Metabolic engineering of Escherichia coli for the production of 1-propanol

Metabolic Engineering 14 (2012) 477–486

Contents lists available at SciVerse ScienceDirect

Metabolic Engineering journal homepage: www.elsevier.com/locate/ymben

Metabolic engineering of Escherichia coli for the production of 1-propanol Yong Jun Choi a,b, Jin Hwan Park a,b, Tae Yong Kim a,b, Sang Yup Lee a,b,c,d,n a

Metabolic and Biomolecular Engineering National Research Laboratory, Department of Chemical and Biomolecular Engineering (BK21 program), Center for Systems and Synthetic Biotechnology, Institute for the BioCentury, KAIST, Daejeon, Republic of Korea BioProcess Engineering Research Center, KAIST, Daejeon, Republic of Korea c Department of Bio and Brain Engineering and Bioinformatics Research Center, KAIST, Daejeon, Republic of Korea d Department of Biological Sciences, KAIST, 335 Gwahangno, Yuseong-gu, Daejeon 305-701, Republic of Korea b

a r t i c l e i n f o

abstract

Article history: Received 3 June 2012 Received in revised form 9 July 2012 Accepted 23 July 2012 Available online 1 August 2012

An engineered Escherichia coli strain that produces 1-propanol under aerobic condition was developed based on an L-threonine-overproducing E. coli strain. First, a feedback resistant ilvA gene encoding threonine dehydratase was introduced and the competing metabolic pathway genes were deleted. Further engineering was performed by overexpressing the cimA gene encoding citramalate synthase and the ackA gene encoding acetate kinase A/propionate kinase II, introducing a modified adhE gene encoding an aerobically functional AdhE, and by deleting the rpoS gene encoding the stationary phase sigma factor. Fed-batch culture of the final engineered strain harboring pBRthrABC-tac-cimA-tac-ackA and pTacDA-tac-adhEmut allowed production of 10.8 g L  1 of 1-propanol with the yield and productivity of 0.107 g g  1 and 0.144 g L  1 h  1, respectively, from 100 g L  1 of glucose, and 10.3 g L  1 of 1-propanol with the yield and productivity of 0.259 g g  1 and 0.083 g L  1 h  1, respectively, from 40 g L  1 glycerol. & 2012 Elsevier Inc. All rights reserved.

Keywords: Escherichia coli 1-propanol L-threonine 2-ketobutyrate In silico metabolic flux analysis Glycerol

1. Introduction 1-propanol is an important industrial chemical that has been used in various industrial products such as paint and cosmetics (Shen and Liao, 2008), and is considered to be a better biofuel than ethanol. It has advantages over ethanol in terms of energy density, combustion efficiency, storage convenience and transportation. Although microbial production of 1-propanol has been demonstrated by Clostridium sp. 17Cr1 and yeast (Eden et al., 2001; Janssen, 2004), the final titers achieved were less than 70 mg L  1. Recently, metabolically engineered Escherichia coli strain harboring 2-keto acid decarboxylase and alcohol/aldehyde dehydrogenase capable of producing 1 g L  1 of 1-propanol via 2-ketobutyrate was developed (Shen and Liao, 2008). Through the introduction of a modified Methanococcus jannaschii citramalate synthase (encoded by cimA) that can directly convert pyruvate to 2-ketobutyrate, created through in vitro evolution, up to 3.5 g L  1 of 1-propanol could be produced (Atsumi and Liao, 2008; Howell et al., 1999). Thermobifida fusca, a cellulolytic microorganism, harboring the Clostridium acetobutylicum ATCC 824 alcohol/ aldehyde dehydrogenase also produced 0.48 g L  1 of 1-propanol

n Corresponding author at: Metabolic and Biomolecular Engineering National Research Laboratory, Department of Chemical and Biomolecular Engineering, Korea Advanced Institute of Science and Technology (KAIST), 335 Gwahangno, Yuseong-gu, Daejeon 305–701, Republic of Korea. Fax: þ82 42 350 8800. E-mail address: [email protected] (S. Yup Lee).

1096-7176/$ - see front matter & 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ymben.2012.07.006

from untreated lignocellulosic biomass as a carbon source via 2-ketobutyrate as a metabolic intermediate (Deng and Fong, 2011). Recently, a wild-type E. coli harboring 1,2-propanediol dehydratase from Klebsiella oxytoca was shown to produce 0.25 g L  1 of 1-propanol following additional engineering of the 1,2-propanediol pathway (Jain and Yan, 2011). Thus, the final 1-propanol titers achieved by employing various engineered microorganism so far are rather low. In most microorganisms, 2-ketobutyrate is a key metabolic intermediate in the biosynthesis of L-isoleucine through L-threonine metabolism. Previous studies on the L-threonine metabolic pathway have shown that L-threonine dehydratase, encoded by the tdc operon (Hesslinger et al., 1998), as well as phosphotransacetylase and acetate kinase A/propionate kinase II, encoded by the pta and ackA genes, respectively, are involved in the degradation of L-threonine (Van Dyk and LaRossa, 1987). Recently, 2-ketoacids, intermediate metabolites in branched amino acid biosynthesis, have been successfully diverted to form structurally similar, but non-natural, alcohols (Atsumi et al., 2008; Berezina, 2012; Mainguet and Liao, 2010; Peralta-Yahya and Keasling, 2010). Among them, 2-ketobutyrate, in particular, has been used as a starting point for the production of 1-butanol and 1-propanol (Shen and Liao, 2008). As the need for biofuel production increases, inexpensive feedstocks are becoming increasingly important for cost-effective production. Glycerol, as a byproduct of biodiesel production, has been receiving much attention as a good substrate for the

478

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

production of chemicals and fuels (Yazdani and Gonzalez, 2007). Moreover, glycerol is more reduced carbon substrate and provides more reducing equivalents compared to glucose. Thus, glycerol is a particularly advantageous carbon source for the production of reduced chemicals with higher yield compared to glucose. A variety of chemicals and fuels including 1-butanol (Malaviya et al., 2011; Nielsen et al., 2009), ethanol (Hu and Wood, 2010; Yazdani and Gonzalez, 2007), succinate (Lee et al., 2001), 1,3-propandiol (Liu et al., 2010) and propionate (Zhu et al., 2010) have been produced using glycerol as a sole carbon source. Taken together, these observations led us to investigate the possibility of efficient production of 1-propanol through amino acid biosynthetic pathway using glucose or glycerol as a carbon source. To achieve this goal, a previously constructed L-threonineoverproducing strain, TH20 (Lee et al., 2007) was employed as a base strain. This strain was engineered to establish a novel pathway leading to the formation of 1-propanol under aerobic condition. The final engineered strain, PRO2, harboring a plasmid overexpressing the atoDA, adhEmut, thrABC, ackA and cimA genes was able to produce more than 10 g L  1 of 1-propanol from glucose or glycerol in aerobic fed-batch fermentation.

2. Materials and methods 2.1. Bacterial strains, plasmids and chromosome manipulation The strains and plasmids constructed and used in this study are listed in Table 1. The primers used for gene cloning and knockout are listed in Table 2. All restriction enzymes were purchased from New England Biolabs (Ipswich, MA, USA). Pfu DNA polymerase for polymerase chain reaction (PCR) was purchased from Solgent (Daejeon, Korea). 2.2. Removal of feedback inhibition of threonine dehydratase The oligonucleotide primers ilvA1 and ilvA2 containing four mutated bases (C1339T, G1341T, C1351G, T1352C) were used to amplify a 1592-bp DNA fragment. Another 577-bp DNA fragment was amplified using the primers ilvA3 (containing the above four mutated bases) and ilvA4. The two DNA fragments were purified

and mixed, and the complete 2115-bp fragment was amplified by overlapping PCR using the primers ilvA1 and ilvA4 (Table 1). The BamHI-PstI-digested 2115-bp PCR fragment was ligated into the BamHI-PstI-digested pSacHR06 to make pSacilvA. Successful substitution of the four bases was confirmed by DNA sequencing. The resultant construct was digested with NheI and self-ligated to remove the 855-bp fragment containing the pMB1 origin of replication. The final construct was then transformed into the TH20 strain harboring pKD46, and the target clone with replaced gene was subsequently identified by positive selection based on the conditional lethal effect of the sacB gene in E. coli.

2.3. Deletion of chromosomal genes and promoter replacement Deletion of the ilvIH and ilvBN operons and the rpoS gene, and replacement of the native promoter of ilvA with trc, were performed using a one-step inactivation method (Datsenko and Wanner, 2000). The l-Red recombinase expression plasmid pKD46 was used to disrupt genes in the chromosome of the TH20 strain with appropriate antibiotic markers. The TH20 strain harboring pKD46 was cultivated at 30 1C, and expression of l recombinase was induced by adding L-arabinose (10 mM). Electrocompetent cells were prepared by a standard protocol. PCR was performed using the plasmid pMloxC (Lee et al., 2007), which contains the antibiotic resistance gene flanked by a loxP sequence (CRE recognition target), as a template, and primers listed in Table 2. The PCR products were transformed into the TH20 strain harboring pKD46. Colonies were selected on LB agar plates containing chloramphenicol (34 mg mL  1). Successful gene replacement with the antibiotic marker was confirmed by direct colony PCR. The antibiotic marker was eliminated using the helper plasmid pJW168 (Palmeros et al., 2000), encoding CRE recombinase. Plasmid pJW168 contains ampicillin and chloramphenicol-resistance markers, and shows temperature-sensitive replication. The CmR-knockout mutants were transformed with pJW168, and ampicillin-resistant transformants were selected on LB agar plates at 30 1C. Several colonies were picked and cultivated without antibiotic marker in LB medium at 42 1C and then examined for the loss of resistance to all antibiotics. Elimination of antibiotic markers was verified by PCR.

Table 1 Bacterial strains and plasmids used in this study. Strains/plasmids Strains W3110 Top10 TH20 PRO1 PRO2 Plasmids pMloxC pJW168 pKD46 pBRthrABC pTac15K pBRthrABC_ptac_cimA pBRthrABC_ptac_cimA_ptac_ackA pTacDA pTacDA_ptac_adhE pTacDA_ptac_adhEmut a b c

Relevant characteristicsa

References/source

Derived from K-12 Cloning host W3110 (DlacI, thrAC1034T, lysCC1055T, Pthr::Ptac, DlysA, DmetA, ilvAC290T, DtdhA, DicllR, Pppc::Ptrc) W3110 (DlacI, thrAC1034T, lysCC1055T, Pthr::Ptac, DlysA, DmetA, ilvAC1139T, G1341T, C1351G, T1352C)T, DtdhA, DicllR, Pppc::Ptrc, DilvIH, DilvBN) W3110 (DlacI, thrAC1034T, lysCC1055T, Pthr::Ptac, DlysA, DmetA, ilvAC1139T, G1341T, C1351G, T1352C)T, DtdhA, DicllR, Pppc::Ptrc, DilvIH, DilvBN, DrpoS)

CGSCb Invitrogenc (Lee et al., 2007) This study

ApR, lox66-CmR-lox71 ApR, Cre recombinase expression plasmid, temperature-sensitive ori ApR, Red recombinase expression plasmid, temperature-sensitive ori ApR, thrABC overexpression vector KmR, tac promoter, p15A ori ApR tac promoter, M. jannaschii cimA, cloned into pBRthrABC ApR tac promoter, M. jannaschii cimA and ackA cloned into pBRthrABC KmR, atoDA cloned into pTac15K KmR, tac promoter, adhE cloned into pTacDA KmR, tac promoter, adhEmut cloned into pTacDA

(Lee et al., 2007) (Palmeros et al., 2000) (Datsenko and Wanner, 2000) (Lee et al., 2007) Lab stock This study This study This study This study

Abbreviations: Ap, ampicillin; km, kanamycin; R, resistance. Coli Genetic Stock Center. Invitrogen, Corp., Carlsbad, CA.

This study

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

479

Table 2 Oligonucleotides used for gene cloning and deletion. a

Name

Sequence (50 -30 )

atoDAf atoDAr adhEf adhEr mutadhE1 mutadhE2 mutadhE3 mutadhE4 tacadhEf tacadhEr cimAf cimAr taccimAf taccimAr ackAf ackAr tacackAf tacackAr ilvIHKOf ilvIHKOr ilvBNKOf ilvBNKOr rpoSKOf rpoSKOr ilvA1 ilvA2 ilvA3 ilvA4

GCCATCTAGAATGAAAACAAAATTGATGAC TATAGCATGCTCATAAATCACCCCGTTGCG TATAGAATTCATGGCTGTTACTAATGTCGC TATTGAGCTCTTAAGCGGATTTTTTCGCTT ACTCGAGCTCGAGACAGACACTGGGAGTAA TACGTCTAGATTAACCCCCCAGTTTCGATT ATCTTCTAGAATCGGAAGCTGTGGTATGGC GTGCTCTAGAAGGCCTGATCAGCTAGCTGTTTCCTGTGTGA TGTGGCATGCTGGCAAATATTCTGAAATGA TATTGCATGCTTAAGCGGATTTTTTCGCTT TATTGAGCTCTTGAGAGACGGTGAACAAAC TATTTCTAGATTACTCTTCCCGGATAAGGC TATCAAGCTTTGGCAAATATTCTGAAATGA TATTAAGCTTTTACTCTTCCCGGATAAGGC CGCGCGAATTCATGTCGAGTAAGTTAGTACT TATTGAGCTCTCAGGCAGTCAGGCGGCTCG TATAGAGCTCACTGCATAATTCGTGTCGCTCA TATTTCTAGATCAGGCAGTCAGGCGGCTCG ATGGAGCTGTTGTCTGGAGCCGAGATGGTCGTCCGATCGCTTATCGATCATAGGTGACACTATAGAACGCG TCAACGCATTATTTTATCGCCGCGCGAAAGTCCGACCACACCAGAGCGAGTAGTGGATCTGATGGGTACC ATGGCAAGTTCGGGCACAACATCGACGCGTAAGCGCTTTACCGGCGCAGATAGGTGACACTATAGAACGCG TTACTGAAAAAACACCGCGATCTTGTTAAACATCGTCGGATCGGACTGATTAGTGGATCTGATGGGTACC AGGTTTTTGACGAAAAGGCCTTAGTAGAATAGGAACCCAGTGATAACGATTAGGTGACACTATAGAACGCG ACAGAAAAGGCCAGCCTCGCTTGAGACTGGCCTTTCTGACAGATGCTTACTAGTGGATCTGATGGGTACC ATACGGATCCTGGTGACCTGATCGCTATCG TGTTGGCGAAGCGCAGAAACGCGCCCGGTGATTCCGGGAATTCGAAGCTGTAGA TCTACAGCTTCGAATTCCCGGAATCACCGGGCGCGTTTCTGCGCTTCGCCAACA AGTCCTGCAGGTGGTTTCGACGCAATAAAA

a

Restriction sites are in italics.

2.4. Construction of pBRthrABC-ptac-cimA-ptac-ackA and pTacDA-ptac-adhEmut For the construction of pTacDA, the atoDA operon was amplified by PCR with the primers atoDAf and atoDAr using the genomic DNA of E. coli W3110 as a template. The PCR product was digested with XbaI and SphI, and ligated with the XbaI-SphIdigested DNA fragment of pTac15K (Qian et al., 2009). The resulting plasmid, pTacDA, contains the atoDA operon under the control of the strong tac promoter. Plasmid pTacDA-ptac-adhEmut was constructed by first cloning the adhEmut gene (Holland-Staley et al., 2000) or native adhE gene into pTac15K using mismatched overlapping PCR or conventional PCR. In case of adhEmut, the oligonucleotide primers mutadhE1 and mutadhE2, containing a single mutated base (C1702T), were used to amplify a 1720-bp DNA fragment. A second 956-bp DNA fragment was amplified using the primers mutadhE3, containing a single mutated base (G1702A), and mutadhE4. The two DNA fragments were purified and mixed, and the complete 2676-bp fragment was amplified by overlapping PCR using the primers mutadhE1 and mutadhE4 (Table 2). The SacI-XbaI-digested 2676-bp PCR fragment was then ligated into SacI-XbaI-digested pTac15K to make pTac15K-adhEmut. In case of native adhE, the adhE gene was amplified by PCR with the oligonucleotide primers adhEf and adhEr using the genomic DNA of E. coli W3110 as a template. The PCR product was digested with EcoRI and SacI, and ligated with EcoRI-SacI-digested DNA fragment of pTac15k. tac-adhEmut and tac-adhE were amplified with the primers tacadhEf and tacadhEr using pTac15K-adhEmut and pTac15K-adhE as a template. The PCR product was digested with SphI and ligated with SphI-digested DNA fragment of pTacDA, yielding pTacDA-tac-adhEmut and pTacDA-tac-adhE. For the construction of pBRthrABC-ptac-cimA, the cimA gene was amplified by PCR with the primers cimAf and cimAr using pGEM-T-easy-CimA (provided by Dr. S.J. Park, Korea Research Institute of Chemical Technology, Daejeon, Republic of Korea) as a

template. The PCR product was digested with SacI and XbaI, and ligated with a SacI-XbaI-digested DNA fragment of pTac15k. The resulting plasmid, pTac15k-cimA, contains the cimA gene under the control of the tac promoter. Plasmid pBRthrABC-ptaccimA was constructed by amplifying the tac-cimA gene with the primers taccimAf and taccimAr using pTac15k-cimA as a template. The PCR product was digested with HindIII and ligated with the HindIII-digested DNA fragment of pBRthrABC (Lee et al., 2007), yielding pBRthrABC-ptac-cimA. For the construction of pBRthrABC-ptac-cimA-ptac-ackA plasmid, the ackA gene was amplified by PCR with the primers ackAf and ackAr using the genomic DNA of E. coli W3110 as a template. The PCR product was digested with EcoRI and SacI, and ligated with the EcoRI-SacI-digested DNA fragment of pTac15k. The resulting plasmid, pTac15K-ackA, contains the ackA gene under the control of the tac promoter. Plasmid pBRthrABC-tac-cimA-tacackA was constructed by amplifying the tac-ackA gene with the primers tacackAf and tacackAr using pTac15K-ackA as a template. The PCR product was digested with SphI and BamHI, and ligated with the SphI-BamHI-digested DNA fragment of pBRthrABC-taccimA, yielding pBRthrABC-tac-cimA-tac-ackA. 2.5. Analytical procedures Cell growth was monitored by measuring the absorbance at 600 nm (OD600) using an Ultrospec3000 spectrophotometer (Pharmacia Biotech, Uppsala, Sweden). Glucose concentration was measured using a glucose analyzer (model 2700 STAT; Yellow Springs Instrument, Yellow Springs, OH, USA). For the analysis of 1-propanol and ethanol, the supernatant obtained by centrifugation and filtration of the sampled culture broth (1 mL) was analyzed by gas chromatography (Agilent 6890N GC System; Agilent Technologies Inc., CA, USA) equipped with a packed column (Supelco Carbopack B AW/6.6% PEG 20 M, 2 m  2 mm ID; Bellefonte, PA, USA) and a flame ionization detector (FID).

480

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

Helium was used as a carrier gas at a flow rate of 17 mL min  1 with the septum purge flow of 3 mL min  1. Conditions for analysis were: inlet heater temperature at 220 1C; oven temperature of 100 1C for 30s, ramping to 135 1C at 10 1C min  1, ramping to 170 1C at 30 1C min  1, and holding at 170 1C for 9 min; and FID at 280 1C. Glycerol and acetic acid concentrations were measured using a high performance liquid chromatography system (ProStar 210; Varian, Palo Alto, CA, USA) equipped with a refractive index detector (Shodex RI-71; Showa Denko K.K., Tokyo, Japan). The MetaCarb 87H column was eluted with 0.01N H2SO4 at 60 1C at a flow rate of 0.6 mL min  1. 2.6. Fermentation Batch and fed-batch cultures were carried out at 31 1C using a semi-defined medium containing (per liter) 20 g glucose or glycerol, 20 g (NH4)2SO4, 2.0 g KH2PO4, 0.4 g MgSO4.7H2O, 3 g yeast extract and 5 mL trace metal solution. The trace metal solution contains (per liter) 10 g FeSO4–7H2O, 1.35 g CaCl2, 2.25 g ZnSO4–7H2O, 0.5 g MnSO4– 4H2O, 1 g CuSO4–5H2O, 0.106 g (NH4)6Mo7O24–4H2O, 0.23 g Na2B4O7– 10H2O, 10 mL 35% HCl. The culture medium was supplemented with 2 mM L-leucine, 2 mM L-isoleucine, 2 mM lysine, 2 mM L-methionine, 2 mM L-valine and 1.5 mM sodium D-pantothenate to compensate for auxotrophy. Kanamycin (40 mg mL  1) and ampicillin (50 mg mL  1) were added to the medium when necessary. Seed culture was prepared by transferring 1 mL of 10 mL overnight culture prepared in LB medium into 250 mL Erlenmeyer flask containing 100 mL LB medium and culturing at 31 1C with shaking at 250 rpm. Cultured cells were used to inoculate a 6.6-L bioreactor (Bioflo 3000; New Brunswick Scientific Co., Edison, NJ, USA) containing 2 L of the semi-defined medium to make the initial OD600 after inoculation of 0.2–0.3. The feeding solution for fed-batch cultivation consisted of 20 g L  1 glycerol or glucose, 2 g L  1 KH2PO4, 1 mM L-isoleucine, 1 mM L-leucine, 1 mM lysine, 1 mM methionine 1 mM valine and 0.75 mM sodium D-pantothenate. When the glycerol or glucose concentration in the culture broth fell below 1 g L  1, 100 mL of feeding solution was added manually. The pH was controlled at 6.0 by automatic feeding of 25% (v/v) NH4OH. The dissolved oxygen concentration was maintained above 40% of air saturation by supplying air at 1 vvm [(air volume) (working volume)  1 min  1] and by automatically controlling the agitation speed up to 1000 rpm. 2.7. In silico metabolic flux analysis The in silico metabolic flux analysis (Lee et al., 2007) was performed using the genome-scale metabolic model E. coli EcoMBEL979, which is same as the iJR904 model (Reed et al., 2003) with slight modifications and consists of 979 metabolic reactions and 814 metabolites (Park et al., 2007). Metabolic flux analysis was performed to examine the effects of using different carbon sources, glucose and glycerol, on 1-propanol production. The objective function used during simulation was maximum 1-propanol production or cell growth rate of the PRO2 strain. During the simulation, the glucose uptake rate was set at 10 mmol gDCW  1 h  1 as a constraint. For the comparison, the glycerol uptake rate was set to 20 mmol gDCW  1 h  1 considering its number of carbons (a half of that of glucose).

3. Results 3.1. Construction of the PRO1 strain through metabolic engineering of the TH20 strain We previously reported the development of an L-threonineoverproducing E. coli strain, TH20, in which the feedback inhibition

of aspartokinase I (encoded by thrA), aspartokinase III (encoded by lysC) and threonine dehydratase (encoded by ilvA) by L-threonine, L-lysine and L-isoleucine, respectively, was removed through targeted mutagenesis of the corresponding enzymes. In the TH20 strain, negative transcriptional regulation was also eliminated by the replacement of the native promoter in the leader region of the thrABC operon with the tac promoter to direct carbon flux towards L-threonine formation (Lee et al., 2007). In this strain, the metA, lysA, tdh and iclR genes were also deleted to make more metabolic precursors available for L-threonine formation, and the native promoter of the ppc gene, encoding phosphoenolpyruvate carboxylase, was replaced with the trc promoter in the chromosome to increase the pool of oxaloacetate, a starting precursor of L-threonine biosynthesis (Fig. 1). The TH20 strain allows constitutive gene expression from trc and tac promoters since the lacI gene was deleted. To make a base strain capable of producing 1-propanol from the TH20 strain, rational metabolic engineering was performed to establish a novel pathway shown in Fig. 1. L-threonine is converted to 2-ketobutyrate, which is spontaneously converted to propionyl-phosphate (Chang and Cronan, 2000). Propionyl-phosphate is then converted to propionate, which is sequentially converted to propionyl-CoA, propionyl-aldehyde, and finally to 1-propanol (Fig. 1). Metabolic engineering was performed to increase the 2-ketobutyrate pool, the main precursor of 1-propanol (Fig. 1). As the first step, the mutated ilvA gene, encoding a mutated threonine dehydratase designed to decrease threonine dehydratase activity (Lee et al., 2007), was restored back to the original ilvA sequence and four mutations (C1339T, G1341T, C1351G, T1352C) were introduced to remove feedback inhibition by L-isoleucine. To make more 2-ketobutyrate available for 1-propanol production, the ilvI, ilvH, ilvB and ilvN genes were deleted from the genome. The resulting strain, named PRO1, was used as a base strain for 1-propanol production. To see if the PRO1 strain can produce 1-propanol, the genes for aspartokinase I and homoserine dehydrogenase I (thrA), homoserine kinase (thrB) and L-threonine synthase (thrC) (Lee et al., 2007), and acetyl-CoA: acetoacetyl-CoA transferase alpha and beta subunits (atoD and atoA) (Clomburg and Gonzalez, 2010; Dellomonaco et al., 2010; Pauli and Overath, 1972) and alcohol/aldehyde dehydrogenase (adhE) from E. coli were overexpressed (Fig. 1). The PRO1 strain harboring pBRthrABC and pTacDA-tac-adhE produced 0.33 g L  1 of 1-propanol from 20 g L  1 of glucose under anaerobic condition (Fig. 2). Thus, the novel pathway from 2-ketobutyrate to 1-propanol was found to be functional as designed. 3.2. Increasing the 2-ketobutyrate pool by introducing citramalate synthase Under anaerobic condition, acetyl-CoA is used for the formation of ethanol, acetate and other undesirable byproducts. When the PRO1 strain harboring pBRthrABC and pTacDA-tac-adhE was cultured under anaerobic condition, much acetyl-CoA was converted to acetate (4.495 g L  1) and ethanol (2.3670.3 g L  1) (Fig. 2). In order to reduce acetate and ethanol formation and redirect the acetyl-CoA flux toward 2-ketobutyrate, the cimA gene from M. jannaschii (Atsumi and Liao, 2008; Howell et al., 1999) encoding citramalate synthase, which catalyzes the condensation of pyruvate and acetyl-CoA, was introduced into the PRO1 strain. The PRO1 strain harboring pBRthrABC-tac-cimA and pTacDA-tacadhE showed more than 40% increase in 1-propanol production (0.436 g L  1) with decreased acetate formation (4.1870.1 g L  1) from 20 g L  1 glucose in anaerobic batch fermentation (Fig. 2). Cell growth was somewhat retarded most likely due to the conversion of acetyl-CoA and pyruvate to 2-ketobutyrate. Ethanol production was similar for the first 36 h, but increased toward the

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

481

Fig. 1. L-threonine biosynthetic pathways and strategies for constructing the synthetic pathway for 1-propanol production in E. coli. Central metabolic pathways for the biosynthesis of L-threonine and the synthetic pathway for 1-propanol with regulatory circuits and competing pathways are shown. Thick arrows indicate increased flux or activity achieved by overexpressing or exchanging the promoter (i.e., with a strong promoter) of the corresponding genes. Dotted lines indicate feedback inhibition. The gray X’s denote genes that are knocked out or inhibitions/repressions that are removed.

Fig. 2. Effects of cimA overexpression on 1-propanol production. Time courses of cell growth, 1-propanol, ethanol and acetate production; and glucose utilization during anaerobic batch fermentation of the PRO1 strain harboring pBRthrABC and pTacDA-tac-adhE with (filled circles) and without (open circles) cimA are shown. All experiments were performed in triplicate; error bars denote standard deviations.

end of fermentation in the case of cimA overexpression. Thus, it was thought that anaerobic fermentation might not be the best choice for the production of 1-propanol. 3.3. Respiro-fermentative production of 1-propanol by employing the aerobically functional alcohol/aldehyde dehydrogenase In most cases, the alcohol production was conducted under anaerobic condition due to oxygen-sensitive alcohol/aldehyde

dehydrogenase (encoded by adhE), which is inactive under aerobic condition. Under anaerobic condition, the adhE gene is expressed in response to the increased level of NADH (Leonardo et al., 1993), and mutants lacking the adhE gene cannot grow well (Clark, 1989). Also, the biosynthesis of amino acids is generally more active under aerobic condition. Since 1-propanol is derived from L-threonine, aerobic fermentation might be more advantageous. In a previous study (Holland-Staley et al., 2000), a mutant alcohol/aldehyde dehydrogenase (encoded by adhEmut) that

482

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

retained its function under aerobic condition was developed. This mutant gene, containing a single amino acid substitution, was successfully employed for the production of several biofuels and chemicals (ethanol, butanol and isopropanol) under respirofermentative conditions (Dellomonaco et al., 2010). Thus, the adhEmut gene instead of native adhE gene was employed to examine the possibility of 1-propanol production under aerobic condition. When the PRO1 strain harboring pBRthrABC-tac-cimA and pTacDA-tac-adhEmut was cultured aerobically, acetate (0.261 g L  1) and ethanol (0.032 g L  1) formation was significantly reduced, while 1-propanol production (0.526 g L  1) was increased by 20% compared with that obtained with a strain harboring the adhE gene cultured under anaerobic condition (Fig. 3A). Moreover, the yield was increased by 19% (from 0.021 to 0.025 g g  1) and the volumetric productivity was increased by 3.5-fold from 0.009 to 0.032 g L  1 h  1 (Fig. 3B). However, the specific productivity was decreased by 50% from 0.022 to 0.011 g gDCW  1 h  1. Since L-threonine is used both for 1-propanol and biomass formation, the increased biomass formation under aerobic condition seems to have caused the reduced specific productivity.

3.4. Effect of amplifying acetate kinase A/propionate kinase II on 1-propanol production The recombinant PRO1 strain harboring the above plasmids produces 1-propanol employing the inherent E. coli acetate kinase A/propionate kinase II (encoded by ackA) under aerobic condition and the inherent propionate kinase/acetate kinase C (encoded by tdcD) under anaerobic condition. Thus, the effect of acetate kinase A/propionate kinase II overexpression on 1-propanol production was examined under aerobic condition. The recombinant PRO1 strain harboring pBRthrABC-tac-cimA-tac-ackA and pTacDA-tacadhEmut produced 0.6 g L  1 of 1-propanol from 20 g L  1 glucose, which is more than 15% increase compared with that obtained without the overexpression of the ackA gene in aerobic batch fermentation (Fig. 4).

3.5. Effect of knocking-out the sigma factor RpoS The stationary phase sigma factor (encoded by rpoS) regulates the expression of a set of genes involved in the stress response in E. coli. In mutants lacking the rpoS gene, the growth rate is similar to that of the wild type, while acetate production is significantly reduced (Matsuoka and Shimizu, 2011; Rahman and Shimizu, 2008). Knocking out the rpoS gene also results in increased expression of genes for most TCA cycle enzymes, including citrate synthase, isocitrate dehydrogenase, malate dehydrogenase, and succinate dehydrogenase. It was also found that pyruvate, phosphoenolpyruvate and oxaloacetate accumulate in the rpoS mutant during the stationary growth phase, and L-threonine metabolism is dramatically up-regulated (Rahman et al., 2006). Therefore, the rpoS gene was selected as a target gene to be knocked out for reducing acetate formation while reinforcing the L-threonine metabolism. The rpoS gene was knocked out from the genome of the PRO1 strain, to construct the PRO2 strain. The PRO2 strain harboring pBRthrABC-tac-cimA-tac-ackA and pTacDA-tacadhEmut produced 1.3870.1 g L  1 of 1-propanol with a yield of 0.069 g g  1 and productivity of 0.077 g L  1 h  1 from 20 g L  1 glucose by aerobic batch fermentation. The yield and productivity were increased by 129% and 103%, respectively, compared to those obtained with the PRO1 strain harboring the same plasmids (Fig. 5). Fed-batch culture of this recombinant strain allowed production of 10.8 g L  1 of 1-propanol production with the yield of 0.107 g g  1 (24.1% of the theoretical maximum yield) and productivity of 0.144 g L  1 h  1 from 100 g L  1 of glucose under aerobic fermentation (Table 3). Acetate formation during the earlier phase of batch fermentation of the recombinant PRO2 strain was much less than that of the recombinant PRO1 strain, but it became similar towards the end of fermentation (Fig. 5). 3.6. Production of 1-propanol from glycerol and in silico metabolic flux analysis Since 1-propanol is a reduced product, it was reasoned that glycerol, which is more reduced carbon source than glucose,

Fig. 3. Effects of aerobically functional alcohol/aldehyde dehydrogenase (adhEmut) on 1-propanol production. (A) Time courses of cell growth, 1-propanol, ethanol and acetate production; and glucose utilization are shown. (B) The introduction of adhEmut substantially increased the productivity and yield of 1-propanol production. All experiments were performed in triplicate; error bars denote standard deviations.

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

483

Fig. 4. Effects of ackA overexpression on 1-propanol production. Time courses of cell growth, 1-propanol, ethanol and acetate production; and glucose utilization during aerobic batch fermentation of the PRO1 strain harboring pBRthrABC-tac-cimA and pTacDA-tac-adhEmut with (filled circles) and without (open circles) ackA are shown. All experiments were performed in triplicate; error bars denote standard deviations.

Fig. 5. Effects of rpoS deletion on 1-propanol production. Time courses of cell growth, 1-propanol, ethanol and acetate production; and glucose utilization during aerobic batch fermentation of PRO1 strain harboring pBRthrABC-tac-cimA-tac-ackA and pTacDA-tac-adhEmut and PRO2 strain harboring same plasmids. All experiments were performed in triplicate; error bars denote standard deviations.

might be a better carbon source (Yazdani and Gonzalez, 2007). Metabolic flux analyses were performed using glucose or glycerol as a carbon source. As can be seen from Fig. 7, the specific 1-propanol production rate was higher when glycerol was used as a carbon source. To examine if this was indeed due the additional reducing power generated, we artificially removed NADH formation by glycerol dehydrogenase reaction and performed simulation again. As shown in Fig. 7, the specific 1-propanol production rate decreased to the level obtained with glucose. Based on the simulation results, aerobic batch culture of the PRO2 strain harboring pBRthrABC-tac-cimA-tac-ackA and pTacDA-tac-adhEmut was performed; 4.18 g L  1 of 1-propanol from 20 g L  1 glycerol was produced (Fig. 6B). It should be

emphasized that ethanol and acetate were not produced when glycerol was used as a carbon source. The resulting yield (0.209 g g  1) and productivity (0.096 g L  1 h  1) represent approximately 150% and 25% increases, respectively, compared to those obtained with glucose (Fig. 6A and Table 3). Fed-batch culture of this recombinant strain allowed production of 10.3 g L  1 of 1-propanol with the yield of 0.259 g g  1 (52.2% of the theoretical maximum yield) and productivity of 0.083 g L  1 h  1 from 40 g L  1 glycerol under aerobic condition (Fig. 6C and Table 3). Again, ethanol and acetate were not produced during the fed-batch culture by using glycerol as a carbon source. Interestingly, 4 g L  1 of propionic acid was not converted to 1-propanol and accumulated at the end of fed-batch fermentation using glycerol (Fig. 6C).

484

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

Table 3 Comparison of fed-fermentation profiles of the PRO2 strain harboring pBRthrABC-tac-cimA-tac-ackA, pTacDA-tac-adhEmut cultured using glucose or glycerol as a carbon source. 1-propanol titer (g L  1)

Glucose Glycerol

Batch

Final

Carbon source (g)

1.38 4.18

10.69 10.36

200 80

Final cell density (OD600) 29.5 24.5

1-propanol yield (g g  1)

Volumetric productivity (g L  1 h  1)

Batch phase 0.069a 0.209c

Batch phase 0.077 0.096

Fed-batch phase 0.107b 0.259d

Fed-batch phase 0.144 0.083

a and b 15.5% and 24.1% of the theoretical yield, respectively. c and d 42.1% and 52.2% of the theoretical yield, respectively.

Fig. 6. Fermentation profiles of the PRO2 harboring pBRthrABC-tac-cimA-tac-ackA and pTacDA-tac-adhEmut cultured using two different carbon sources under aerobic condition. Batch fermentation was conducted using (A) glucose, (B) glycerol, and (C) fed-batch fermentation was conducted using glycerol as a carbon source.

Fig. 7. In silico flux-response analysis under two different carbon sources (A) 1-propanol production rate in response to varying growth rates was examined by in silico flux-response analysis under two different carbon sources. (B) Comparison of glucose and glycerol metabolism under aerobic fermentative conditions in E. coli.

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

Since propionic acid was not produced during the glycerol batch fermentation, studies are needed to understand this phenomenon and consequently to further increase 1-propanol production.

4. Discussion Production of biofuels from renewable biomass has been receiving much attention due to the limited nature of fossil resources and environmental problems caused by using them. 1-propanol is one of the next generation alternative fuels, in terms of energy density, combustion efficiency, storage convenience and transportation. To date, 1-propanol has been produced mainly by the strategy of employing ketoacid decarboxylase from Lactococcus lactis, alcohol dehydrogenase 2 from Saccharomyces cerevisiae (Atsumi et al., 2008; Shen and Liao, 2008) and evolved citramalate synthase (encoded by cimA). Recently, a new pathway for 1-propanol production by expanding the 1,2-propanediol pathway with combination of 1,2-propanediol dehydratase and alcohol dehydrogenase was also reported (Jain and Yan, 2011). There have so far been fewer reports on the bio-based production of 1-propanol by metabolic engineering. Also, most studies employed anaerobic fermentation condition due to the oxygensensitive alcohol/aldehyde dehydrogenase. It was reasoned that 1-propanol production using the L-threonine pathway might be more efficient under aerobic condition as the biosynthesis of metabolite and biomass formation is generally more active under aerobic condition. Thus, our study aimed at developing a metabolically engineered E. coli strain capable of producing 1-propanol from L-threonine via 2-ketobutyrate as an intermediate metabolite under aerobic condition. 2-ketobutyrate is spontaneously converted to propionyl-phosphate. Then, propionyl-phosphate is further converted to propionate, which is sequentially converted to propionyl-CoA, propionyl-aldehyde, and finally to 1-propanol. It has been reported that acetyl-CoA:acetoacetyl-CoA transferase (encoded by the atoDA operon) plays an important role in short chain fatty acid metabolism (Chen et al., 1991; Jenkins and Nunn, 1987). Despite of a bifunctional acetyl-CoA synthetase and propionyl-CoA transferase (acs) in E. coli, the acs gene product has been studied mainly related to acetate metabolism (Lin et al., 2006). As propionate is one of the short chain fatty acid, the E. coli atoDA system was used for converting propionate to propionylCoA. System-wide metabolic engineering strategies including deregulation of negative regulatory circuits, amplification of pathway enzymes, and replacement of anaerobic alcohol/aldehyde dehydrogenase with aerobically functional one all contributed to the development of a better 1-propanol producing strain. It has been reported that acetate formation during cell growth is regulated by sigma factor S (encoded by rpoS), and much less acetate is produced and L-threonine metabolism is up-regulated in rpoS deletion mutant E. coli strain compared to the wild type strain (Rahman et al., 2006). Thus, it was reasoned that deletion of RpoS would partially reduce acetate formation and increase 1-propanol production. Indeed, 1-propanol production could be significantly enhanced (from 0.6 g L  1 to 1.38 70.1 g L  1; Fig. 5), and the yield and productivity were also increased by 129% and 103%, respectively by deleting the rpoS gene. However, it is notable that acetate formation was not significantly reduced at the end of fermentation. A similar result was reported in a previous report (Rahman et al., 2006). Not all the attempts we made led to successful results on improving 1-propanol production. There has been a report on enhanced biopolymer production from propionyl-CoA by knocking out the 2-methylcitrate synthase (prpC) (Chen et al., 2011). When the prpC gene was knocked out in the PRO2 strain harboring pBRthrABC-tac-cimA-tac-ackA and pTacDA-tac-adhEmut,

485

cell growth was significantly retarded without any improvement in 1-propanol production. In silico gene knock-out simulation identified succinyl-CoA synthase alpha and beta subunit (encoded by sucD and sucC) as knockout targets for the enhanced 1-propanol production by in silico knockout simulation. However, deletion of sucCD operon did not allow higher 1-propanol production because of retarded cell growth (data not shown), possibly because these enzymes in the TCA cycle are critical for cell growth in aerobic condition. Also, it was observed that about 4 g L  1 of propionic acid was not converted to 1-propanol and accumulated at the end of glycerol fermentation (Fig. 6C). It seems that the accumulated propionic acid seems to inhibit cell growth and glycerol uptake, leading to lower 1-propanol production in the later phase of fermentation. Further studies are needed to address this problem and increase 1-propanol production. Finally, glycerol fermentation has become an attractive for reduced chemical production due to their reduced nature of glycerol resulting in the generation of more reducing equivalents. Hence, high yield of butanol production was reported by using glycerol as a carbon source (Yazdani and Gonzalez, 2007). However, it has not been reported to produce 1-propanol by glycerol fermentation. Therefore, we exploited these advantages on 1-propanol production. The PRO2 strain harboring pBRthrABC-tac-cimAtac-ackA and pTacDA-tac-adhEmut produced 10.3 g L  1 of 1-propanol with yield of 0.259 g g  1 and productivity of 0.083 g L  1 h  1 from 40 g L  1 glycerol under aerobic condition. Moreover, we demonstrated that 1-propanol yield could be increased on glycerol fermentation by in silico flux response analysis.

5. Conclusion In this study, we reported the development of a metabolically engineered E. coli strain capable of efficiently producing 1-propanol under respiro-fermentative conditions by (1) releasing feedback inhibition of amino acid biosynthesis and deleting competing metabolic pathways, (2) concentrating the carbon flux from L-threonine to 2-ketobutyrate using a feedback-resistant ilvA gene, (3) introducing a modified adhE gene encoding aerobically functional alcohol/aldehyde dehydrogenase instead of native one to produce 1-propanol under aerobic condition, (4) overexpression of the ackA gene to efficiently convert propionyl-phosphate to propionate, and (5) deleting the rpoS gene encoding a stress response global regulator. It was also demonstrated that both glucose and glycerol can be efficiently employed for 1-propanol production. Fed-batch culture of the final engineered strain allowed production of 10.8 g L  1 of 1-propanol with the yield and productivity of 0.107 g g  1 and 0.144 g L  1 h  1, respectively, from 100 g L  1 of glucose, and 10.3 g L  1 of 1-propanol with the yield and productivity of 0.259 g g  1 and 0.083 g L  1 h  1, respectively, from 40 g L  1 glycerol under aerobic condition. Further studies are underway to increase the performance of 1-propanol production by increasing 1-propanol formation without propionate accumulation, increasing the specific 1-propanol productivity under aerobic condition, and genome-scale gene amplification/ knock-out simulation.

Acknowledgments We thank W. J. Kim and Y. B. Kim for helpful discussion of in silico simulation. This work was supported by the Advanced Biomass Research and Development Center of Korea (ABC-2011– 0028386) through the Global Frontier Research Program (GFRP) of the Ministry of Education, Science and Technology (MEST). Further supports by the Project for Developing Systems Metabolic

486

Y. Jun Choi et al. / Metabolic Engineering 14 (2012) 477–486

Engineering Platform Technologies for Biorefineries, Technology Development Program to Solve Climate Changes (NRF-2012C1AAA001-2012M1A2A2026556) and the World Class University program (R32-2008-000–10142-0) of MEST are appreciated. References Atsumi, S., Hanai, T., Liao, J.C., 2008. Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature 451, 86–89. Atsumi, S., Liao, J.C., 2008. Directed evolution of Methanococcus jannaschii citramalate synthase for biosynthesis of 1-propanol and 1-butanol by Escherichia coli. Appl. Environ. Microbiol. 74, 7802–7808. Berezina, N., 2012. Enhancing the 3-hydroxyvalerate component in bioplastic PHBV production by Cupriavidus necator. Biotechnol. J. 7, 304–309. Chang, Y.Y., Cronan Jr., J.E., 2000. Conversion of Escherichia coli pyruvate oxidase to an ’alpha-ketobutyrate oxidase. Biochem. J. 352 (3), 717–724. Chen, C.Y., Hogarth, L.A., Shanley, M.S., 1991. Regulatory sequences controlling short chain fatty acid metabolism in Escherichia coli. SAAS Bull. Biochem. Biotechnol. 4, 22–26. Chen, Q., Wang, Q., Wei, G., Liang, Q., Qi, Q., 2011. Production in Escherichia coli of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) with differing monomer compositions from unrelated carbon sources. Appl. Environ. Microbiol. 77, 4886–4893. Clark, D.P., 1989. The fermentation pathways of Escherichia coli. FEMS Microbiol. Rev. 5, 223–234. Clomburg, J.M., Gonzalez, R., 2010. Biofuel production in Escherichia coli: the role of metabolic engineering and synthetic biology. Appl. Microbiol. Biotechnol. 86, 419–434. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Nat. Acad. Sci. U.S.A. 97, 6640–6645. Dellomonaco, C., Rivera, C., Campbell, P., Gonzalez, R., 2010. Engineered respirofermentative metabolism for the production of biofuels and biochemicals from fatty acid-rich feedstocks. Appl. Environ. Microbiol. 76, 5067–5078. Deng, Y., Fong, S.S., 2011. Metabolic engineering of Thermobifida fusca for direct aerobic bioconversion of untreated lignocellulosic biomass to 1-propanol. Metab. Eng. 13, 570–577. Eden, A., Van Nedervelde, L., Drukker, M., Benvenisty, N., Debourg, A., 2001. Involvement of branched-chain amino acid aminotransferases in the production of fusel alcohols during fermentation in yeast. Appl. Microbiol. Biotechnol. 55, 296–300. Hesslinger, C., Fairhurst, S.A., Sawers, G., 1998. Novel keto acid formate-lyase and propionate kinase enzymes are components of an anaerobic pathway in Escherichia coli that degrades L-threonine to propionate. Mol Microbiol. 27, 477–492. Holland-Staley, C.A., Lee, K.S., Clark, D.P., Cunningham, P.R., 2000. Aerobic activity of Escherichia coli alcohol dehydrogenase is determined by a single amino acid. J. Bacteriol. 182, 6049–6054. Howell, D.M., Xu, H., White, R.H., 1999. (R)-citramalate synthase in methanogenic archaea. J. Bacteriol. 181, 331–333. Hu, H., Wood, T.K., 2010. An evolved Escherichia coli strain for producing hydrogen and ethanol from glycerol. Biochem. Biophys. Res. Commun. 391, 1033–1038. Jain, R., Yan, Y., 2011. Dehydratase mediated 1-propanol production in metabolically engineered Escherichia coli. Microb. Cell Factors 10, 97. Janssen, P.H., 2004. Propanol as an end product of threonine fermentation. Arch. Microbiol. 182, 482–486. Jenkins, L.S., Nunn, W.D., 1987. Genetic and molecular characterization of the genes involved in short-chain fatty acid degradation in Escherichia coli: the ato system. J Bacteriol. 169, 42–52.

Lee, K.H., Park, J.H., Kim, T.Y., Kim, H.U., Lee, S.Y., 2007. Systems metabolic engineering of Escherichia coli for L-threonine production. Mol. Syst. Biol. 3, 149. Lee, P.C., Lee, W.G., Lee, S.Y., Chang, H.N., 2001. Succinic acid production with reduced by-product formation in the fermentation of Anaerobiospirillum succiniciproducens using glycerol as a carbon source. Biotechnol. Bioeng. 72, 41–48. Leonardo, M.R., Cunningham, P.R., Clark, D.P., 1993. Anaerobic regulation of the adhE gene, encoding the fermentative alcohol dehydrogenase of Escherichia coli. J. Bacteriol. 175, 870–878. Lin, H., Castro, N.M., Bennet, G.N., San, K.Y., 2006. Acetyl-CoA synthetase overexpression in Escherichia coli demonstrates more efficient acetate assimilation and lower acetate accumulation: a potential tool in metabolic engineering. Appl. Microbiol. Biotechnol. 71, 870–874. Liu, H., Xu, Y., Zheng, Z., Liu, D., 2010. 1,3-Propanediol and its copolymers: research, development and industrialization. Biotechnol. J. 5, 1137–1148. Mainguet, S.E., Liao, J.C., 2010. Bioengineering of microorganisms for C(3) to C(5) alcohols production. Biotechnol. J. 5, 1297–1308. Malaviya, A., Jang, Y.S., Lee, S.Y., 2011. Continuous butanol production with reduced byproducts formation from glycerol by a hyper producing mutant of Clostridium pasteurianum. Appl. Microbiol. Biotechnol 93, 1485–1494. Matsuoka, Y., Shimizu, K., 2011. Metabolic regulation in Escherichia coli in response to culture environments via global regulators. Biotechnol. J. 6, 1330–1341. Nielsen, D.R., Leonard, E., Yoon, S.H., Tseng, H.C., Yuan, C., Jones Prather, K.L., 2009. Engineering alternative butanol production platforms in heterologous bacteria. Metab. Eng. 11, 262–273. Palmeros, B., Wild, J., Szybalski, W., Le Borgne, S., Hernandez-Chavez, G., Gosset, G., Valle, F., Bolivar, F., 2000. A family of removable cassettes designed to obtain antibiotic-resistance-free genomic modifications of Escherichia coli and other bacteria. Genetics 247, 255–264. Park, J.H., Lee, W.H., Kim, T.Y., Lee, S.Y., 2007. Metabolic engineering of Escherichia coli for the production of L-valine based on transcriptome analysis and in silico gene knockout simulation. Proc. Nat. Acad. Sci. U.S.A. 104, 7797–7802. Pauli, G., Overath, P., 1972. ato Operon: a highly inducible system for acetoacetate and butyrate degradation in Escherichia coli. Eur. J. Biochem. 29, 553–562. Peralta-Yahya, P.P., Keasling, J.D., 2010. Advanced biofuel production in microbes. Biotechnol. J. 5, 147–162. Qian, Z.G., Xia, X.X., Lee, S.Y., 2009. Metabolic engineering of Escherichia coli for the production of putrescine: a four carbon diamine. Biotechnol. Bioeng. 104, 651–662. Rahman, M., Hasan, M.R., Oba, T., Shimizu, K., 2006. Effect of rpoS gene knockout on the metabolism of Escherichia coli during exponential growth phase and early stationary phase based on gene expressions, enzyme activities and intracellular metabolite concentrations. Biotechnol. Bioeng. 94, 585–595. Rahman, M., Shimizu, K., 2008. Altered acetate metabolism and biomass production in several Escherichia coli mutants lacking rpoS-dependent metabolic pathway genes. Mol. Biosyst. 4, 160–169. Reed, J.L., Vo, T.D., Schilling, C.H., Palsson, B.O., 2003. An expanded genome-scale model of Escherichia coli K-12 (iJR904 GSM/GPR). Genome Biol. 4, R54. Shen, C.R., Liao, J.C., 2008. Metabolic engineering of Escherichia coli for 1-butanol and 1-propanol production via the keto-acid pathways. Metab. Eng. 10, 312–320. Van Dyk, T.K., LaRossa, R.A., 1987. Involvement of ack-pta operon products in alpha-ketobutyrate metabolism by Salmonella typhimurium. Mol. Genet. 207, 435–440. Yazdani, S.S., Gonzalez, R., 2007. Anaerobic fermentation of glycerol: a path to economic viability for the biofuels industry. Curr. Opin. Biotechnol. 18, 213–219. Zhu, Y., Li, J., Tan, M., Liu, L., Jiang, L., Sun, J., Lee, P., Du, G., Chen, J., 2010. Optimization and scale-up of propionic acid production by propionic acidtolerant Propionibacterium acidipropionici with glycerol as the carbon source. Bioresour. Technol. 101, 8902–8906.