- Email: [email protected]
Metabolic engineering of Corynebacterium glutamicum ATCC13869 for l -valine production
Metabolic Engineering 29 (2015) 66–75
Contents lists available at ScienceDirect
Metabolic Engineering journal homepage: www.elsevier.com/locate/ymben
Metabolic engineering of Corynebacterium glutamicum ATCC13869 for L-valine production Cheng Chen a,b, Yanyan Li b, Jinyu Hu b, Xunyan Dong b, Xiaoyuan Wang a,c,n a
State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi, China Key Laboratory of Industrial Biotechnology of Ministry of Education, Jiangnan University, Wuxi, China c Synergetic Innovation Center of Food Safety and Nutrition, Jiangnan University, Wuxi, China b
art ic l e i nf o
a b s t r a c t
Article history: Received 26 July 2014 Received in revised form 28 February 2015 Accepted 2 March 2015 Available online 10 March 2015
In this study, an L-valine-producing strain was developed from Corynebacterium glutamicum ATCC13869 through deletion of the three genes aceE, alaT and ilvA combined with the overexpression of six genes ilvB, ilvN, ilvC, lrp1, brnF and brnE. Overexpression of lrp1 alone increased L-valine production by 16-fold. Deletion of the aceE, alaT and ilvA increased L-valine production by 44-fold. Overexpression of the six genes ilvB, ilvN, ilvC, lrp1, brnE and brnF in the triple deletion mutant WCC003 further increased L-valine production. The strain WCC003/pJYW-4-ilvBNC1-lrp1-brnFE produced 243 mM L-valine in flask cultivation and 437 mM (51 g/L) L-valine in fed-batch fermentation and lacked detectable amino-acid byproduct such as L-alanine and L-isoleucine that are usually found in the fermentation of L-valineproducing C. glutamicum. & 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Keywords: Corynebacterium glutamicum L-Valine production Metabolic engineering Lrp alat Ilva
1. Introduction Corynebacterium glutamicum has been widely used in industrial fermentation to produce various products, including L-valine (Oldiges et al., 2014), L-leucine (Vogt et al., 2014), L-lysine (Becker et al., 2011; Kind et al., 2013), diaminopentane (Kind et al., 2010), and even bio-based nylon (Kind et al., 2014). L-Valine, one of the branched-chain amino acids (BCAAs), is essential for vertebrates; therefore, it is used in dietary products, pharmaceuticals, cosmetics, and as a precursor for antibiotic and herbicide synthesis. Efficient methods for development of L-valine, such as high-producing C. glutamicum, are required to meet the growing market demand. In C. glutamicum, the L-valine biosynthetic pathway is complex and tightly regulated (Fig. 1). The four key enzymes in the L-valine biosynthetic pathway are acetohydroxy acid synthase (AHAS), acetohydroxy acid isomeroreductase (AHAIR), dihydroxy acid dehydratase (DHAD), and transaminase B (TA) (Park and Lee, 2009). AHAS is encoded by the two genes ilvB and ilvN; AHAIR, DHAD and TA are encoded by ilvC, ilvD, and ilvE, respectively. These four enzymes also catalyze similar reactions in the biosynthesis of n Correspondence to: State Key Laboratory of Food Science and Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi 214122, China. Fax: þ86 510 85329239. E-mail address: [email protected] (X. Wang).
L-isoleucine (Blombach et al., 2008); therefore, L-isoleucine tends to be a by-product in L-valine-producing strains. Excess L-valine, Lisoleucine, L-leucine or 2-ketoisovalerate could potentially inhibit the activity of AHAS, and AHAS mutants that release this inhibition have been reported (Elisáková et al., 2005; Krause et al., 2010). The key intermediate for L-valine biosynthesis, 2-ketoisovalerate, is also the precursor for L-leucine and pantothenate synthesis (Buchholz et al., 2013; Bückle-Vallant et al., 2014). Pyruvate is also a central precursor and can be consumed for synthesis of acetyl-CoA or Lalanine (Fig. 1). Intracellular L-valine can be exported outside the cell via a two-component export system consisting of BrnE and BrnF (BrnFE) encoded by brnE and brnF, respectively. BrnFE is responsible for the export of the three BCAAs and L-methionine (Lange et al., 2012). The expression and activity of BrnFE may be regulated by the global regulator Lrp, which is encoded by lrp (Kennerknecht et al., 2002; Lange et al., 2012). Lrp exists in various bacteria (Lintner et al., 2008), but only Escherichia coli Lrp has been well studied. E. coli Lrp regulates the expression of several genes in the biosynthetic pathways of BCAAs, including ilvGMEDA encoding AHAS II (Rhee et al., 1996), ilvIH encoding AHAS III (Platko et al., 1990), leuABCD encoding enzymes for L-leucine biosynthesis (Calvo and Matthews, 1994), and ilvJ and ygaZH encoding the BCAA export system (Haney et al., 1992; Park et al., 2007). Recently, it was found that C. glutamicum Lrp could bind to the intragenic region between lrp and brnF and activating the expression of brnFE when BCAAs and L-methionine accumulate in cells (Kennerknecht et al., 2002; Lange et al., 2012).
http://dx.doi.org/10.1016/j.ymben.2015.03.004 1096-7176/& 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
67
strain was capable of producing 437 mM (51 g/L) L-valine with no detectable amino-acid by-products. The results demonstrate the superior potential of C. glutamicum ATCC13869 for genetic engineering and L-valine production.
2. Materials and methods 2.1. Strains and plasmids
Fig. 1. Biosynthetic pathway of L-valine in Corynebacterium glutamicum. AHAS, acetohydroxy acid synthase; AHIAR, acetohydroxyacid isomeroreductase; DHAD, dihydroxy acid dehydratase; TA, transaminase B; AT, aminotransferase; PDHC, pyruvate dehydrogenase complex; TD, threonine dehydratase. The plus ( þ ) symbol indicates the activation of gene expression.
Several strategies have been reported in attempts to increase Lvaline production in C. glutamicum that involve modification of the biosynthetic pathway. For example, deletion of leuA encoding 2isopropylmalate synthase blocks L-leucine biosynthesis and deletion of panB encoding 3-methyl-2-oxobutanoate hydroxymethyl transferase blocks pantothenate biosynthesis (Bartek et al., 2008). These deletion mutants increased L-valine production and decreased levels of by-products. Deletion mutants of pyc, which encodes pyruvate carboxylase, and pqo, which encodes pyruvate/quinine oxidoreductase, increased L-valine production by increasing pyruvate levels (Blombach et al., 2008). Deletion of pgi, which encodes phosphoglucoseisomerase (Blombach et al., 2008), increased L-valine production by increasing NADPH supply through the pentose pathway (Bartek et al., 2010; Shi et al., 2012). Modulating the promoter activity (Holátko et al., 2009; Hou et al., 2012) or improving the redox balance (Hasegawa et al., 2012, 2013) are also strategies that have been used to improve L-valine production in C. glutamicum. The most commonly used wild-type C. glutamicum strains include ATCC13032, R, ATCC13869 and ATCC14067. Genome sequences of ATCC13032 and R are available, whereas those of ATCC 13869 and ATCC14067 are not. L-valine-producing strains have usually been developed by random mutagenesis or by engineering the ATCC13032 and R C. glutamicum strains. However, these strains face the problem of production of amino-acid by-products, such as L-alanine and L-isoleucine (Kalinowski et al., 2003; Hou et al., 2012). The most efficient L-valine-producing C. glutamicum strains isolated from nature have been derived from the ATCC13869 or ATCC14067 strains. As genetic manipulation is more difficult in the ATCC14067 strain than in ATCC13869, the latter strain was chosen for use in this study. C. glutamicum ATCC13869 cells usually do not accumulate L-valine; however, after deletion of aceE, alaT and ilvA and overexpression of ilvB, ilvN, ilvC, lrp1, brnF and brnE, the
The strains and plasmids used in this study are listed in Table 1. E. coli JM109 was grown in LB medium (5 g/L yeast extract, 10 g/L tryptone and 10 g/L NaCl) at 37 1C, and C. glutamicum strains were grown at 30 1C in LBG medium (LB medium supplemented with 5 g/L glucose). The L-valine-producing mutant C. glutamicum strain (VWB-1) was derived through a screening and selection process. Briefly, bacteria were originally isolated from soil and treated with the mutagen diethyl sulfate. VWB-1 was selected on agar plates containing molecules with similar structures to L-valine, such as sulfaguanidine and α-aminobutyric acid. Based on the sequence similarity of its 16S rDNA, VWB-1 was predicted to be derived from C. glutamicum ATCC13869. VWB-1 cells were grown in LBG medium supplemented with 18.5 g/L Brain Heart Infusion (BHI) powder. A point mutation (Arg39Trp) was found in Lrp1 in VWB-1 compared to Lrp from ATCC13869. LBHIS medium (5 g/L tryptone, 5 g/L NaCl, 2.5 g/L yeast extract, 18.5 g/L BHI powder and 91 g/L sorbitol) was used for the transformation of the mutant gene into C. glutamicum cells (Van der Rest et al., 1999). When necessary, 30 mg/L kanamycin was added to the medium. The shuttle vector pJYW-4 for gene transfer between E. coli and C. glutamicum was constructed by modifying the plasmid pEC-XK99E (Kirchner and Tauch, 2003) and was used for gene overexpression in C. glutamicum (Hu et al., 2014). 2.2. DNA preparation and transformation The primers used in this study are listed in Table 2. Most primer sequences were designed according to the genome sequence of C. glutamicum ATCC13032 (Kalinowski et al., 2003). Genomic DNA of C. glutamicum ATCC13869 and VWB-1 were isolated and used as templates for PCR-amplification of genes or gene clusters lrp, brnFE and ilvBNC. The genes lrp from ATCC13869 and lrp1 from VWB-1 were amplified using the primer pair lrp-F and lrp-R, digested with BamHI and EcoRI, and ligated into the BamHI and EcoRI sites of pJYW-4, resulting in the plasmids pJYW-4-lrp and pJYW-4-lrp1, respectively. The gene cluster brnFE was amplified using the primer pair brnFE-F and brnFE-R, digested with BamHI and EcoRI, and ligated into pJYW-4, resulting in the plasmid pJYW-4-brnFE. The gene cluster ilvBNC1 was amplified from VWB-1 using the primer pair ilvBNC-F and ilvBNC-R, digested with NtoI and HpaI, and ligated into the same sites in pJYW-4, resulting in the plasmid pJYW-4ilvBNC1. The DNA fragment containing the tac promoter and brnFE in pJYW-4-brnFE was amplified using the primer pair tac-brnFE-F and brnFE-R, digested with EcoRI, and ligated into EcoRI-digested pJYW-4-lrp1 and treated with shrimp alkaline phosphatase, resulting in the plasmid pJYW-4-lrp1-brnFE. The DNA fragment containing the tac promoter and lrp1-brnFE was amplified from pJYW-4-lrp1brnFE using the primer pair tac-lrp-F and lrp-brnFE-R, digested with HpaI, and ligated into HpaI-digested pJYW-4-ilvBNC1 and treated with shrimp alkaline phosphatase, resulting in the plasmid pJYW-4ilvBNC1-lrp1-brnFE (Fig. 2A). All the plasmids were transformed into E. coli JM109 for selection and amplification. Preparation of competent cells and transformation of E. coli were performed according to the published method (Sambrook and Russell, 2001). Preparation of electroporation-competent cells and high-efficiency transformation of C. glutamicum were performed
68
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Table 1 Strains and plasmids used in this study. Strains or plasmids Strains JM109 ATCC13869 VWB-1 ATCC13869ΔaceE WCC002 WCC003 ATCC13869/pJYW-4 ATCC13869/pJYW-4-lrp ATCC13869/pJYW-4-lrp1 ATCC13869/pJYW-4-brnFE ATCC13869/pJYW-4-lrp1-brnFE WCC003/pJYW-4 WCC003/pJYW-4-ilvBNC1 WCC003/pJYW-4-lrp1-brnFE WCC003/pJYW-4-ilvBNC1-lrp1--brnFE Plasmids pJYW-4 pJYW-4-lrp pJYW-4-lrp1 pJYW-4-brnFE pJYW-4-ilvBNC1 pJYW-4-lrp1-brnFE pJYW-4-ilvBNC1-lrp1-brnFE pBluescriptIISK( þ) pDTW109 pDTW201 pDTW301 pWCC001 pDTW302
Description
Sources
Wild type E. coli Wild type C. glutamicum C. glutamicum, L-valine-producing strain aceE deletion mutant of ATCC13869 aceE and alaT deletion mutant ofATCC13869 aceE, alaT and ilvA deletion mutant of ATCC13869 ATCC13869 harboring pJYW-4 ATCC13869 harboring pJYW-4-lrp ATCC13869 harboring pJYW-4-lrp1 ATCC13869 harboring pJYW-4-brnFE ATCC13869 harboring pJYW-4-lrp1-brnFE WCC003 harboring pJYW-4 WCC003 harboring pJYW-4-ilvBNC1 WCC003 harboring pJYW-4-lrp1-brnFE WCC003 harboring pJYW-4-ilvBNC1-lrp1–brnFE
NEB ATCC Lab stock Hu et al. (2013) This work This work This work This work This work This work This work This work This work This work This work
Shuttle vector between E. coli and C. glutamicum pJYW-4 harboring lrp from ATCC13869 pJYW-4 harboring lrp1 from VWB-1 pJYW-4 harboring brnFE pJYW-4 harboring ilvBNC from VWB-1 pJYW-4 harboring lrp1 and brnFE pJYW-4 harboring ilvBNC1, lrp1 and brnFE Cloning vector, ColE, lacZ, Ampr Temperature-sensitive Cre expression vector pBluescriptIISK( þ ) harboring loxp-kan-loxp aceE deletion vector alaT deletion vector ilvA deletion vector
Hu et al. (2014) This work This work This work This work This work This work NEB Hu et al. (2013) Hu et al. (2013) Hu et al. (2013) This work Hu et al. (2013)
according to published methods (Van der Rest et al., 1999; Xu et al., 2010).
(Hu et al., 2013), resulting in the triple deletion strain ATCC13869ΔaceEΔalaTΔilvA, which was renamed WCC003 (Fig. 2B).
2.3. Multiple gene deletions in C. glutamicum ATCC13869
2.4. Quantification of mRNA using real-time PCR
Several genes were deleted from the chromosome of C. glutamicum ATCC13869 using published methods (Hu et al., 2013). The upstream fragment of the alaT gene was amplified from the genomic DNA of C. glutamicum ATCC13869 using the primer pair alaTU-F and alaTU-R; the downstream fragment of the alaT gene was amplified using the primer pair of alaTD-F and alaTD-R; the fragment loxp-kan-loxp was amplified from pDTW201 using the primer pair kan-lox-F and kan-lox-R. These DNA fragments were digested with the appropriate enzymes, ligated together, and then cloned into pBluescript II SK (þ), resulting in the plasmid pWCC001. The plasmid pWCC001 was introduced into C. glutamicum ATCC13869ΔaceE by electroporation and was selected on LBHIS agar supplemented with 30 mg/L kanamycin and 0.5% potassium acetate. The correct insertion of loxp-kan-loxp in the chromosome of the mutant strains was confirmed by PCR using the primer pairs alaTUF and alaTD-R, and ΔalaT-F and ΔalaT-F. Next, the plasmid pDTW109 was introduced into the mutant strain and selected on LBHIS agar plates containing 10 mg/L chloramphenicol and 0.5% potassium acetate at 25 1C for 36 h. Colonies were picked from the plate into liquid LBG medium supplemented with 0.5% potassium acetate and grown at 37 1C for 12 h. The culture was then streaked on LBG agar plates containing potassium acetate and incubated at 30 1C for 36 h. In the end, single colonies were picked from the plates and streaked onto LBG agar plates containing 0.5% potassium acetate either without antibiotics, with kanamycin, or with chloramphenicol, and grown at 30 1C for 24 h. The cells of mutant strain ATCC13869ΔaceEΔalaT (renamed WCC002) grew on the plate without antibiotics, but did not grow on the plates with kanamycin or chloramphenicol. Similarly, the ilvA gene in the genome of WCC002 was deleted using the plasmids pDTW302 and pDTW109
Real-time reverse transcription PCR (RT-PCR) was used to quantify mRNA for ilvA, ilvBN, ilvC, ilvD, ilvE, alaT, avtA, brnFE and lrp. Total RNA was extracted from cultures harvested at the midexponential growth phase using an RNA extraction kit (BioFlux, Beijing, China). DNaseI was used to remove residual DNA from the RNA extract sample. The quality and amount of RNA were judged and quantified by electrophoresis. Transcription of 500 ng RNA into cDNA was performed using a Revert AidTM First Strand cDNA synthesis kit (Fermentas, Shanghai, China) with random hexamer primers. RT-PCR was performed using an ABI Step One RT-PCR system (Applied Biosystems, San Mateo, CA, USA) with a Real Master Mix kit (TIANGEN, Beijing, China). Primers for detection of various genes are listed in Table 2. The program used for RT-PCR was as follows: 94 1C for 1 min, followed by 40 cycles of 94 1C for 10 s, 55 1C for 30 s and 68 1C for 15 s. All assays were performed in triplicate. The relative abundance of the targeted mRNAs was quantified based on the cycle threshold (Ct) value, which is defined as the number of cycles required to obtain a fluorescent signal above the background and was calculated according to the published method (Livak and Schmittgen, 2001; Nolden et al., 2001). To standardize the results, the relative abundance of 16S rRNA was used as an internal standard control. 2.5. Fermentation and HPLC analysis The L-valine production levels and growth characteristics of various C. glutamicum strains were evaluated by fermentation. The seed medium contained 30 g/L glucose, 5 g/L (NH4)2SO4, 5 g/L urea, 1 g/L KH2PO4, 0.04 g/L FeSO4, 0.07 g/L MnSO4, 0.1 g/L MgSO4, 0.7 g/L methionine, 0.2 mg/L biotin, 0.05 mg/L thiamine and 60 g/L
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
69
Table 2 Primers used in this study. Restriction enzyme sites are underlined. Primers
Sequences (50 -30 )
Restriction site
lrp-F lrp-R brnFE-F brnFE-R ilvBNC-F ilvBNC-R tac-brnFE-F tac-lrp-F lrp-brnFE-R alaT-U-F alaT-U-R alaT-D-F alaT-D-R kan-lox-F kan-lox-R ΔalaT-F ΔalaT-R 16S rRNA-1 16S rRNA-2 lrp-1 lrp-2 brnFE-1 brnFE-2 ilvA-1 ilvA-2 ilvBN-1 ilvBN-2 ilvC-1 ilvC-2 ilvD-1 ilvD-2 ilvE-1 ilvE-2
CGGGATCCAGAAGGAGATATACCATGAAGCTAGATTCCATTG CGGAATTCTCACACCTGGGGGCGA CGGGATCCAGAAGGAGATATACCGTGCAAAAAACGCAAGAGAT CGGAATTCTTAGAAAAGATTCACCAGTC ATAAGAATGCGGCCGCTAGAAGGAGTTTTATTGTGAATGTGGCAG CCGTTAACTTAAGCCGTCAAAGGGGTG CGGAATTCACTCGACAACTGTTAATT CCGTTAACACTCGACAACTGTTAATT CCGTTAACTTAGAAAAGATTCACCAGTC ATTACTGCAGATTTCTTAGGATTCCAGGCTTTCG ATTAGGATTCTTGTCTGTAGTCACCCGCTCAAT ACTATCTAGATTCAACTGGCCACATCACGATCA ATTACTCGAGAAATAACGGCACTACACACGACA ATGGATCCAATACGACTCACTATAGG ACCTCTAGAGCGCAATTAACCCTCACTAAAG ACCCCGTGAACAGCAAACCGAT CTGGCTGCAATCTCAAGTTTCT ACCTGGAGAAGAAGCACCG TCAAGTTATGCCCGTATCG TCATTTTGGGCTACAGCGC GTACTTCATCATGCTGCGC CTTATCGACGAAGCCTACG AACTCTGCGATCGCCACTC CTACACCATCGTGGAGAAGA AACCCAGCGATAGACAGC CGGATGACAGGTGCAAAGG TTGTGGAGGAATAGAGCGG CATCGAGCCAAACCTGAACGC CATCAACGAACTGACGGCGAAC GCATTGCCACCAAGAAGG GCGAGGATGTGGAGGATG GTCTGGCTGAGCGAAGATTACG GGCATCCAACCATACGACCTG
BamHI EcoRI BamHI EcoRI NotI HpaI EcoRI HpaI HpaI PstI BamHI XbaI XhoI BamHI XbaI
soybean steep liquor. The fermentation medium contained 120 g/L glucose, 40 g/L (NH4)2SO4, 1 g/L KH2PO4, 0.04 g/L FeSO4, 0.07 g/L MnSO4, 0.1 g/L MgSO4, 0.7 g/L methionine, 0.3 mg/L biotin, 0.05 mg/L thiamine and 10 g/L soybean steep liquor. When necessary, 30 mg/L kanamycin was added to the medium. For flask fermentation, C. glutamicum strains were streaked from frozen stock onto plates containing activation medium (LBHIS media supplemented with 5 g/L glucose) and were incubated at 30 1C for 48 h. One loop of colonies was inoculated in 25 mL seed medium in a 250-mL flask and cultivated for 18 h, resulting in the first-grade seeds. Then the first-grade seeds were inoculated into 25 mL fermentation medium in a 250-mL flask with the initial optical density at 562 nm (OD562) adjusted to 1, and the sample was cultivated at 30 1C and 200 rpm for 96 h. A solution of 20 g/L CaCO3 was used to adjust pH and 30 mg/L kanamycin was used to maintain the plasmid in the cells. In some fermentation procedures, the second-grade seeds were used instead of the first-grade seeds. The second-grade seeds were prepared by inoculating the firstgrade seeds in 25 mL fresh seed medium in a 250-mL flask for 18 h. For fed-batch fermentation, 200-mL seed cultures were first prepared in flasks at 30 1C for 18 h and then transferred to a 5-L fermentor (Biostat B, Germany) containing 2 L fermentation medium. The pH was automatically controlled at 7.2 by adding 50% NH4OH solution. The temperature was kept at 30 1C by a water circulation system. The dissolved oxygen level was controlled by adjusting the agitation speed (200 rpm in the first 12 h and 600 rpm thereafter) and an aeration rate of 1.5 volume per volume per minute (vvm). Samples were taken every 8 or 12 h to determine residual glucose levels by the dinitrosalicylic acid method (Miller, 1959). A glucose solution (600 g/L) was fed by peristaltic pump with a constant rate of 2 mL/min for 100 min when the residual glucose in the medium was lower than 60 g/L. Potassium acetate solution (200 g/L) was fed at 24 and 48 h by peristaltic pumping at a constant rate of 5 mL/min for
20 min when necessary. Biomass was determined by measuring OD562 with UV-1800 spectrophotometer (Shimadzu, Japan). The dry cell weight (DCW) per liter was calculated using the formula for ATCC13869: DCW (g/L)¼0.35 OD562 þ0.24, which was experimentally determined in a previous publication (Hou et al., 2012). The levels of L-valine and other amino acids were analyzed by HPLC (Agilent Technologies 1200 series, USA) according to the published method (Koros et al., 2008).
3. Results and discussion 3.1. Overexpression of lrp and brnFE significantly increased L-valine production in C. glutamicum ATCC13869 In C. glutamicum, Lrp binds the intragenic region between lrp and brnF to activate expression of brnFE when the substrate BCAAs and Lmethionine accumulate in cells (Kennerknecht et al., 2002; Lange et al., 2012). Co-expression of lrp and brnFE increased L-isoleucine production in L-isoleucine-producing C. glutamicum (Yin et al., 2013). To investigate the effect of lrp and brnFE on L-valine production in C. glutamicum ATCC13869, the genes lrp, lrp1, or gene cluster brnFE were cloned into the vector pJYW-4 and transformed into ATCC13869, resulting in the strains ATCC13869/pJYW-4-lrp, ATCC13869/pJYW-4-lrp1, and ATCC13869/ pJYW-4-brnFE, respectively. The gene lrp was amplified from ATCC13869 while the gene lrp1 was amplified from the selected mutant VWB-1. The difference between proteins Lrp and Lrp1 is the 39th amino acid (Arg in Lrp, Trp in Lrp1). Growth curves of ATCC13869/pJYW-4, ATCC13869/ pJYW-4-lrp, ATCC13869/pJYW-4-lrp1, and ATCC13869/pJYW-4-brnFE are shown in Fig. 3A. Compared with the control strain ATCC13869/pJYW-4, ATCC13869/pJYW-4-brnFE showed improved growth, whereas ATCC13869/pJYW-4-lrp and ATCC13869/pJYW-4-lrp1 grew more slowly than the control, suggesting that the overexpression of lrp or lrp1 in
70
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Fig. 2. (A) Maps of plasmids constructed in this study. oriE, the origin of Escherichia coli plasmid pBR322; alr, the gene encoding alanine racemase; Ptac, the tac promoter; t1 and t2, the terminators from pEC-XK-99E; repA and per, C. glutamicum origin; kan, the kanamycin resistance gene. (B) The construction of deletion mutants from C. glutamicum ATCC13869.
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Fig. 3. Flask fermentation of C. glutamicum strains ATCC13869/pJYW-4, ATCC13869/ pJYW-4-lrp, ATCC13869/pJYW-4-lrp1, ATCC13869/pJYW-4-brnFE and ATCC13869/ pJYW-4-lrp1-brnFE. (A) Growth curves (solid symbols) and residual glucose (open symbols); (B) production of L-valine and the major by-products L-alanine and Lisoleucine after 96 h fermentation. (C) Transcript levels of ilvA, ilvBN, ilvC, ilvD, ilvE, alaT, avtA, brnFE and lrp in C. glutamicum strains ATCC13869/pJYW-4-lrp, ATCC13869/ pJYW-4-lrp1 and ATCC13869/pJYW-4-brnFE investigated by RT-PCR analysis, using ATCC13869/pJYW-4 as a control. Samples were taken at the mid-log growth phase.
C. glutamicum ATCC13869 inhibits cell growth. However, cell-growth inhibition by Lrp1 is lower than by Lrp (Fig. 3A), suggesting that the point mutation Arg39Trp in this protein plays an important role. Similar growth inhibition by Lrp was also observed in L-isoleucine-producing C. glutamicum (Yin et al., 2013). Glucose levels in all the strains gradually decreased in similar patterns during growth; the faster the cells grew, the more glucose was consumed (Fig. 3A).
71
The effect of Lrp on L-valine production in C. glutamicum ATCC13869 is significant. As shown in Fig. 3B, after 96-h cultivation, the control strain ATCC13869/pJYW-4 produced only 1.9 mM L-valine, but ATCC13869/pJYW-4-lrp and ATCC13869/pJYW-4-lrp1 produced 27.1 and 30.2 mM L-valine, respectively. This result indicates that Lrp plays an important role in L-valine production in C. glutamicm ATCC13869 and that the point mutation Arg39Trp in Lrp1 facilitates L-valine accumulation. Several mutations clustered within the putative helix-turn-helix protein region near the N-terminus of E. coli Lrp have been found to affect the protein’s ability to bind DNA and regulate gene expression. The point mutation Arg39Trp is also located at the N-terminal of Lrp1 and therefore might also influence the protein’s DNA-binding ability. Levels of L-isoleucine and L-alanine also increased in ATCC13869/ pJYW-4-lrp and ATCC13869/pJYW-4-lrp1 (Fig. 3B). Lrp is known to activate BrnFE, which can export all of the three branched-chain amino acids and L-methionine from the cell (Yin et al., 2013), although the effect of Lrp on L-alanine production needs to be investigated. Compared to the control strain ATCC13869/pJYW-4, the level of L-valine increased 16-fold in ATCC13869/pJYW-4-lrp1, but the level of L-isoleucine increased only 8.9-fold, suggesting that Lrp affects L-valine production more than L-isoleucine production in C. glutamicum ATCC13869. Compared to ATCC13869/pJYW4, L-valine production in ATCC13869/pJYW-4-brnFE increased 2.7fold, but levels of L-isoleucine did not change, suggesting that L-valine is a better substrate for BrnFE than L-isoleucine in C. glutamicum ATCC13869. Compared to ATCC13869/pJYW-4, the level of L-valine increased only 2.7-fold in ATCC13869/pJYW-4brnFE, but increased 16.1-fold in ATCC13869/pJYW-4-lrp1, suggesting that Lrp plays an important role in the export of L-valine in C. glutamicum ATCC13869. To understand the differences in L-valine production among the C. glutamicum strains ATCC13869/pJYW-4-lrp, ATCC13869/pJYW4-lrp1 and ATCC13869/pJYW-4-brnFE, transcriptional levels of some key genes (ilvA, ilvBN, ilvC, ilvD, ilvE, alaT, avtA, brnFE and lrp) were investigated by RT-PCR analysis, using ATCC13869/pJYW4 as a control (Fig. 3C). Genes related to L-valine biosynthesis, including ilvBN, ilvC, ilvD, and brnFE, were generally up-regulated in ATCC13869/pJYW-4-lrp and ATCC13869/pJYW-4-lrp1, and the levels were higher in ATCC13869/pJYW-4-lrp1 than in ATCC13869/ pJYW-4-lrp. In fact, the gene ilvE, which encodes the immediate precursor of L-valine, was up-regulated in ATCC13869/pJYW-4-lrp1 but down-regulated in ATCC13869/pJYW-4-lrp. These results are consistent with the higher L-valine production in ATCC13869/ pJYW-4-lrp1 (Fig. 3B). The up-regulation of ilvA explained the increase in L-isoleucine production in some C. glutamicum strains overexpressing lrp (Yin et al., 2012). Slight increases in the transcriptional levels of ilvA, ilvBN, ilvD, ilvE, and lrp were also observed in ATCC13869/pJYW-4-brnFE, suggesting that the export of L-valine could improve the biosynthesis of L-valine. Interestingly, the transcriptional level of alaT increased in both ATCC13869/pJYW-4-lrp and ATCC13869/pJYW-4-lrp1, and the degree of up-regulation in the latter was much higher than in the former. This result explains the accumulation of L-alanine in ATCC13869/pJYW-4-lrp and the enhanced L-alanine accumulation in ATCC13869/pJYW-4-lrp1 (Fig. 3B). Because overexpression of lrp1 in C. glutamicum led to higher production of L-valine but had a lesser effect on cell growth than overexpression of lrp, lrp1 was chosen to be overexpressed together with brnFE in ATCC13869. Compared to the control ATCC13869/pJYW4, ATCC13869/pJYW-4-lrp1-brnFE grew more slowly and consumed less glucose (Fig. 3A) but produced 25.1-fold more L-valine (Fig. 3B). Apart from L-valine, levels of L-alanine and L-isoleucine also increased synchronously (Fig. 3B). These data demonstrate that overexpression of lrp and brnFE in C. glutamicum ATCC13869 efficiently increased production of L-valine but also accumulated L-alanine and L-isoleucine.
72
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
3.2. Deletion of aceE, alaT and ilvA significantly increases L-valine production and decreases levels of L-alanine and L-isoleucine in C. glutamicum ATCC13869 Because L-alanine and L-isoleucine are the major by-products encountered in the ATCC13869/pJYW-4-lrp1-brnFE strain, the biosynthesis needs to be controlled. L-alanine is converted from pyruvate by an aminotransferase encoded by alaT and avtA (Marienhagen and Eggeling, 2008), and deletion of alaT or avtA can reduce the level of L-alanine (Hou et al., 2012). Considering the fact that alaT was up-regulated when Lrp or Lrp1 was overexpressed (Fig. 3C), deletion of alaT was chosen for use in this study (Fig. 1). Threonine dehydratase encoded by ilvA is the key enzyme for L-isoleucine biosynthesis (Fig. 1); therefore, deletion of ilvA should decrease L-isoleucine accumulation in C. glutamicum (Radmacher et al., 2002). Optimizing the intracellular availability of pyruvate in C. glutamicum may increase L-valine production (Oldiges et al., 2014). Metabolism of pyruvate is closely tied to the glycolytic pathway and tricarboxylic acid cycle (Sawada et al., 2010). Elp encoded by aceE is a key subunit of the pyruvate dehydrogenase complex that converts pyruvate to acetyl-CoA (Blombach et al., 2007). Previously, we constructed an aceE mutant C. glutamicum (ATCC13869ΔaceE), which accumulated more L-valine than ATCC13869 (Hu et al., 2013). Therefore, ATCC13869ΔaceE was used as the base strain for deletions of alaT and ilvA. WCC002 was constructed by deleting alaT in ATCC13869ΔaceE and WCC003 was constructed by deleting ilvA in
Fig. 4. Flask fermentation of C. glutamicum strains ATCC13869, ATCC13869ΔaceE, WCC002 and WCC003. A. Growth curves (solid symbols) and residual glucose (open symbols); (B) production of L-valine and the major by-products L-alanine and L-isoleucine after 96 h fermentation. WCC002, ATCC13869ΔaceEΔalaT; WCC003, ATCC13869ΔaceEΔalaTΔilvA.
WCC002. The more genes were deleted in C. glutamicum ATCC13869, the slower it grew and the less glucose it consumed (Fig. 4A). Compared to ATCC13869, the levels of L-valine in WCC002 and WCC003 increased 18.8-fold and 43.5-fold, respectively (Fig. 4B). Compared to ATCC13869ΔaceE, the level of L-alanine decreased 56.4% in WCC002, but the level of L-isoleucine production increased 4.15-fold, suggesting that the deletion of alaT led to an accumulation of pyruvate that was converted to both L-valine and L-isoleucine. Compared to WCC002, the level of L-alanine did not change, L-isoleucine accumulation decreased, and L-valine production significantly increased in WCC003 (Fig. 4B). The results demonstrate that deletion of aceE, alaT and ilvA in C. glutamicum ATCC13869 both increased L-valine production through a rise in pyruvate levels and also decreased levels of the major by-products L-alanine and L-isoleucine. 3.3. Overexpression of ilvB, ilvN, ilvC, lrp1, brnE and brnF in WCC003 further increased L-valine production Overexpression of gene clusters ilvBNC, ilvBNCD or ilvBNCE (Elisáková et al., 2005; Radmacher et al., 2002; Sahm and Eggeling, 1999) can increase L-valine production in C. glutamicum by directing the carbon flux toward L-valine (Park and Lee, 2009; Wang, 2012). In order to draw the metabolic flux from pyruvate towards L-valine biosynthesis in C. glutamicum WCC003, the key enzymes AHAS, encoded by ilvB and ilvN, and AHAIR, encoded by ilvC, should be overexpressed. The three genes ilvB, ilvN and ilvC are located next to one another on the chromosome. These genes were amplified as a gene cluster (ilvBNC1) from the chromosome of L-valine-producing C. glutamicum VWB-1, cloned into pJYW-4, and transformed into WCC003, resulting in the WCC003/pJYW4-ilvBNC1 strain. Based on DNA sequences, the difference between the gene cluster ilvBNC1 and ilvBNC from ATCC13869 would be expected to cause seven point mutations (Gln29Lys, Pro34Ser, Val137Ala, Ser224Ala, His251Tyr, Ser361Thr and Leu594Pro) in the catalytic subunit and one point mutation (Leu47His) in the regulatory subunit of AHAS. These mutations differ from those that have been published (Park and Lee, 2009; Oldiges et al., 2014), and the mechanism of their influence on Lvaline production requires further study. Both the growth rate and glucose consumption of WCC003/pJYW-4-ilvBNC1 were similar to those of the control strain WCC003/pJYW-4 (Fig. 5A), but the L-valine production of the former was much higher than that of the latter (Fig. 5B). After 96-h cultivation, the level of L-valine in WCC003/pJYW-4-ilvBNC1 increased by 87.6% compared to the control WCC003/pJYW-4. Because expression of pJYW-4-lrp1-brnFE in ATCC13869 increased L-valine production (Fig. 3), pJYW-4-lrp1-brnFE was also transformed into WCC003, resulting in WCC003/pJYW-4-lrp1-brnFE. As expected, more L-valine was produced by WCC003/pJYW-4-lrp1-brnFE than by the control WCC03/pJYW-4 (Fig. 5B). Therefore, the gene cluster ilvBNC1 and the genes lrp1 and brnFE were cloned together in pJYW-4 and transformed into C. glutamicum WCC003, resulting in the mutant strain WCC003/pJYW-4-ilvBNC1-lrp1-brnFE. WCC003/ pJYW-4-ilvBNC1-lrp1-brnFE grew more slowly than strains WCC003/ pJYW-4, WCC003/pJYW-4-lrp1-brnFE and WCC003/pJYW-4-ilvBNC1 (Fig. 5A), but produced much more L-valine than the others (Fig. 5B). After 96-h cultivation, the level of L-valine in WCC003/pJYW-4ilvBNC1-lrp1-brnFE was 112% higher than in the control WCC003/ pJYW-4. WCC003/pJYW-4-ilvBNC1-lrp1-brnFE consumed similar levels of glucose to the other strains, suggesting that it used more glucose to synthesize L-valine because its growth rate was much slower than that of the other strains (Fig. 5A). After 96-h cultivation, WCC003/pJYW-4ilvBNC1-lrp1-brnFE produced 204 mM L-valine with no detectable byproducts. The enzyme encoded by alaT is more important than the enzyme encoded by avtA for the fundamental supply of L-alanine in C. glutamicum (Marienhagen and Eggeling, 2008), but synthesis of L-alanine could be catalyzed by overexpressing ilvBNC in alaT deletion strains; therefore, deletion of avtA was also used to decrease the production of L-alanine in C. glutamicum (Hou et al., 2012; Hasegawa
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
73
could lead to L-isoleucine auxotrophy; therefore, the amount of that should be added to the growth medium was determined (Fig. 6). WCC003/pJYW-4-ilvBNC1-lrp1-brnFE could grow in fermentation medium without added L-isoleucine, but addition of up to 1 g/L (7.6 mM) L-isoleucine improved growth, glucose consumption and L-valine production. As the addition of more than 0.4 g/L (3.0 mM) L-isoleucine did not further improve L-valine production in WCC003/pJYW-4-ilvBNC1-lrp1-brnFE, 0.4 g/L L-isoleucine was added to the medium in all of the following experiments. Deletion of the gene aceE could lead to acetate auxotrophy (Blombach et al., 2007); therefore, the amount of potassium acetate that should be added to the growth medium was determined (Fig. 6). WCC003/pJYW-4-ilvBNC1-lrp1-brnFE grew very slowly in fermentation medium without added potassium acetate, but addition of up to 10 g/L (152 mM) potassium acetate significantly improved growth, glucose consumption and L-valine production. L-Valine production started to decrease when more than 10 g/L potassium acetate was added to the medium (Fig. 6), and a similar pattern was observed in PDHC-deficient strains overexpressing ilvBNCE (Oldiges et al., 2014). Therefore, 10 g/L was chosen as the optimal initial concentration of potassium acetate in the medium. As acetate is necessary for cell growth and is quickly consumed during fermentation, the effect of multiple additions of potassium acetate to the L-valine production in WCC003/pJYW-4ilvBNC1-lrp1-brnFE was also investigated (Fig. 6). Triple additions of 10 g/L potassium acetate at 0, 24 and 48 h led to L-valine production of 218.4 mM. To further improve cell growth, second-grade seeds were used for fermentation, causing dry cell weight and L-valine production to increase by 63.5% and 10.9%, respectively. As pyruvate is an important intermediate precursor for BCAA biosynthesis and biomass formation, combined with the fact that addition of pyruvate increased L-isoleucine production in E. coli, the effect of up to 0.22 g/L (2 mM) sodium pyruvate on the production of L-valine in WCC003/pJYW-4-ilvBNC1-lrp1-brnFE was investigated (Fig. 6). The highest production of L-valine in WCC003/pJYW-4ilvBNC1-lrp1-brnFE was obtained when 2 mM sodium pyruvate was added, and the pyruvate was completely consumed after 96 h. In summary, the optimal growth conditions for L-valine production in WCC003/pJYW-4-ilvBNC1-lrp1-brnFE involve using second-grade seeds and initial addition of 0.4 g/L isoleucine, 3 additions of 10 g/L potassium acetate (at 0, 24 and 48 h) and 2 mM sodium pyruvate. Using these optimized conditions, L-valine production in WCC003/pJYW-4ilvBNC1-lrp1-brnFE reached 242.8 mM (Fig. 6). L-isoleucine
Fig. 5. Flask fermentation of C. glutamicum strains WCC003/pJYW-4, WCC003/ pJYW-4-ilvBNC1, WCC003/pJYW-4-lrp1-brnFE and WCC003/pJYW-4- ilvBNC1-lrp1brnFE. (A) Growth curves and residual glucose; B. L-valine production. (C) Fed-batch fermentation of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE. A 200-mL glucose solution (600 g/L) was fed by peristaltic pump with a constant rate of 2 mL/min when the residual glucose in the medium was lower than 60 g/L.
et al., 2013). In WCC003/pJYW-4-ilvBNC1-lrp1-brnFE, the low level of L-alanine was maintained by the down-regulation of avaA caused by Lrp1 (Fig. 3C) and the deletion of alaT. These data suggest the potential of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE as a strain for L-valine production. Therefore, WCC003/pJYW-4-ilvBNC1-lrp1-brnFE was further evaluated in fed-batch fermentation (Fig. 5C). After 96 h of fermentation, WCC003/pJYW-4-ilvBNC1-lrp1-brnFE produced 312 mM L-valine, but the productivity was only 0.381 g/L/h. The production of L-valine was strongly affected by the cell growth of WCC003/pJYW-4-ilvBNC1-lrp1brnFE in fed-batch fermentation. 3.4. Fermentation optimization of L-valine production in C. glutamicum WCC003/pJYW-4-ilvBNC1-lrp1-brnFE To optimize fermentation, WCC003/pJYW-4-ilvBNC1-lrp1-brnFE was cultivated under various conditions. Deletion of the gene ilvA
3.5. Fed-batch fermentation of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE Fed-batch fermentation of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE was performed under the determined optimal conditions (Fig. 7). The second-grade seeds were cultivated, and 30 mg/L kanamycin, 0.4 g/L isoleucine, 10 g/L potassium acetate and 4 mM sodium pyruvate (instead of 2 mM) were added. Glucose was added when the residual glucose in the medium was lower than 200 mM, and 20 g potassium acetate was added at 24 and 48 h. L-valine production was very low throughout the first 24 h, but after 24 h the levels increased rapidly. Pyruvate levels remained stable during the first 24 h but were quickly consumed after 24 h when biomass and L-valine increased quickly. This result suggests that the supply of pyruvate at the beginning of fermentation could increase cell growth and L-valine yield. The concentration of pyruvate started decreasing at 24 h, and was completely consumed by 72 h, suggesting that pyruvate synthesized from glucose was used immediately for L-valine biosynthesis. The double addition of glucose and triple addition of potassium acetate were consumed completely by the end of fermentation, suggesting that these additions improved cell growth and L-valine production by WCC003/pJYW-4-ilvBNC1-lrp1-brnFE. The level of
74
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Fig. 6. Dry cell weight and L-valine production of C. glutamicum WCC003/pJYW-4-ilvBNC1-lrp1-brnFE resulting from different flask-fermentation conditions.
2013), as and commercial improvement through reduction of additives such as kanamycin (Hu et al., 2014).
Acknowledgments Funding was provided by grants from the National Natural Science Foundation of China (NSFC31370131), National Key Basic Research Program of China (973 Program 2012CB725202), Six Talent Peaks Project of Jiangsu Province (2012-SWYY-008) and Key project of Jiangnan University “Independent Research Plan” (JUSRP51303A). References
Fig. 7. Fed-batch fermentation of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE under the final optimized conditions: 0.4 g/L isoleucine, 10 g/L potassium acetate and 4.4 g/L sodium pyruvate were added at the beginning of the fermentation, 200 mL glucose solution (600 g/L) was fed by peristaltic pump with a constant rate of 2 mL/min when the residual glucose in the medium was lower than 200 mM, 100 mL potassium acetate solution (200 g/L) was fed at 24 and 48 h by peristaltic pump with a constant rate of 5 mL/min.
acetate was well-controlled and led to few side effects on growth or Lvaline yield in the cells. After 96 h fermentation, WCC003/pJYW-4-ilvBNC1-lrp1-brnFE produced 437 mM (51.2 g/L) of L-valine with a productivity of 0.533 g/L/h and a yield of 0.473 mol of L-valine from 1 mol of glucose. Moreover, there were almost no detectable amino-acid by-products such as L-alanine and L-isoleucine, which are usually found during the fermentation of L-valine-producing C. glutamicum. These results demonstrate that C. glutamicum WCC003/pJYW-4-ilvBNC1-lrp1-brnFE has potential for use in industrial L-valine production. Future work will focus on metabolic engineering of the TCA cycle and NADPH-generation pathway, which has been successfully implemented for L-lysine production (Kind et al., 2010; Bommareddy et al., 2014), fermentation under anoxic conditions (Hasegawa et al., 2012,
Bartek, T., Blombach, B., Zönnchen, E., Makus, P., Lang, S., Eikmanns, B.J., Oldiges, M., 2010. Importance of NADPH supply for improved L-valine formation in Corynebacterium glutamicum. Biotechnol. Prog. 26, 361–371. Bartek, T., Makus, P., Klein, B., Lang, S., Oldiges, M., 2008. Influence of L-isoleucine and pantothenate auxotrophy for L-valine formation in Corynebacterium glutamicum revisited by metabolome analyses. Bioprocess Biosyst. Eng. 31, 217–225. Becker, J., Zelder, O., Häfner, S., Schröder, H., Wittmann, C., 2011. Design-based systems metabolic engineering of Corynebacterium glutamicum for L-lysine production. Metab. Eng. 13, 159–168. Blombach, B., Schreiner, M.E., Holatko, J., Bartek, T., Oldiges, M., Eikmanns, B.J., 2007. L-Valine production with pyruvate dehydrogenase complex-deficient Corynebacterium glutamicum. Appl. Environ. Microbiol. 73, 2079–2084. Blombach, B., Schreiner, M.E., Bartek, T., Oldiges, M., Eikmanns, B.J., 2008. Corynebacterium glutamicum tailored for high-yield L-valine production. Appl. Microbiol. Biotechnol. 79, 471–479. Bommareddy, R.R., Chen, Z., Rappert, S., Zeng, A.-P., 2014. A de novo NADPH generation pathway for improving lysine production of Corynebacterium glutamicum by rational design of the coenzyme specificity of glyceraldehyde 3-phosphate dehydrogenase. Metab. Eng. 25, 30–37. Buchholz, J., Schwentner, A., Brunnenkan, B., Gabris, C., Grimm, S., Gerstmeir, R., Takors, R., Eikmanns, B.J., Blombach, B., 2013. Platform engineering of Corynebacterium glutamicum with reduced pyruvate dehydrogenase complex activity for improved production of L-lysine, L-valine, and 2-ketoisovalerate. Appl. Environ. Microbiol. 79, 5566–5575. Bückle-Vallant, V., Krause, F.S., Messerschmidt, S., Eikmanns, B.J., 2014. Metabolic engineering of Corynebacterium glutamicum for 2-ketoisocaproate production. Appl. Microbiol. Biotechnol. 98, 297–311. Calvo, J.M., Matthews, R.G., 1994. The Leucine-responsive regulatory protein, a global regulator of metabolism in Escherichia coli. Microbiol. Rev. 58, 466–490. Elisáková, V., Pátek, M., Holátko, J., Nesvera, J., Leyval, D., Goergen, J., Delaunay, S., 2005. Feedback-resistant acetohydroxy acid synthase increases valine production in Corynebacterium glutamicum. Appl. Environ. Microbiol. 71, 207–213. Haney, S.A., Platko, J.V., Oxender, D.L., Calvo, J.M., 1992. Lrp, a leucine-responsive protein, regulates branched-chain amino acid transport genes in Escherichia coli. J. Bacteriol. 174, 108–115. Hasegawa, S., Suda, M., Uematsu, K., Natsuma, Y., Hiraga, K., Jojima, T., Inui, M., Yukawaa, H., 2013. Engineering of Corynebacterium glutamicum for high-yield Lvaline production under oxygen deprivation conditions. Appl. Environ. Microbiol. 79, 1250–1257. Hasegawa, S., Uematsu, K., Natsuma, Y., Suda, M., Hiraga, K., Jojima, T., Inui, M., Yukawaa, H., 2012. Improvement of the redox balance increases L-valine production by Corynebacterium glutamicum under oxygen deprivation conditions. Appl. Environ. Microbiol. 78, 865–875. Holátko, J., Elisáková, V., Prouza, M., Sobotka, M., Nesvera, J., Pátek, M., 2009. Metabolic engineering of the L-valine biosynthesis pathway in Corynebacterium glutamicum using promoter activity modulation. J. Biotechnol. 139, 203–210.
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Hou, X.H., Chen, X.D., Zhang, Y., Qian, H., Zhang, W.G., 2012. L-Valine production with minimization of by-products’ synthesis in Corynebacterium glutamicum and Brevibacterium flavum. Amino Acids 43, 2301–2311. Hu, J., Li, Y., Zhang, H., Tan, Y., Wang, X., 2014. Construction of a novel expression system for use in Corynebacterium glutamicum. Plasmid 2014 (75), 18–26. Hu, J., Tan, Y., Li, Y., Hu, X., Dong, X., Wang, X., 2013. Construction and application of an efficient multiple-gene-deletion system in Corynebacterium glutamicum. Plasmid 3, 303–313. Kalinowski, J., Bathe, B., Bartels, D., Bischoff, N., Bott, M., Burkovski, A., Dusch, N., Eggeling, L., 2003. The complete Corynebacterium glutamicum ATCC13032 genome sequence and its impact on the production of L-aspartate-derived amino acids and vitamins. J. Biotechnol. 104, 5–25. Kennerknecht, N., Sahm, H., Yen, M., Pátek, M., Saier, M.H., Eggeling, L., 2002. Export of L-Isoleucine from Corynebacterium glutamicum: a two-gene-encoded member of a new translocator family. J. Bacteriol. 184, 3947–3956. Kind, S., Becker, J., Wittmann, C., 2013. Increased lysine production by flux coupling of the tricarboxylic acid cycle and the lysine biosynthetic pathway—metabolic engineering of the availability of succinyl-CoA in Corynebacterium glutamicum. Metab. Eng. 15, 184–195. Kind, S., Jeong, W.K., Schröder, H., Wittmann, C., 2010. Systems-wide metabolic pathway engineering in Corynebacterium glutamicum for bio-based production of diaminopentane. Metab. Eng. 12, 341–351. Kind, S., Neubauer, S., Becker, J., Yamamoto, M., Völkert, M., Abendroth, G., Zelder, O., Wittmann, C., 2014. From zero to hero—production of bio-based nylon from renewable resources using engineered Corynebacterium glutamicum. Metab. Eng. 25, 113–123. Kirchner, O., Tauch, A., 2003. Tools for genetic engineering in the amino acidproducing bacterium Corynebacterium glutamicum. J. Biotechnol. 104, 287–299. Koros, A., Varga, Z.S., Molnar, P., 2008. Simultaneous analysis of amino acids and amines as their ophthalaldehyde-ethanethiol-9-fluorenylmethyl chloroformate derivatives in cheese by high-performance liquid chromatography. J. Chromatogr. A. 1203, 146–152. Krause, F.S., Blombach, B., Eikmanns, B.J., 2010. Metabolic engineering of Corynebacterium glutamicum for 2-ketoisovalerate production. Appl. Environ. Microbiol. 76, 8053–8061. Lange, C., Mustafi, N., Frunzke, J., Kennerknecht, N., Wessel, M., Bott, M., Wendisch, V.F., 2012. Lrp of Corynebacterium glutamicum controls expression of the brnFE operon encoding the export system for L-methionine and branched-chain amino acids. J. Biotechnol. 158, 231–241. Lintner, R.E., Mishra, P.K., Srivastava, P., Martinez-Vaz, B.M., Khodursky, A.B., Blumenthal, R.M., 2008. Limited functional conservation of a global regulator among related bacterial genera: Lrp in Escherichia, Proteus and Vibrio. BMC Microbiol. 8, 60. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using ΔΔCT method. Methods 25, 402–408. real-time quantitative PCR and the 2 Marienhagen, J., Eggeling, L., 2008. Metabolic function of Corynebacterium glutamicum aminotransferases alaT and avtA and impact on L-valine production. Appl. Environ. Microbiol. 74, 7457–7462.
75
Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugars. Anal. Chem. 31, 426–428. Nolden, L., Farwick, M., Krämer, R., Burkovski, A., 2001. Glutamine synthetases of Corynebacterium glutamicum: transcriptional control and regulation of activity. FEMS Microbiol. Lett. 201, 91–98. Oldiges, M., Eikmanns, B.J., Blombach, B., 2014. Application of metabolic engineering for the biotechnological production of L-valine. Appl. Microbiol. Biotechnol. 98, 5859–5870. Park, J.H., Lee, K.H., Kim, J.Y., Lee, S.Y., 2007. Metabolic engineering of Escherichia coli for the production of L-valine based on transcriptome analysis and in silico gene knockout simulation. Proc. Natl. Acad. Sci. U.S.A. 104, 7797–7802. Park, J.H., Lee, S.Y., 2009. Fermentative production of branched chain amino acids: a focus on metabolic engineering. Appl. Microbiol. Biotechnol. 85, 491–506. Platko, J.V., Willins, D.A., Calvo, J.M., 1990. The ilvIH operon of Escherichia coli is positively regulated. J. Bacteriol. 172, 4563–4570. Radmacher, E., Vaitsikova, A., Burger, U., Krumbach, K., Sahm, H., Eggeling, L., 2002. Linking central metabolism with increased pathway flux: L-valine accumulation by Corynebacterium glutamicum. Appl. Environ. Microbiol. 68, 2246–2250. Rhee, K.Y., Parekh, B.S., Hatfield, G.W., 1996. Leucine-responsive regulatory proteinDNA interactions in the leader region of the ilvGMEDA operon of Escherichia coli. J. Biol. Chem. 271, 26499–26507. Sahm, H., Eggeling, L., 1999. D-Pantothenate synthesis in Corynebacterium glutamicum and use of panBC and genes encoding L-valine synthesis for D-pantothenate overproduction. Appl. Environ. Microbiol. 65, 1973–1979. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, NY. Sawada, K., Zen-in, S., Wada, M., Yokota, A., 2010. Metabolic changes in a pyruvate kinase gene deletion mutant of Corynebacterium glutamicum ATCC 13032. Metab. Eng. 12, 401–407. Shi, F., Huan, X.J., Wang, X., Ning, J.F., 2012. Over-expression of NAD kinases improves the L-isoleucine biosyntheis in Corynebacterium glutamicumssp. lactofermentum. Enzyme Microb. Technol. 51, 73–80. Van der Rest, M.E., Lange, C., Molenaar, D., 1999. A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Biotechnol. 52, 541–545. Vogt, M., Haas, S., Klaffl, S., Polen, T., Eggeling, L., Ooyen, J., Bott, M., 2014. Pushing product formation to its limit: metabolic engineering of Corynebacterium glutamicum for L-leucine overproduction. Metab. Eng. 22, 40–52. Wang, X., 2012. Metabolic engineering in C. glutamicum to increase L-valine production. J. Food Sci. Biotechnol. 31, 225–231. Xu, D., Tan, Y., Huan, X., Hu, X., Wang, X., 2010. Construction of a novel shuttle vector for use in Brevibacterium flavum, an industrial amino acid producer. J. Microbiol. Methods 80, 86–92. Yin, L., Hu, X., Xu, D., Ning, J., Chen, J., Wang, X., 2012. Co-expression of feedbackresistant threonine dehydratase and acetohydroxy acid synthase increase Lisoleucine production in Corynebacterium glutamicum. Metab. Eng. 14, 542–550. Yin, L., Shi, F., Hu, X., Chen, C., Wang, X., 2013. Increasing L-isoleucine production in Corynebacterium glutamicum by overexpressing global regulator Lrp and twocomponent export system BrnFE. J. Appl. Microbiol. 114, 1369–1377.
Contents lists available at ScienceDirect
Metabolic Engineering journal homepage: www.elsevier.com/locate/ymben
Metabolic engineering of Corynebacterium glutamicum ATCC13869 for L-valine production Cheng Chen a,b, Yanyan Li b, Jinyu Hu b, Xunyan Dong b, Xiaoyuan Wang a,c,n a
State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi, China Key Laboratory of Industrial Biotechnology of Ministry of Education, Jiangnan University, Wuxi, China c Synergetic Innovation Center of Food Safety and Nutrition, Jiangnan University, Wuxi, China b
art ic l e i nf o
a b s t r a c t
Article history: Received 26 July 2014 Received in revised form 28 February 2015 Accepted 2 March 2015 Available online 10 March 2015
In this study, an L-valine-producing strain was developed from Corynebacterium glutamicum ATCC13869 through deletion of the three genes aceE, alaT and ilvA combined with the overexpression of six genes ilvB, ilvN, ilvC, lrp1, brnF and brnE. Overexpression of lrp1 alone increased L-valine production by 16-fold. Deletion of the aceE, alaT and ilvA increased L-valine production by 44-fold. Overexpression of the six genes ilvB, ilvN, ilvC, lrp1, brnE and brnF in the triple deletion mutant WCC003 further increased L-valine production. The strain WCC003/pJYW-4-ilvBNC1-lrp1-brnFE produced 243 mM L-valine in flask cultivation and 437 mM (51 g/L) L-valine in fed-batch fermentation and lacked detectable amino-acid byproduct such as L-alanine and L-isoleucine that are usually found in the fermentation of L-valineproducing C. glutamicum. & 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Keywords: Corynebacterium glutamicum L-Valine production Metabolic engineering Lrp alat Ilva
1. Introduction Corynebacterium glutamicum has been widely used in industrial fermentation to produce various products, including L-valine (Oldiges et al., 2014), L-leucine (Vogt et al., 2014), L-lysine (Becker et al., 2011; Kind et al., 2013), diaminopentane (Kind et al., 2010), and even bio-based nylon (Kind et al., 2014). L-Valine, one of the branched-chain amino acids (BCAAs), is essential for vertebrates; therefore, it is used in dietary products, pharmaceuticals, cosmetics, and as a precursor for antibiotic and herbicide synthesis. Efficient methods for development of L-valine, such as high-producing C. glutamicum, are required to meet the growing market demand. In C. glutamicum, the L-valine biosynthetic pathway is complex and tightly regulated (Fig. 1). The four key enzymes in the L-valine biosynthetic pathway are acetohydroxy acid synthase (AHAS), acetohydroxy acid isomeroreductase (AHAIR), dihydroxy acid dehydratase (DHAD), and transaminase B (TA) (Park and Lee, 2009). AHAS is encoded by the two genes ilvB and ilvN; AHAIR, DHAD and TA are encoded by ilvC, ilvD, and ilvE, respectively. These four enzymes also catalyze similar reactions in the biosynthesis of n Correspondence to: State Key Laboratory of Food Science and Technology, Jiangnan University, 1800 Lihu Avenue, Wuxi 214122, China. Fax: þ86 510 85329239. E-mail address: [email protected] (X. Wang).
L-isoleucine (Blombach et al., 2008); therefore, L-isoleucine tends to be a by-product in L-valine-producing strains. Excess L-valine, Lisoleucine, L-leucine or 2-ketoisovalerate could potentially inhibit the activity of AHAS, and AHAS mutants that release this inhibition have been reported (Elisáková et al., 2005; Krause et al., 2010). The key intermediate for L-valine biosynthesis, 2-ketoisovalerate, is also the precursor for L-leucine and pantothenate synthesis (Buchholz et al., 2013; Bückle-Vallant et al., 2014). Pyruvate is also a central precursor and can be consumed for synthesis of acetyl-CoA or Lalanine (Fig. 1). Intracellular L-valine can be exported outside the cell via a two-component export system consisting of BrnE and BrnF (BrnFE) encoded by brnE and brnF, respectively. BrnFE is responsible for the export of the three BCAAs and L-methionine (Lange et al., 2012). The expression and activity of BrnFE may be regulated by the global regulator Lrp, which is encoded by lrp (Kennerknecht et al., 2002; Lange et al., 2012). Lrp exists in various bacteria (Lintner et al., 2008), but only Escherichia coli Lrp has been well studied. E. coli Lrp regulates the expression of several genes in the biosynthetic pathways of BCAAs, including ilvGMEDA encoding AHAS II (Rhee et al., 1996), ilvIH encoding AHAS III (Platko et al., 1990), leuABCD encoding enzymes for L-leucine biosynthesis (Calvo and Matthews, 1994), and ilvJ and ygaZH encoding the BCAA export system (Haney et al., 1992; Park et al., 2007). Recently, it was found that C. glutamicum Lrp could bind to the intragenic region between lrp and brnF and activating the expression of brnFE when BCAAs and L-methionine accumulate in cells (Kennerknecht et al., 2002; Lange et al., 2012).
http://dx.doi.org/10.1016/j.ymben.2015.03.004 1096-7176/& 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
67
strain was capable of producing 437 mM (51 g/L) L-valine with no detectable amino-acid by-products. The results demonstrate the superior potential of C. glutamicum ATCC13869 for genetic engineering and L-valine production.
2. Materials and methods 2.1. Strains and plasmids
Fig. 1. Biosynthetic pathway of L-valine in Corynebacterium glutamicum. AHAS, acetohydroxy acid synthase; AHIAR, acetohydroxyacid isomeroreductase; DHAD, dihydroxy acid dehydratase; TA, transaminase B; AT, aminotransferase; PDHC, pyruvate dehydrogenase complex; TD, threonine dehydratase. The plus ( þ ) symbol indicates the activation of gene expression.
Several strategies have been reported in attempts to increase Lvaline production in C. glutamicum that involve modification of the biosynthetic pathway. For example, deletion of leuA encoding 2isopropylmalate synthase blocks L-leucine biosynthesis and deletion of panB encoding 3-methyl-2-oxobutanoate hydroxymethyl transferase blocks pantothenate biosynthesis (Bartek et al., 2008). These deletion mutants increased L-valine production and decreased levels of by-products. Deletion mutants of pyc, which encodes pyruvate carboxylase, and pqo, which encodes pyruvate/quinine oxidoreductase, increased L-valine production by increasing pyruvate levels (Blombach et al., 2008). Deletion of pgi, which encodes phosphoglucoseisomerase (Blombach et al., 2008), increased L-valine production by increasing NADPH supply through the pentose pathway (Bartek et al., 2010; Shi et al., 2012). Modulating the promoter activity (Holátko et al., 2009; Hou et al., 2012) or improving the redox balance (Hasegawa et al., 2012, 2013) are also strategies that have been used to improve L-valine production in C. glutamicum. The most commonly used wild-type C. glutamicum strains include ATCC13032, R, ATCC13869 and ATCC14067. Genome sequences of ATCC13032 and R are available, whereas those of ATCC 13869 and ATCC14067 are not. L-valine-producing strains have usually been developed by random mutagenesis or by engineering the ATCC13032 and R C. glutamicum strains. However, these strains face the problem of production of amino-acid by-products, such as L-alanine and L-isoleucine (Kalinowski et al., 2003; Hou et al., 2012). The most efficient L-valine-producing C. glutamicum strains isolated from nature have been derived from the ATCC13869 or ATCC14067 strains. As genetic manipulation is more difficult in the ATCC14067 strain than in ATCC13869, the latter strain was chosen for use in this study. C. glutamicum ATCC13869 cells usually do not accumulate L-valine; however, after deletion of aceE, alaT and ilvA and overexpression of ilvB, ilvN, ilvC, lrp1, brnF and brnE, the
The strains and plasmids used in this study are listed in Table 1. E. coli JM109 was grown in LB medium (5 g/L yeast extract, 10 g/L tryptone and 10 g/L NaCl) at 37 1C, and C. glutamicum strains were grown at 30 1C in LBG medium (LB medium supplemented with 5 g/L glucose). The L-valine-producing mutant C. glutamicum strain (VWB-1) was derived through a screening and selection process. Briefly, bacteria were originally isolated from soil and treated with the mutagen diethyl sulfate. VWB-1 was selected on agar plates containing molecules with similar structures to L-valine, such as sulfaguanidine and α-aminobutyric acid. Based on the sequence similarity of its 16S rDNA, VWB-1 was predicted to be derived from C. glutamicum ATCC13869. VWB-1 cells were grown in LBG medium supplemented with 18.5 g/L Brain Heart Infusion (BHI) powder. A point mutation (Arg39Trp) was found in Lrp1 in VWB-1 compared to Lrp from ATCC13869. LBHIS medium (5 g/L tryptone, 5 g/L NaCl, 2.5 g/L yeast extract, 18.5 g/L BHI powder and 91 g/L sorbitol) was used for the transformation of the mutant gene into C. glutamicum cells (Van der Rest et al., 1999). When necessary, 30 mg/L kanamycin was added to the medium. The shuttle vector pJYW-4 for gene transfer between E. coli and C. glutamicum was constructed by modifying the plasmid pEC-XK99E (Kirchner and Tauch, 2003) and was used for gene overexpression in C. glutamicum (Hu et al., 2014). 2.2. DNA preparation and transformation The primers used in this study are listed in Table 2. Most primer sequences were designed according to the genome sequence of C. glutamicum ATCC13032 (Kalinowski et al., 2003). Genomic DNA of C. glutamicum ATCC13869 and VWB-1 were isolated and used as templates for PCR-amplification of genes or gene clusters lrp, brnFE and ilvBNC. The genes lrp from ATCC13869 and lrp1 from VWB-1 were amplified using the primer pair lrp-F and lrp-R, digested with BamHI and EcoRI, and ligated into the BamHI and EcoRI sites of pJYW-4, resulting in the plasmids pJYW-4-lrp and pJYW-4-lrp1, respectively. The gene cluster brnFE was amplified using the primer pair brnFE-F and brnFE-R, digested with BamHI and EcoRI, and ligated into pJYW-4, resulting in the plasmid pJYW-4-brnFE. The gene cluster ilvBNC1 was amplified from VWB-1 using the primer pair ilvBNC-F and ilvBNC-R, digested with NtoI and HpaI, and ligated into the same sites in pJYW-4, resulting in the plasmid pJYW-4ilvBNC1. The DNA fragment containing the tac promoter and brnFE in pJYW-4-brnFE was amplified using the primer pair tac-brnFE-F and brnFE-R, digested with EcoRI, and ligated into EcoRI-digested pJYW-4-lrp1 and treated with shrimp alkaline phosphatase, resulting in the plasmid pJYW-4-lrp1-brnFE. The DNA fragment containing the tac promoter and lrp1-brnFE was amplified from pJYW-4-lrp1brnFE using the primer pair tac-lrp-F and lrp-brnFE-R, digested with HpaI, and ligated into HpaI-digested pJYW-4-ilvBNC1 and treated with shrimp alkaline phosphatase, resulting in the plasmid pJYW-4ilvBNC1-lrp1-brnFE (Fig. 2A). All the plasmids were transformed into E. coli JM109 for selection and amplification. Preparation of competent cells and transformation of E. coli were performed according to the published method (Sambrook and Russell, 2001). Preparation of electroporation-competent cells and high-efficiency transformation of C. glutamicum were performed
68
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Table 1 Strains and plasmids used in this study. Strains or plasmids Strains JM109 ATCC13869 VWB-1 ATCC13869ΔaceE WCC002 WCC003 ATCC13869/pJYW-4 ATCC13869/pJYW-4-lrp ATCC13869/pJYW-4-lrp1 ATCC13869/pJYW-4-brnFE ATCC13869/pJYW-4-lrp1-brnFE WCC003/pJYW-4 WCC003/pJYW-4-ilvBNC1 WCC003/pJYW-4-lrp1-brnFE WCC003/pJYW-4-ilvBNC1-lrp1--brnFE Plasmids pJYW-4 pJYW-4-lrp pJYW-4-lrp1 pJYW-4-brnFE pJYW-4-ilvBNC1 pJYW-4-lrp1-brnFE pJYW-4-ilvBNC1-lrp1-brnFE pBluescriptIISK( þ) pDTW109 pDTW201 pDTW301 pWCC001 pDTW302
Description
Sources
Wild type E. coli Wild type C. glutamicum C. glutamicum, L-valine-producing strain aceE deletion mutant of ATCC13869 aceE and alaT deletion mutant ofATCC13869 aceE, alaT and ilvA deletion mutant of ATCC13869 ATCC13869 harboring pJYW-4 ATCC13869 harboring pJYW-4-lrp ATCC13869 harboring pJYW-4-lrp1 ATCC13869 harboring pJYW-4-brnFE ATCC13869 harboring pJYW-4-lrp1-brnFE WCC003 harboring pJYW-4 WCC003 harboring pJYW-4-ilvBNC1 WCC003 harboring pJYW-4-lrp1-brnFE WCC003 harboring pJYW-4-ilvBNC1-lrp1–brnFE
NEB ATCC Lab stock Hu et al. (2013) This work This work This work This work This work This work This work This work This work This work This work
Shuttle vector between E. coli and C. glutamicum pJYW-4 harboring lrp from ATCC13869 pJYW-4 harboring lrp1 from VWB-1 pJYW-4 harboring brnFE pJYW-4 harboring ilvBNC from VWB-1 pJYW-4 harboring lrp1 and brnFE pJYW-4 harboring ilvBNC1, lrp1 and brnFE Cloning vector, ColE, lacZ, Ampr Temperature-sensitive Cre expression vector pBluescriptIISK( þ ) harboring loxp-kan-loxp aceE deletion vector alaT deletion vector ilvA deletion vector
Hu et al. (2014) This work This work This work This work This work This work NEB Hu et al. (2013) Hu et al. (2013) Hu et al. (2013) This work Hu et al. (2013)
according to published methods (Van der Rest et al., 1999; Xu et al., 2010).
(Hu et al., 2013), resulting in the triple deletion strain ATCC13869ΔaceEΔalaTΔilvA, which was renamed WCC003 (Fig. 2B).
2.3. Multiple gene deletions in C. glutamicum ATCC13869
2.4. Quantification of mRNA using real-time PCR
Several genes were deleted from the chromosome of C. glutamicum ATCC13869 using published methods (Hu et al., 2013). The upstream fragment of the alaT gene was amplified from the genomic DNA of C. glutamicum ATCC13869 using the primer pair alaTU-F and alaTU-R; the downstream fragment of the alaT gene was amplified using the primer pair of alaTD-F and alaTD-R; the fragment loxp-kan-loxp was amplified from pDTW201 using the primer pair kan-lox-F and kan-lox-R. These DNA fragments were digested with the appropriate enzymes, ligated together, and then cloned into pBluescript II SK (þ), resulting in the plasmid pWCC001. The plasmid pWCC001 was introduced into C. glutamicum ATCC13869ΔaceE by electroporation and was selected on LBHIS agar supplemented with 30 mg/L kanamycin and 0.5% potassium acetate. The correct insertion of loxp-kan-loxp in the chromosome of the mutant strains was confirmed by PCR using the primer pairs alaTUF and alaTD-R, and ΔalaT-F and ΔalaT-F. Next, the plasmid pDTW109 was introduced into the mutant strain and selected on LBHIS agar plates containing 10 mg/L chloramphenicol and 0.5% potassium acetate at 25 1C for 36 h. Colonies were picked from the plate into liquid LBG medium supplemented with 0.5% potassium acetate and grown at 37 1C for 12 h. The culture was then streaked on LBG agar plates containing potassium acetate and incubated at 30 1C for 36 h. In the end, single colonies were picked from the plates and streaked onto LBG agar plates containing 0.5% potassium acetate either without antibiotics, with kanamycin, or with chloramphenicol, and grown at 30 1C for 24 h. The cells of mutant strain ATCC13869ΔaceEΔalaT (renamed WCC002) grew on the plate without antibiotics, but did not grow on the plates with kanamycin or chloramphenicol. Similarly, the ilvA gene in the genome of WCC002 was deleted using the plasmids pDTW302 and pDTW109
Real-time reverse transcription PCR (RT-PCR) was used to quantify mRNA for ilvA, ilvBN, ilvC, ilvD, ilvE, alaT, avtA, brnFE and lrp. Total RNA was extracted from cultures harvested at the midexponential growth phase using an RNA extraction kit (BioFlux, Beijing, China). DNaseI was used to remove residual DNA from the RNA extract sample. The quality and amount of RNA were judged and quantified by electrophoresis. Transcription of 500 ng RNA into cDNA was performed using a Revert AidTM First Strand cDNA synthesis kit (Fermentas, Shanghai, China) with random hexamer primers. RT-PCR was performed using an ABI Step One RT-PCR system (Applied Biosystems, San Mateo, CA, USA) with a Real Master Mix kit (TIANGEN, Beijing, China). Primers for detection of various genes are listed in Table 2. The program used for RT-PCR was as follows: 94 1C for 1 min, followed by 40 cycles of 94 1C for 10 s, 55 1C for 30 s and 68 1C for 15 s. All assays were performed in triplicate. The relative abundance of the targeted mRNAs was quantified based on the cycle threshold (Ct) value, which is defined as the number of cycles required to obtain a fluorescent signal above the background and was calculated according to the published method (Livak and Schmittgen, 2001; Nolden et al., 2001). To standardize the results, the relative abundance of 16S rRNA was used as an internal standard control. 2.5. Fermentation and HPLC analysis The L-valine production levels and growth characteristics of various C. glutamicum strains were evaluated by fermentation. The seed medium contained 30 g/L glucose, 5 g/L (NH4)2SO4, 5 g/L urea, 1 g/L KH2PO4, 0.04 g/L FeSO4, 0.07 g/L MnSO4, 0.1 g/L MgSO4, 0.7 g/L methionine, 0.2 mg/L biotin, 0.05 mg/L thiamine and 60 g/L
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
69
Table 2 Primers used in this study. Restriction enzyme sites are underlined. Primers
Sequences (50 -30 )
Restriction site
lrp-F lrp-R brnFE-F brnFE-R ilvBNC-F ilvBNC-R tac-brnFE-F tac-lrp-F lrp-brnFE-R alaT-U-F alaT-U-R alaT-D-F alaT-D-R kan-lox-F kan-lox-R ΔalaT-F ΔalaT-R 16S rRNA-1 16S rRNA-2 lrp-1 lrp-2 brnFE-1 brnFE-2 ilvA-1 ilvA-2 ilvBN-1 ilvBN-2 ilvC-1 ilvC-2 ilvD-1 ilvD-2 ilvE-1 ilvE-2
CGGGATCCAGAAGGAGATATACCATGAAGCTAGATTCCATTG CGGAATTCTCACACCTGGGGGCGA CGGGATCCAGAAGGAGATATACCGTGCAAAAAACGCAAGAGAT CGGAATTCTTAGAAAAGATTCACCAGTC ATAAGAATGCGGCCGCTAGAAGGAGTTTTATTGTGAATGTGGCAG CCGTTAACTTAAGCCGTCAAAGGGGTG CGGAATTCACTCGACAACTGTTAATT CCGTTAACACTCGACAACTGTTAATT CCGTTAACTTAGAAAAGATTCACCAGTC ATTACTGCAGATTTCTTAGGATTCCAGGCTTTCG ATTAGGATTCTTGTCTGTAGTCACCCGCTCAAT ACTATCTAGATTCAACTGGCCACATCACGATCA ATTACTCGAGAAATAACGGCACTACACACGACA ATGGATCCAATACGACTCACTATAGG ACCTCTAGAGCGCAATTAACCCTCACTAAAG ACCCCGTGAACAGCAAACCGAT CTGGCTGCAATCTCAAGTTTCT ACCTGGAGAAGAAGCACCG TCAAGTTATGCCCGTATCG TCATTTTGGGCTACAGCGC GTACTTCATCATGCTGCGC CTTATCGACGAAGCCTACG AACTCTGCGATCGCCACTC CTACACCATCGTGGAGAAGA AACCCAGCGATAGACAGC CGGATGACAGGTGCAAAGG TTGTGGAGGAATAGAGCGG CATCGAGCCAAACCTGAACGC CATCAACGAACTGACGGCGAAC GCATTGCCACCAAGAAGG GCGAGGATGTGGAGGATG GTCTGGCTGAGCGAAGATTACG GGCATCCAACCATACGACCTG
BamHI EcoRI BamHI EcoRI NotI HpaI EcoRI HpaI HpaI PstI BamHI XbaI XhoI BamHI XbaI
soybean steep liquor. The fermentation medium contained 120 g/L glucose, 40 g/L (NH4)2SO4, 1 g/L KH2PO4, 0.04 g/L FeSO4, 0.07 g/L MnSO4, 0.1 g/L MgSO4, 0.7 g/L methionine, 0.3 mg/L biotin, 0.05 mg/L thiamine and 10 g/L soybean steep liquor. When necessary, 30 mg/L kanamycin was added to the medium. For flask fermentation, C. glutamicum strains were streaked from frozen stock onto plates containing activation medium (LBHIS media supplemented with 5 g/L glucose) and were incubated at 30 1C for 48 h. One loop of colonies was inoculated in 25 mL seed medium in a 250-mL flask and cultivated for 18 h, resulting in the first-grade seeds. Then the first-grade seeds were inoculated into 25 mL fermentation medium in a 250-mL flask with the initial optical density at 562 nm (OD562) adjusted to 1, and the sample was cultivated at 30 1C and 200 rpm for 96 h. A solution of 20 g/L CaCO3 was used to adjust pH and 30 mg/L kanamycin was used to maintain the plasmid in the cells. In some fermentation procedures, the second-grade seeds were used instead of the first-grade seeds. The second-grade seeds were prepared by inoculating the firstgrade seeds in 25 mL fresh seed medium in a 250-mL flask for 18 h. For fed-batch fermentation, 200-mL seed cultures were first prepared in flasks at 30 1C for 18 h and then transferred to a 5-L fermentor (Biostat B, Germany) containing 2 L fermentation medium. The pH was automatically controlled at 7.2 by adding 50% NH4OH solution. The temperature was kept at 30 1C by a water circulation system. The dissolved oxygen level was controlled by adjusting the agitation speed (200 rpm in the first 12 h and 600 rpm thereafter) and an aeration rate of 1.5 volume per volume per minute (vvm). Samples were taken every 8 or 12 h to determine residual glucose levels by the dinitrosalicylic acid method (Miller, 1959). A glucose solution (600 g/L) was fed by peristaltic pump with a constant rate of 2 mL/min for 100 min when the residual glucose in the medium was lower than 60 g/L. Potassium acetate solution (200 g/L) was fed at 24 and 48 h by peristaltic pumping at a constant rate of 5 mL/min for
20 min when necessary. Biomass was determined by measuring OD562 with UV-1800 spectrophotometer (Shimadzu, Japan). The dry cell weight (DCW) per liter was calculated using the formula for ATCC13869: DCW (g/L)¼0.35 OD562 þ0.24, which was experimentally determined in a previous publication (Hou et al., 2012). The levels of L-valine and other amino acids were analyzed by HPLC (Agilent Technologies 1200 series, USA) according to the published method (Koros et al., 2008).
3. Results and discussion 3.1. Overexpression of lrp and brnFE significantly increased L-valine production in C. glutamicum ATCC13869 In C. glutamicum, Lrp binds the intragenic region between lrp and brnF to activate expression of brnFE when the substrate BCAAs and Lmethionine accumulate in cells (Kennerknecht et al., 2002; Lange et al., 2012). Co-expression of lrp and brnFE increased L-isoleucine production in L-isoleucine-producing C. glutamicum (Yin et al., 2013). To investigate the effect of lrp and brnFE on L-valine production in C. glutamicum ATCC13869, the genes lrp, lrp1, or gene cluster brnFE were cloned into the vector pJYW-4 and transformed into ATCC13869, resulting in the strains ATCC13869/pJYW-4-lrp, ATCC13869/pJYW-4-lrp1, and ATCC13869/ pJYW-4-brnFE, respectively. The gene lrp was amplified from ATCC13869 while the gene lrp1 was amplified from the selected mutant VWB-1. The difference between proteins Lrp and Lrp1 is the 39th amino acid (Arg in Lrp, Trp in Lrp1). Growth curves of ATCC13869/pJYW-4, ATCC13869/ pJYW-4-lrp, ATCC13869/pJYW-4-lrp1, and ATCC13869/pJYW-4-brnFE are shown in Fig. 3A. Compared with the control strain ATCC13869/pJYW-4, ATCC13869/pJYW-4-brnFE showed improved growth, whereas ATCC13869/pJYW-4-lrp and ATCC13869/pJYW-4-lrp1 grew more slowly than the control, suggesting that the overexpression of lrp or lrp1 in
70
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Fig. 2. (A) Maps of plasmids constructed in this study. oriE, the origin of Escherichia coli plasmid pBR322; alr, the gene encoding alanine racemase; Ptac, the tac promoter; t1 and t2, the terminators from pEC-XK-99E; repA and per, C. glutamicum origin; kan, the kanamycin resistance gene. (B) The construction of deletion mutants from C. glutamicum ATCC13869.
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Fig. 3. Flask fermentation of C. glutamicum strains ATCC13869/pJYW-4, ATCC13869/ pJYW-4-lrp, ATCC13869/pJYW-4-lrp1, ATCC13869/pJYW-4-brnFE and ATCC13869/ pJYW-4-lrp1-brnFE. (A) Growth curves (solid symbols) and residual glucose (open symbols); (B) production of L-valine and the major by-products L-alanine and Lisoleucine after 96 h fermentation. (C) Transcript levels of ilvA, ilvBN, ilvC, ilvD, ilvE, alaT, avtA, brnFE and lrp in C. glutamicum strains ATCC13869/pJYW-4-lrp, ATCC13869/ pJYW-4-lrp1 and ATCC13869/pJYW-4-brnFE investigated by RT-PCR analysis, using ATCC13869/pJYW-4 as a control. Samples were taken at the mid-log growth phase.
C. glutamicum ATCC13869 inhibits cell growth. However, cell-growth inhibition by Lrp1 is lower than by Lrp (Fig. 3A), suggesting that the point mutation Arg39Trp in this protein plays an important role. Similar growth inhibition by Lrp was also observed in L-isoleucine-producing C. glutamicum (Yin et al., 2013). Glucose levels in all the strains gradually decreased in similar patterns during growth; the faster the cells grew, the more glucose was consumed (Fig. 3A).
71
The effect of Lrp on L-valine production in C. glutamicum ATCC13869 is significant. As shown in Fig. 3B, after 96-h cultivation, the control strain ATCC13869/pJYW-4 produced only 1.9 mM L-valine, but ATCC13869/pJYW-4-lrp and ATCC13869/pJYW-4-lrp1 produced 27.1 and 30.2 mM L-valine, respectively. This result indicates that Lrp plays an important role in L-valine production in C. glutamicm ATCC13869 and that the point mutation Arg39Trp in Lrp1 facilitates L-valine accumulation. Several mutations clustered within the putative helix-turn-helix protein region near the N-terminus of E. coli Lrp have been found to affect the protein’s ability to bind DNA and regulate gene expression. The point mutation Arg39Trp is also located at the N-terminal of Lrp1 and therefore might also influence the protein’s DNA-binding ability. Levels of L-isoleucine and L-alanine also increased in ATCC13869/ pJYW-4-lrp and ATCC13869/pJYW-4-lrp1 (Fig. 3B). Lrp is known to activate BrnFE, which can export all of the three branched-chain amino acids and L-methionine from the cell (Yin et al., 2013), although the effect of Lrp on L-alanine production needs to be investigated. Compared to the control strain ATCC13869/pJYW-4, the level of L-valine increased 16-fold in ATCC13869/pJYW-4-lrp1, but the level of L-isoleucine increased only 8.9-fold, suggesting that Lrp affects L-valine production more than L-isoleucine production in C. glutamicum ATCC13869. Compared to ATCC13869/pJYW4, L-valine production in ATCC13869/pJYW-4-brnFE increased 2.7fold, but levels of L-isoleucine did not change, suggesting that L-valine is a better substrate for BrnFE than L-isoleucine in C. glutamicum ATCC13869. Compared to ATCC13869/pJYW-4, the level of L-valine increased only 2.7-fold in ATCC13869/pJYW-4brnFE, but increased 16.1-fold in ATCC13869/pJYW-4-lrp1, suggesting that Lrp plays an important role in the export of L-valine in C. glutamicum ATCC13869. To understand the differences in L-valine production among the C. glutamicum strains ATCC13869/pJYW-4-lrp, ATCC13869/pJYW4-lrp1 and ATCC13869/pJYW-4-brnFE, transcriptional levels of some key genes (ilvA, ilvBN, ilvC, ilvD, ilvE, alaT, avtA, brnFE and lrp) were investigated by RT-PCR analysis, using ATCC13869/pJYW4 as a control (Fig. 3C). Genes related to L-valine biosynthesis, including ilvBN, ilvC, ilvD, and brnFE, were generally up-regulated in ATCC13869/pJYW-4-lrp and ATCC13869/pJYW-4-lrp1, and the levels were higher in ATCC13869/pJYW-4-lrp1 than in ATCC13869/ pJYW-4-lrp. In fact, the gene ilvE, which encodes the immediate precursor of L-valine, was up-regulated in ATCC13869/pJYW-4-lrp1 but down-regulated in ATCC13869/pJYW-4-lrp. These results are consistent with the higher L-valine production in ATCC13869/ pJYW-4-lrp1 (Fig. 3B). The up-regulation of ilvA explained the increase in L-isoleucine production in some C. glutamicum strains overexpressing lrp (Yin et al., 2012). Slight increases in the transcriptional levels of ilvA, ilvBN, ilvD, ilvE, and lrp were also observed in ATCC13869/pJYW-4-brnFE, suggesting that the export of L-valine could improve the biosynthesis of L-valine. Interestingly, the transcriptional level of alaT increased in both ATCC13869/pJYW-4-lrp and ATCC13869/pJYW-4-lrp1, and the degree of up-regulation in the latter was much higher than in the former. This result explains the accumulation of L-alanine in ATCC13869/pJYW-4-lrp and the enhanced L-alanine accumulation in ATCC13869/pJYW-4-lrp1 (Fig. 3B). Because overexpression of lrp1 in C. glutamicum led to higher production of L-valine but had a lesser effect on cell growth than overexpression of lrp, lrp1 was chosen to be overexpressed together with brnFE in ATCC13869. Compared to the control ATCC13869/pJYW4, ATCC13869/pJYW-4-lrp1-brnFE grew more slowly and consumed less glucose (Fig. 3A) but produced 25.1-fold more L-valine (Fig. 3B). Apart from L-valine, levels of L-alanine and L-isoleucine also increased synchronously (Fig. 3B). These data demonstrate that overexpression of lrp and brnFE in C. glutamicum ATCC13869 efficiently increased production of L-valine but also accumulated L-alanine and L-isoleucine.
72
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
3.2. Deletion of aceE, alaT and ilvA significantly increases L-valine production and decreases levels of L-alanine and L-isoleucine in C. glutamicum ATCC13869 Because L-alanine and L-isoleucine are the major by-products encountered in the ATCC13869/pJYW-4-lrp1-brnFE strain, the biosynthesis needs to be controlled. L-alanine is converted from pyruvate by an aminotransferase encoded by alaT and avtA (Marienhagen and Eggeling, 2008), and deletion of alaT or avtA can reduce the level of L-alanine (Hou et al., 2012). Considering the fact that alaT was up-regulated when Lrp or Lrp1 was overexpressed (Fig. 3C), deletion of alaT was chosen for use in this study (Fig. 1). Threonine dehydratase encoded by ilvA is the key enzyme for L-isoleucine biosynthesis (Fig. 1); therefore, deletion of ilvA should decrease L-isoleucine accumulation in C. glutamicum (Radmacher et al., 2002). Optimizing the intracellular availability of pyruvate in C. glutamicum may increase L-valine production (Oldiges et al., 2014). Metabolism of pyruvate is closely tied to the glycolytic pathway and tricarboxylic acid cycle (Sawada et al., 2010). Elp encoded by aceE is a key subunit of the pyruvate dehydrogenase complex that converts pyruvate to acetyl-CoA (Blombach et al., 2007). Previously, we constructed an aceE mutant C. glutamicum (ATCC13869ΔaceE), which accumulated more L-valine than ATCC13869 (Hu et al., 2013). Therefore, ATCC13869ΔaceE was used as the base strain for deletions of alaT and ilvA. WCC002 was constructed by deleting alaT in ATCC13869ΔaceE and WCC003 was constructed by deleting ilvA in
Fig. 4. Flask fermentation of C. glutamicum strains ATCC13869, ATCC13869ΔaceE, WCC002 and WCC003. A. Growth curves (solid symbols) and residual glucose (open symbols); (B) production of L-valine and the major by-products L-alanine and L-isoleucine after 96 h fermentation. WCC002, ATCC13869ΔaceEΔalaT; WCC003, ATCC13869ΔaceEΔalaTΔilvA.
WCC002. The more genes were deleted in C. glutamicum ATCC13869, the slower it grew and the less glucose it consumed (Fig. 4A). Compared to ATCC13869, the levels of L-valine in WCC002 and WCC003 increased 18.8-fold and 43.5-fold, respectively (Fig. 4B). Compared to ATCC13869ΔaceE, the level of L-alanine decreased 56.4% in WCC002, but the level of L-isoleucine production increased 4.15-fold, suggesting that the deletion of alaT led to an accumulation of pyruvate that was converted to both L-valine and L-isoleucine. Compared to WCC002, the level of L-alanine did not change, L-isoleucine accumulation decreased, and L-valine production significantly increased in WCC003 (Fig. 4B). The results demonstrate that deletion of aceE, alaT and ilvA in C. glutamicum ATCC13869 both increased L-valine production through a rise in pyruvate levels and also decreased levels of the major by-products L-alanine and L-isoleucine. 3.3. Overexpression of ilvB, ilvN, ilvC, lrp1, brnE and brnF in WCC003 further increased L-valine production Overexpression of gene clusters ilvBNC, ilvBNCD or ilvBNCE (Elisáková et al., 2005; Radmacher et al., 2002; Sahm and Eggeling, 1999) can increase L-valine production in C. glutamicum by directing the carbon flux toward L-valine (Park and Lee, 2009; Wang, 2012). In order to draw the metabolic flux from pyruvate towards L-valine biosynthesis in C. glutamicum WCC003, the key enzymes AHAS, encoded by ilvB and ilvN, and AHAIR, encoded by ilvC, should be overexpressed. The three genes ilvB, ilvN and ilvC are located next to one another on the chromosome. These genes were amplified as a gene cluster (ilvBNC1) from the chromosome of L-valine-producing C. glutamicum VWB-1, cloned into pJYW-4, and transformed into WCC003, resulting in the WCC003/pJYW4-ilvBNC1 strain. Based on DNA sequences, the difference between the gene cluster ilvBNC1 and ilvBNC from ATCC13869 would be expected to cause seven point mutations (Gln29Lys, Pro34Ser, Val137Ala, Ser224Ala, His251Tyr, Ser361Thr and Leu594Pro) in the catalytic subunit and one point mutation (Leu47His) in the regulatory subunit of AHAS. These mutations differ from those that have been published (Park and Lee, 2009; Oldiges et al., 2014), and the mechanism of their influence on Lvaline production requires further study. Both the growth rate and glucose consumption of WCC003/pJYW-4-ilvBNC1 were similar to those of the control strain WCC003/pJYW-4 (Fig. 5A), but the L-valine production of the former was much higher than that of the latter (Fig. 5B). After 96-h cultivation, the level of L-valine in WCC003/pJYW-4-ilvBNC1 increased by 87.6% compared to the control WCC003/pJYW-4. Because expression of pJYW-4-lrp1-brnFE in ATCC13869 increased L-valine production (Fig. 3), pJYW-4-lrp1-brnFE was also transformed into WCC003, resulting in WCC003/pJYW-4-lrp1-brnFE. As expected, more L-valine was produced by WCC003/pJYW-4-lrp1-brnFE than by the control WCC03/pJYW-4 (Fig. 5B). Therefore, the gene cluster ilvBNC1 and the genes lrp1 and brnFE were cloned together in pJYW-4 and transformed into C. glutamicum WCC003, resulting in the mutant strain WCC003/pJYW-4-ilvBNC1-lrp1-brnFE. WCC003/ pJYW-4-ilvBNC1-lrp1-brnFE grew more slowly than strains WCC003/ pJYW-4, WCC003/pJYW-4-lrp1-brnFE and WCC003/pJYW-4-ilvBNC1 (Fig. 5A), but produced much more L-valine than the others (Fig. 5B). After 96-h cultivation, the level of L-valine in WCC003/pJYW-4ilvBNC1-lrp1-brnFE was 112% higher than in the control WCC003/ pJYW-4. WCC003/pJYW-4-ilvBNC1-lrp1-brnFE consumed similar levels of glucose to the other strains, suggesting that it used more glucose to synthesize L-valine because its growth rate was much slower than that of the other strains (Fig. 5A). After 96-h cultivation, WCC003/pJYW-4ilvBNC1-lrp1-brnFE produced 204 mM L-valine with no detectable byproducts. The enzyme encoded by alaT is more important than the enzyme encoded by avtA for the fundamental supply of L-alanine in C. glutamicum (Marienhagen and Eggeling, 2008), but synthesis of L-alanine could be catalyzed by overexpressing ilvBNC in alaT deletion strains; therefore, deletion of avtA was also used to decrease the production of L-alanine in C. glutamicum (Hou et al., 2012; Hasegawa
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
73
could lead to L-isoleucine auxotrophy; therefore, the amount of that should be added to the growth medium was determined (Fig. 6). WCC003/pJYW-4-ilvBNC1-lrp1-brnFE could grow in fermentation medium without added L-isoleucine, but addition of up to 1 g/L (7.6 mM) L-isoleucine improved growth, glucose consumption and L-valine production. As the addition of more than 0.4 g/L (3.0 mM) L-isoleucine did not further improve L-valine production in WCC003/pJYW-4-ilvBNC1-lrp1-brnFE, 0.4 g/L L-isoleucine was added to the medium in all of the following experiments. Deletion of the gene aceE could lead to acetate auxotrophy (Blombach et al., 2007); therefore, the amount of potassium acetate that should be added to the growth medium was determined (Fig. 6). WCC003/pJYW-4-ilvBNC1-lrp1-brnFE grew very slowly in fermentation medium without added potassium acetate, but addition of up to 10 g/L (152 mM) potassium acetate significantly improved growth, glucose consumption and L-valine production. L-Valine production started to decrease when more than 10 g/L potassium acetate was added to the medium (Fig. 6), and a similar pattern was observed in PDHC-deficient strains overexpressing ilvBNCE (Oldiges et al., 2014). Therefore, 10 g/L was chosen as the optimal initial concentration of potassium acetate in the medium. As acetate is necessary for cell growth and is quickly consumed during fermentation, the effect of multiple additions of potassium acetate to the L-valine production in WCC003/pJYW-4ilvBNC1-lrp1-brnFE was also investigated (Fig. 6). Triple additions of 10 g/L potassium acetate at 0, 24 and 48 h led to L-valine production of 218.4 mM. To further improve cell growth, second-grade seeds were used for fermentation, causing dry cell weight and L-valine production to increase by 63.5% and 10.9%, respectively. As pyruvate is an important intermediate precursor for BCAA biosynthesis and biomass formation, combined with the fact that addition of pyruvate increased L-isoleucine production in E. coli, the effect of up to 0.22 g/L (2 mM) sodium pyruvate on the production of L-valine in WCC003/pJYW-4-ilvBNC1-lrp1-brnFE was investigated (Fig. 6). The highest production of L-valine in WCC003/pJYW-4ilvBNC1-lrp1-brnFE was obtained when 2 mM sodium pyruvate was added, and the pyruvate was completely consumed after 96 h. In summary, the optimal growth conditions for L-valine production in WCC003/pJYW-4-ilvBNC1-lrp1-brnFE involve using second-grade seeds and initial addition of 0.4 g/L isoleucine, 3 additions of 10 g/L potassium acetate (at 0, 24 and 48 h) and 2 mM sodium pyruvate. Using these optimized conditions, L-valine production in WCC003/pJYW-4ilvBNC1-lrp1-brnFE reached 242.8 mM (Fig. 6). L-isoleucine
Fig. 5. Flask fermentation of C. glutamicum strains WCC003/pJYW-4, WCC003/ pJYW-4-ilvBNC1, WCC003/pJYW-4-lrp1-brnFE and WCC003/pJYW-4- ilvBNC1-lrp1brnFE. (A) Growth curves and residual glucose; B. L-valine production. (C) Fed-batch fermentation of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE. A 200-mL glucose solution (600 g/L) was fed by peristaltic pump with a constant rate of 2 mL/min when the residual glucose in the medium was lower than 60 g/L.
et al., 2013). In WCC003/pJYW-4-ilvBNC1-lrp1-brnFE, the low level of L-alanine was maintained by the down-regulation of avaA caused by Lrp1 (Fig. 3C) and the deletion of alaT. These data suggest the potential of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE as a strain for L-valine production. Therefore, WCC003/pJYW-4-ilvBNC1-lrp1-brnFE was further evaluated in fed-batch fermentation (Fig. 5C). After 96 h of fermentation, WCC003/pJYW-4-ilvBNC1-lrp1-brnFE produced 312 mM L-valine, but the productivity was only 0.381 g/L/h. The production of L-valine was strongly affected by the cell growth of WCC003/pJYW-4-ilvBNC1-lrp1brnFE in fed-batch fermentation. 3.4. Fermentation optimization of L-valine production in C. glutamicum WCC003/pJYW-4-ilvBNC1-lrp1-brnFE To optimize fermentation, WCC003/pJYW-4-ilvBNC1-lrp1-brnFE was cultivated under various conditions. Deletion of the gene ilvA
3.5. Fed-batch fermentation of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE Fed-batch fermentation of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE was performed under the determined optimal conditions (Fig. 7). The second-grade seeds were cultivated, and 30 mg/L kanamycin, 0.4 g/L isoleucine, 10 g/L potassium acetate and 4 mM sodium pyruvate (instead of 2 mM) were added. Glucose was added when the residual glucose in the medium was lower than 200 mM, and 20 g potassium acetate was added at 24 and 48 h. L-valine production was very low throughout the first 24 h, but after 24 h the levels increased rapidly. Pyruvate levels remained stable during the first 24 h but were quickly consumed after 24 h when biomass and L-valine increased quickly. This result suggests that the supply of pyruvate at the beginning of fermentation could increase cell growth and L-valine yield. The concentration of pyruvate started decreasing at 24 h, and was completely consumed by 72 h, suggesting that pyruvate synthesized from glucose was used immediately for L-valine biosynthesis. The double addition of glucose and triple addition of potassium acetate were consumed completely by the end of fermentation, suggesting that these additions improved cell growth and L-valine production by WCC003/pJYW-4-ilvBNC1-lrp1-brnFE. The level of
74
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Fig. 6. Dry cell weight and L-valine production of C. glutamicum WCC003/pJYW-4-ilvBNC1-lrp1-brnFE resulting from different flask-fermentation conditions.
2013), as and commercial improvement through reduction of additives such as kanamycin (Hu et al., 2014).
Acknowledgments Funding was provided by grants from the National Natural Science Foundation of China (NSFC31370131), National Key Basic Research Program of China (973 Program 2012CB725202), Six Talent Peaks Project of Jiangsu Province (2012-SWYY-008) and Key project of Jiangnan University “Independent Research Plan” (JUSRP51303A). References
Fig. 7. Fed-batch fermentation of WCC003/pJYW-4-ilvBNC1-lrp1-brnFE under the final optimized conditions: 0.4 g/L isoleucine, 10 g/L potassium acetate and 4.4 g/L sodium pyruvate were added at the beginning of the fermentation, 200 mL glucose solution (600 g/L) was fed by peristaltic pump with a constant rate of 2 mL/min when the residual glucose in the medium was lower than 200 mM, 100 mL potassium acetate solution (200 g/L) was fed at 24 and 48 h by peristaltic pump with a constant rate of 5 mL/min.
acetate was well-controlled and led to few side effects on growth or Lvaline yield in the cells. After 96 h fermentation, WCC003/pJYW-4-ilvBNC1-lrp1-brnFE produced 437 mM (51.2 g/L) of L-valine with a productivity of 0.533 g/L/h and a yield of 0.473 mol of L-valine from 1 mol of glucose. Moreover, there were almost no detectable amino-acid by-products such as L-alanine and L-isoleucine, which are usually found during the fermentation of L-valine-producing C. glutamicum. These results demonstrate that C. glutamicum WCC003/pJYW-4-ilvBNC1-lrp1-brnFE has potential for use in industrial L-valine production. Future work will focus on metabolic engineering of the TCA cycle and NADPH-generation pathway, which has been successfully implemented for L-lysine production (Kind et al., 2010; Bommareddy et al., 2014), fermentation under anoxic conditions (Hasegawa et al., 2012,
Bartek, T., Blombach, B., Zönnchen, E., Makus, P., Lang, S., Eikmanns, B.J., Oldiges, M., 2010. Importance of NADPH supply for improved L-valine formation in Corynebacterium glutamicum. Biotechnol. Prog. 26, 361–371. Bartek, T., Makus, P., Klein, B., Lang, S., Oldiges, M., 2008. Influence of L-isoleucine and pantothenate auxotrophy for L-valine formation in Corynebacterium glutamicum revisited by metabolome analyses. Bioprocess Biosyst. Eng. 31, 217–225. Becker, J., Zelder, O., Häfner, S., Schröder, H., Wittmann, C., 2011. Design-based systems metabolic engineering of Corynebacterium glutamicum for L-lysine production. Metab. Eng. 13, 159–168. Blombach, B., Schreiner, M.E., Holatko, J., Bartek, T., Oldiges, M., Eikmanns, B.J., 2007. L-Valine production with pyruvate dehydrogenase complex-deficient Corynebacterium glutamicum. Appl. Environ. Microbiol. 73, 2079–2084. Blombach, B., Schreiner, M.E., Bartek, T., Oldiges, M., Eikmanns, B.J., 2008. Corynebacterium glutamicum tailored for high-yield L-valine production. Appl. Microbiol. Biotechnol. 79, 471–479. Bommareddy, R.R., Chen, Z., Rappert, S., Zeng, A.-P., 2014. A de novo NADPH generation pathway for improving lysine production of Corynebacterium glutamicum by rational design of the coenzyme specificity of glyceraldehyde 3-phosphate dehydrogenase. Metab. Eng. 25, 30–37. Buchholz, J., Schwentner, A., Brunnenkan, B., Gabris, C., Grimm, S., Gerstmeir, R., Takors, R., Eikmanns, B.J., Blombach, B., 2013. Platform engineering of Corynebacterium glutamicum with reduced pyruvate dehydrogenase complex activity for improved production of L-lysine, L-valine, and 2-ketoisovalerate. Appl. Environ. Microbiol. 79, 5566–5575. Bückle-Vallant, V., Krause, F.S., Messerschmidt, S., Eikmanns, B.J., 2014. Metabolic engineering of Corynebacterium glutamicum for 2-ketoisocaproate production. Appl. Microbiol. Biotechnol. 98, 297–311. Calvo, J.M., Matthews, R.G., 1994. The Leucine-responsive regulatory protein, a global regulator of metabolism in Escherichia coli. Microbiol. Rev. 58, 466–490. Elisáková, V., Pátek, M., Holátko, J., Nesvera, J., Leyval, D., Goergen, J., Delaunay, S., 2005. Feedback-resistant acetohydroxy acid synthase increases valine production in Corynebacterium glutamicum. Appl. Environ. Microbiol. 71, 207–213. Haney, S.A., Platko, J.V., Oxender, D.L., Calvo, J.M., 1992. Lrp, a leucine-responsive protein, regulates branched-chain amino acid transport genes in Escherichia coli. J. Bacteriol. 174, 108–115. Hasegawa, S., Suda, M., Uematsu, K., Natsuma, Y., Hiraga, K., Jojima, T., Inui, M., Yukawaa, H., 2013. Engineering of Corynebacterium glutamicum for high-yield Lvaline production under oxygen deprivation conditions. Appl. Environ. Microbiol. 79, 1250–1257. Hasegawa, S., Uematsu, K., Natsuma, Y., Suda, M., Hiraga, K., Jojima, T., Inui, M., Yukawaa, H., 2012. Improvement of the redox balance increases L-valine production by Corynebacterium glutamicum under oxygen deprivation conditions. Appl. Environ. Microbiol. 78, 865–875. Holátko, J., Elisáková, V., Prouza, M., Sobotka, M., Nesvera, J., Pátek, M., 2009. Metabolic engineering of the L-valine biosynthesis pathway in Corynebacterium glutamicum using promoter activity modulation. J. Biotechnol. 139, 203–210.
C. Chen et al. / Metabolic Engineering 29 (2015) 66–75
Hou, X.H., Chen, X.D., Zhang, Y., Qian, H., Zhang, W.G., 2012. L-Valine production with minimization of by-products’ synthesis in Corynebacterium glutamicum and Brevibacterium flavum. Amino Acids 43, 2301–2311. Hu, J., Li, Y., Zhang, H., Tan, Y., Wang, X., 2014. Construction of a novel expression system for use in Corynebacterium glutamicum. Plasmid 2014 (75), 18–26. Hu, J., Tan, Y., Li, Y., Hu, X., Dong, X., Wang, X., 2013. Construction and application of an efficient multiple-gene-deletion system in Corynebacterium glutamicum. Plasmid 3, 303–313. Kalinowski, J., Bathe, B., Bartels, D., Bischoff, N., Bott, M., Burkovski, A., Dusch, N., Eggeling, L., 2003. The complete Corynebacterium glutamicum ATCC13032 genome sequence and its impact on the production of L-aspartate-derived amino acids and vitamins. J. Biotechnol. 104, 5–25. Kennerknecht, N., Sahm, H., Yen, M., Pátek, M., Saier, M.H., Eggeling, L., 2002. Export of L-Isoleucine from Corynebacterium glutamicum: a two-gene-encoded member of a new translocator family. J. Bacteriol. 184, 3947–3956. Kind, S., Becker, J., Wittmann, C., 2013. Increased lysine production by flux coupling of the tricarboxylic acid cycle and the lysine biosynthetic pathway—metabolic engineering of the availability of succinyl-CoA in Corynebacterium glutamicum. Metab. Eng. 15, 184–195. Kind, S., Jeong, W.K., Schröder, H., Wittmann, C., 2010. Systems-wide metabolic pathway engineering in Corynebacterium glutamicum for bio-based production of diaminopentane. Metab. Eng. 12, 341–351. Kind, S., Neubauer, S., Becker, J., Yamamoto, M., Völkert, M., Abendroth, G., Zelder, O., Wittmann, C., 2014. From zero to hero—production of bio-based nylon from renewable resources using engineered Corynebacterium glutamicum. Metab. Eng. 25, 113–123. Kirchner, O., Tauch, A., 2003. Tools for genetic engineering in the amino acidproducing bacterium Corynebacterium glutamicum. J. Biotechnol. 104, 287–299. Koros, A., Varga, Z.S., Molnar, P., 2008. Simultaneous analysis of amino acids and amines as their ophthalaldehyde-ethanethiol-9-fluorenylmethyl chloroformate derivatives in cheese by high-performance liquid chromatography. J. Chromatogr. A. 1203, 146–152. Krause, F.S., Blombach, B., Eikmanns, B.J., 2010. Metabolic engineering of Corynebacterium glutamicum for 2-ketoisovalerate production. Appl. Environ. Microbiol. 76, 8053–8061. Lange, C., Mustafi, N., Frunzke, J., Kennerknecht, N., Wessel, M., Bott, M., Wendisch, V.F., 2012. Lrp of Corynebacterium glutamicum controls expression of the brnFE operon encoding the export system for L-methionine and branched-chain amino acids. J. Biotechnol. 158, 231–241. Lintner, R.E., Mishra, P.K., Srivastava, P., Martinez-Vaz, B.M., Khodursky, A.B., Blumenthal, R.M., 2008. Limited functional conservation of a global regulator among related bacterial genera: Lrp in Escherichia, Proteus and Vibrio. BMC Microbiol. 8, 60. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using ΔΔCT method. Methods 25, 402–408. real-time quantitative PCR and the 2 Marienhagen, J., Eggeling, L., 2008. Metabolic function of Corynebacterium glutamicum aminotransferases alaT and avtA and impact on L-valine production. Appl. Environ. Microbiol. 74, 7457–7462.
75
Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugars. Anal. Chem. 31, 426–428. Nolden, L., Farwick, M., Krämer, R., Burkovski, A., 2001. Glutamine synthetases of Corynebacterium glutamicum: transcriptional control and regulation of activity. FEMS Microbiol. Lett. 201, 91–98. Oldiges, M., Eikmanns, B.J., Blombach, B., 2014. Application of metabolic engineering for the biotechnological production of L-valine. Appl. Microbiol. Biotechnol. 98, 5859–5870. Park, J.H., Lee, K.H., Kim, J.Y., Lee, S.Y., 2007. Metabolic engineering of Escherichia coli for the production of L-valine based on transcriptome analysis and in silico gene knockout simulation. Proc. Natl. Acad. Sci. U.S.A. 104, 7797–7802. Park, J.H., Lee, S.Y., 2009. Fermentative production of branched chain amino acids: a focus on metabolic engineering. Appl. Microbiol. Biotechnol. 85, 491–506. Platko, J.V., Willins, D.A., Calvo, J.M., 1990. The ilvIH operon of Escherichia coli is positively regulated. J. Bacteriol. 172, 4563–4570. Radmacher, E., Vaitsikova, A., Burger, U., Krumbach, K., Sahm, H., Eggeling, L., 2002. Linking central metabolism with increased pathway flux: L-valine accumulation by Corynebacterium glutamicum. Appl. Environ. Microbiol. 68, 2246–2250. Rhee, K.Y., Parekh, B.S., Hatfield, G.W., 1996. Leucine-responsive regulatory proteinDNA interactions in the leader region of the ilvGMEDA operon of Escherichia coli. J. Biol. Chem. 271, 26499–26507. Sahm, H., Eggeling, L., 1999. D-Pantothenate synthesis in Corynebacterium glutamicum and use of panBC and genes encoding L-valine synthesis for D-pantothenate overproduction. Appl. Environ. Microbiol. 65, 1973–1979. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, NY. Sawada, K., Zen-in, S., Wada, M., Yokota, A., 2010. Metabolic changes in a pyruvate kinase gene deletion mutant of Corynebacterium glutamicum ATCC 13032. Metab. Eng. 12, 401–407. Shi, F., Huan, X.J., Wang, X., Ning, J.F., 2012. Over-expression of NAD kinases improves the L-isoleucine biosyntheis in Corynebacterium glutamicumssp. lactofermentum. Enzyme Microb. Technol. 51, 73–80. Van der Rest, M.E., Lange, C., Molenaar, D., 1999. A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Biotechnol. 52, 541–545. Vogt, M., Haas, S., Klaffl, S., Polen, T., Eggeling, L., Ooyen, J., Bott, M., 2014. Pushing product formation to its limit: metabolic engineering of Corynebacterium glutamicum for L-leucine overproduction. Metab. Eng. 22, 40–52. Wang, X., 2012. Metabolic engineering in C. glutamicum to increase L-valine production. J. Food Sci. Biotechnol. 31, 225–231. Xu, D., Tan, Y., Huan, X., Hu, X., Wang, X., 2010. Construction of a novel shuttle vector for use in Brevibacterium flavum, an industrial amino acid producer. J. Microbiol. Methods 80, 86–92. Yin, L., Hu, X., Xu, D., Ning, J., Chen, J., Wang, X., 2012. Co-expression of feedbackresistant threonine dehydratase and acetohydroxy acid synthase increase Lisoleucine production in Corynebacterium glutamicum. Metab. Eng. 14, 542–550. Yin, L., Shi, F., Hu, X., Chen, C., Wang, X., 2013. Increasing L-isoleucine production in Corynebacterium glutamicum by overexpressing global regulator Lrp and twocomponent export system BrnFE. J. Appl. Microbiol. 114, 1369–1377.