heterologous adhE2 gene from C. acetobutylicum was functionally expressed in C. carboxidivorans. The AOR activity can be assayed by measuring the absorbance changes of aldehyde-dependent reduction of methyl viologen or benzyl viologen (Mukund and Adams, 1991). The FNR activity may be assayed by monitoring the formation of NADH from NAD+ due to the electron transfer from the reduced ferredoxin (FdH2) in the presence of CO and CO dehydrogenase (Mock et al., 2015). However, these assay methods would depend on or be affected by other enzymes such as CO dehydrogenase for FNR assay and aldehyde dehydrogenase for AOR. FNR assay may also be interfered by the activity of enzymes in the ferredoxin-NAD+ oxidoreductase (Rnf) complex. Although AOR and FNR activities in the cells were not measured in this study, functional 417

Bioresource Technology 284 (2019) 415–423

C. carboxidivorans wild-type

12

12

1.5

4

1.0

Glucose(g/L)

6

2.0

8

6

0.5

2

0

0.0

0

90 Time (h)

120

150

C. carboxidivorans Cc(adhE2)

12

Glucose Ethanol Butanol

10

Acetic acid Butyric acid

14

3.5

12

3.0 2.5

8

2.0

6

1.5

4

1.0

2

0.5

0

0.0

0

30

C 14

60 90 Time (h)

120

150

Glucose Ethanol Butanol

10

1.0

0.5 0

30

60

90 Time (h)

120

150

0.0

4.0

C. carboxidivorans Cc(aor-fnr)

3.5 3.0

10

Glucose Ethanol Butanol

8 6

2.5

Acetic acid Butyric acid

2.0 1.5

4

1.0

2 0

D

0.5 0

30

60

90 Time (h)

120

150

0.0

3.5

Acetic acid Butyric acid

3.0 2.5

8

2.0

6

1.5

4

1.0

2

0

2.0

4.0

C. carboxidivorans Cc(adhE2-fnr)

12

2.5

1.5

B 4.0

Glucose (g/L)

14

60

Products (g/L)

30

3.0

4

2

0

3.5

Glucose Acetic acid Ethanol Butyric acid Butanol

10

Products (g/L)

8

2.5

Acetic acid Butyric acid

4.0

C. carboxidivorans Cc(aor)

Products (g/L)

Glucose (g/L)

Glucose Ethanol Butanol

A

Glucose (g/L)

14

3.5 3.0

10

Glucose (g/L)

4.0

Products (g/L)

14

Products (g/L)

C. Cheng, et al.

0.5

0

30

E

60 90 Time (h)

120

150

0.0

Fig. 2. Fermentation kinetics of glucose at ∼pH 5.75 in serum bottles by various strains of C. carboxidivorans. (A) wild-type; (B) Cc(aor); (C) Cc(adhE2); (D) Cc(aorfnr); (E) Cc(adhE2-fnr). All fermentation conditions were studied in duplicate and the mean and standard deviation are reported.

expressions of AOR in Cc(aor) and Cc(aor-fnr) and FNR in Cc(aor-fnr) and Cc(adhE2-fnr) could be expected from the RT-PCR results and different phenotypes observed in the fermentation kinetics studies discussed below.

Clostridium acetobutylicum and C. beijerinckii (Wang et al., 2014; Zhao et al., 2013). It should also be noted that more C2 metabolites (acetate and ethanol) and less C4 metabolites (butyrate and butanol) were produced from glucose in the fermentations by C. carboxidivorans. Consequently, a relatively low C4/C2 mass ratio of 0.41–0.49 (g/g) was observed for all strains as compared to 2–5 (g/g) typically observed with solventogenic Clostridium such as C. acetobutylicum and C. beijerinckii (Jang et al., 2012). Moreover, the early termination and lack of alcohols production in the later stage of glucose fermentation and carboxydotrophic phase was most likely due to a lack of reducing equivalent or NADH, instead of down-regulation of alcohol dehydrogenase, since adhE2 was over-expressed in Cc(adhE2) and Cc (adhE2-fnr).

3.2. Fermentation kinetics with glucose Fermentation kinetics with glucose as the carbon source by C. carboxidivorans wild-type and recombinant strains are shown in Fig. 2. In all fermentations, alcohols production started from the beginning and soon leveled off before glucose was depleted while acids production continued even after all glucose had been depleted, which could be attributed to the fixation of CO2 and H2 released in the glycolysis via the Wood-Ljungdahl pathway (Bao et al., 2018; Jones et al., 2016). Consequently, throughout the batch fermentation the alcohols/acids mass ratio decreased continuously from 0.52 (g/g) at the beginning to 0.19 (g/g) for the wild type. Similarly, all mutant strains also showed a continuous decrease in the alcohols/acids mass ratio, from the initial 0.55–0.62 (g/g) to the final 0.23–0.32 (g/g), which were significantly higher than those with the wild type. The much higher alcohols/acids ratio of 0.32 (vs. 0.19 for the wild type) observed with Cc(adhE2-fnr) could be attributed to the overexpressions of adhE2 and fnr. Clearly, alcohols production from glucose by C. carboxidivorans is not characterized by a distinct solventogenic phase (Fernández-Naveira et al., 2017b) as commonly observed with solventogenic clostridia such as

3.2.1. Effects of overexpressing aor and adhE2 In general, the recombinant strains grew slower at a specific growth rate of 0.044 ± 0.04 h−1 (vs. 0.072 ± 0.06 h-1 for the wild-type) due to the additional metabolic burden caused by the addition of antibiotic in the medium. However, as can be seen from the final product concentrations, the effects of over-expressing adhE2 or aor on the fermentation were significant, especially on ethanol production, which increased by 31% to 70% compared to the wild type. Since the initial glucose concentration varied in these batch fermentations, product yields (instead of final product concentrations) are presented in Table 2 for comparison. Ethanol production (both yield and final titer) and 418

Bioresource Technology 284 (2019) 415–423

C. Cheng, et al.

Table 2 Comparison of product yields from glucose by C. carboxidivorans wild-type and recombinant strains in batch fermentation in serum bottles at ∼pH 5.75. Strain

Acetate (g/g)

Ethanol (g/g)

Butyrate (g/g)

Butanol (g/g)

Total alcohols (g/g)

Total acids (g/g)

Alcohols/Acids (g/g)

C4/C2 (g/g)

C recovery (%)

Wild-type Cc(aor) Cc(adhE2) Cc(aor-fnr) Cc(adhE2-fnr)

0.27 0.32 0.24 0.30 0.25

0.06 0.11 0.08 0.09 0.10

0.13 0.16 0.14 0.16 0.14

0.019 0.022 0.016 0.019 0.021

0.08 0.13 0.10 0.11 0.12

0.40 0.48 0.38 0.46 0.39

0.19 0.27 0.26 0.23 0.32

0.47 0.41 0.49 0.48 0.46

53.6 75.3 57.9 66.6 64.4

± ± ± ± ±

0.02 0.03 0.01 0.02 0.01

± ± ± ± ±

0.01 0.02 0.01 0.00 0.00

± ± ± ± ±

0.01 0.01 0.01 0.01 0.00

± ± ± ± ±

0.001 0.004 0.001 0.002 0.000

± ± ± ± ±

0.01 0.02 0.01 0.00 0.00

± ± ± ± ±

0.03 0.04 0.02 0.03 0.01

Data are from duplicate batch fermentation runs with mean and standard deviation reported.

alcohols/acids ratio were significantly higher for all engineered strains compared to the wild-type. On the other hand, the effects on butanol and butyrate (yield and final titer) were relatively small or negligible. The fact that the C4/C2 ratio among these strains remained relatively unchanged at 0.41 to 0.49 (g/g) suggested that the carbon flux from acetyl-CoA to butyryl-CoA was limiting butyrate and butanol biosynthesis. Moreover, the carbon flux and final product profiles were also affected by the reducing equivalent or available NADH. All recombinant strains showed a higher total alcohol yield compared to the wild-type (see Table 2), indicating that overexpressing either aor or adhE2 could increase alcohol production in glucose fermentation. In C. carboxidivorans and some other acetogens, ethanol and butanol can be produced from corresponding acyl-CoA via two different routes: a direct route with ALD and ADH and an indirect route with AOR and ADH (Liew et al., 2017). The indirect pathway with AOR was suggested to be the main route for autotrophic ethanol and butanol production in acetogens such as C. ljungdahlii and C. autoethanogenum, while the direct route with aldehyde and alcohol dehydrogenases was dominant for heterotrophic conditions (Liew et al., 2017; Marcellin et al., 2016; Mock et al., 2015). Therefore, overexpressing either aor or adhE2 increased total alcohols, mainly ethanol, production from glucose. Interestingly, the total product yield from glucose in the fermentations by Cc(aor) and Cc(aor-fnr) was significantly higher than those from the wild type, Cc(adhE2), and Cc(adhE2-fnr) (Fig. 3). In addition, for Cc(aor), > 75% of the carbon in glucose was recovered in the products acetate, butyrate, ethanol and butanol (see Table 2). In glycolysis, only 2/3 of the carbon in glucose is converted to pyruvate while 1/3 of carbon is released as CO2. It is clear that some CO2 released during heterotrophic growth on glucose were re-assimilated via the WoodLjungdahl pathway, resulting in a higher carbon efficiency, which might have also been enhanced by overexpressing aor. Further examination of CO2-assimilation behavior during heterotrophic growth of C. carboxidivorans requires a thorough metabolic flux analysis including all metabolic products including succinic acid, formic acid, hexanoic acid, and hexanol which might have also been produced (Fernández-

0.7

Acetic acid

Butyric Acid

Ethanol

Naveira et al., 2017a) but were not monitored in the present study. 3.2.2. Effects of overexpressing fnr The co-expression of fnr with aor or adhE2 showed opposite effects on alcohol production from glucose. AOR utilizes FdH2 as a cofactor, while the bifunctional aldehyde/alcohol dehydrogenase from C. acetobutylicum utilizes NADH. FNR catalyzes the electron transfer from one FdH2 to one NAD+, yielding one oxidized ferredoxin (Fd) and one NADH. Overexpression of fnr increased NADH availability, and therefore, simultaneous overexpression of fnr and adhE2 led to significantly increased ethanol and butanol production compared to only overexpressing adhE2. On the contrary, Cc(aor-fnr) produced significantly less alcohols compared to Cc(aor) because less FdH2 in Cc(aor-fnr) would be available for the reduction of acids to corresponding aldehydes by AOR. 3.3. Fermentation kinetics with syngas The autotrophic fermentation kinetics of C. carboxidivorans wildtype and mutant strains with syngas (20% CO2, 40% CO and 20% H2, 1 atm) as the substrate are shown in Fig. 4 with the final product titers summarized in Table 3. Unlike the growth on glucose, all five strains produced ethanol and acetate as the main products until around Day 5 when acetate production leveled off while ethanol production continued, but no butanol or butyrate production was detected until after day 6. Interestingly, acetate and butyrate produced in syngas fermentations by Cc(adhE2) and Cc(adhE2-fnr) were re-assimilated to ethanol and butanol, respectively. Consequently, almost no acid was detected at the end of the fermentation. This obvious acid re-assimilation phenomenon was not observed in glucose fermentation nor with the wildtype, Cc(aor), and Cc(aor-fnr). Fig. 5 compares the product profiles in syngas fermentations with various C. carboxidivorans strains. Among the five strains, Cc(adhE2-fnr) produced the most butanol (0.351 ± 0.010 g/L), ∼18% higher than the wild-type; and Cc(adhE2) produced the most ethanol (3.00 ± 0.061 g/L), ∼50% higher than the wild-type. 3.3.1. Effects of overexpressing aor and adhE2 As discussed earlier, AOR provides an important pathway for acetogens to produce ethanol and butanol while generating ATP. Although overexpressing aor significantly increased alcohols production from glucose, there was no significant change in ethanol or butanol production from syngas by Cc(aor) compared to the wild-type (see Table 3). One possible explanation was that the strictly regulated aor was already highly expressed under autotrophic growth and thus overexpressing the homologous aor would not significantly increase aor expression or its catalyzed reaction, which might be limited by the available FdH2. Both Cc(adhE2) and Cc(adhE2-fnr) produced significantly more ethanol than the wild-type and showed high acid re-assimilation activities reducing the final total acids to less than 0.15 g/L with a much higher alcohols/acids ratio of > 20 (see Table 3), compared to 2.6–3.0 for the other three strains. The adhE2 gene encodes a bifunctional aldehyde/alcohol dehydrogenase catalyzing the conversion of acetyl-CoA to ethanol, so adhE2 alone cannot facilitate the acid re-assimilation in

Butanol

0.6

Yield (g/g)

0.5 0.4 0.3 0.2

0.1 0.0

wild-type

Cc(aor)

Cc(adhE2)

Cc(aor-fnr)

Cc(adhE2-fnr)

Fig. 3. Comparison of product yields from glucose by various C. carboxidivorans strains in batch fermentations. Yields were calculated from the time-course data shown in Fig. 2. 419

Bioresource Technology 284 (2019) 415–423

C. Cheng, et al.

Fig. 4. Fermentation kinetics of syngas (CO2/CO/H2 [20:40:40] 1 atm) in serum bottles by various strains of C. carboxidivorans. (A) wild-type; (B) Cc(aor); (C) Cc (adhE2); (D) Cc(aor-fnr); (E) Cc(adhE2-fnr). All fermentation conditions were studied in duplicate and the mean and standard deviation are reported.

Table 3 Comparison of product titer by C. carboxidivorans wild-type and recombinant strains from syngas (CO2/CO/H2 [20:40:40], 1 atm). Strain

Acetate (g/L)

Ethanol (g/L)

Butyrate (g/L)

Butanol (g/L)

Total alcohols (g/g)

Total acids (g/g)

Alcohols/Acids (g/g)

C4/C2 (g/g)

Wild-type Cc(aor) Cc(adhE2) Cc(aor-fnr) Cc(adhE2-fnr)

0.70 0.87 0.05 0.60 0.05

2.00 2.38 3.00 1.62 2.44

0.05 0.07 0.11 0.05 0

0.30 0.20 0.27 0.06 0.35

2.30 ± 0.05 2.58 ± 0.16 3.27 ± 0.08 1.68 ± 0.09 2.79 ± 0.09

0.76 0.93 0.16 0.65 0.05

3.04 2.76 20.84 2.57 51.69

0.13 0.08 0.13 0.05 0.14

± ± ± ± ±

0.11 0.09 0.01 0.04 0.01

± ± ± ± ±

0.01 0.13 0.06 0.06 0.08

± ± ± ±

0.02 0.00 0.00 0.01

± ± ± ± ±

0.04 0.03 0.02 0.03 0.01

Bold values indicate significant difference from the wild-type.

420

± ± ± ± ±

0.13 0.09 0.01 0.05 0.01

Bioresource Technology 284 (2019) 415–423

C. Cheng, et al. 4.0 3.5

Acetic acid

Butyric Acid

Ethanol

(Köpke et al., 2010), and A. woodii (Hoffmeister et al., 2016), have been metabolically engineered to produce ethanol or acetone (Humphreys and Minton, 2018). However, no metabolic engineering study has been reported for C. carboxidivorans, although its complete genome sequence has also been reported (Bruant et al., 2010; Paul et al., 2010; Li et al., 2015). The anaerobic, non-photosynthetic (ANP) mixotrophy, in which CO2 evolved in glycolysis is re-assimilated via the Wood-Ljungdahl pathway, has been widely reported for a number of acetogens including A. woodii, C. aceticum, C. formicoaceticum, C. ljungdahlii, C. autoethanogenum, and C. scatologenes (Fast et al., 2015; Jones et al., 2016; Maru et al., 2018; Yang et al., 1987). In limited ANP mixotrophy, CO2 and H2 evolved during glycolysis are re-assimilated via the WoodLjungdahl pathway, and the yield of acetate and butyrate can increase up to 51% and 22%, respectively, but due to the limitation of reducing power, the enhancement of alcohol yield is marginal (∼2%) (Fast et al., 2015). With H2- or syngas-enhanced ANP mixotrophy, the necessary reducing equivalents can be provided by H2 or CO to fix CO2 and produce reducing products such as ethanol and butanol (Jones et al., 2016). The results from this study implied that C. carboxidivorans also has the potential for ANP mixotrophy with a high carbon efficiency and potentially high alcohol yield with H2- or syngas-enhanced ANP mixotrophy. Several studies have suggested that AOR is the main route of ethanol and butanol production in autotrophic fermentation of acetogens. A thermophilic archaeon with aor and heterologous alcohol dehydrogenase (adh) genes were able to produce ethanol from glucose, and convert exogenous carboxylic acids to their corresponding alcohols (Basen et al., 2014). It was suggested that the net ATP production in ethanol biosynthesis via the AOR/ADH pathway would be higher than via the ALD/ADH pathway in C. autoethanogenum (Mock et al., 2015). Another study showed that aor was amongst the most up-regulated genes under autotrophic growth conditions compared to heterotrophic growth conditions in C. autoethanogenum (Marcellin et al., 2016). Liew et al. (2017) found that in C. autoethanogenum, double knock-outs of aor1 and aor2 resulted in a strain unable to convert exogenously added acetate and butyrate to ethanol and butanol, indicating that the AOR/ ADH pathway is crucial for alcohol production in C. autoethanogenum. It is clear that AOR provides an important pathway for acetogens to produce ethanol and butanol autotrophically while generating ATP. However, overexpressing aor in autotrophically growing acetogens has never been reported before. C. carboxidivorans has been attractive for its ability to produce nbutanol from syngas. Several process studies on alcohol production from syngas by C. carboxidivorans have been reported (FernándezNaveira et al., 2016; Phillips et al., 2015; Ramió-Pujol et al., 2015; Shen et al., 2017). It is difficult to compare alcohol titers due to the different conditions, especially syngas composition and pressure, used in these studies. In general, a high CO content favors alcohol production. Gas pressure also plays a significant role due to the low solubility of CO and H2. The highest alcohol production (5.55 g/L ethanol and 2.66 g/L butanol) was obtained with CO at a partial pressure of > 100 kPa in a bioreactor with pH controlled at 5.75 and 33 °C (Fernández-Naveira et al., 2016). H2 and CO both can provide reducing power for autotrophic and mixotrophic fermentation of acetogens, CO provides more ATP and reducing power than H2. The key enzymes for ATP generation under autotrophic condition are Rnf complexes, which couple the oxidation of FdH2 with the translocation of ions across membrane, and the ion gradient is used by ATPase to generate ATP. Acetogens use electron bifurcation to produce FdH2 from H2, thus, H2 generates less FdH2 and ATP compared to the same mole of CO (Schuchmann and Muller, 2014). With more FdH2, higher cell growth rate and higher alcohol production can be achieved with CO as substrate as compared to CO2/ H2. It has also been reported that the growth rate of C. carboxidivorans in 80% CO, 6% CO2 (0.16 h−1) was higher than that in 80% H2, 20% CO2 (0.12 h−1) at 230 kPa because of the higher ATP yield (Liou et al.,

Butanol

Product Titer (g/L)

3.0 2.5 2.0

1.5 1.0

0.5 0.0

wild-type

Cc(aor)

Cc(adhE2)

Cc(aor-fnr) Cc(adhE2-fnr)

Fig. 5. Comparison of products from syngas fermentations by various C. carboxidivorans strains. Data are the final product concentrations from batch fermentations shown in Fig. 4.

these strains, as in glucose fermentation in which aor was not upregulated. The alcohol dehydrogenase activities of autotrophically grown cells (under CO, 1 atm) were significantly higher in Cc(adhE2) and Cc(adhE2-fnr) compared to the wild-type: ∼90% and ∼30% increase in ethanol dehydrogenase and ∼100% and ∼40% increase in butanol dehydrogenase, respectively (see Fig. 1). These results indicated that the overexpression of adhE2 strengthened the aldehyde to alcohol reaction. Marcellin et al. (2016) also found that during autotrophic growth, although genes encoding ALD were significantly downregulated, aor and one adh were highly up-regulated. Apparently, the strengthened AOR/ADH pathway in the strains overexpressing adhE2 enhanced their acid re-assimilation ability and thus more alcohols were produced from syngas by them. 3.3.2. Effects of overexpressing fnr As mentioned earlier, FNR catalyzes the electron transfer from FdH2 to NAD+. Overexpressing fnr with aor resulted in the depletion of FdH2 needed by AOR, thus resulting in significantly lower amounts of ethanol and butanol produced in syngas fermentation. In contrast, Cc(adhE2fnr) produced slightly more butanol but less ethanol compared to Cc (adhE2). Overall, it produced less total alcohols compared to Cc (adhE2). Apparently, the effect from increased NADH for ALD was compromised or negated by the reduced FdH2 required by AOR. In some acetogens, such as A. woodii, C. formicoaceticum, and C. autoethanogenum, the ferredoxin-NAD+ oxidoreductase (Rnf) complex can transfer the electrons from one FdH2 to one NAD+ while translocating two H+ or Na+ across cytoplasmic membrane, creating an ion gradient for ATP generation (Bao et al., 2018; Schuchmann and Muller, 2014). The FNR enzyme catalyzes electron transfer from FdH2 to NAD+ without creating transmembrane ion gradient for ATP generation. Therefore, Cc(adhE2-fnr) generated less ATP and produced a lower amount of total alcohols compared to Cc(adhE2). 3.4. Comparison to other studies Many acetogens, including Acetobacterium woodii (Bertsch and Mueller, 2015), Clostridium aceticum (Poehlein et al., 2015), Clostridium formicoaceticum (Bao et al., 2018), Clostridium autoethanogenum (Abrini et al., 1994), Clostridium ljungdahlii (Younesi et al., 2005), and C. carboxidivorans (Liou et al., 2005), can convert or fix CO2 with H2 or CO as the energy source and electron donor to acetyl-CoA via the WoodLjungdahl pathway. The anaerobic, non-photosynthetic (ANP) mixotrophic acetogens concurrently utilizing sugars and gases (CO2 and H2) for acids (mainly acetate) and/or alcohols (mainly ethanol) production present a great potential for industrial production of biofuels and chemicals (Jones et al., 2016). To date, several mixotrophic acetogens with sequenced genomes, including C. autoethanogenum, C. ljungdahlii 421

Bioresource Technology 284 (2019) 415–423

C. Cheng, et al.

Fig. 6. Metabolic pathways and key enzymes involved in C. carboxidivorans. (ACK: acetate kinase; ACS: acetyl-CoA synthase; ADH: alcohol dehydrogenase; ALD: aldehyde dehydrogenase; AOR: aldehyde:ferredoxin oxidoreductase; ATPase: ATP synthase; BCD: 3hydroxybutyryl-CoA dehydratase; BUK: butyrate kinase; CODH: CO dehydrogenase; CRT: crotonase; FNR: ferredoxin-NAD+ reductase; HBD: 3-hydroxybutyryl-CoA dehydrogenase; HYD: hydrogenase; THL: thiolase; PTA: phosphotransacetylase; PTB: phosphotransbutyrylase; Rnf complex: ferredoxinNAD+ oxidoreductase).

2005). For industrial application, it is necessary to have a higher titer of alcohol in the fermentation broth (> 10 g/L ethanol and butanol), which could be achieved with optimized fermentation conditions and better engineered strains. As mentioned earlier, the C4/C2 ratio in syngas fermentation by acetogens is much lower than those from solventogenic Clostridium such as C. acetobutylicum. Further studies strengthening the C2 to C4 pathway in C. carboxidivorans is crucial to the production of a decent amount of butanol, which is a more desirable biofuel than ethanol. Strengthening the acetyl-CoA to butyryl-CoA pathway by overexpressing thl, hbd, crt, and bcd genes, which are present in the genome of C. carboxidivorans (Bruant et al., 2010) but are probably repressed under autotrophic conditions, should increase C4/C2 ratio and enhance butanol production (see Fig. 6). Overexpressing genes in the WoodLjungdahl pathway, such as hydrogenase and CO dehydrogenase, should enhance syngas utilization and increase the availability of reducing power, and therefore increase productivity during autotrophic fermentation or enhance CO2 re-assimilation during heterotrophic fermentation. Future studies should also include developing novel gene manipulation tools in C. carboxidivorans, such as CRISPR/Cas-based genome editing tools for the inactivation of acids biosynthesis. According to an in silico model of C. ljungdahlii, acetate production can be abolished with ethanol overproduction by combined inactivation of ack and ald genes in the genome (Chen and Henson, 2016), which may also be applied to C. carboxidivorans for enhanced ethanol and butanol production. Finally, process engineering to optimize medium and bioreactor design with enhanced mass transfer and co-culturing the carboxydotrophic C. carboxidivorans with solventogenic Clostridium (Wang et al., 2014) should increase both the titer and yield of ethanol and butanol produced from sugars and gases in the fermentation.

∼22% more ethanol. This is the first report of overexpressing homologous and heterologous genes in two different alcohol biosynthesis pathways for enhanced alcohols production in C. carboxidivorans. Acknowledgements This work was supported in part by the Department of Energy's Office of Energy Efficiency and Renewable Energy (EERE) under the Bioenergy Technologies Office (Award Number DE-EE0007005) and National Natural Science Foundation of China (21808026). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.biortech.2019.03.145. References Abrini, J., Naveau, H., Nyns, E.J., 1994. Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch. Microbiol. 161, 345–351. Bao, T., Cheng, C., Xin, X., Wang, J., Wang, M., Yang, S.T., 2018. Deciphering mixotrophic Clostridium formicoaceticum metabolism and energy conservation: genomic analysis and experimental studies. Genomics. https://doi.org/10.1016/j.ygeno.2018. 11.020. in press. Basen, M., Schut, G.J., Nguyen, D.M., Lipscomb, G.L., Benn, R.A., Prybol, C.J., Vaccaro, B.J., Poole, F.L., Kelly, R.M., Adams, M.W.W., 2014. Single gene insertion drives bioalcohol production by a thermophilic archaeon. PNAS 111, 17618–17623. Bertsch, J., Mueller, V., 2015. CO metabolism in the acetogen Acetobacterium woodii. Appl. Environ. Microbiol. 81, 5949–5956. Bruant, G., Levesque, M.J., Peter, C., Guiot, S.R., Masson, L., 2010. Genomic analysis of carbon monoxide utilization and butanol production by Clostridium carboxidivorans strain P7. PLoS ONE 5, e13033. Charubin, K., Bennett, R.K., Fast, A.G., Papoutsakis, E.T., 2018. Engineering Clostridium organisms as microbial cell-factories: challenges & opportunities. Metab. Eng. 50, 173–191. Chen, J., Henson, M.A., 2016. In silico metabolic engineering of Clostridium ljungdahlii for synthesis gas fermentation. Metab. Eng. 38, 389–400. Du, Y.M., Jian, G.W.Y., Yu, M.R., Tang, I.C., Yang, S.T., 2015. Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: effects of methyl viologen on NADH availability, flux distribution, and fermentation kinetics. Biotechnol. Bioeng. 112, 705–715. Fast, A.G., Schmidt, E.D., Jones, S.W., Tracy, B.P., 2015. Acetogenic mixotrophy: novel options for yield improvement in biofuels and biochemicals production. Curr. Opin. Biotechnol. 33, 60–72. Fernández-Naveira, Á., Abubackar, H.N., Veiga, M.C., Kennes, C., 2016. Efficient butanolethanol (B-E) production from carbon monoxide fermentation by Clostridium

4. Conclusions In summary, four C. carboxidivorans recombinant strains overexpressing aor, adhE2, aor and fnr, and adhE2 and fnr, respectively, were constructed. In glucose fermentation, all strains showed improved alcohol yields compared to the wild-type. Strains overexpressing aor showed CO2 re-assimilation during heterotrophic growth on glucose. In syngas fermentation, compared to the wild-type, the strain overexpressing adhE2 produced ∼50% more ethanol, whereas the strain overexpressing adhE2 and fnr produced ∼18% more butanol and 422

Bioresource Technology 284 (2019) 415–423

C. Cheng, et al. carboxidivorans. Appl. Microbiol. Biotechnol. 100, 3361–3370. Fernández-Naveira, Á., Veiga, M.C., Kennes, C., 2017b. Glucose bioconversion profile in the syngas-metabolizing species Clostridium carboxidivorans. Bioresour. Technol. 244, 552–559. Fernández-Naveira, Á., Abubackar, H.N., Veiga, M.C., Kennes, C., 2017a. Production of chemicals from C1 gases (CO, CO2) by Clostridium carboxidivorans. World J. Microbiol. Biotechnol. 33, 43. Girbal, L., Soucaille, P., 1994. Regulation of Clostridium acetobutylicum metabolism as revealed by mixed-substrate steady-state continuous cultures: role of NADH/NAD ratio and ATP pool. J. Bacteriol. 176, 6433–6438. Hoffmeister, S., Gerdom, M., Bengelsdorf, F.R., Linder, S., Flüchter, S., Öztürk, H., Blümke, W., May, A., Fischer, R.-J., Bahl, H., Dürre, P., 2016. Acetone production with metabolically engineered strains of Acetobacterium woodii. Metab. Eng. 36, 37–47. Humphreys, C.M., Minton, N.P., 2018. Advances in metabolic engineering in the microbial production of fuels and chemicals from C1 gas. Curr. Opin. Biotechnol. 50, 174–181. Jang, Y.S., Lee, J.Y., Lee, J., Park, J.H., Im, J.A., Eom, M.H., Lee, J., Lee, S.H., Song, H., Cho, J.H., Seung, D.Y., Lee, S.Y., 2012. Enhanced butanol production obtained by reinforcing the direct butanol-forming route in Clostridium acetobutylicum. MBio. 3, e00314–e412. Jones, S.W., Fast, A.G., Carlson, E.D., Wiedel, C.A., Au, J., 2016. CO2 fixation by anaerobic nonphotosynthetic mixotrophy for improved carbon conversion. Nat. Comm. 7, 12800. Klasson, K.T., Ackerson, M.D., Clausen, E.C., Gaddy, J.L., 1993. Biological conversion of coal and coal-derived synthesis gas. Fuel 72, 1673–1678. Köpke, M., Held, C., Hujer, S., Liesegang, H., Wiezer, A., Wollherr, A., Ehrenreich, A., Liebl, W., Gottschalk, G., Durre, P., 2010. Clostridium ljungdahlii represents a microbial production platform based on syngas. PNAS 107, 13087–13092. Lee, S.Y., Park, J.H., Jang, S.H., Nielsen, L.K., Kim, J., Jung, K.S., 2008. Fermentative butanol production by clostridia. Biotechnol. Bioeng. 101, 209–228. Lee, S.H., Yun, E.J., Kim, J., Lee, S.J., Um, Y., Kim, K.H., 2016. Biomass, strain engineering, and fermentation processes for butanol production by solventogenic clostridia. Appl. Microbiol. Biotechnol. 100, 8255–8271. Li, N., Yang, J., Chai, C., Yang, S., Jiang, W., Gu, Y., 2015. Complete genome sequence of Clostridium carboxidivorans P7(T), a syngas-fermenting bacterium capable of producing long-chain alcohols. J. Biotechnol. 211, 44–45. Liew, F., Martin, M.E., Tappel, R.C., Heijstra, B.D., Mihalcea, C., Köpke, M., 2016. Gas fermentation – a flexible platform for commercial scale production of low-carbon fuels and chemicals from waste and renewable feedstocks. Front. Microbiol. 7, 694. Liew, F., Henstra, A.M., Kӧpke, M., Winzer, K., Simpson, S.D., Minton, N.P., 2017. Metabolic engineering of Clostridium autoethanogenum for selective alcohol production. Metab. Eng. 40, 104–114. Liou, J.S.C., Balkwill, D.L., Drake, G.R., Tanner, R.S., 2005. Clostridium carboxidivorans sp. nov., a solvent-producing clostridium isolated from an agricultural settling lagoon, and reclassification of the acetogen Clostridium scatologenes strain SL1 as Clostridium drakei sp. nov. Int. J. Syst. Evol. Microbiol. 55, 2085–2091. Marcellin, E., Behrendorff, J.B., Nagaraju, S., DeTissera, S., Segovia, S., Palfreyman, R.W., Daniell, J., Licona-Cassani, C., Quek, L.E., Speight, R., Hodson, M.P., Simpson, S.D., Mitchell, W.P., Köpke, M., Nielsen, L.K., 2016. Low carbon fuels and commodity chemicals from waste gases-systematic approach to understand energy metabolism in a model acetogen. Green Chem. 18, 3020–3028. Maru, B.T., Munasinghe, P.C., Gilary, H., Jones, S.W., Tracy, B.P., 2018. Fixation of CO2 and CO on a diverse range of carbohydrates using anaerobic, nonphotosynthetic mixotrophy. FEMS Microbiol. Lett. 365, fny039. Mock, J., Zheng, Y., Mueller, A.P., Ly, S., Tran, L., Segovia, S., Nagaraju, S., Köpke, M., Dürre, P., Thauer, R.K., 2015. Energy conservation associated with ethanol formation from H2 and CO2 in Clostridium autoethanogenum involving electron bifurcation. J. Bacteriol. 197, 2965–2980. Mukund, S., Adams, M.W., 1991. The novel tungsten-iron-sulfur protein of the hyperthermophilic archaebacterium, Pyrococcus furiosus, is an aldehyde ferredoxin oxidoreductase. Evidence for its participation in a unique glycolytic pathway. J. Biol. Chem. 266, 14208–14216. Ou, J., Ma, C., Xu, N., Du, Y., Liu, X.M., 2015. High butanol production by regulating carbon, redox and energy in Clostridia. Front. Chem. Sci. Eng. 9, 317–323. Paul, D., Austin, F.W., Arick, T., Bridges, S.M., Burgess, S.C., Dandass, Y.S., et al., 2010. Genome sequence of the solvent-producing bacterium Clostridium carboxidivorans strain P7T. J. Bacteriol. 192, 5554–5555.

Phillips, J.R., Atiyeh, H.K., Tanner, R.S., Torres, J.R., Saxena, J., Wilkins, M.R., Huhnke, R.L., 2015. Butanol and hexanol production in Clostridium carboxidivorans syngas fermentation: medium development and culture techniques. Bioresour. Technol. 190, 114–121. Poehlein, A., Cebulla, M., Ilg, M.M., Bengelsdorf, F.R., Schiel-Bengelsdorf, B., Whited, G., Andreesen, J.R., Gottschalk, G., Daniel, R., Duerre, P., 2015. The complete genome sequence of Clostridium aceticum: a missing link between rnf- and cytochrome-containing autotrophic acetogens. Mbio. 6 (5), e01168–e1215. Pyne, M.E., Bruder, M., Moo-Young, M., Chung, D.A., Chou, C.P., 2014. Technical guide for genetic advancement of underdeveloped and intractable Clostridium. Biotechnol. Adv. 32, 623–641. Ramió-Pujol, S., Ganigué, R., Bañeras, L., Colprim, J., 2015. Incubation at 25 °C prevents acid crash and enhances alcohol production in Clostridium carboxidivorans P7. Bioresour. Technol. 192, 296–303. Roberts, R.J., Vincze, T., Posfai, J., Macelis, D., 2015. REBASE - a database for DNA restriction and modification: enzymes, genes and genomes. Nucleic Acids Res. 43, D298–D299. Schuchmann, K., Muller, V., 2014. Autotrophy at the thermodynamic limit of life: a model for energy conservation in acetogenic bacteria. Nat. Rev. Microbiol. 12, 809–821. Shen, Y., Brown, R., Wen, Z., 2014. Syngas fermentation of Clostridium carboxidivorans P7 in a hollow fiber membrane biofilm reactor: evaluating the mass transfer coefficient and ethanol production performance. Biochem. Eng. J. 85, 21–29. Shen, S., Gu, Y., Chai, C., Jiang, W., Zhuang, Y., Wang, Y., 2017. Enhanced alcohol titre and ratio in carbon monoxide-rich off-gas fermentation of Clostridium carboxidivorans through combination of trace metals optimization with variable-temperature cultivation. Bioresour. Technol. 239, 236–243. Ukpong, M.N., Atiyeh, H.K., De Lorme, M.J.M., Liu, K., Zhu, X., Tanner, R.S., Wilkins, M.R., Stevenson, B.S., 2012. Physiological response of Clostridium carboxidivorans during conversion of synthesis gas to solvents in a gas-fed bioreactor. Biotechnol. Bioeng. 109, 2720–2728. Wang, J., Yang, X., Chen, C.C., Yang, S.T., 2014. Engineering clostridia for butanol production from biorenewable resources: from cells to process integration. Curr. Opin. Chem. Eng. 6, 43–54. Williams, D.R., Young, D.I., Young, M., 1990. Conjugative plasmid transfer from Escherichia coli to Clostridium acetobutylicum. Microbiology 136, 819–826. Yang, S.T., Tang, I.C., Okos, M.R., 1987. Kinetics of homoacetic fermentation of lactate by Clostridium formicoaceticum. Appl. Environ. Microbiol. 53, 823–827. Yang, X., Xu, M., Yang, S.T., 2015b. Restriction modification system analysis and development of in vivo methylation for the transformation of Clostridium cellulovorans. Appl. Microbiol. Biotechnol. 100, 1–11. Yang, X., Xu, M., Yang, S.T., 2015a. Metabolic and process engineering of Clostridium cellulovorans for biofuel production from cellulose. Metab. Eng. 32, 39–48. Younesi, H., Najafpour, G., Mohamed, A.R., 2005. Ethanol and acetate production from synthesis gas via fermentation processes using anaerobic bacterium, Clostridium ljungdahlii. Biochem. Eng. J. 27, 110–119. Yu, M., Zhang, Y., Tang, I.C., Yang, S.T., 2011. Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab. Eng. 13, 373–382. Yu, M., Du, Y., Jiang, W., Chang, W.L., Yang, S.T., Tang, I.C., 2012. Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl. Microbiol. Biotechnol. 93, 881–889. Yu, L., Zhao, J., Xu, M., Dong, J., Varghese, S., Yu, M., Tang, I.C., Yang, S.T., 2015. Metabolic engineering of Clostridium tyrobutyricum for n-butanol production: effects of CoA transferase. Appl. Microbiol. Biotechnol. 99, 4917–4930. Zhang, J., Taylor, S., Wang, Y., 2016. Effects of end products on fermentation profiles in Clostridium carboxidivorans P7 for syngas fermentation. Bioresour. Technol. 218, 1055–1063. Zhang, J., Yu, L., Xu, M., Yang, S.T., Yan, Q., Lin, M., Tang, I.C., 2017b. Metabolic engineering of Clostridium tyrobutyricum for n-butanol production from sugarcane juice. Appl. Microbiol. Biotechnol. 101, 4327–4337. Zhang, J., Yu, L., Lin, M., Yan, Q., Yang, S.T., 2017a. n-Butanol production from sucrose and sugarcane juice by engineered Clostridium tyrobutyricum overexpressing sucrose catabolism genes and adhE2. Bioresour. Technol. 233, 51–57. Zhao, J., Lu, C., Chen, C.C., Yang, S.T., 2013. Biological production of butanol and higher alcohols. In: Yang, S.T., El-Enshasy, H.A., Thongchul, N. (Eds.), Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers. John Wiley & Sons, New York, pp. 235–261.

423