- Email: [email protected]
Metformin ameliorates TGF-β1–induced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting β-catenin signaling
Biochemical and Biophysical Research Communications xxx (2018) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling Fayuan Liu a, Chong Chu a, Qinyu Wei b, Jiawei Shi a, Huadong Li a, *, Nianguo Dong a, ** a Department of Cardiovascular Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430022, China b Department of Epidemiology and Biostatistics, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 April 2018 Accepted 17 April 2018 Available online xxx
Osteoblastic differentiation of aortic valve interstitial cells (AVICs) is the central process in the development of calcific aortic valve disease (CAVD). Metformin is a widely used first-line antidiabetic drug, and recently, pleiotropic benefits of metformin beyond hypoglycemia have been reported in the cardiovascular system. Here, we examined the effect of metformin on the osteoblastic differentiation of human AVICs. Our results showed that metformin ameliorated TGF-b1einduced production of osteogenic proteins Runx2 and osteopontin as well as calcium deposition in the cultured human AVICs. Experiments using AICAR, Compound C and AMPKa siRNA showed that the beneficial effect of metformin on TGF-b1einduced osteoblastic differentiation of human AVICs was mediated by AMPKa. Moreover, metformin inhibited the TGF-b1einduced activation of b-catenin, and b-catenin siRNA blocked TGF-b1 einduced osteoblastic differentiation of AVICs. Smad2/3 and JNK were phosphorylated to promote the TGF-b1einduced activation of b-catenin and osteoblastic differentiation of AVICs, and metformin also alleviated TGF-b1einduced activation of Smad2/3 and JNK. In conclusion, our results suggest a beneficial effect of metformin based on the prevention of osteoblastic differentiation of human AVICs via inhibition of b-catenin, which indicates the therapeutic potential of metformin for CAVD. © 2018 Published by Elsevier Inc.
Keywords: CAVD Metformin AVICs Osteoblastic differentiation b-catenin TGF-b1
1. Introduction Calcific aortic valve disease (CAVD) has been the most common heart valve disease among people over the age of 65 in western countries. However, there are no available pharmacological interventions to prevent this disease, and aortic valve replacement is the only effective treatment for CAVD patients [1]. Although the pathologic mechanism of CAVD remains incompletely understood, CAVD is now recognized as an active and multifactor regulated pathological process, rather than simply a result of aging and degeneration [2,3]. Aortic valve interstitial cells (AVICs) are the most prevalent cell type in aortic valves, and the osteoblastic differentiation of AVICs plays a pivotal role in aortic valve
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (H. Li), [email protected] (N. Dong).
calcification [4,5]. Such differentiation of AVICs can be activated by many mediators including oxidized-low density lipoprotein (oxLDL) and pro-inflammatory cytokines such as interleukin (IL)-1, IL6 and transforming growth factor- b1 (TGF-b1) [5,6]. The resulting osteoblast-like cells express osteogenic transcription factors Runx2, MSX2, SOX9, etc., which further increases the production of bone matrix proteins such as osteocalcin, osteopontin and bone sialoprotein and promotes the synthesis of collagens and alkaline phosphate kinase (ALP) activity, all of which ultimately lead to the deposition of calcium nodules within aortic valve leaflets [3,4,7]. Metformin is widely used to lower blood glucose in patients with type 2 diabetes mellitus (T2DM), and activation of 50 -adenosine monophosphate-activated protein kinase (AMPK) has been identified as a major mechanism by which metformin exerts its anti-T2DM effect [8,9]. Recent studies demonstrated that metformin also has protective effects in cardiovascular diseases and cancer beyond lowering blood glucose levels, and these effects include the inhibition of vascular calcification in aortic smooth muscle cells
https://doi.org/10.1016/j.bbrc.2018.04.141 0006-291X/© 2018 Published by Elsevier Inc.
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
2
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
(SMCs) [10,11]. Interestingly, activation of AMPK was shown to negatively regulate the differentiation of chondrocytes and osteoblasts [12,13]. Additional studies revealed that ablation or inactivation of AMPK promotes aortic arterial calcification in vivo, and treatment with metformin inhibited arterial calcification in vivo and in vitro [14,15]. However, it is unknown whether metformin attenuates the osteoblastic differentiation of human AVICs. Here, we investigated the effect of metformin on the osteoblastic differentiation of human AVICs induced by TGF-b1 and further explored the associated signaling mechanisms. 2. Materials and methods 2.1. Human aortic valve collection Relatively healthy aortic valve leaflets were obtained intraoperatively from five patients undergoing Bentall operation due to acute type I aortic dissection in the Department of Cardiovascular Surgery of Wuhan Union Hospital through a protocol that conformed to the principles of the Declaration of Helsinki and was approved by the Institutional Review Board of Union Hospital and Tongji Medical College. The five patients, whose ages ranged from 39 to 53 years, were all males with no history of diabetes, infective endocarditis, rheumatic heart disease, or a congenital bicuspid aortic valve. Valves were obtained in a sterile environment, preserved in Dulbecco's modified Eagle's medium (DMEM; Hyclone, USA) pre-chilled to 4 C, and transported to the laboratory on ice. 2.2. Cell culture and treatments Human AVICs were isolated and characterized as previously described [16,17]. AVICs from passages 3e5 were used in all experiments. Cells were cultured in DMEM containing 10% fetal bovine serum (FBS; Gibco, New Zealand), 100 U/ml penicillin, and 100 U/mL streptomycin (Gibco, USA), in a humidified incubator at 37 C. When the cultured AVICs reached 70%e80% confluency, the medium was changed to DMEM containing only 2% FBS overnight, and cells were treated with various concentrations of recombinant human TGF-b1 (R&D Systems, USA) for various periods. As appropriate, pharmacological reagents, including metformin, 5-amino-1b-D-ribofuranosyl-imidazole-4-carboxamide (AICAR), Compound C, and SP600125 (all purchased from Selleck Chemicals, USA) were added to the culture medium 2 h before the addition of TGF-b1. 2.3. Western blotting Total protein or nuclear protein lysates were extracted from cultured AVICs using commercial sample buffers (Thermo Fisher, USA) according to the manufacturer's instructions. Protein samples were electrophoretically separated on a 10% acrylamide gel and blotted onto polyvinylidene difluoride membranes. Nonspecific binding was blocked by incubating the membrane in 5% non-fat milk in a TBS-T solution at room temperature for 1 h. Membranes were then incubated with appropriate primary antibodies overnight at 4 C. Specific binding was detected via the use of horseradish peroxidase (HRP)-conjugated secondary antibodies and an enhanced chemiluminescence (ECL) Western Blotting Kit (Thermo, USA). The density of each band was analyzed using ImageJ software (NIH, USA). The primary antibodies used in this study were: anti-Runx2 (ab23981,1:500), anti-osteopontin (ab8448, 1:500), anti-vimentin (ab8978,1:50) and anti-alpha smooth muscle actin (aSMA; ab5694, 1:100) from Abcam (UK) along with anti-phospho-p38 (Thr180/ Tyr182) (4511, 1:1000), anti-P38 (#8690, 1:1000), anti-phospho-p44/ 42 mitogen-activated protein kinase(ERK1/2)(Thr202/Tyr204) (#4377, 1:1000), anti-ERK (#4695, 1:1000), anti-phospho-c-Jun N-
terminal kinase (JNK; Thr183/Tyr185) (#4668, 1:1000), anti-JNK (#9252, 1:1000), anti-phospho-glycogen synthase kinase 3b (GSK3b)(Ser9) (#5558, 1:1000), anti-GSK3b (#12456, 1:1000), anti-phospho-AMPKa(Thr172) (#2535, 1:1000), anti-AMPKa (#5832, 1:1000), anti-phospho-Smad2(Ser465/467)/Smad3(Ser423/ 425)(#9510, 1:1000), anti-Smad2/3(#8685, 1:1000), anti-non-phospho(active)b-catenin(Ser33/37/Thr41) (#8814, 1:1000), and anti-bcatenin (#8480, 1:1000) from Cell Signaling Technology (USA). Antiglyceraldehyde-3-phosphate dehydrogenase (GAPDH; 60004-1-Ig, 1:5000) was purchased from Proteintech (China). 2.4. Cell viability AVICs cultured in 96-well plates were treated with various concentrations of metformin (0.2, 0.5, 1, 2 or 5 mM) for 72 h, and the 3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide, yellowtetrazole (MTT) assay was conducted to measure cell viability as previously described [18]. 2.5. Immunofluorescence staining AVICs were cultured in 3.5-mm glass-bottomed dishes (NEST, China), and TGF-b1 was added to the culture medium for 12 h with or without pretreatment with metformin. After treatment, cells were stained as previously described [17]. 2.6. Gene knock-down To silence AMPKa, b-catenin, or Smad2/3, cultured AVICs at 70%e80% confluency were transfected with specific siRNA (100 nM) or scramble siRNA (100 nM) using the Lipofectamine 3000 Transfection Reagent (Life Technologies, USA) according to the manufacturer's recommendations. The AMPKa siRNA consisted of three distinct RNA sequences (si-AMPKa #1 CACAGAAG GAUUUAAAUAUUGAGGG, si-AMPKa #2 CCCAUCCUGAAAGAGUACCAUUCUU and si-AMPKa #3 ACCAUGAUUGAUGAAGCCUUAA) all purchased from Life Technologies (1299001). The b-catenin siRNA (sc-29209) and Smad2/3 siRNA (sc-37238) were purchased from Santa Cruz Biotechnology (USA). After transfection with siRNA for 6 h, the culture medium was changed and AVICs were cultured for an additional 48 h before being lysed for validation of knockdown or stimulated with TGF-b1 with or without metformin pretreatment. 2.7. Alizarin Red S staining AVICs were cultured in 24-well plates, and cells were treated with different interventions upon reaching 70%e80% confluency in the calcific conditioning medium (DMEM with 2% FBS, 10 mmol/L b-glycerophosphate and 8 mmol/L CaCl2) for 21 days. The medium was exchanged every 3 days during this culture period. Alizarin Red S staining was then conducted using a commercial Alizarin Red S staining kit (ScienCell, #0223, USA) as previously described [17]. 2.8. Statistical analysis All experiments were independently replicated in cells from at least three different human aortic valves, and the results are presented as mean ± standard deviation (SD). Kolmogorov-Smirnov test was used to confirm that all variables were normally distributed. Differences between two groups were evaluated via student's t-test. P < 0.05 were considered statistically significant.
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
3. Results and discussion 3.1. TGF-b1 induces osteoblastic differentiation in human AVICs AVICs are highly plastic cells that have been considered myofibroblasts based on their expression of both a-SMA and vimentin [1,19]. We isolated AVICs from relatively normal human aortic valves and confirmed this phenotype by immunofluorescence staining for these two markers (Fig. 1A). Over the past decade, AVICs have been widely accepted as the major source of osteoblastlike cells in calcified aortic valves [1,3]. The osteoblastic differentiation of AVICs is not fully characterized, but appears to be the central step in the pathology process of CAVD. Many mediators can stimulate AVICs to transdifferentiate into osteoblastic-like cells upon binding to receptors on these cells that activate calcific pathways, including the Wnt/b-catenin, Notch, nuclear factor kappa B (NF-kB), and receptor activator of nuclear factor kappa B (RANK)/receptor activator of nuclear factor kappa B ligand(RANKL)/ osteoprotegerin (OPG) pathways [3,7]. Previous studies revealed that TGF-b1 is present in calcific human aortic valves and promotes AVIC calcification via apoptosis [20]. Song etc. also demonstrated that TGF-b1 induces osteoblastic differentiation of AVICs [21]. We therefore tested the osteogenic effects of TGF-b1 on human AVICs using various concentrations (0.1, 1, 5, or 10 ng/ml) of TGF-b1. After 3 days of stimulation, we found that TGF-b1 increased the expression of osteoblastic marker Runx2 and osteopontin in a dosedependent manner (Fig. 1B). To confirm whether TGF-b1 stimulation promotes matrix mineralization or calcium deposition in cultured normal human AVICs, we treated AVICs in a conditioning medium for 21 days and found that TGF-b1 significantly promoted calcium deposition in human AVICs (Fig. 1G).
3
3.2. Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human AVICs by activating AMPKa Metformin is an extensively used anti-T2DM agent, and T2DM is an important risk factor for CAVD [22]. Metformin has been reported to improve glucose homoeostasis via the activation of AMPK [9]. AMPK is a heterotrimeric enzyme composed of three subunits in a 1:1:1 stoichiometric ratio, the catalytic a subunit (AMPKa) and the regulatory b (AMPKb) and g subunits (AMPKg), and the activation of AMPK is induced by phosphorylation of the AMPKa (Thr172) subunit [23,24]. In addition to this role in metabolic regulation, activation of AMPKa also prevents vascular calcification [10,11,14,15], with recent evidence suggesting that AMPKa inhibits osteoblastic and chondrogenic differentiation [12,13]. In our study, we found that stimulation by TGF-b1 markedly reduced the phosphorylation level of AMPKa in human AVICs (Fig. 1C), and pretreatment of AVICs with metformin resulted in reduced protein expression of Runx2 and osteopontin (Fig. 1F), and consistently, decreased matrix calcium deposition after stimulation with TGF-b1 (Fig. 1G). To determine whether the inhibiting effect of metformin on the osteoblastic differentiation of AVICs was mediated by AMPKa activation, we tested the effects of another AMPKa agonist, AICAR (1 mM) as well as an AMPK antagonist, Compound C (10 mg/ mL), on the TGF-b1einduced trans-differentiation of AVICs. The Western blots presented in Fig. 2A show that AICAR, consistent with metformin, depressed the expression levels of osteoblastic markers Runx2 and osteopontin after stimulation with TGF-b1, and inclusion of Compound C with AICAR or metformin during pretreatment of AVICs reversed the attenuating effects of AICAR and metformin on AVIC expression of these osteoblastic markers. To further confirm the role of AMPKa in the osteoblastic
Fig. 1. Metformin effectively ameliorates TGF-b1einduced osteoblastic differentiation of human AVICs. (A) Immunofluorescence staining showing that human AVICs were positive for both a-SMA and vimentin. (B) Western blotting showed that TGF-b1 treatment of human AVICs increased the expression of osteoblastic differentiation markers (Runx2 and osteopontin) and (C) decreased the phosphorylation of AMPKa in a dose-dependent manner, *P < 0.05 vs control, **P < 0.01 vs control. (D) Western blotting revealed AMPKa phosphorylation in human AVICs after 72 h of treatment with varying concentrations of metformin. (E) Human AVIC viability after 72 h of treatment with various concentrations of metformin was analyzed by MTT assay, *P < 0.05 vs control. (F) Western blotting showed that pretreatment of AVICs with metformin (2 mM) mitigated the TGF-b1 (5 ng/ml)e induced expression of Runx2 and osteopontin in these cells. (G) Alizarin Red S staining was used to observe calcium deposition in human AVICs after 21 days in culture with different interventions, *P < 0.05 vs control, #P < 0.05 vs TGF-b1 only. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
4
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 2. The alleviating effect of metformin against TGF-b1einduced osteoblastic differentiation of human AVICs is mediated by AMPKa. (A) Western blotting showed that pretreatment of human AVICs with the AMPKa activator AICAR (1 mM) significantly blocked TGF-b1einduced up-regulation of Runx2 and osteopontin, whereas AMPKa inhibitor Compound C (10 mg/mL) blocked the mitigating effects of metformin and AICAR on the TGF-b1einduced osteoblastic differentiation of human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1, &P < 0.05 vs TGF-b1þMet, $P < 0.05 vs TGF-b1þAICAR. (B) Western blotting showed that AMPKa expression was significantly reduced in human AVICs after transfection of the cells with three different AMPKa siRNAs for 48 h,*P < 0.05 vs control, **P < 0.01 vs control. (C) Western blotting indicated that transfection of AVICs with AMPKa siRNA (siAMPKa #3) blocked the ability of metformin to ameliorate TGF-b1einduced expression of Runx2 and osteopontin in human AVICs, xP < 0.05 vs control (si-Scramble),※P < 0.05 vs si-Scramble þ TGF-b1, +P < 0.05 vs si-Scramble þ TGF-b1þMet.
Fig. 3. TGF-b1einduced osteoblastic differentiation of human AVICs is mediated via activation of b-catenin. (A, B) Western blotting showed that TGF-b1 induced the activation b-catenin in dose- and time-dependent manners, *P < 0.05 vs control (or 0 min). (C) Western blotting indicated that TGF-b1 induced accumulation of b-catenin in the nuclei of human AVICs at the indicated times, *P < 0.05 vs 0 h, **P < 0.01 vs 0 h. (D) Western blotting revealed that siRNA silencing of b-catenin reduced the protein expression of b-catenin and inhibited the TGF-b1einduced expression of Runx2 and osteopontin in human AVICs, *P < 0.05 vs control (si-scramble), #P < 0.05 vs si-scramble þ TGF-b1. (E) Alizarin Red S staining showed that gene silencing of b-catenin ameliorated TGF-b1einduced calcium deposition in human AVICs, *P < 0.05 vs Control (si-scramble), #P < 0.05 vs siscramble þ TGF-b1. (F, G) Western blotting and immunofluorescence staining revealed that metformin pretreatment prevented the TGF-b1einduced nuclear translocation of bcatenin over 12 h in human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
differentiation of AVICs, we designed three siRNA sequences (siAMPKa #1, si-AMPKa #2 and si-AMPKa #3) for silencing AMPKa, and the immunoblotting results in Fig. 2B show that treatment of AVICs with these three siRNAs significantly down-regulated the protein expression of AMPKa, with si-AMPKa #3 having the strongest gene silencing effect. Administration of si-AMPKa #3 also blocked the ameliorating effect of metformin against the TGFb1einduced production of Runx2 and osteopontin by AVICs (Fig. 2C). Together, our data demonstrate that the effect of metformin on TGF-b1einduced osteoblastic differentiation of human AVICs is mediated via AMPKa. 3.3. Metformin inhibits b-catenin to alleviate TGF-b1einduced osteoblastic differentiation of human AVICs
b-catenin is a key regulatory molecule in cell differentiation, and binding of Wnt to LDL-related protein 5 receptors (LRP5) is the canonical pathway for b-catenin activation [25]. However, b-catenin can also be activated by TGF-b1 [26]. b-catenin pathway is upregulated in CAVD [6], but whether b-catenin is responsible for TGF-b1einduced osteoblastic differentiation of human AVICs has not been clarified. To further explore the mechanisms of TGFb1einduced osteoblastic differentiation of human AVICs, we investigated the activation and nuclear translocation of b-catenin and found that TGF-b1 increased the expression of the activated form of b-catenin, non-phosphorylated b-Catenin (Ser33/37/ Thr41), in a time- and dose-dependent manner (Fig. 3A and B). Because activation of b-catenin promotes its stabilization in the cytoplasm and therefore enhances its nuclear translocation [25], we next evaluated the nuclear level of b-catenin. Immunoblotting
5
showed that TGF-b1 stimulation induced the accumulation of bcatenin within the nucleus of AVICs in a time-dependent manner (Fig. 3C), and the translocation of b-catenin was further confirmed by immunofluorescence staining (Fig. 3G). Moreover, gene silencing of b-catenin by siRNA blocked the TGF-b1einduced production of Runx2 and osteopontin as well as calcium deposition in AVICs (Fig. 3D and E). These findings suggest that the TGFb1einduced osteoblastic differentiation of human AVICs is mediated via the activation of b-catenin. Because b-catenin transfer into the nucleus activates the expression of osteogenic regulatory genes and metformin alleviated the osteoblastic differentiation of AVICs in our experiments, we hypothesized that metformin may inhibit the nuclear translocation of b-catenin to ameliorate the TGFb1einduced osteoblastic differentiation of cultured human AVICs. To test this hypothesis, we examined the expression of b-catenin in the nuclei of human AVICs pretreated with metformin (2 mM) before incubation with TGF-b1 (5 ng/ml) for 12 h. Western blotting and immunofluorescence staining demonstrated that pretreatment with metformin markedly decreased the TGF-b1einduced nuclear translocation of b-catenin (Fig. 3F and G). Taken together, our results show that activation of b-catenin pathway mediated TGFb1einduced osteoblastic differentiation of AVICs, which could be inhibited by metformin. 3.4. Metformin blocked TGF-b1einduced nuclear translocation of b-catenin in human AVICs by inhibiting the JNK and Smad2/3 pathways Although activation of b-catenin was shown to be responsible for the TGF-b1einduced osteoblastic differentiation of human
Fig. 4. Metformin mitigates the activation of b-catenin induced by TGF-b1 by inhibiting the JNK and Smad2/3 pathways in human AVICs. (A) Western blotting revealed the relevant phosphorylation of proteins in human AVICs treated with TGF-b1 at the indicated times. (B) Treatment with JNK inhibitor SP600125 prevented the TGF-b1einduced expression of Runx2 and osteopontin in human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1. (C) Treatment with SP600125 inhibited the TGF-b1einduced nuclear translocation of b-catenin in human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1. (D) Silencing of Smad2/3 by transfection of AVICs with Smad2/3 siRNA significantly decreased the TGFb1einduced expression of Runx2 and osteopontin, *P < 0.05 vs si-Scramble, #P < 0.05 vs si-Scramble þ TGF-b1. (E) Transfection of AVICs with Smad2/3 siRNA inhibited the TGFb1einduced nuclear translocation of b-catenin,*P < 0.05 vs si-Scramble, #P < 0.05 vs si-Scramble þ TGF-b1. Metformin administration reduced the TGF-b1einduced phosphorylation of JNK (F) and Smad2/3 (G) in human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1.
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
6
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
AVICs, the mechanism by which b-catenin was activated remained unknown. Glycogen synthase kinase 3b (GSK3b) destabilizes and inhibits b-catenin by phosphorylating it at its Ser33, Ser37, and Thr41 sites [27], and GSK3b activity can be inhibited by phosphorylation at its Ser9 site [28]. A recent study in peritoneal mesothelial cells suggested that TGF-b1 activates b-catenin by promoting the phosphorylation of GSK3b [26]. Canonically, TGF-b1 binds to TGF-b receptors to signal through the Smad2/3 proteins; however, other pathways also have been revealed to be stimulated, including the MAPK family pathways [29]. Therefore, we investigated the effect of TGF-b1 on the phosphorylation of GSK3b, Smad2/3, JNK, p38, and ERK1/2 in human AVICs. Western blotting showed that TGF-b1 induced the phosphorylation of JNK at Thr183/ Tyr185 from 15 min and the phosphorylation of Smad2 (Ser465/ 467) and Smad3 (Ser423/425) from 30 min. Consistently, the level of phosphorylated-AMPKa (Thr172) was decreased from 3 h of treatment of TGF-b1. However, the GSK3b, p38 MAPK, and p44/ 42 MAPK (ERK1/2) pathways were not obviously stimulated by TGF-b1 in human AVICs (Fig. 4A). Notably, b-catenin is not activated by the GSK3b, p38, or ERK1/2 pathways. To determine whether JNK signaling is responsible for TGF-b1einduced activation of b-catenin to promote osteoblastic differentiation of human AVICs, we pretreated AVICs with SP600125 (10 mM), a JNK inhibitor, for 2 h before stimulation with TGF-b1. Inhibition of JNK with SP600125 reduced the TGF-b1einduced expression of osteoblastic markers Runx2 and osteopontin in human AVICs (Fig. 4B). Moreover, administration of SP600125 also decreased the nuclear accumulation of b-catenin induced by TGF-b1 in cultured human AVICs (Fig. 4C). We next examined the role of Smad2/3 signaling in the TGF-b1einduced osteoblastic differentiation of human AVICs by gene silencing of Smad2/3 using a siRNA. Knock down of Smad2/3 in AVICs significantly reduced the TGF-b1einduced expression of Runx2 and osteopontin (Fig. 4D) as well as the nuclear translocation of b-catenin (Fig. 4E). Based on our findings that activation of JNK and Smad2/3 by TGF-b1 promoted stimulation of b-catenin to induce osteoblastic differentiation of human AVICs, we hypothesized that the effects of metformin are mediating via the inhibition of JNK and Smad2/3 activation in AVICs. To confirm this, we treated cultured human AVICs with metformin (2 mM) for 2 h before stimulation with TGF-b1, and Weestern blotting revealed that the expression levels of phosphorylated JNK and Smad2/3 were markedly reduced compared to those in AVICs not pretreated with metformin (Fig. 4F and G), suggesting that metformin blocked TGF-b1einduced activation of JNK and Smad2/3. 4. Summary The present study demonstrate that metformin can ameliorate the TGF-b1einduced osteoblastic differentiation of human AVICs. Mechanistically, the protective effect of metformin against osteoblastic differentiation of human AVICs is attributed to the inhibition of b-catenin signaling. Specifically, metformin mitigated the activation and nuclear translocation of b-catenin in human AVICs through the inhibition of TGF-b1einduced phosphorylation of JNK and Smad2/3. Moreover, the beneficial effect of metformin in preventing the osteoblastic differentiation of human AVICs could be mediated by AMPKa. To our knowledge, this is the first study to show that metformin ameliorates osteoblastic differentiation of human AVICs and may have therapeutic potential for patients with or at risk for CAVD. Acknowledgment This work was supported by the National Nature Science Foundation of China (81500301, 81770387 and 31330029).
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.04.141. References [1] B.R. Lindman, M.A. Clavel, P. Mathieu, B. Iung, P. Lancellotti, C.M. Otto, P. Pibarot, Calcific aortic stenosis, Nat. Rev. Dis. Primer. 2 (2016). [2] N.M. Rajamannan, F.J. Evans, E. Aikawa, K.J. Grande-Allen, L.L. Demer, D.D. Heistad, C.A. Simmons, K.S. Masters, P. Mathieu, K.D. O'Brien, F.J. Schoen, D.A. Towler, A.P. Yoganathan, C.M. Otto, Calcific aortic valve disease: not simply a degenerative process: a review and agenda for research from the National Heart and Lung and Blood Institute Aortic Stenosis Working Group, Executive summary: Calcific aortic valve disease-2011 update, Circulation 124 (2011) 1783e1791. [3] T.A. Pawade, D.E. Newby, M.R. Dweck, Calcification in aortic stenosis: the skeleton key, J. Am. Coll. Cardiol. 66 (2015) 561e577. [4] A. Rutkovskiy, A. Malashicheva, G. Sullivan, M. Bogdanova, A. Kostareva, K.O. Stenslokken, A. Fiane, J. Vaage, Valve interstitial cells: the key to understanding the pathophysiology of heart valve calcification, J. Am. Heart. Assoc. 6 (2017). [5] J.D. Hutcheson, E. Aikawa, W.D. Merryman, Potential drug targets for calcific aortic valve disease, Nat. Rev. Cardiol. 11 (2014) 218e231. [6] F.C. Caira, S.R. Stock, T.G. Gleason, E.C. McGee, J. Huang, R.O. Bonow, T.C. Spelsberg, P.M. McCarthy, S.H. Rahimtoola, N.M. Rajamannan, Human degenerative valve disease is associated with up-regulation of low-density lipoprotein receptor-related protein 5 receptor-mediated bone formation, J. Am. Coll. Cardiol. 47 (2006) 1707e1712. [7] D.A. Towler, Oxidation, inflammation, and aortic valve calcification peroxide paves an osteogenic path, J. Am. Coll. Cardiol. 52 (2008) 851e854. [8] G. Zhou, R. Myers, Y. Li, Y. Chen, X. Shen, J. Fenyk-Melody, M. Wu, J. Ventre, T. Doebber, N. Fujii, N. Musi, M.F. Hirshman, L.J. Goodyear, D.E. Moller, Role of AMP-activated protein kinase in mechanism of metformin action, J. Clin. Invest. 108 (2001) 1167e1174. [9] R.J. Shaw, K.A. Lamia, D. Vasquez, S.H. Koo, N. Bardeesy, R.A. Depinho, M. Montminy, L.C. Cantley, The kinase LKB1 mediates glucose homeostasis in liver and therapeutic effects of metformin, Science (New York, N.Y.) 310 (2005) 1642e1646. [10] X. Cao, H. Li, H. Tao, N. Wu, L. Yu, D. Zhang, X. Lu, J. Zhu, Z. Lu, Q. Zhu, Metformin inhibits vascular calcification in female rat aortic smooth muscle cells via the AMPK-eNOS-NO pathway, Endocrinology 154 (2013) 3680e3689. [11] X. Zhang, J. Xiao, R. Li, X. Qin, F. Wang, Y. Mao, W. Liang, X. Sheng, M. Guo, Y. Song, X. Ji, Metformin alleviates vascular calcification induced by vitamin D3 plus nicotine in rats via the AMPK pathway, Vasc. Pharmacol. 81 (2016) 83e90. [12] T. Kasai, K. Bandow, H. Suzuki, N. Chiba, K. Kakimoto, T. Ohnishi, S. Kawamoto, E. Nagaoka, T. Matsuguchi, Osteoblast differentiation is functionally associated with decreased AMP kinase activity, J. Cell. Physiol. 221 (2009) 740e749. [13] K. Bandow, J. Kusuyama, K. Kakimoto, T. Ohnishi, T. Matsuguchi, AMP-activated protein kinase (AMPK) activity negatively regulates chondrogenic differentiation, Bone 74 (2015) 125e133. [14] Z. Cai, Y. Ding, M. Zhang, Q. Lu, S. Wu, H. Zhu, P. Song, M.H. Zou, Ablation of adenosine monophosphate-activated protein kinase alpha1 in vascular smooth muscle cells promotes diet-induced atherosclerotic calcification in vivo, Circ. Res. 119 (2016) 422e433. [15] Y. Lin, J. Chen, Z. Sun, Antiaging gene klotho deficiency promoted high-fat diet-induced arterial stiffening via inactivation of AMP-activated protein kinase, Hypertension (Dallas) 67 (2016) 564e573. [16] R.A. Gould, J.T. Butcher, Isolation of valvular endothelial cells, J. Vis. Exp. 46 (2010) e2158. [17] F. Li, R. Song, L. Ao, T.B. Reece, J.C. Cleveland Jr., N. Dong, D.A. Fullerton, X. Meng, ADAMTS5 deficiency in calcified aortic valves is associated with elevated pro-osteogenic activity in valvular interstitial cells, Arterioscler. Thromb. Vasc. Biol. 37 (2017) 1339e1351. [18] F. Sun, J. Shi, S. Chen, C. Deng, X. Hu, H. Li, G. Li, Y. Liu, N. Dong, Lazaroid U74389G inhibits the osteoblastic differentiation of IL-1beta-induced aortic valve interstitial cells through glucocorticoid receptor and inhibition of NFkappaB pathway, J. Steroid Biochem. Mol. Biol. 152 (2015) 114e123. [19] D.A. Filip, A. Radu, M. Simionescu, Interstitial cells of the heart valves possess characteristics similar to smooth muscle cells, Circ. Res. 59 (1986) 310e320. [20] B. Jian, N. Narula, Q.Y. Li, E.R. Mohler 3rd, R.J. Levy, Progression of aortic valve stenosis: TGF-beta1 is present in calcified aortic valve cusps and promotes aortic valve interstitial cell calcification via apoptosis, Ann. Thorac. Surg. 75 (2003) 457e465 discussion 465e456. [21] R. Song, D.A. Fullerton, L. Ao, K.S. Zhao, X. Meng, An epigenetic regulatory loop controls pro-osteogenic activation by TGF-beta1 or bone morphogenetic protein 2 in human aortic valve interstitial cells, J. Biol. Chem. 292 (2017) 8657e8666. [22] N.M. Rajamannan, R.O. Bonow, S.H. Rahimtoola, Calcific aortic stenosis: an update, Nature clinical practice, Cardiovasc. Med. 4 (2007) 254e262. [23] P.C. Cheung, I.P. Salt, S.P. Davies, D.G. Hardie, D. Carling, Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7 binding, Biochem. J. 3 (2000) 659e669, 346 Pt. [24] S.A. Hawley, M. Davison, A. Woods, S.P. Davies, R.K. Beri, D. Carling, D.G. Hardie, Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase, J. Biol. Chem. 271 (1996) 27879e27887. [25] R. Baron, M. Kneissel, WNT signaling in bone homeostasis and disease: from human mutations to treatments, Nat. Med. 19 (2013) 179e192. [26] H.S. Shin, J. Ko, D.A. Kim, E.S. Ryu, H.M. Ryu, S.H. Park, Y.L. Kim, E.S. Oh, D.H. Kang, Metformin ameliorates the phenotype transition of peritoneal mesothelial cells and peritoneal fibrosis via a modulation of oxidative stress,
7
Sci. Rep. 7 (2017) 5690. [27] C. Yost, M. Torres, J.R. Miller, E. Huang, D. Kimelman, R.T. Moon, The axisinducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3, Genes Dev. 10 (1996) 1443e1454. [28] D.A. Cross, D.R. Alessi, P. Cohen, M. Andjelkovich, B.A. Hemmings, Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B, Nature 378 (1995) 785e789. [29] Y.E. Zhang, Non-Smad pathways in TGF-beta signaling, Cell Res. 19 (2009) 128e139.
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling Fayuan Liu a, Chong Chu a, Qinyu Wei b, Jiawei Shi a, Huadong Li a, *, Nianguo Dong a, ** a Department of Cardiovascular Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430022, China b Department of Epidemiology and Biostatistics, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 April 2018 Accepted 17 April 2018 Available online xxx
Osteoblastic differentiation of aortic valve interstitial cells (AVICs) is the central process in the development of calcific aortic valve disease (CAVD). Metformin is a widely used first-line antidiabetic drug, and recently, pleiotropic benefits of metformin beyond hypoglycemia have been reported in the cardiovascular system. Here, we examined the effect of metformin on the osteoblastic differentiation of human AVICs. Our results showed that metformin ameliorated TGF-b1einduced production of osteogenic proteins Runx2 and osteopontin as well as calcium deposition in the cultured human AVICs. Experiments using AICAR, Compound C and AMPKa siRNA showed that the beneficial effect of metformin on TGF-b1einduced osteoblastic differentiation of human AVICs was mediated by AMPKa. Moreover, metformin inhibited the TGF-b1einduced activation of b-catenin, and b-catenin siRNA blocked TGF-b1 einduced osteoblastic differentiation of AVICs. Smad2/3 and JNK were phosphorylated to promote the TGF-b1einduced activation of b-catenin and osteoblastic differentiation of AVICs, and metformin also alleviated TGF-b1einduced activation of Smad2/3 and JNK. In conclusion, our results suggest a beneficial effect of metformin based on the prevention of osteoblastic differentiation of human AVICs via inhibition of b-catenin, which indicates the therapeutic potential of metformin for CAVD. © 2018 Published by Elsevier Inc.
Keywords: CAVD Metformin AVICs Osteoblastic differentiation b-catenin TGF-b1
1. Introduction Calcific aortic valve disease (CAVD) has been the most common heart valve disease among people over the age of 65 in western countries. However, there are no available pharmacological interventions to prevent this disease, and aortic valve replacement is the only effective treatment for CAVD patients [1]. Although the pathologic mechanism of CAVD remains incompletely understood, CAVD is now recognized as an active and multifactor regulated pathological process, rather than simply a result of aging and degeneration [2,3]. Aortic valve interstitial cells (AVICs) are the most prevalent cell type in aortic valves, and the osteoblastic differentiation of AVICs plays a pivotal role in aortic valve
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (H. Li), [email protected] (N. Dong).
calcification [4,5]. Such differentiation of AVICs can be activated by many mediators including oxidized-low density lipoprotein (oxLDL) and pro-inflammatory cytokines such as interleukin (IL)-1, IL6 and transforming growth factor- b1 (TGF-b1) [5,6]. The resulting osteoblast-like cells express osteogenic transcription factors Runx2, MSX2, SOX9, etc., which further increases the production of bone matrix proteins such as osteocalcin, osteopontin and bone sialoprotein and promotes the synthesis of collagens and alkaline phosphate kinase (ALP) activity, all of which ultimately lead to the deposition of calcium nodules within aortic valve leaflets [3,4,7]. Metformin is widely used to lower blood glucose in patients with type 2 diabetes mellitus (T2DM), and activation of 50 -adenosine monophosphate-activated protein kinase (AMPK) has been identified as a major mechanism by which metformin exerts its anti-T2DM effect [8,9]. Recent studies demonstrated that metformin also has protective effects in cardiovascular diseases and cancer beyond lowering blood glucose levels, and these effects include the inhibition of vascular calcification in aortic smooth muscle cells
https://doi.org/10.1016/j.bbrc.2018.04.141 0006-291X/© 2018 Published by Elsevier Inc.
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
2
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
(SMCs) [10,11]. Interestingly, activation of AMPK was shown to negatively regulate the differentiation of chondrocytes and osteoblasts [12,13]. Additional studies revealed that ablation or inactivation of AMPK promotes aortic arterial calcification in vivo, and treatment with metformin inhibited arterial calcification in vivo and in vitro [14,15]. However, it is unknown whether metformin attenuates the osteoblastic differentiation of human AVICs. Here, we investigated the effect of metformin on the osteoblastic differentiation of human AVICs induced by TGF-b1 and further explored the associated signaling mechanisms. 2. Materials and methods 2.1. Human aortic valve collection Relatively healthy aortic valve leaflets were obtained intraoperatively from five patients undergoing Bentall operation due to acute type I aortic dissection in the Department of Cardiovascular Surgery of Wuhan Union Hospital through a protocol that conformed to the principles of the Declaration of Helsinki and was approved by the Institutional Review Board of Union Hospital and Tongji Medical College. The five patients, whose ages ranged from 39 to 53 years, were all males with no history of diabetes, infective endocarditis, rheumatic heart disease, or a congenital bicuspid aortic valve. Valves were obtained in a sterile environment, preserved in Dulbecco's modified Eagle's medium (DMEM; Hyclone, USA) pre-chilled to 4 C, and transported to the laboratory on ice. 2.2. Cell culture and treatments Human AVICs were isolated and characterized as previously described [16,17]. AVICs from passages 3e5 were used in all experiments. Cells were cultured in DMEM containing 10% fetal bovine serum (FBS; Gibco, New Zealand), 100 U/ml penicillin, and 100 U/mL streptomycin (Gibco, USA), in a humidified incubator at 37 C. When the cultured AVICs reached 70%e80% confluency, the medium was changed to DMEM containing only 2% FBS overnight, and cells were treated with various concentrations of recombinant human TGF-b1 (R&D Systems, USA) for various periods. As appropriate, pharmacological reagents, including metformin, 5-amino-1b-D-ribofuranosyl-imidazole-4-carboxamide (AICAR), Compound C, and SP600125 (all purchased from Selleck Chemicals, USA) were added to the culture medium 2 h before the addition of TGF-b1. 2.3. Western blotting Total protein or nuclear protein lysates were extracted from cultured AVICs using commercial sample buffers (Thermo Fisher, USA) according to the manufacturer's instructions. Protein samples were electrophoretically separated on a 10% acrylamide gel and blotted onto polyvinylidene difluoride membranes. Nonspecific binding was blocked by incubating the membrane in 5% non-fat milk in a TBS-T solution at room temperature for 1 h. Membranes were then incubated with appropriate primary antibodies overnight at 4 C. Specific binding was detected via the use of horseradish peroxidase (HRP)-conjugated secondary antibodies and an enhanced chemiluminescence (ECL) Western Blotting Kit (Thermo, USA). The density of each band was analyzed using ImageJ software (NIH, USA). The primary antibodies used in this study were: anti-Runx2 (ab23981,1:500), anti-osteopontin (ab8448, 1:500), anti-vimentin (ab8978,1:50) and anti-alpha smooth muscle actin (aSMA; ab5694, 1:100) from Abcam (UK) along with anti-phospho-p38 (Thr180/ Tyr182) (4511, 1:1000), anti-P38 (#8690, 1:1000), anti-phospho-p44/ 42 mitogen-activated protein kinase(ERK1/2)(Thr202/Tyr204) (#4377, 1:1000), anti-ERK (#4695, 1:1000), anti-phospho-c-Jun N-
terminal kinase (JNK; Thr183/Tyr185) (#4668, 1:1000), anti-JNK (#9252, 1:1000), anti-phospho-glycogen synthase kinase 3b (GSK3b)(Ser9) (#5558, 1:1000), anti-GSK3b (#12456, 1:1000), anti-phospho-AMPKa(Thr172) (#2535, 1:1000), anti-AMPKa (#5832, 1:1000), anti-phospho-Smad2(Ser465/467)/Smad3(Ser423/ 425)(#9510, 1:1000), anti-Smad2/3(#8685, 1:1000), anti-non-phospho(active)b-catenin(Ser33/37/Thr41) (#8814, 1:1000), and anti-bcatenin (#8480, 1:1000) from Cell Signaling Technology (USA). Antiglyceraldehyde-3-phosphate dehydrogenase (GAPDH; 60004-1-Ig, 1:5000) was purchased from Proteintech (China). 2.4. Cell viability AVICs cultured in 96-well plates were treated with various concentrations of metformin (0.2, 0.5, 1, 2 or 5 mM) for 72 h, and the 3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide, yellowtetrazole (MTT) assay was conducted to measure cell viability as previously described [18]. 2.5. Immunofluorescence staining AVICs were cultured in 3.5-mm glass-bottomed dishes (NEST, China), and TGF-b1 was added to the culture medium for 12 h with or without pretreatment with metformin. After treatment, cells were stained as previously described [17]. 2.6. Gene knock-down To silence AMPKa, b-catenin, or Smad2/3, cultured AVICs at 70%e80% confluency were transfected with specific siRNA (100 nM) or scramble siRNA (100 nM) using the Lipofectamine 3000 Transfection Reagent (Life Technologies, USA) according to the manufacturer's recommendations. The AMPKa siRNA consisted of three distinct RNA sequences (si-AMPKa #1 CACAGAAG GAUUUAAAUAUUGAGGG, si-AMPKa #2 CCCAUCCUGAAAGAGUACCAUUCUU and si-AMPKa #3 ACCAUGAUUGAUGAAGCCUUAA) all purchased from Life Technologies (1299001). The b-catenin siRNA (sc-29209) and Smad2/3 siRNA (sc-37238) were purchased from Santa Cruz Biotechnology (USA). After transfection with siRNA for 6 h, the culture medium was changed and AVICs were cultured for an additional 48 h before being lysed for validation of knockdown or stimulated with TGF-b1 with or without metformin pretreatment. 2.7. Alizarin Red S staining AVICs were cultured in 24-well plates, and cells were treated with different interventions upon reaching 70%e80% confluency in the calcific conditioning medium (DMEM with 2% FBS, 10 mmol/L b-glycerophosphate and 8 mmol/L CaCl2) for 21 days. The medium was exchanged every 3 days during this culture period. Alizarin Red S staining was then conducted using a commercial Alizarin Red S staining kit (ScienCell, #0223, USA) as previously described [17]. 2.8. Statistical analysis All experiments were independently replicated in cells from at least three different human aortic valves, and the results are presented as mean ± standard deviation (SD). Kolmogorov-Smirnov test was used to confirm that all variables were normally distributed. Differences between two groups were evaluated via student's t-test. P < 0.05 were considered statistically significant.
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
3. Results and discussion 3.1. TGF-b1 induces osteoblastic differentiation in human AVICs AVICs are highly plastic cells that have been considered myofibroblasts based on their expression of both a-SMA and vimentin [1,19]. We isolated AVICs from relatively normal human aortic valves and confirmed this phenotype by immunofluorescence staining for these two markers (Fig. 1A). Over the past decade, AVICs have been widely accepted as the major source of osteoblastlike cells in calcified aortic valves [1,3]. The osteoblastic differentiation of AVICs is not fully characterized, but appears to be the central step in the pathology process of CAVD. Many mediators can stimulate AVICs to transdifferentiate into osteoblastic-like cells upon binding to receptors on these cells that activate calcific pathways, including the Wnt/b-catenin, Notch, nuclear factor kappa B (NF-kB), and receptor activator of nuclear factor kappa B (RANK)/receptor activator of nuclear factor kappa B ligand(RANKL)/ osteoprotegerin (OPG) pathways [3,7]. Previous studies revealed that TGF-b1 is present in calcific human aortic valves and promotes AVIC calcification via apoptosis [20]. Song etc. also demonstrated that TGF-b1 induces osteoblastic differentiation of AVICs [21]. We therefore tested the osteogenic effects of TGF-b1 on human AVICs using various concentrations (0.1, 1, 5, or 10 ng/ml) of TGF-b1. After 3 days of stimulation, we found that TGF-b1 increased the expression of osteoblastic marker Runx2 and osteopontin in a dosedependent manner (Fig. 1B). To confirm whether TGF-b1 stimulation promotes matrix mineralization or calcium deposition in cultured normal human AVICs, we treated AVICs in a conditioning medium for 21 days and found that TGF-b1 significantly promoted calcium deposition in human AVICs (Fig. 1G).
3
3.2. Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human AVICs by activating AMPKa Metformin is an extensively used anti-T2DM agent, and T2DM is an important risk factor for CAVD [22]. Metformin has been reported to improve glucose homoeostasis via the activation of AMPK [9]. AMPK is a heterotrimeric enzyme composed of three subunits in a 1:1:1 stoichiometric ratio, the catalytic a subunit (AMPKa) and the regulatory b (AMPKb) and g subunits (AMPKg), and the activation of AMPK is induced by phosphorylation of the AMPKa (Thr172) subunit [23,24]. In addition to this role in metabolic regulation, activation of AMPKa also prevents vascular calcification [10,11,14,15], with recent evidence suggesting that AMPKa inhibits osteoblastic and chondrogenic differentiation [12,13]. In our study, we found that stimulation by TGF-b1 markedly reduced the phosphorylation level of AMPKa in human AVICs (Fig. 1C), and pretreatment of AVICs with metformin resulted in reduced protein expression of Runx2 and osteopontin (Fig. 1F), and consistently, decreased matrix calcium deposition after stimulation with TGF-b1 (Fig. 1G). To determine whether the inhibiting effect of metformin on the osteoblastic differentiation of AVICs was mediated by AMPKa activation, we tested the effects of another AMPKa agonist, AICAR (1 mM) as well as an AMPK antagonist, Compound C (10 mg/ mL), on the TGF-b1einduced trans-differentiation of AVICs. The Western blots presented in Fig. 2A show that AICAR, consistent with metformin, depressed the expression levels of osteoblastic markers Runx2 and osteopontin after stimulation with TGF-b1, and inclusion of Compound C with AICAR or metformin during pretreatment of AVICs reversed the attenuating effects of AICAR and metformin on AVIC expression of these osteoblastic markers. To further confirm the role of AMPKa in the osteoblastic
Fig. 1. Metformin effectively ameliorates TGF-b1einduced osteoblastic differentiation of human AVICs. (A) Immunofluorescence staining showing that human AVICs were positive for both a-SMA and vimentin. (B) Western blotting showed that TGF-b1 treatment of human AVICs increased the expression of osteoblastic differentiation markers (Runx2 and osteopontin) and (C) decreased the phosphorylation of AMPKa in a dose-dependent manner, *P < 0.05 vs control, **P < 0.01 vs control. (D) Western blotting revealed AMPKa phosphorylation in human AVICs after 72 h of treatment with varying concentrations of metformin. (E) Human AVIC viability after 72 h of treatment with various concentrations of metformin was analyzed by MTT assay, *P < 0.05 vs control. (F) Western blotting showed that pretreatment of AVICs with metformin (2 mM) mitigated the TGF-b1 (5 ng/ml)e induced expression of Runx2 and osteopontin in these cells. (G) Alizarin Red S staining was used to observe calcium deposition in human AVICs after 21 days in culture with different interventions, *P < 0.05 vs control, #P < 0.05 vs TGF-b1 only. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
4
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
Fig. 2. The alleviating effect of metformin against TGF-b1einduced osteoblastic differentiation of human AVICs is mediated by AMPKa. (A) Western blotting showed that pretreatment of human AVICs with the AMPKa activator AICAR (1 mM) significantly blocked TGF-b1einduced up-regulation of Runx2 and osteopontin, whereas AMPKa inhibitor Compound C (10 mg/mL) blocked the mitigating effects of metformin and AICAR on the TGF-b1einduced osteoblastic differentiation of human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1, &P < 0.05 vs TGF-b1þMet, $P < 0.05 vs TGF-b1þAICAR. (B) Western blotting showed that AMPKa expression was significantly reduced in human AVICs after transfection of the cells with three different AMPKa siRNAs for 48 h,*P < 0.05 vs control, **P < 0.01 vs control. (C) Western blotting indicated that transfection of AVICs with AMPKa siRNA (siAMPKa #3) blocked the ability of metformin to ameliorate TGF-b1einduced expression of Runx2 and osteopontin in human AVICs, xP < 0.05 vs control (si-Scramble),※P < 0.05 vs si-Scramble þ TGF-b1, +P < 0.05 vs si-Scramble þ TGF-b1þMet.
Fig. 3. TGF-b1einduced osteoblastic differentiation of human AVICs is mediated via activation of b-catenin. (A, B) Western blotting showed that TGF-b1 induced the activation b-catenin in dose- and time-dependent manners, *P < 0.05 vs control (or 0 min). (C) Western blotting indicated that TGF-b1 induced accumulation of b-catenin in the nuclei of human AVICs at the indicated times, *P < 0.05 vs 0 h, **P < 0.01 vs 0 h. (D) Western blotting revealed that siRNA silencing of b-catenin reduced the protein expression of b-catenin and inhibited the TGF-b1einduced expression of Runx2 and osteopontin in human AVICs, *P < 0.05 vs control (si-scramble), #P < 0.05 vs si-scramble þ TGF-b1. (E) Alizarin Red S staining showed that gene silencing of b-catenin ameliorated TGF-b1einduced calcium deposition in human AVICs, *P < 0.05 vs Control (si-scramble), #P < 0.05 vs siscramble þ TGF-b1. (F, G) Western blotting and immunofluorescence staining revealed that metformin pretreatment prevented the TGF-b1einduced nuclear translocation of bcatenin over 12 h in human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
differentiation of AVICs, we designed three siRNA sequences (siAMPKa #1, si-AMPKa #2 and si-AMPKa #3) for silencing AMPKa, and the immunoblotting results in Fig. 2B show that treatment of AVICs with these three siRNAs significantly down-regulated the protein expression of AMPKa, with si-AMPKa #3 having the strongest gene silencing effect. Administration of si-AMPKa #3 also blocked the ameliorating effect of metformin against the TGFb1einduced production of Runx2 and osteopontin by AVICs (Fig. 2C). Together, our data demonstrate that the effect of metformin on TGF-b1einduced osteoblastic differentiation of human AVICs is mediated via AMPKa. 3.3. Metformin inhibits b-catenin to alleviate TGF-b1einduced osteoblastic differentiation of human AVICs
b-catenin is a key regulatory molecule in cell differentiation, and binding of Wnt to LDL-related protein 5 receptors (LRP5) is the canonical pathway for b-catenin activation [25]. However, b-catenin can also be activated by TGF-b1 [26]. b-catenin pathway is upregulated in CAVD [6], but whether b-catenin is responsible for TGF-b1einduced osteoblastic differentiation of human AVICs has not been clarified. To further explore the mechanisms of TGFb1einduced osteoblastic differentiation of human AVICs, we investigated the activation and nuclear translocation of b-catenin and found that TGF-b1 increased the expression of the activated form of b-catenin, non-phosphorylated b-Catenin (Ser33/37/ Thr41), in a time- and dose-dependent manner (Fig. 3A and B). Because activation of b-catenin promotes its stabilization in the cytoplasm and therefore enhances its nuclear translocation [25], we next evaluated the nuclear level of b-catenin. Immunoblotting
5
showed that TGF-b1 stimulation induced the accumulation of bcatenin within the nucleus of AVICs in a time-dependent manner (Fig. 3C), and the translocation of b-catenin was further confirmed by immunofluorescence staining (Fig. 3G). Moreover, gene silencing of b-catenin by siRNA blocked the TGF-b1einduced production of Runx2 and osteopontin as well as calcium deposition in AVICs (Fig. 3D and E). These findings suggest that the TGFb1einduced osteoblastic differentiation of human AVICs is mediated via the activation of b-catenin. Because b-catenin transfer into the nucleus activates the expression of osteogenic regulatory genes and metformin alleviated the osteoblastic differentiation of AVICs in our experiments, we hypothesized that metformin may inhibit the nuclear translocation of b-catenin to ameliorate the TGFb1einduced osteoblastic differentiation of cultured human AVICs. To test this hypothesis, we examined the expression of b-catenin in the nuclei of human AVICs pretreated with metformin (2 mM) before incubation with TGF-b1 (5 ng/ml) for 12 h. Western blotting and immunofluorescence staining demonstrated that pretreatment with metformin markedly decreased the TGF-b1einduced nuclear translocation of b-catenin (Fig. 3F and G). Taken together, our results show that activation of b-catenin pathway mediated TGFb1einduced osteoblastic differentiation of AVICs, which could be inhibited by metformin. 3.4. Metformin blocked TGF-b1einduced nuclear translocation of b-catenin in human AVICs by inhibiting the JNK and Smad2/3 pathways Although activation of b-catenin was shown to be responsible for the TGF-b1einduced osteoblastic differentiation of human
Fig. 4. Metformin mitigates the activation of b-catenin induced by TGF-b1 by inhibiting the JNK and Smad2/3 pathways in human AVICs. (A) Western blotting revealed the relevant phosphorylation of proteins in human AVICs treated with TGF-b1 at the indicated times. (B) Treatment with JNK inhibitor SP600125 prevented the TGF-b1einduced expression of Runx2 and osteopontin in human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1. (C) Treatment with SP600125 inhibited the TGF-b1einduced nuclear translocation of b-catenin in human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1. (D) Silencing of Smad2/3 by transfection of AVICs with Smad2/3 siRNA significantly decreased the TGFb1einduced expression of Runx2 and osteopontin, *P < 0.05 vs si-Scramble, #P < 0.05 vs si-Scramble þ TGF-b1. (E) Transfection of AVICs with Smad2/3 siRNA inhibited the TGFb1einduced nuclear translocation of b-catenin,*P < 0.05 vs si-Scramble, #P < 0.05 vs si-Scramble þ TGF-b1. Metformin administration reduced the TGF-b1einduced phosphorylation of JNK (F) and Smad2/3 (G) in human AVICs, *P < 0.05 vs control, #P < 0.05 vs TGF-b1.
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
6
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7
AVICs, the mechanism by which b-catenin was activated remained unknown. Glycogen synthase kinase 3b (GSK3b) destabilizes and inhibits b-catenin by phosphorylating it at its Ser33, Ser37, and Thr41 sites [27], and GSK3b activity can be inhibited by phosphorylation at its Ser9 site [28]. A recent study in peritoneal mesothelial cells suggested that TGF-b1 activates b-catenin by promoting the phosphorylation of GSK3b [26]. Canonically, TGF-b1 binds to TGF-b receptors to signal through the Smad2/3 proteins; however, other pathways also have been revealed to be stimulated, including the MAPK family pathways [29]. Therefore, we investigated the effect of TGF-b1 on the phosphorylation of GSK3b, Smad2/3, JNK, p38, and ERK1/2 in human AVICs. Western blotting showed that TGF-b1 induced the phosphorylation of JNK at Thr183/ Tyr185 from 15 min and the phosphorylation of Smad2 (Ser465/ 467) and Smad3 (Ser423/425) from 30 min. Consistently, the level of phosphorylated-AMPKa (Thr172) was decreased from 3 h of treatment of TGF-b1. However, the GSK3b, p38 MAPK, and p44/ 42 MAPK (ERK1/2) pathways were not obviously stimulated by TGF-b1 in human AVICs (Fig. 4A). Notably, b-catenin is not activated by the GSK3b, p38, or ERK1/2 pathways. To determine whether JNK signaling is responsible for TGF-b1einduced activation of b-catenin to promote osteoblastic differentiation of human AVICs, we pretreated AVICs with SP600125 (10 mM), a JNK inhibitor, for 2 h before stimulation with TGF-b1. Inhibition of JNK with SP600125 reduced the TGF-b1einduced expression of osteoblastic markers Runx2 and osteopontin in human AVICs (Fig. 4B). Moreover, administration of SP600125 also decreased the nuclear accumulation of b-catenin induced by TGF-b1 in cultured human AVICs (Fig. 4C). We next examined the role of Smad2/3 signaling in the TGF-b1einduced osteoblastic differentiation of human AVICs by gene silencing of Smad2/3 using a siRNA. Knock down of Smad2/3 in AVICs significantly reduced the TGF-b1einduced expression of Runx2 and osteopontin (Fig. 4D) as well as the nuclear translocation of b-catenin (Fig. 4E). Based on our findings that activation of JNK and Smad2/3 by TGF-b1 promoted stimulation of b-catenin to induce osteoblastic differentiation of human AVICs, we hypothesized that the effects of metformin are mediating via the inhibition of JNK and Smad2/3 activation in AVICs. To confirm this, we treated cultured human AVICs with metformin (2 mM) for 2 h before stimulation with TGF-b1, and Weestern blotting revealed that the expression levels of phosphorylated JNK and Smad2/3 were markedly reduced compared to those in AVICs not pretreated with metformin (Fig. 4F and G), suggesting that metformin blocked TGF-b1einduced activation of JNK and Smad2/3. 4. Summary The present study demonstrate that metformin can ameliorate the TGF-b1einduced osteoblastic differentiation of human AVICs. Mechanistically, the protective effect of metformin against osteoblastic differentiation of human AVICs is attributed to the inhibition of b-catenin signaling. Specifically, metformin mitigated the activation and nuclear translocation of b-catenin in human AVICs through the inhibition of TGF-b1einduced phosphorylation of JNK and Smad2/3. Moreover, the beneficial effect of metformin in preventing the osteoblastic differentiation of human AVICs could be mediated by AMPKa. To our knowledge, this is the first study to show that metformin ameliorates osteoblastic differentiation of human AVICs and may have therapeutic potential for patients with or at risk for CAVD. Acknowledgment This work was supported by the National Nature Science Foundation of China (81500301, 81770387 and 31330029).
Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.04.141. References [1] B.R. Lindman, M.A. Clavel, P. Mathieu, B. Iung, P. Lancellotti, C.M. Otto, P. Pibarot, Calcific aortic stenosis, Nat. Rev. Dis. Primer. 2 (2016). [2] N.M. Rajamannan, F.J. Evans, E. Aikawa, K.J. Grande-Allen, L.L. Demer, D.D. Heistad, C.A. Simmons, K.S. Masters, P. Mathieu, K.D. O'Brien, F.J. Schoen, D.A. Towler, A.P. Yoganathan, C.M. Otto, Calcific aortic valve disease: not simply a degenerative process: a review and agenda for research from the National Heart and Lung and Blood Institute Aortic Stenosis Working Group, Executive summary: Calcific aortic valve disease-2011 update, Circulation 124 (2011) 1783e1791. [3] T.A. Pawade, D.E. Newby, M.R. Dweck, Calcification in aortic stenosis: the skeleton key, J. Am. Coll. Cardiol. 66 (2015) 561e577. [4] A. Rutkovskiy, A. Malashicheva, G. Sullivan, M. Bogdanova, A. Kostareva, K.O. Stenslokken, A. Fiane, J. Vaage, Valve interstitial cells: the key to understanding the pathophysiology of heart valve calcification, J. Am. Heart. Assoc. 6 (2017). [5] J.D. Hutcheson, E. Aikawa, W.D. Merryman, Potential drug targets for calcific aortic valve disease, Nat. Rev. Cardiol. 11 (2014) 218e231. [6] F.C. Caira, S.R. Stock, T.G. Gleason, E.C. McGee, J. Huang, R.O. Bonow, T.C. Spelsberg, P.M. McCarthy, S.H. Rahimtoola, N.M. Rajamannan, Human degenerative valve disease is associated with up-regulation of low-density lipoprotein receptor-related protein 5 receptor-mediated bone formation, J. Am. Coll. Cardiol. 47 (2006) 1707e1712. [7] D.A. Towler, Oxidation, inflammation, and aortic valve calcification peroxide paves an osteogenic path, J. Am. Coll. Cardiol. 52 (2008) 851e854. [8] G. Zhou, R. Myers, Y. Li, Y. Chen, X. Shen, J. Fenyk-Melody, M. Wu, J. Ventre, T. Doebber, N. Fujii, N. Musi, M.F. Hirshman, L.J. Goodyear, D.E. Moller, Role of AMP-activated protein kinase in mechanism of metformin action, J. Clin. Invest. 108 (2001) 1167e1174. [9] R.J. Shaw, K.A. Lamia, D. Vasquez, S.H. Koo, N. Bardeesy, R.A. Depinho, M. Montminy, L.C. Cantley, The kinase LKB1 mediates glucose homeostasis in liver and therapeutic effects of metformin, Science (New York, N.Y.) 310 (2005) 1642e1646. [10] X. Cao, H. Li, H. Tao, N. Wu, L. Yu, D. Zhang, X. Lu, J. Zhu, Z. Lu, Q. Zhu, Metformin inhibits vascular calcification in female rat aortic smooth muscle cells via the AMPK-eNOS-NO pathway, Endocrinology 154 (2013) 3680e3689. [11] X. Zhang, J. Xiao, R. Li, X. Qin, F. Wang, Y. Mao, W. Liang, X. Sheng, M. Guo, Y. Song, X. Ji, Metformin alleviates vascular calcification induced by vitamin D3 plus nicotine in rats via the AMPK pathway, Vasc. Pharmacol. 81 (2016) 83e90. [12] T. Kasai, K. Bandow, H. Suzuki, N. Chiba, K. Kakimoto, T. Ohnishi, S. Kawamoto, E. Nagaoka, T. Matsuguchi, Osteoblast differentiation is functionally associated with decreased AMP kinase activity, J. Cell. Physiol. 221 (2009) 740e749. [13] K. Bandow, J. Kusuyama, K. Kakimoto, T. Ohnishi, T. Matsuguchi, AMP-activated protein kinase (AMPK) activity negatively regulates chondrogenic differentiation, Bone 74 (2015) 125e133. [14] Z. Cai, Y. Ding, M. Zhang, Q. Lu, S. Wu, H. Zhu, P. Song, M.H. Zou, Ablation of adenosine monophosphate-activated protein kinase alpha1 in vascular smooth muscle cells promotes diet-induced atherosclerotic calcification in vivo, Circ. Res. 119 (2016) 422e433. [15] Y. Lin, J. Chen, Z. Sun, Antiaging gene klotho deficiency promoted high-fat diet-induced arterial stiffening via inactivation of AMP-activated protein kinase, Hypertension (Dallas) 67 (2016) 564e573. [16] R.A. Gould, J.T. Butcher, Isolation of valvular endothelial cells, J. Vis. Exp. 46 (2010) e2158. [17] F. Li, R. Song, L. Ao, T.B. Reece, J.C. Cleveland Jr., N. Dong, D.A. Fullerton, X. Meng, ADAMTS5 deficiency in calcified aortic valves is associated with elevated pro-osteogenic activity in valvular interstitial cells, Arterioscler. Thromb. Vasc. Biol. 37 (2017) 1339e1351. [18] F. Sun, J. Shi, S. Chen, C. Deng, X. Hu, H. Li, G. Li, Y. Liu, N. Dong, Lazaroid U74389G inhibits the osteoblastic differentiation of IL-1beta-induced aortic valve interstitial cells through glucocorticoid receptor and inhibition of NFkappaB pathway, J. Steroid Biochem. Mol. Biol. 152 (2015) 114e123. [19] D.A. Filip, A. Radu, M. Simionescu, Interstitial cells of the heart valves possess characteristics similar to smooth muscle cells, Circ. Res. 59 (1986) 310e320. [20] B. Jian, N. Narula, Q.Y. Li, E.R. Mohler 3rd, R.J. Levy, Progression of aortic valve stenosis: TGF-beta1 is present in calcified aortic valve cusps and promotes aortic valve interstitial cell calcification via apoptosis, Ann. Thorac. Surg. 75 (2003) 457e465 discussion 465e456. [21] R. Song, D.A. Fullerton, L. Ao, K.S. Zhao, X. Meng, An epigenetic regulatory loop controls pro-osteogenic activation by TGF-beta1 or bone morphogenetic protein 2 in human aortic valve interstitial cells, J. Biol. Chem. 292 (2017) 8657e8666. [22] N.M. Rajamannan, R.O. Bonow, S.H. Rahimtoola, Calcific aortic stenosis: an update, Nature clinical practice, Cardiovasc. Med. 4 (2007) 254e262. [23] P.C. Cheung, I.P. Salt, S.P. Davies, D.G. Hardie, D. Carling, Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141
F. Liu et al. / Biochemical and Biophysical Research Communications xxx (2018) 1e7 binding, Biochem. J. 3 (2000) 659e669, 346 Pt. [24] S.A. Hawley, M. Davison, A. Woods, S.P. Davies, R.K. Beri, D. Carling, D.G. Hardie, Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase, J. Biol. Chem. 271 (1996) 27879e27887. [25] R. Baron, M. Kneissel, WNT signaling in bone homeostasis and disease: from human mutations to treatments, Nat. Med. 19 (2013) 179e192. [26] H.S. Shin, J. Ko, D.A. Kim, E.S. Ryu, H.M. Ryu, S.H. Park, Y.L. Kim, E.S. Oh, D.H. Kang, Metformin ameliorates the phenotype transition of peritoneal mesothelial cells and peritoneal fibrosis via a modulation of oxidative stress,
7
Sci. Rep. 7 (2017) 5690. [27] C. Yost, M. Torres, J.R. Miller, E. Huang, D. Kimelman, R.T. Moon, The axisinducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3, Genes Dev. 10 (1996) 1443e1454. [28] D.A. Cross, D.R. Alessi, P. Cohen, M. Andjelkovich, B.A. Hemmings, Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B, Nature 378 (1995) 785e789. [29] Y.E. Zhang, Non-Smad pathways in TGF-beta signaling, Cell Res. 19 (2009) 128e139.
Please cite this article in press as: F. Liu, et al., Metformin ameliorates TGF-b1einduced osteoblastic differentiation of human aortic valve interstitial cells by inhibiting b-catenin signaling, Biochemical and Biophysical Research Communications (2018), https://doi.org/10.1016/ j.bbrc.2018.04.141