Methiopropamine, a methamphetamine analogue, produces neurotoxicity via dopamine receptors

Chemico-Biological Interactions 305 (2019) 134–147

Contents lists available at ScienceDirect

Chemico-Biological Interactions journal homepage: www.elsevier.com/locate/chembioint

Methiopropamine, a methamphetamine analogue, produces neurotoxicity via dopamine receptors

T

Phuong-Tram Nguyena,1, Duy-Khanh Dangb,1, Hai-Quyen Trana, Eun-Joo Shina,*, Ji Hoon Jeongc, Seung-Yeol Nahd, Min Chang Choe, Yong Sup Leee, Choon-Gon Jangf, Hyoung-Chun Kima,** a

Neuropsychopharmacology and Toxicology Program, College of Pharmacy, Kangwon National University, Chunchon, 24341, Republic of Korea Pharmacy Faculty, Can Tho University of Medicine and Pharmacy, Can Tho City, 900000, Viet Nam c Department of Pharmacology, College of Medicine, Chung-Ang University, Seoul, 06974, Republic of Korea d Ginsentology Research Laboratory and Department of Physiology, College of Veterinary Medicine, Konkuk University, Seoul, 05029, Republic of Korea e Department of Life and Nanopharmaceutical Sciences & Medicinal Chemistry Laboratory, College of Pharmacy, Kyung Hee University, Seoul, 02447, Republic of Korea f Department of Pharmacology, School of Pharmacy, Sungkyunkwan University, Suwon, 16419, Republic of Korea b

A R T I C LE I N FO

A B S T R A C T

Keywords: Methiopropamine Dopamine receptors Oxidative stress Apoptosis Microgliosis Dopaminergic deficits

Methiopropamine (MPA) is structurally categorized as a thiophene ring-based methamphetamine (MA) derivative. Although abusive potential of MPA was recognized, little is known about the neurotoxic potential of MPA up to now. We investigated whether MPA induces dopaminergic neurotoxicity, and whether MPA activates a specific dopamine receptor. Here, we observed that treatment with MPA resulted in dopaminergic neurotoxicity in a dose-dependent manner. MPA treatment potentiated oxidative parameters (i.e., increases in the level of reactive oxygen species, 4-hydroxynonenal, and protein carbonyl), M1 phenotype-related microglial activity, and pro-apoptotic property (i.e., increases in Bax- and cleaved caspase-3-expressions, while a decrease in Bcl-2expression). Moreover, treatment with MPA resulted in significant impairments in dopaminergic parameters [i.e., changes in dopamine level, dopamine turnover rate, tyrosine hydroxylase (TH) levels, dopamine transporter (DAT) expression, and vesicular monoamine transporter-2 (VMAT-2) expression], and in behavioral deficits. Both dopamine D1 receptor antagonist SCH23390 and D2 receptor antagonist sulpiride protected from these neurotoxic consequences. Therefore, our results suggest that dopamine D1 and D2 receptors simultaneously mediate MPA-induced dopaminergic neurodegeneration in mice via oxidative burdens, microgliosis, and pro-apoptosis.

1. Introduction Amphetamine (AMPH), methamphetamine (MA), and 3,4-ethylenedioxymethamphetamine (MDMA) are widely abused psychoactive substances, with the basic chemical structure of phenylethylamine [1]. The abuse of these drugs is associated with psychostimulant, anorectic and hallucinogenic properties [2]. Furthermore, amphetamine analogs (AMPHs) exhibited significant toxic effects on the central nervous system, could cause long-term damage to nigrostriatal dopaminergic system [3–6]. Indeed, compelling evidence suggested that MA [7–14] and AMPHs (i.e., para-methoxymethamphetamine [15], and 3-fluoromethamphetamine [16]), induce neurotoxicity associated with oxidative stress, microglial activation, and pro-apoptotic changes. These neurotoxic potentials might be, at least in part, due to the excessive

release of dopamine, followed by activation of dopamine receptors, and consistent degeneration of dopaminergic system [17]. Moreover, converging evidence indicated that either pharmacological antagonism [7,8,18–21] or genetic inhibition of dopamine D1 or D2 receptor [18,22] protects from nigrostriatal dopaminergic neurotoxicity induced by MA, suggesting that dopamine receptors are critical mediators for the dopaminergic neurotoxicity. The use of novel psychoactive substances has been increasing substantially in many countries, and being used as recreational drugs in recent years [23]. The methiopropamine [MPA, 1-(2-thienyl)- 2-(methylamino)propane] is a MA analogue in which benzene ring has been replaced by a thiophene ring [24]. It was first synthesized in 1942 [25], and first appeared on internet selling as “legal highs” in 2010 [26]. MPA was first detected for the prevalence of synthetic drug in Europe in

*

Corresponding author. Corresponding author. E-mail addresses: [email protected] (E.-J. Shin), [email protected] (H.-C. Kim). 1 PT Nguyen and DK Dang are equally contributed to this work. **

https://doi.org/10.1016/j.cbi.2019.03.017 Received 7 August 2018; Received in revised form 3 February 2019; Accepted 20 March 2019 Available online 25 March 2019 0009-2797/ © 2019 Published by Elsevier B.V.

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

pro-apoptosis changes, gliosis, dopaminergic toxicity, and behavioral impairment, ten-week-old male Taconic ICR mice were challenged with four times of MPA doses (10 or 20 mg/kg, i.p.) or saline as a 2 h-interval, and sacrificed 4 h, 1 d, 3 d, and 14 d after the final treatment of MPA (Supplementary Fig. S1B). To clarify the role of the dopamine D1 and D2 receptors in neurotoxicity and behavioral impairment, either SCH 23390 (0.1 mg/kg, i.p.) or sulpiride (20 mg/kg, i.p.) was given 3 times, 30 min before the first and the third MPA administration, and 30 min after the final MPA administration. Mice were sacrificed 4 h, 1 d, and 3 d after the final MPA administration (Supplementary Fig. S1C). The doses of SCH 23390 and sulpiride were determined based on our previous studies [9,35].

2011 [27]. MPA is still legally available in Germany, but it became a controlled drug in Switzerland in 2012 [26]. In addition, there has been a growing evidence of MPA use in the United Kingdom (UK) in 2012 [28,29]. Administration of MPA encompasses a wide range of adverse effects including tachycardia, anxiety, insomnia, perspirations, and hallucinations [30]. A recent finding indicated that dopamine D2 receptor mediates behavioral sensitization exerted by MPA [31]. There are two reported cases on the significant acute toxicity induced by MPA [24], and even death in Australia [30], which are attributed to human MPA abuse. Moreover, three cases of fatal intoxication were reported in UK, and Sweden when MPA is consumed in conjunction with other drugs [30,32]. However, up to date, little is known about the neurotoxicity induced by MPA. In the present study, we sought to examine whether the 4 × 10 mg/ kg, i.p. or 20 mg/kg, i.p. paradigm of MPA induces neurotoxicity, and whether MPA activates dopamine receptors. Here we observed that both dopamine D1 and D2 receptors mediate dopaminergic neurotoxicity induced by MPA.

2.4. Measurement of rectal temperature Rectal temperature (under ambient temperature: 21 ± 1 °C) was measured once before MPA or saline treatment and every 1 h after every MPA or saline treatment by inserting a thermometer probe lubricated with oil at least 3 cm into the rectum of mice. To prevent sudden movements, animals were gently handled with a wool glove while their tail was moved to allow probe insertion. This was done to reduce any effect of restraint stress on rectal temperature. When the attempt to insert the probe was not successful (i.e., sudden movements of the animal or the need to restrain the mouse), the animal was excluded from the group [8,36].

2. Materials and methods 2.1. Animals All animals were treated in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council of the National Academies., 2011; www.dels.nas.edu/ila). The present study was performed in accordance with the Institute for Laboratory Research (ILAR) Guidelines for the Care and Use of Laboratory Animals, and the animal experimental procedure was approved by the Institutional Animal Care and Use Committee (IACUC) of Kangwon National University. Mice were maintained under a 12-h light:12-h dark cycle and fed ad libitum. They were adapted to these conditions for 2 weeks prior to the experiment. We employed 10-week-old male ICR mice (Taconic Farms, Inc., Samtako Bio Korea, O-San, South Korea) for the experiments.

2.5. Locomotor activity Locomotor activity was measured for 30 min using an automated video-tracking system (Noldus Information Technology, Wageningen, The Netherlands). Four test boxes (40 cm × 40 cm × 40 cm high) were operated simultaneously by an IBM computer. Mice were studied individually during locomotion in each test box, where they had been adapted for 5 min prior to the beginning of the experiment. The distance travelled in centimeters by the animals during horizontal locomotor activity was analyzed. Data were collected and analyzed between 09:00 and 17:00 h [16,37].

2.2. Synthesis of methiopropamine (MPA)

2.6. Rota-rod test

Synthesis and use of MPA for the present study were approved by the Korea Food and Drug Administration (KFDA), and were performed in strict accordance with KFDA regulations. MPA was synthesized as described previously [33,34] and its structure and purity were further confirmed by the following NMR spectroscopy and HPLC analyses. 1HNMR (400 MHz, CDCl3, δ): 9.71 (2H, bs, -NH2), 7.21 (1H, dd, J = 5.0, 0.92 Hz, thiophene-5H), 7.08 (1H, dd, J = 5.0, 3.5 Hz, thiophene-4H), 6.98 (1H, dd, J = 3.5, 0.92 Hz, thiophene-3H), 3.62 (1H, dd, J = 14.0, 4.1 Hz, one H from CH2), 3.34 (1H, ddq, J = 14.0, 10.3, 4.1 Hz, CHN), 3.18 (1H, dd, J = 14.0, 10.3 Hz, one H from CH2), 2.71 (3H, s, -NCH3) and 1.43 (3H, d, J = 6.9 Hz, CCH3); 13C-NMR (100 MHz, CDCl3, δ): 137.6 (thiophene-2C), 127.4 (thiophene-3C), 127.2 (thiophene-4C), 125.1 (thiophene-5C), 57.3 (CCH3), 33.6 (CH2), 30.4 (NCH3) and 15.9 ppm (CCH3); LRMS (EI-, 70 eV): m/z = 154 (0.5%, [M − H]), 140 (1), 97 (36), and 58 (100); HRMS (ESI+, 15 eV) calculated for [M + H] C8H14NS: 156.0841, found: 156.0844; HPLC purity = 99.5%, ACE 3C18 3 μm (150 × 4.6 mm), mobile phase: acetonitrile: ammonium formate buffer (10 mM, pH 3.5 ± 0.02) (10 : 90 v/v), tR = 5.4 min.

The apparatus (Ugo Basile model 7650, Comerio, VA, Italy) consisted of a base platform and a rotating rod with a non-slip surface. The rod was placed at a height of 15 cm from the base. The rod, 30 cm in length, was divided into five equal sections by six opaque disks (so that the subjects could not be distracted by one another). To assess motor performance, mice were first trained on the apparatus for 2 min at a constant rate of 4 rpm. The test was performed 30 min after training and an accelerating paradigm was applied, starting from a rate of 4 rpm to the maximal speed of 40 rpm, then the rotation speed was kept constant at 40 rpm for a maximum of 300 s. The duration for which animal could maintain balance on the rotating drum was measured as the latency to fall, with a maximal cut-off time of 300 s [8,37]. 2.7. Western blot analysis Striatal tissues were lysed in buffer containing a 200 mM Tris–HCl (pH 6.8), 1% SDS, 5 mM EGTA, 5 mM EDTA, 10% glycerol, 1 × phosphatase inhibitor cocktail I (Sigma-Aldrich, St. Louis, MO, U.S.A.), and 1 × protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, U.S.A.). Lysate was centrifuged at 12,000×g for 30 min and the supernatant fraction was used for Western blot analysis as described previously [38,39]. Proteins (20 μg/lane) were separated by 10% or 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) and transferred onto PVDF membranes. Following transfer, the membranes were pre-incubated with 5% non-fat milk for 30 min and incubated overnight at 4 °C with primary antibody against Bcl-2 (1:1000; Santa Cruz

2.3. Drug treatment MPA hydrochloride (Supplementary Fig. S1A) and SCH 23390 hydrochloride (dopamine D1 receptor antagonist; Tocris Bioscience, Ellisville, MO, U.S.A) were dissolved in sterile 0.9% saline. (RS)( ± )-sulpiride (dopamine D2 receptor antagonist; Tocris Bioscience, Ellisville, MO, U.S.A) was dissolved in a small amount of 0.1 N HCl solution, and the pH was adjusted to 6–7 with 0.1 N NaOH. To examine whether MPA induces hyperthermia, oxidative stress, 135

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

2.11. Measurements of dopamine (DA), 3,4-dihydroxyphenylacetic acid (DOPAC), and homovanillic acid (HVA)

Biotechnology), Bax (1:1000; Santa Cruz Biotechnology), cleaved caspase 3 (1:1000; Cell Signaling Technology), caspase 3 (1:1000; Cell Signaling Technology), Iba-1 (1:500; Wako Pure Chemical Industries, Chuo-ku, Osaka, Japan), GFAP (1:500; Santa Cruz Biotechnology), TH [1:5000; Chemicon (EMD Millipore)], DAT (1:1000; Abcam, Cambridge, U.K.), VMAT-2 (1:500; Novus Biologicals, Littleton, CO, USA), or β-actin (1:50000; Sigma-Aldrich, St. Louis, MO, U.S.A.). Membranes were then incubated with HRP-conjugated secondary anti-rabbit IgG (1:1000, GE healthcare, Piscataway, NJ, U.S.A.), anti-mouse IgG (1:1000, Sigma-Aldrich) or anti-goat IgG (1:1000, Sigma-Aldrich) for 2 h. Subsequent visualization was performed using an enhanced chemiluminescence system (ECL plus®, GE Healthcare, Arlington Heights, IL, U.S.A.). Relative intensities of the bands were quantified by PhotoCapt MW (version 10.01 for Windows; Vilber Lourmat, Marne la Vallée, France), and then normalized to the intensity of β-actin [40,41].

Mice were sacrificed by cervical dislocation and the brains were removed. The striatum was dissected, immediately frozen on dry ice, and stored at −70 °C before assays were performed. Tissues were weighed, ultrasonicated in 10% perchloric acid, and centrifuged at 20,000×g for 10 min. The levels of DA and its metabolites DOPAC, and HVA were determined by HPLC coupled with an electrochemical detector, as described previously [13,46]. Supernatant aliquots (20 μL) were injected into an HPLC equipped with a C18 column with 3 μm particle size (Waters). The mobile phase was comprised of 26 mL of acetonitrile, 21 mL of tetrahydrofuran, and 960 mL of 0.15 M monochloroacetic acid (pH 3.0) containing 50 mg/L of EDTA and 200 mg/mL of sodium octyl sulfate. The amount of DA was determined by comparison of peak areas of tissue samples with the standard, and was expressed in ng/g of wet tissue.

2.8. Quantification of 4-hydroxynonenal (HNE) 2.12. Immunocytochemistry The amount of lipid peroxidation was determined by measuring the level of 4-hydroxynonenal (HNE) using the OxiSelect™ HNE adduct ELISA kit (Cell Biolabs, Inc., San Diego, CA, U.S.A.) according to the manufacturer's instructions. 100 μL of striatal homogenate at a protein concentration of 10 μg/mL was incubated in 96-well protein binding plates at 4 °C overnight. After protein adsorption, HNE adducts in each well were labeled with HNE antibody, followed by HRP-conjugated secondary antibody. Colorimetric development was then performed with substrate solution. Absorbance was recorded at 450 nm using a microplate reader (Molecular Devices Inc., Sunnyvale, CA, U.S.A.), and an amount of HNE adduct in each sample was calculated from the standard curve for HNE-BSA [42].

Immunocytochemistry was performed as described previously [37]. Mice were transcardially perfused with 50 mL of ice-cold PBS (10 mL/ 10 g body weight) followed by 4% paraformaldehyde (20 mL/10 g body weight). Brains were removed and stored in 4% paraformaldehyde overnight. Series of every sixth sections (30 μm thickness, 210 μm apart) from striatum were selected and subjected to immunocytochemistry. Sections were blocked with PBS containing 0.3% hydrogen peroxide for 30 min and then incubated in PBS containing 0.4% Triton X-100% and 1% normal serum for 20 min. After a 48-h incubation with primary antibody against TH [1:500; Chemicon (EMD Millipore)], Iba-1 (1:500, Wako Pure Chemical Industries, Chuo-ku, Osaka, Japan), or glial fibrillary acidic protein (GFAP) [1:250; Chemicon (EMD Millipore), sections were incubated with the biotinylated secondary antibody (1:1000; Vector Laboratories, Burlingame, CA, U.S.A.) for 1 h. The sections were then immersed in a solution containing avidin–biotin peroxidase complex (Vector Laboratories) for 1 h, and 3,3′-diaminobenzidine was utilized as the chromogen. Digital images were acquired under an upright microscope (BX51; Olympus) using an attached digital microscope camera (DP72; Olympus) and an IBM PC. ImageJ version 1.47 software (National Institutes of Health, Bethesda, MD, U.S.A.) was employed to measure the immunoreactivities of TH, Iba-1, and GFAP in the striatum as described previously [8,46]. Briefly, the entire striatal region from each section was selected as the region of interest (ROI). Threshold values for hue (0–100), saturation (0–255), and brightness (175–255) were set in the “Adjust Color Threshold” dialog box, and then the mean density was measured.

2.9. Quantification of protein carbonyl groups The extent of protein oxidation was assessed by measuring the content of protein carbonyl groups, which was determined spectrophotometrically with the 2,4-dinitrophenylhydrazine (DNPH)-labeling procedure as described by Oliver [43,44]. The results are expressed as nmol of DNPH incorporated/mg protein based on the extinction coefficient for aliphatic hydrazones of 21 mM−1 cm−1. Protein was measured using the Pierce 660 nm Protein Assay™ reagent (Thermo Scientific, Rockford, IL, U.S.A).

2.10. Quantification of reactive oxygen species (ROS) formation The ROS formation in the striatum was assessed by measuring the conversion from 2′,7′-dichlorofluorescin diacetate (DCFH-DA) to dichlorofluorescin (DCF) [45]. Brain homogenates were added to a tube containing 2 mL of PBS with 10 nmol of DCFH-DA, dissolved in methanol. The mixture was incubated at 37 °C for 3 h, and then fluorescence was measured at 480 nm excitation and 525 nm emission. DCF was used as a standard.

2.13. Reverse transcription and polymerase chain reaction (RT-PCR) Total RNA was isolated from the striatal tissues using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. Reverse transcription reactions were carried out using the RNA to cDNA Eco-Dry Premix (Clontech, Palo Alto, CA, USA) with a 1-h

Table 1 Gene primer sequences for RT-PCR analysis. Gene

Forward primer (5’ – 3′)

Reverse primer (5’ – 3′)

Arginase 1 CD206 CD16 CD32 CD86 GAPDH

GAACACGGCAGTGGCTTTAAC TCTTTGCCTTTCCCAGTCTCC TTTGGACACCCAGATGTTTCAG AATCCTGCCGTTCCTACTGATC TTGTGTGTGTTCTGGAAACGGAG ACCACAGTCCATGCCATCAC

TGCTTAGCTCTGTCTGCTTTGC TGACACCCAGCGGAATTTC GTCTTCCTTGAGCACCTGGATC GTGTCACCGTGTCTTCCTTGAG AACTTAGAGGCTGTGTTGCTGGG TCCACCACCCTGTTGCTGTA

136

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

incubation at 42 °C. Polymerase chain reaction (PCR) amplification was performed for 35 cycles of denaturation at 94 °C for 1 min, annealing at 60 °C for 2 min, and extension at 72 °C for 1 min. Primer sequences [16,46] for PCR amplification are listed in Table 1. PCR products were separated on 2% agarose gels containing ethidium bromide and visualized under ultraviolet light. Quantitative analysis of RNA was performed using PhotoCapt MW (version 10.01 for Windows; Vilber Lourmat). 2.14. Statistics Data were analyzed using IBM SPSS ver. 19.0 (IBM, Chicago, IL, USA). One-way analysis of variance (ANOVA) or two-way ANOVA was employed for the statistical analyses. Post-hoc Fisher's least significant difference pairwise comparisons tests were then conducted. Results are expressed as mean ± S.E.M. The statistical significance of mortality was calculated using the Chi-square test. Differences were considered statistically significant at P-values < 0.05. 3. Results 3.1. Effect of dopamine receptor antagonists on MPA-induced hyperthermia in mice According to experimental design shown in Figs. S1B–C, significant hyperthermic responses were found by the paradigm of four times injection of 20 mg/kg MPA (P < 0.01) (Fig. 1A). We then investigated whether SCH 23390 or sulpiride affects hyperthermia induced by MPA. As shown in Fig. 1B, both SCH 23390 and sulpiride significantly attenuated MPA-induced hyperthermia (both SCH 23390 and sulpiride; P < 0.05, respectively). 3.2. Effect of dopamine receptor antagonists on MPA-induced oxidative burdens in the striatum of mice As shown in Fig. 2A–C, in advance we examined whether the 4 × 10 mg/kg or 20 mg/kg paradigm of MPA administration produces reactive oxygen species (ROS), 4-hydroxynonenal (4-HNE), and protein carbonyl over time. The 4 × 10 mg/kg paradigm of MPA administration significantly increased ROS (P < 0.01), 4-HNE (P < 0.05), or protein carbonyl (P < 0.01) 4 h later. In addition, the effects by the 4 × 20 mg/kg paradigm of MPA administration were more pronounced (ROS, 4-HNE, and protein carbonyl; P < 0.05 vs. the 4 × 10 mg/kg paradigm of MPA, respectively) than those by the 4 × 10 mg/kg paradigm of MPA, indicating that MPA-induced oxidative burdens are dosedependent. However, these oxidative burdens returned to saline (control) levels within 1 d post-MPA. As shown in Fig. 2D–F, we then investigated whether SCH 23390 or sulpiride affects MPA (4 × 20 mg/kg)-induced increases in oxidative parameters 4 h later. Both SCH 23390 and sulpiride significantly attenuated MPA-induced increases in ROS (both SCH 23390 and sulpiride; P < 0.01, respectively), 4-HNE (both SCH 23390 and sulpiride; P < 0.05, respectively), and protein carbonyl (both SCH 23390 and sulpiride; P < 0.05, respectively).

Fig. 1. Effect of dopamine receptor antagonists on the hyperthermia induced by MPA in mice. Dose-dependent hyperthermic effects of MPA (A). Effect of SCH 23390 or sulpiride on MPA-induced hyperthermia after the 4 × 20 mg/kg paradigm of MPA administration in mice (B). Basal rectal temperature was measured 1 h before the first MPA treatment. Rectal temperature was measured four times as a 1 h-interval after every MPA administration. Sal = Saline. SCH = SCH 23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. For more details, please refer to 2. Materials and methods. Each value is the mean ± S.E.M of six animals. *P < 0.05, **P < 0.01 vs. Sal or Sal + Sal. # P < 0.05, ##P < 0.01 vs. Sal + MPA 20 (two-way ANOVA followed by Fisher's LSD pairwise comparisons).

4 × 20 mg/kg paradigm of MPA administration were consistently more pronounced (Bax, cleaved caspase-3, and Bcl-2: 1 d, 3 d, and 14 d postMPA; P < 0.01, P < 0.01, and P < 0.05 vs. the 4 × 10 mg/kg paradigm of MPA, respectively) than those by the 4 × 10 mg/kg paradigm of MPA. As these changes appear to be most pronounced in 1 d post-MPA (4 × 10 mg/kg or 20 mg/kg) out of 4 h, 1 d, 3 d, and 14 d post-MPA, we focused on 1 d post-MPA (4 × 20 mg/kg). As shown in Fig. 3D–F, both SCH 23390 and sulpiride significantly attenuated changes in Bax- (both SCH 23390 and sulpiride; P < 0.01, respectively), cleaved caspase-3(both SCH 23390 and sulpiride; P < 0.01, respectively), and Bcl-2expressions (both SCH 23390 and sulpiride; P < 0.01, respectively).

3.3. Effect of dopamine receptor antagonists on MPA-induced change in pro-apoptotic and anti-apoptotic parameters in the striatum of mice As shown in Fig. 3, we tested whether the 4 × 10 mg/kg or 20 mg/ kg paradigm of MPA administration alters pro-apoptotic (i.e., Bax, cleaved caspase-3), and anti-apoptotic (i.e., Bcl-2) proteins over time, and whether SCH 23390 or sulpiride affects these alterations. As shown in Fig. 3A–C, pro-apoptotic and anti-apoptotic parameters were significantly changed (Bax, cleaved caspase-3, and Bcl-2: 1 d, and 3 d postMPA; P < 0.05 vs. corresponding saline, respectively) by the 4 × 10 mg/kg paradigm of MPA. However, the changes by the 137

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

Fig. 2. Effect of dopamine receptor antagonists on oxidative parameters induced by MPA in mice. Time-course of changes in reactive oxygen species (ROS) (A), 4-hydroxynonenal (4-HNE, a parameter of lipid peroxidation) (B), and protein carbonyl (a parameter of protein oxidation) (C) induced by the 4 × 10 mg/kg or 20 mg/kg paradigm of MPA administration. Effect of SCH or Sul on the increases in ROS (D), 4-HNE (E), and protein carbonyl (F) 4 h after the final MPA treatment (4 × 20 mg/kg) in the striatum of mice. Sal = Saline. MPA 10 = the 4 × 10 mg/ kg paradigm of MPA. MPA 20 = the 4 × 20 mg/ kg paradigm of MPA. SCH = SCH 23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of six animals. *P < 0.05, **P < 0.01 vs. Sal. †P < 0.05 vs. MPA 10. # P < 0.05, ##P < 0.01 vs. Sal + MPA 20 (one-way ANOVA followed by Fisher's LSD pairwise comparisons).

3.5. Effect of dopamine receptor antagonists on MPA-induced microglial differentiation into M1 or M2 phenotype in the striatum of mice

3.4. Effect of dopamine receptor antagonists on MPA-induced ionized calcium-binding adapter molecule-1 (Iba-1)-labeled microgliosis in the striatum of mice

Because the most significantly activated Iba-1-labeled microglia occurred 1 d post-MPA, we focused on this time-point in order to clarify which phenotype's parameters contribute microglial activation. As shown in Fig. 5A–E, the 4 × 20 mg/kg paradigm of MPA administration significantly increased the M1 phenotype mRNAs (CD16, CD32, and CD86; P < 0.01 vs. corresponding saline, respectively). However, MPA did not significantly alter the M2 phenotype mRNAs (i.e., Arginase 1 and CD206). Dopaminergic antagonists attenuated CD16 mRNA expression (both SCH 23390 and sulpiride; P < 0.01, respectively), CD32 mRNA expression (both SCH 23390 and sulpiride; P < 0.05, respectively), CD86 mRNA expression (both SCH 23390 and sulpiride; P < 0.05, respectively). Dopaminergic antagonists did not significant change Arginase 1 and CD206 mRNA expressions (Fig. 5D and E).

As we demonstrated that microglial response associated with MA neurotoxicity appears to be a critical step in the neurodegeneration [8,9,37], we tested whether MPA also induces microgliosis. As shown in Fig. 4A and B, we examined the changes in Iba-1 expression and Iba-1labeled microglial immunoreactivity (IR) 4 h, 1 d, 3 d, and 14 d after the final MPA administration (4 × 10 mg/kg or 20 mg/kg paradigm). Iba-1 expression and Iba-1-IR induced by MPA were most significant 1 d postMPA out of the time-points. Furthermore, MPA induced microglial activation in a dose-related manner (the 4 × 20 mg/kg paradigm of MPA: Iba-1 expression, and Iba-1-IR; 1 d, and 3 d post-MPA; P < 0.01 vs. the 4 × 10 mg/kg paradigm of MPA, respectively). We then examined the effects of SCH 23390 or sulpiride on microglial activation 1 d post-MPA (4 × 20 mg/kg). As presented in Fig. 4C and D, SCH 23390 and sulpiride attenuated against increases in the Iba-1 expression and Iba-1-IR (both SCH 23390 and sulpiride; P < 0.01, respectively) induced by MPA.

3.6. Effect of dopamine receptor antagonists on MPA-induced glial fibrillary acidic protein (GFAP)-labeled astrogliosis in the striatum of mice Although reactive astrocytes are, in part, considered as a detrimental factor for neuronal function, compelling evidence suggested that reactive astrocytes may have beneficial effects and promote neuronal survival [47,48]. Therefore, we have tested the role of GFAP138

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

Fig. 3. Effect of dopamine receptor antagonists on the change in the pro-apoptotic and antiapoptotic parameters induced by MPA in mice. Time-course of changes in Bax (A), cleaved caspase-3 (B) and Bcl-2 (C) induced by the 4 × 10 mg/kg or 20 mg/kg paradigm of MPA administration. Effect of SCH or Sul on the changes in Bax (D), cleaved caspase-3 (E) and Bcl-2 (F) 1 d after the final MPA treatment (4 × 20 mg/kg, i.p.) in the striatum of mice. Sal = Saline. MPA 10 = the 4 × 10 mg/kg paradigm of MPA. MPA 20 = the 4 × 20 mg/kg paradigm of MPA. SCH = SCH 23390 (0.1 mg/ kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of six animals. *P < 0.05, **P < 0.01 vs. Sal. †P < 0.05, ††P < 0.01 vs. MPA 10. #P < 0.01 vs. Sal + MPA 20 (one-way ANOVA followed by Fisher's LSD pairwise comparisons).

corresponding saline, respectively), TH-IR (3 d, and 14 d post-MPA; P < 0.01, and P < 0.05 vs. corresponding saline, respectively), dopamine level (3 d, and 14 d post-MPA; P < 0.01 vs. corresponding saline, respectively), and significantly increased dopamine turnover rate (3 d, and 14 d post-MPA; P < 0.05 vs. corresponding saline, respectively). Consistently, these changes were more pronounced in the 4 × 20 mg/kg paradigm of MPA than in the 4 × 10 mg/kg paradigm of MPA. The 4 × 20 mg/kg paradigm of MPA significantly decreased TH expression, TH-IR, dopamine level (1 d, 3 d, and 14 d post-MPA; P < 0.01 vs. corresponding saline, respectively), and significantly increased dopamine turnover rate (1 d, 3 d, and 14 d post-MPA; P < 0.01 vs. corresponding saline, respectively). In addition, the changes induced by the 4 × 20 mg/kg paradigm of MPA were more pronounced (TH expression, TH-IR, dopamine, and dopamine turnover rate: 1 d, 3 d, and 14 d post-MPA; P < 0.01 vs. the 4 × 10 mg/kg paradigm of MPA, respectively) than those induced by the 4 × 10 mg/kg paradigm of MPA. These changes appeared to be most significant 3 d post-MPA. We next investigated the effects of SCH 23390 or sulpiride on the dopaminergic impairments 3 d after the final MPA (4 × 20 mg/kg) (Fig. 7E–H). Either compound provided a significant protection (both SCH 23390 and sulpiride; P < 0.01, respectively) against MPA-induced changes in TH expression, TH-IR, DA level, and DA turnover rate.

labeled astrocytes in the MPA-induced neurotoxicity. As shown in Fig. 6A and B, significant increases in GFAP expression (P < 0.05 vs. corresponding saline) and GFAP-positive astrocytes (P < 0.01 vs. corresponding saline) was observed 3 d post-MPA (4 × 10 mg/kg). These significant increases in GFAP expression and GFAP-immunoreactivity (GFAP-IR) were more pronounced in the 4 × 20 mg/kg paradigm of MPA (GFAP expression, and GFAP-IR: 1 d, 3 d, and 14 d post-MPA; P < 0.05, P < 0.01, and P < 0.01 vs. the 4 × 10 mg/kg paradigm of MPA, respectively) than in the 4 × 10 mg/kg paradigm of MPA. The maximal GFAP expression and GFAP-IR were observed 3 d post-MPA (4 × 10 mg/kg or 20 mg/kg), and the increases remained elevated 14 d post-MPA. Unexpectedly, treatment with SCH 23390 or sulpiride did not significantly alter the astrocytic induction 3 d postMPA (4 × 20 mg/kg) (Fig. 6C and D). 3.7. Effect of dopamine receptor antagonists on MPA-induced dopaminergic impairments in the striatum of mice We examined whether MPA impairs dopaminergic system. As shown in Fig. 7A–D, we examined tyrosine hydroxylase (TH) expression, TH-immunoreactivity (TH-IR), dopamine, and dopamine turnover rate over time. The 4 × 10 mg/kg paradigm of MPA significantly decreased TH expression (3 d, and 14 d post-MPA; P < 0.05 vs. 139

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

Fig. 4. Effect of dopamine receptor antagonists on the change in ionized calcium-binding adapter molecule-1 (Iba-1) levels induced by MPA in mice. Time-course of changes in Iba-1 expression (A) and Iba-1-immunoreactivity (B) induced by the 4 × 10 mg/kg or 20 mg/kg paradigm of MPA administration. Effect of SCH or Sul on the changes in Iba-1 expression (C) and Iba-1-immunoreactivity (D) 1 d after the final MPA treatment (4 × 20 mg/kg, i.p.) in the striatum of mice. Sal = Saline. MPA 10 = the 4 × 10 mg/kg paradigm of MPA. MPA 20 = the 4 × 20 mg/kg paradigm of MPA. SCH = SCH 23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of six animals. *P < 0.05, **P < 0.01 vs. Sal. †P < 0.01 vs. MPA 10. # P < 0.01 vs. Sal + MPA 20 (one-way ANOVA followed by Fisher's LSD pairwise comparisons). Scale bar = 100 μm.

P < 0.05 vs. the 4 × 10 mg/kg paradigm of MPA, respectively) expressions was more evident in the 4 × 20 mg/kg paradigm of MPA than in the 4 × 10 mg/kg paradigm of MPA. Because these decreases were most significant 3 d post-MPA, we focused on this time point for further study. As shown in Fig. 8C and D, either SCH 23390 or sulpiride treatment significantly attenuated (both SCH 23390 and sulpiride; P < 0.01, respectively) against decreases in DAT- and VMAT-2- expressions 3 d post-MPA (4 × 20 mg/kg).

3.8. Effect of dopamine receptor antagonists on MPA-induced decrease in dopamine transporter (DAT) and vesicular monoamine transporter-2 (VMAT-2) expressions in the striatum of mice DAT, a transmembrane protein, is involved in clearing dopamine from the synapse and returning it to the presynaptic terminals. VMAT-2 transports dopamine, serotonin, and norepinephrine from the cytoplasm into specialized secretory vesicles. Using Western blotting, a previous study demonstrated that chronic MA users exhibited deficits in dopaminergic terminal markers [49]. In addition, we and others demonstrated the essential role that dopamine terminal markers play in MA-induced neurotoxicity [38,50]. Therefore, as shown in Fig. 8A and B, we investigated whether MPA affects DAT- and VMAT-2-expressions over time. MPA treatment significantly decreased DAT and VMAT-2 expressions. The 4 × 10 mg/kg paradigm of MPA significantly decreased DAT (3 d, and 14 d post-MPA; P < 0.05 vs. corresponding saline, respectively), and VMAT-2 (3 d, and 14 d post-MPA; P < 0.01, and P < 0.05 vs. corresponding saline, respectively) expressions. Consistently, these decreases in DAT (1 d, 3 d, and 14 d post-MPA; P < 0.05 vs. the 4 × 10 mg/kg paradigm of MPA, respectively), and VMAT-2 (3 d, and 14 d post-MPA; P < 0.01, and

3.9. Effect of dopamine receptor antagonists on MPA-induced behavioral impairments in mice Because AMPHs-induced behavioral impairment is, at least in part, related to the dopaminergic degenerative effects of the drug [8,38,51], we measured locomotor activity and rota-rod performance in mice. As shown in Fig. 9A and B, we measured locomotor activity and rota-rod performance 4 h, 1 d, 3 d, and 14 d after the final MPA treatment (4 × 20 mg/kg). Behavioral profile of locomotor activity paralleled that of rota-rod performance. The 4 × 10 mg/kg paradigm of MPA significantly decreased locomotor activity (3 d, and 14 d post-MPA; 140

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

Fig. 5. Effect of dopamine receptor antagonists on the microglial differentiation into M1 phenotype (A–C) and M2 phenotype (D–E) 1 d after the final MPA treatment (4 × 20 mg/kg, i.p.) in the striatum of mice. Sal = Saline. MPA 20 = the 4 × 20 mg/kg paradigm of MPA. SCH = SCH 23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of six animals. *P < 0.01 vs. Sal + Sal. # P < 0.05, ##P < 0.01 vs. Sal + MPA 20 (one-way ANOVA followed by Fisher's LSD pairwise comparisons).

microglial activation, and pro-apoptotic changes. Moreover, treatment with MPA resulted in significant impairments in dopaminergic system, and in behavioral activity. Both dopamine D1 receptor antagonist SCH23390 and D2 receptor antagonist sulpiride consistently and significantly attenuated dopaminergic toxicity induced by MPA, suggesting that activation of both dopamine D1 and D2 receptors contributes to MPA-induced dopaminergic neurotoxicity (Fig. 10). In addition, we propose here that Iba-1-labeled microglia, but not GFAPlabeled astroglia, may be the neurotoxic target for the activation of dopamine D1 and D2 receptors induced by MPA. Converging evidence indicated a possible connection between hyperthermic and neurotoxic responses of AMPHs [52–54]. Earlier reports suggested that MA-induced hyperthermia may be important for striatal dopamine depletion [52], formation of dopamine quinones [55], and thereby production of free radicals [56]. In addition, earlier reports suggested that inhibition of hyperthermia, at least in part, exhibits the

P < 0.05 vs. corresponding saline, respectively) and rota-rod performance (3 d, and 14 d post-MPA; P < 0.01, and P < 0.05 vs. corresponding saline, respectively). Consistently, the decrease in behavioral activities was more prominent in the 4 × 20 mg/kg paradigm of MPA (3 d, and 14 d post-MPA; P < 0.05 vs. the 4 × 10 mg/kg paradigm of MPA, respectively) than in the 4 × 10 mg/kg paradigm of MPA. As shown in Fig. 9C and D, either SCH 23390 or sulpiride significantly attenuated (3 d, and 14 d later: both SCH 23390 and sulpiride; P < 0.01, respectively) against decreases in the locomotor activity and rota-rod performance 3 d, and 14 d post-MPA (4 × 20 mg/ kg).

4. Discussion We observed in this study that MPA treatment significantly induces initial oxidative burdens, followed by M1 phenotype-dependent 141

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

Fig. 6. Effect of dopamine receptor antagonists on the change in glial fibrillary acidic protein (GFAP) levels induced by MPA in mice. Timecourse of changes in GFAP expression (A) and GFAP-immunoreactivity (B) induced by the 4 × 10 mg/kg or 20 mg/kg paradigm of MPA administration. Effect of SCH or Sul on the changes in GFAP expression (C) and GFAP-immunoreactivity (D) 3 d after the final MPA treatment (4 × 20 mg/kg, i.p.) in the striatum of mice. Sal = Saline. MPA 10 = MPA 10 = the 4 × 10 mg/kg paradigm of MPA. MPA 20 = the 4 × 20 mg/kg paradigm of MPA. SCH = SCH 23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of six animals. *P < 0.05, **P < 0.01 vs. Sal. †P < 0.05, ††P < 0.01 vs. MPA 10 (one-way ANOVA followed by Fisher's LSD pairwise comparisons). Scale bar = 100 μm.

neurotoxicity induced by MPA. Activation of astrocytes may exert either neuroprotective or neurotoxic effects to neighboring neurons, since reactive astrocytes can release a broad range of immune mediators including cytokines [i.e., interleukin 6, interferon β, transforming growth factor β, and B cellactivating factor of the tumor necrosis factor family (BAFF), etc.], chemokines [i.e., C-C motif chemokine ligand (CCL) 2, CCL5, and C-X-C motif chemokine 10 (CXCL10), etc.], and growth factors [i.e., nerve growth factor, ciliary neurotrophic factor, brain-derived neurotrophic factor, and insulin-like growth factor 1, etc.] [62]. We observed that MPA significantly induces GFAP-IR initially 1 d, and maximally 3 d, and it remains elevated, at least, for 14 d later. This phenomenon might parallel MA case [37,63]. Therefore, we raise the possibility that it might be a compensative induction against MPA insult, although it remains to be elucidated. Microglia-mediated neuroinflammatory changes might be a hallmark of various neurodegenerative diseases. Numerous studies have suggested that reactive microglia have been shown to secrete pro-inflammatory cytokines (i.e., interleukin 1β family and tumor necrosis factor α), chemokines [mainly, C-C chemokine receptor-like 2

protective effects on MA-dependent neurotoxicity [57,58]. Consistently, genetic or pharmacological inhibition of dopamine D1 or D2 receptor attenuated hyperthermic responses induced by AMPHs [8,16,22,59]. Similarly, we observed that MPA-induced hyperthermia requires activation of both dopamine D1 and D2 receptors. Another mechanism underlying on the toxicity of dopaminergic neurons might be related to dopamine-dependent initial oxidative stress [60]. Dopamine metabolism mediated by monoamine oxidase (MAO) can produce hydrogen peroxide as a by-product, and excess dopamine can undergo auto-oxidation to quinones or semiquinones [55], which results in the formation of superoxide radicals, hydrogen peroxide, and further hydroxyl radicals [10,61]. Consistently, it was demonstrated that dopamine oxidation contributes to damage of dopamine terminals [55]. It is plausible that inhibition of cytosolic dopamine by dopaminergic antagonism might abolish the production of oxidative parameters, and thus subsequently resist to neurotoxicity induced by AMPHs [7,18,22]. Because dopamine receptor antagonists significantly attenuated MPA-induced oxidative burdens, it is plausible that MPA treatment might be sufficient to alter dopaminergic neurotransmission, and dopamine-dependent oxidative burdens might be important for 142

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

Fig. 7. Effect of dopamine receptor antagonists on the change in tyrosine hydroxylase (TH) level, dopamine level, and dopamine turnover rate induced by MPA in mice. Time-course of changes in TH expression (A), TH-immunoreactivity (B), dopamine level (C) and dopamine turnover rate (D) induced by MPA the 4 × 10 mg/kg or 20 mg/kg paradigm of MPA administration. Effect of SCH or Sul on the changes in TH expression (E), TH-immunoreactivity (F), dopamine level (G), and dopamine turnover rate (H) 3 d after the final MPA treatment (4 × 20 mg/kg, i.p.) in the striatum of mice. Sal = Saline. MPA 10 = the 4 × 10 mg/kg paradigm of MPA. MPA 20 = the 4 × 20 mg/kg paradigm of MPA. SCH = SCH 23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of six animals. *P < 0.05, **P < 0.01 vs. Sal. †P < 0.01 vs. MPA 10. #P < 0.01 vs. Sal + MPA 20 (one-way ANOVA followed by Fisher's LSD pairwise comparisons). Scale bar = 1 mm.

Fig. 8. Effect of dopamine receptor antagonists on the change in dopamine transporter (DAT) and vesicular monoamine transporter-2 (VMAT2) induced by MPA in mice. Time-course of changes in DAT expression (A) and VMAT-2 expression (B) induced by the 4 × 10 mg/kg or 20 mg/kg paradigm of MPA administration. Effect of SCH or Sul on the changes in DAT expression (C) and VMAT-2 expression (D) 3 d after the final MPA treatment (4 × 20 mg/kg, i.p.) in the striatum of mice. Sal = Saline. MPA 10 = the 4 × 10 mg/kg paradigm of MPA. MPA 20 = the 4 × 20 mg/kg paradigm of MPA. SCH = SCH 23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of six animals. *P < 0.05, **P < 0.01 vs. Sal. †P < 0.05, †† P < 0.01 vs. MPA 10. #P < 0.01 vs. Sal + MPA 20 (one-way ANOVA followed by Fisher's LSD pairwise comparisons).

143

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

Fig. 9. Effect of dopamine receptor antagonists on the behavioral deficits induced by MPA in mice. Time-course of changes in locomotor activity (A) and rota-rod performance (B) induced by the 4 × 10 mg/kg or 20 mg/kg paradigm of MPA administration. Effect of SCH or Sul on the locomotor activity (C) and rota-rod performance (D) 3 d and 14 d after the final MPA treatment (4 × 20 mg/kg, i.p.). Sal = Saline. MPA 10 = the 4 × 10 mg/kg paradigm of MPA. MPA 20 = the 4 × 20 mg/kg paradigm of MPA. SCH = SCH 23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul = sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of six animals. *P < 0.05, **P < 0.01 vs. Sal. †P < 0.05 vs. MPA 10. #P < 0.01 vs. Sal + MPA 20 (one-way ANOVA followed by Fisher's LSD pairwise comparisons).

microglial activation generates a vicious cycle that leads to a progressive neuronal apoptosis [66]. For example, MA treatment induced microglial activation, alterations in pro-apoptotic and anti-apoptotic proteins, and consequently triggered caspase activation [67,68]. Importantly, a previous report has suggested that caspase activation is involved in regulating microglial activation through a protein kinase C (PKC) δ-dependent pathway [69]. In consistent with these findings, we showed that MPA-induced microglial activation requires up-regulation of pro-apoptotic protein (i.e., Bax, cleaved caspase-3), and down-regulation of anti-apoptotic protein (i.e., Bcl-2). Therefore, we propose that oxidative stress, microglial activation, and pro-apoptotic signaling might facilitate neurotoxic outcomes of MPA. A strong support for a dual role of microglia may be due to distinct microglial phenotypes, which have been broadly categorized into classical pro-inflammatory M1 phenotype and alternative anti-inflammatory M2 phenotype [70,71]. In consistent with these findings, we observed that MPA significantly increased M1 phenotype markers (CD16, CD32, and CD86) without significant changes of M2 phenotypic markers (Arginase 1 and CD206), suggesting that microgliosis induced by MPA depends on pro-inflammatory M1 phenotype. Similarly, our previous reports have demonstrated that PKC δ activates M1 phenotype microglia for inducing dopaminergic damage induced by MA [37]. Importantly, we observed for the first time that M1 phenotype microglial differentiation requires both dopamine D1 and D2 receptors for MPA-induced neurotoxic consequences. AMPHs facilitate dopamine release, which further triggers dopamine depletion [72]. Indeed, we observed that repeated treatment of MPA significantly inhibited TH-, DAT-, and VMAT-2 levels. Since DAT and VMAT-2 are important for dopaminergic terminal markers [10], their decreases suggest that MPA-induced reduction in TH levels is mainly due to dopaminergic degeneration. Neurons in the striatum, unlike those in the cerebral cortex and cerebellum, do not form a layered or columnar structure. Although they appear to be randomly distributed, they are actually scattered in two embryologically different compartments called striosomes (often referred to as“patches”in rodents) and the matrix. The striosome

Fig. 10. A schematic depiction on the role of dopamine receptors in MPA-induced neurotoxicity in mice. Treatment with MPA resulted in an early increase of oxidative parameters in the striatum of mice. These oxidative burdens might activate M1 phenotype-dependent microgliosis as well as pro-apoptotic changes. Oxidative burdens, microglial activation, and pro-apoptotic changes might be important for dopaminergic impairments with the behavioral deficits induced by MPA. Dopamine D1 and D2 receptors might simultaneously mediate these dopaminergic neurotoxic consequences, because the protection by dopamine D1 receptor antagonist SCH 23390 is comparable to that by D2 receptor antagonist sulpiride against MPA neurotoxicity.

(CCRL2)], and oxidative parameters [i.e., hydrogen peroxide (H2O2), nitric oxide (NO), superoxide, and nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase), etc.] which are potential to cause neuronal damage [64,65]. The combination of oxidative stress and 144

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

compartment is embryologically older and the“dopamine island,“observed only during development, corresponds to patch/striosome. The matrix develops later and eventually accounts for approximately 85% of the entire striatum [73–75]. The matrix compartment is densely stained with acetylcholinesterase, and calbindin and somatostatin are expressed at relatively high levels [75–77]. The striosome compartment is rich in μ-opioid receptors [74,75,78,79]. Granado et al. [80] provide the first evidence that MA produces a greater loss of TH/DAT-positive terminals in the striosomes than in the matrix, suggesting that the striosomes are differentially affected by MA. They also propose that the increased susceptibility of the striosomal compartment to the damaging effects of MA may be related to a lower antioxidant capacity in striosomes than in matrix. A similar pattern of greater striosomal damage in the striatum has been observed following administration of MDMA [81,82]. Therefore, we raise the possibility that MPA also could induce similar striosomal damage in the striatum. Previous reports have demonstrated that a correlation between behavioral (motor) dysfunctions and dopaminergic impairments may be possible [8–10,12,37,83,84]. In consistent with these reports, current findings suggest that initial oxidative stress, neuroinflammatory, and proapoptotic properties might be critical for inducing dopaminergic degeneration, and behavioral deficits.

[2] M. Carvalho, H. Carmo, V.M. Costa, J.P. Capela, H. Pontes, F. Remiao, F. Carvalho, L. Bastos Mde, Toxicity of amphetamines: an update, Arch. Toxicol. 86 (2012) 1167–1231. [3] E.S. Calipari, M.J. Ferris, Amphetamine mechanisms and actions at the dopamine terminal revisited, J. Neurosci. : Off. J. Soc. Neurosci. 33 (2013) 8923–8925. [4] T. Steinkellner, M. Freissmuth, H.H. Sitte, T. Montgomery, The ugly side of amphetamines: short- and long-term toxicity of 3,4-methylenedioxymethamphetamine (MDMA, 'Ecstasy'), methamphetamine and D-amphetamine, Biol. Chem. 392 (2011) 103–115. [5] T.M. Furlong, L.S. Leavitt, K.A. Keefe, J.H. Son, Methamphetamine-, d-amphetamine-, and p-chloroamphetamine-induced neurotoxicity differentially effect impulsive responding on the stop-signal task in rats, Neurotox. Res. 29 (2016) 569–582. [6] R. Moratalla, A. Khairnar, N. Simola, N. Granado, J.R. Garcia-Montes, P.F. Porceddu, Y. Tizabi, G. Costa, M. Morelli, Amphetamine-related drugs neurotoxicity in humans and in experimental animals: main mechanisms, Prog. Neurobiol. 155 (2017) 149–170. [7] S. Ares-Santos, N. Granado, R. Moratalla, The role of dopamine receptors in the neurotoxicity of methamphetamine, J. Intern. Med. 273 (2013) 437–453. [8] D.K. Dang, E.J. Shin, A.T. Mai, C.G. Jang, S.Y. Nah, J.H. Jeong, C. Ledent, T. Yamamoto, T. Nabeshima, E.S. Onaivi, H.C. Kim, Genetic or pharmacological depletion of cannabinoid CB1 receptor protects against dopaminergic neurotoxicity induced by methamphetamine in mice, Free Radic. Biol. Med. 108 (2017) 204–224. [9] D.K. Dang, E.J. Shin, Y. Nam, S. Ryoo, J.H. Jeong, C.G. Jang, T. Nabeshima, J.S. Hong, H.C. Kim, Apocynin prevents mitochondrial burdens, microglial activation, and pro-apoptosis induced by a toxic dose of methamphetamine in the striatum of mice via inhibition of p47phox activation by ERK, J. Neuroinflammation 13 (2016) 12. [10] E.J. Shin, D.K. Dang, T.V. Tran, H.Q. Tran, J.H. Jeong, S.Y. Nah, C.G. Jang, K. Yamada, T. Nabeshima, H.C. Kim, Current understanding of methamphetamineassociated dopaminergic neurodegeneration and psychotoxic behaviors, Arch Pharm. Res. (Seoul) 40 (2017) 403–428. [11] E.J. Shin, H.Q. Tran, P.T. Nguyen, J.H. Jeong, S.Y. Nah, C.G. Jang, T. Nabeshima, H.C. Kim, Role of mitochondria in methamphetamine-induced dopaminergic neurotoxicity: involvement in oxidative stress, neuroinflammation, and pro-apoptosis-A Review, Neurochem. Res. 43 (2018) 66–78. [12] D.K. Dang, C.X. Duong, Y. Nam, E.J. Shin, Y.K. Lim, J.H. Jeong, C.G. Jang, S.Y. Nah, T. Nabeshima, H.C. Kim, Inhibition of protein kinase (PK) Cδ attenuates methamphetamine-induced dopaminergic toxicity via upregulation of phosphorylation of tyrosine hydroxylase at Ser40 by modulation of protein phosphatase 2A and PKA, Clin. Exp. Pharmacol. Physiol. 42 (2015) 192–201. [13] D.K. Dang, E.J. Shin, H.Q. Tran, D.J. Kim, J.H. Jeong, C.G. Jang, S.Y. Nah, H. Sato, T. Nabeshima, Y. Yoneda, H.C. Kim, The role of system Xc- in methamphetamineinduced dopaminergic neurotoxicity in mice, Neurochem. Int. 108 (2017) 254–265. [14] N. Granado, I. Lastres-Becker, S. Ares-Santos, I. Oliva, E. Martin, A. Cuadrado, R. Moratalla, Nrf2 deficiency potentiates methamphetamine-induced dopaminergic axonal damage and gliosis in the striatum, Glia 59 (2011) 1850–1863. [15] E.J. Shin, D.K. Dang, H.Q. Tran, Y. Nam, J.H. Jeong, Y.H. Lee, K.T. Park, Y.S. Lee, C.G. Jang, J.S. Hong, T. Nabeshima, H.C. Kim, PKCδ knockout mice are protected from para-methoxymethamphetamine-induced mitochondrial stress and associated neurotoxicity in the striatum of mice, Neurochem. Int. 100 (2016) 146–158. [16] P.T. Nguyen, E.J. Shin, D.K. Dang, H.Q. Tran, C.G. Jang, J.H. Jeong, Y.J. Lee, H.J. Lee, Y.S. Lee, K. Yamada, T. Nabeshima, H.C. Kim, Role of dopamine D1 receptor in 3-fluoromethamphetamine-induced neurotoxicity in mice, Neurochem. Int. 113 (2017) 69–84. [17] W. Xu, J.P. Zhu, J.A. Angulo, Induction of striatal pre- and postsynaptic damage by methamphetamine requires the dopamine receptors, Synapse (N. Y.) 58 (2005) 110–121. [18] S. Ares-Santos, N. Granado, I. Oliva, E. O'Shea, E.D. Martin, M.I. Colado, R. Moratalla, Dopamine D(1) receptor deletion strongly reduces neurotoxic effects of methamphetamine, Neurobiol. Dis. 45 (2012) 810–820. [19] S.J. O'Dell, F.B. Weihmuller, J.F. Marshall, Methamphetamine-induced dopamine overflow and injury to striatal dopamine terminals: attenuation by dopamine D1 or D2 antagonists, J. Neurochem. 60 (1993) 1792–1799. [20] R.R. Metzger, H.M. Haughey, D.G. Wilkins, J.W. Gibb, G.R. Hanson, A.E. Fleckenstein, Methamphetamine-induced rapid decrease in dopamine transporter function: role of dopamine and hyperthermia, J. Pharmacol. Exp. Ther. 295 (2000) 1077–1085. [21] J.A. Angulo, N. Angulo, J. Yu, Antagonists of the neurokinin-1 or dopamine D1 receptors confer protection from methamphetamine on dopamine terminals of the mouse striatum, Ann. N. Y. Acad. Sci. 1025 (2004) 171–180. [22] N. Granado, S. Ares-Santos, I. Oliva, E. O'Shea, E.D. Martin, M.I. Colado, R. Moratalla, Dopamine D2-receptor knockout mice are protected against dopaminergic neurotoxicity induced by methamphetamine or MDMA, Neurobiol. Dis. 42 (2011) 391–403. [23] U.N.O.o.D.a.C. UNODC, The Challenge of New Psychoactive Substances: a Report from the Global SMART Programme, (2013). [24] H.M.D. Lee, D.M. Wood, S. Hudson, J.R.H. Archer, P.I. Dargan, Acute toxicity associated with analytically confirmed recreational use of methiopropamine (1(thiophen-2-yl)-2-methylaminopropane), J. Med. Toxicol. 10 (2014) 299–302. [25] F.F. Blicke, J.H. Burckhalter, α-Thienylaminoalkanes, J. Am. Chem. Soc. 64 (1942) 477–480. [26] J. Welter, M.R. Meyer, E. Wolf, W. Weinmann, P. Kavanagh, H.H. Maurer, 2Methiopropamine, a thiophene analogue of methamphetamine: studies on its metabolism and detectability in the rat and human using GC-MS and LC-(HR)-MS techniques, Anal. Bioanal. Chem. 405 (2013) 3125–3135.

5. Conclusion We suggested that MPA induces initial oxidative burdens, leading to M1 phenotype-dependent microglial activation, and pro-apoptotic changes in the striatum of mice, and that dopamine D1 and D2 receptors mediate MPA-induced dopaminergic neurotoxic consequences. However, neither dopamine D1 nor D2 receptor antagonist significantly altered MPA-induced astrogliosis. Thus, it is possible that microglia can be the specific target for MPA-induced dopaminergic neurotoxicity, although precise mechanism remains to be elucidated. Conflicts of interest The authors indicate no potential conflicts of interest. Acknowledgements This study was supported by a grant (14182MFDS979) from the Korea Food and Drug Administration, and by Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Science and ICT (#NRF-2017R1A2B1003346), Republic of Korea. Phuong-Tram Nguyen, Duy-Khanh Dang and Hai-Quyen Tran were supported by the BK21 PLUS program, National Research Foundation of Korea, Republic of Korea. Equipment at the Institute of New Drug Development Research (Kangwon National University) was used for this study. The English in this document has been checked by at least two professional editors, both native speakers of English. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cbi.2019.03.017. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.cbi.2019.03.017. References [1] A. Teixeira-Gomes, V.M. Costa, R. Feio-Azevedo, L. Bastos Mde, F. Carvalho, J.P. Capela, The neurotoxicity of amphetamines during the adolescent period, Int. J. Dev. Neurosci. : Off. J. Int. Soc. Dev. Neurosci. 41 (2015) 44–62.

145

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

[51] H. Chen, J. Wu, J. Zhang, Y. Fujita, T. Ishima, M. Iyo, K. Hashimoto, Protective effects of the antioxidant sulforaphane on behavioral changes and neurotoxicity in mice after the administration of methamphetamine, Psychopharmacology 222 (2012) 37–45. [52] J.F. Bowyer, D.L. Davies, L. Schmued, H.W. Broening, G.D. Newport, W. Slikker Jr., R.R. Holson, Further studies of the role of hyperthermia in methamphetamine neurotoxicity, J. Pharmacol. Exp. Ther. 268 (1994) 1571–1580. [53] M.S. Levi, B. Divine, J.P. Hanig, D.R. Doerge, M.M. Vanlandingham, N.I. George, N.C. Twaddle, J.F. Bowyer, A comparison of methylphenidate-, amphetamine-, and methamphetamine-induced hyperthermia and neurotoxicity in male SpragueDawley rats during the waking (lights off) cycle, Neurotoxicol. Teratol. 34 (2012) 253–262. [54] D.B. Miller, J.P. O'Callaghan, Environment-, drug- and stress-induced alterations in body temperature affect the neurotoxicity of substituted amphetamines in the C57BL/6J mouse, J. Pharmacol. Exp. Ther. 270 (1994) 752–760. [55] M.J. LaVoie, T.G. Hastings, Dopamine quinone formation and protein modification associated with the striatal neurotoxicity of methamphetamine: evidence against a role for extracellular dopamine, J. Neurosci. 19 (1999) 1484–1491. [56] H.Y. Kil, J. Zhang, C.A. Piantadosi, Brain temperature alters hydroxyl radical production during cerebral ischemia/reperfusion in rats, J. Cereb. Blood Flow Metab. : Off. J. Int. Soc. Cereb. Blood Flow Metab. 16 (1996) 100–106. [57] D.S. Albers, P.K. Sonsalla, Methamphetamine-induced hyperthermia and dopaminergic neurotoxicity in mice: pharmacological profile of protective and nonprotective agents, J. Pharmacol. Exp. Ther. 275 (1995) 1104–1114. [58] D.A. Tata, J. Raudensky, B.K. Yamamoto, Augmentation of methamphetamine-induced toxicity in the rat striatum by unpredictable stress: contribution of enhanced hyperthermia, Eur. J. Neurosci. 26 (2007) 739–748. [59] M. Ito, Y. Numachi, A. Ohara, I. Sora, Hyperthermic and lethal effects of methamphetamine: roles of dopamine D1 and D2 receptors, Neurosci. Lett. 438 (2008) 327–329. [60] J.F. Cubells, S. Rayport, G. Rajendran, D. Sulzer, Methamphetamine neurotoxicity involves vacuolation of endocytic organelles and dopamine-dependent intracellular oxidative stress, J. Neurosci. : Off. J. Soc. Neurosci. 14 (1994) 2260–2271. [61] A. Hermida-Ameijeiras, E. Mendez-Alvarez, S. Sanchez-Iglesias, C. SanmartinSuarez, R. Soto-Otero, Autoxidation and MAO-mediated metabolism of dopamine as a potential cause of oxidative stress: role of ferrous and ferric ions, Neurochem. Int. 45 (2004) 103–116. [62] C. Farina, F. Aloisi, E. Meinl, Astrocytes are active players in cerebral innate immunity, Trends Immunol. 28 (2007) 138–145. [63] S.E. McConnell, M.K. O'Banion, D.A. Cory-Slechta, J.A. Olschowka, L.A. Opanashuk, Characterization of binge-dosed methamphetamine-induced neurotoxicity and neuroinflammation, Neurotoxicology 50 (2015) 131–141. [64] M.L. Block, L. Zecca, J.S. Hong, Microglia-mediated neurotoxicity: uncovering the molecular mechanisms, Nat. Rev. Neurosci. 8 (2007) 57–69. [65] V. Salvi, F. Sozio, S. Sozzani, A. Del Prete, Role of atypical chemokine receptors in microglial activation and polarization, Front. Aging Neurosci. 9 (2017) 148. [66] A. Hald, J. Lotharius, Oxidative stress and inflammation in Parkinson's disease: is there a causal link? Exp. Neurol. 193 (2005) 279–290. [67] S. Jayanthi, X. Deng, M. Bordelon, M.T. McCoy, J.L. Cadet, Methamphetamine causes differential regulation of pro-death and anti-death Bcl-2 genes in the mouse neocortex, FASEB J. : Off. Publ. Fed. Am. Soc. Exp. Biol. 15 (2001) 1745–1752. [68] X.K. Nguyen, J. Lee, E.J. Shin, D.K. Dang, J.H. Jeong, T.T. Nguyen, Y. Nam, H.J. Cho, J.C. Lee, D.H. Park, C.G. Jang, J.S. Hong, T. Nabeshima, H.C. Kim, Liposomal melatonin rescues methamphetamine-elicited mitochondrial burdens, pro-apoptosis, and dopaminergic degeneration through the inhibition PKCdelta gene, J. Pineal Res. 58 (2015) 86–106. [69] M.A. Burguillos, T. Deierborg, E. Kavanagh, A. Persson, N. Hajji, A. GarciaQuintanilla, J. Cano, P. Brundin, E. Englund, J.L. Venero, B. Joseph, Caspase signalling controls microglia activation and neurotoxicity, Nature 472 (2011) 319–324. [70] F.O. Martinez, S. Gordon, The M1 and M2 paradigm of macrophage activation: time for reassessment, F1000Prime Rep. (2014) 6. [71] R. Franco, D. Fernandez-Suarez, Alternatively activated microglia and macrophages in the central nervous system, Prog. Neurobiol. 131 (2015) 65–86. [72] D.M. Thomas, D.M. Francescutti-Verbeem, D.M. Kuhn, The newly synthesized pool of dopamine determines the severity of methamphetamine-induced neurotoxicity, J. Neurochem. 105 (2008) 605–616. [73] J.G. Johnston, C.R. Gerfen, S.N. Haber, D. van der Kooy, Mechanisms of striatal pattern formation: conservation of mammalian compartmentalization, Brain. Res. Dev. Brain. Res. 57 (1990) 93–102. [74] K.C. Nakamura, F. Fujiyama, T. Furuta, H. Hioki, T. Kaneko, Afferent islands are larger than mu-opioid receptor patch in striatum of rat pups, Neuroreport 20 (2009) 584–588. [75] F. Fujiyama, S. Takahashi, F. Karube, Morphological elucidation of basal ganglia circuits contributing reward prediction, Front. Neurosci. 9 (2015) 6. [76] A.M. Graybiel, C.W. Ragsdale Jr., Histochemically distinct compartments in the striatum of human, monkeys, and cat demonstrated by acetylthiocholinesterase staining, Proc. Natl. Acad. Sci. U. S. A. 75 (1978) 5723–5726. [77] C.R. Gerfen, The neostriatal mosaic: multiple levels of compartmental organization, Trends Neurosci. 15 (1992) 133–139. [78] J.M. Delfs, H. Kong, A. Mestek, Y. Chen, L. Yu, T. Reisine, M.F. Chesselet, Expression of mu opioid receptor mRNA in rat brain: an in situ hybridization study at the single cell level, J. Comp. Neurol. 345 (1994) 46–68. [79] A. Mansour, C.A. Fox, S. Burke, F. Meng, R.C. Thompson, H. Akil, S.J. Watson, Mu, delta, and kappa opioid receptor mRNA expression in the rat CNS: an in situ hybridization study, J. Comp. Neurol. 350 (1994) 412–438.

[27] E. EMCDDA, Information Exchange, Risk Assessment and Control of New Psychoactive Substance. New Psychoactive Substances Notified in 2011. Annual Report on the Implementation of Council Decision 2005/387/JHA, (2012). [28] A.J, D.M. Wood, F. Measham, S. Hudson, P.I. Dargan, Detection of use of novel psychoactive substances by attendees at a music festival in the north west of England, Clin. Toxicol. 51 (2013) 340–341. [29] D.P, J.R. Archer, W.L. Chan, A. Hitchings, S. Hudson, D.M. Wood, Trend analysis of novel psychoactive substances detected in pooled urine samples from street urinals over six months, Clin. Toxicol. 51 (2013) 666. [30] S. Anne, R. Tse, A.D. Cala, A fatal case of isolated methiopropamine (1-(Thiophen-2yl)-2-Methylaminopropane) toxicity: a case report, Am. J. Forensic Med. Pathol 36 (2015) 205–206. [31] H.S. Yoon, W.T. Cai, Y.H. Lee, K.T. Park, Y.S. Lee, J.H. Kim, The expression of methiopropamine-induced locomotor sensitization requires dopamine D2, but not D1, receptor activation in the rat, Behav. Brain Res. 311 (2016) 403–407. [32] E.C.o.D.D. ECDD, Methiopropamine Critical Review Report Agenda Item 4.23, (2014). [33] D. Angelov, J. O'Brien, P. Kavanagh, The syntheses of 1-(2-thienyl)-2-(methylamino) propane (methiopropamine) and its 3-thienyl isomer for use as reference standards, Drug Test. Anal. 5 (2013) 145–149. [34] L.R. Cumba, A.V. Kolliopoulos, J.P. Smith, P.D. Thompson, P.R. Evans, O.B. Sutcliffe, D.R. do Carmo, C.E. Banks, Forensic electrochemistry: indirect electrochemical sensing of the components of the new psychoactive substance "Synthacaine", Analyst 140 (2015) 5536–5545. [35] E.J. Shin, J.H. Jeong, H.J. Kim, C.G. Jang, K. Yamada, T. Nabeshima, H.C. Kim, Exposure to extremely low frequency magnetic fields enhances locomotor activity via activation of dopamine D1-like receptors in mice, J. Pharmacol. Sci. 105 (2007) 367–371. [36] E.J. Shin, C.X. Duong, T.X. Nguyen, G. Bing, J.H. Bach, D.H. Park, K. Nakayama, S.F. Ali, A.G. Kanthasamy, J.L. Cadet, T. Nabeshima, H.C. Kim, PKCδ inhibition enhances tyrosine hydroxylase phosphorylation in mice after methamphetamine treatment, Neurochem. Int. 59 (2011) 39–50. [37] E.J. Shin, S.W. Shin, T.T. Nguyen, D.H. Park, M.B. Wie, C.G. Jang, S.Y. Nah, B.W. Yang, S.K. Ko, T. Nabeshima, H.C. Kim, Ginsenoside Re rescues methamphetamine-induced oxidative damage, mitochondrial dysfunction, microglial activation, and dopaminergic degeneration by inhibiting the protein kinase Cδ gene, Mol. Neurobiol. 49 (2014) 1400–1421. [38] E.J. Shin, C.X. Duong, X.K. Nguyen, Z. Li, G. Bing, J.H. Bach, D.H. Park, K. Nakayama, S.F. Ali, A.G. Kanthasamy, J.L. Cadet, T. Nabeshima, H.C. Kim, Role of oxidative stress in methamphetamine-induced dopaminergic toxicity mediated by protein kinase Cδ, Behav. Brain Res. 232 (2012) 98–113. [39] H.N. Mai, N. Sharma, E.J. Shin, B.T. Nguyen, P.T. Nguyen, J.H. Jeong, E.H. Cho, Y.J. Lee, N.H. Kim, C.G. Jang, T. Nabeshima, H.C. Kim, Exposure to far-infrared ray attenuates methamphetamine-induced impairment in recognition memory through inhibition of protein kinase C delta in male mice: comparison with the antipsychotic clozapine, J. Neurosci. Res. 96 (2018) 1294–1310. [40] H.Q. Tran, Y. Lee, E.J. Shin, C.G. Jang, J.H. Jeong, A. Mouri, K. Saito, T. Nabeshima, H.C. Kim, PKCdelta knockout mice are protected from dextromethorphan-induced serotonergic behaviors in mice: involvements of downregulation of 5-HT1A receptor and upregulation of Nrf2-dependent GSH synthesis, Mol. Neurobiol. 55 (2018) 7802–7821. [41] H.N. Mai, N. Sharma, E.J. Shin, B.T. Nguyen, P.T. Nguyen, J.H. Jeong, C.G. Jang, E.H. Cho, S.Y. Nah, N.H. Kim, T. Nabeshima, H.C. Kim, Exposure to far-infrared rays attenuates methamphetamine-induced recognition memory impairment via modulation of the muscarinic M1 receptor, Nrf2, and PKC, Neurochem. Int. 116 (2018) 63–76. [42] D.K. Dang, E.J. Shin, D.J. Kim, H.Q. Tran, J.H. Jeong, C.G. Jang, S.Y. Nah, J.H. Jeong, J.K. Byun, S.K. Ko, G. Bing, J.S. Hong, H.C. Kim, Ginsenoside Re protects methamphetamine-induced dopaminergic neurotoxicity in mice via upregulation of dynorphin-mediated kappa-opioid receptor and downregulation of substance P-mediated neurokinin 1 receptor, J. Neuroinflammation 15 (2018) 52. [43] C.N. Oliver, B.W. Ahn, E.J. Moerman, S. Goldstein, E.R. Stadtman, Age-related changes in oxidized proteins, J. Biol. Chem. 262 (1987) 5488–5491. [44] H.N. Mai, T.W. Jung, D.J. Kim, G. Sharma, N. Sharma, E.J. Shin, C.G. Jang, S.Y. Nah, S.H. Lee, Y.H. Chung, X.G. Lei, J.H. Jeong, H.C. Kim, Protective potential of glutathione peroxidase-1 gene against cocaine-induced acute hepatotoxic consequences in mice, J. Appl. Toxicol. 38 (2018) 1502–1520. [45] E.J. Shin, Y.G. Hwang, D.T. Pham, J.W. Lee, Y.J. Lee, D. Pyo, X.G. Lei, J.H. Jeong, H.C. Kim, Genetic overexpression of glutathione peroxidase-1 attenuates microcystin-leucine-arginine-induced memory impairment in mice, Neurochem. Int. 118 (2018) 152–165. [46] Q. Wang, E.J. Shin, X.K. Nguyen, Q. Li, J.H. Bach, G. Bing, W.K. Kim, H.C. Kim, J.S. Hong, Endogenous dynorphin protects against neurotoxin-elicited nigrostriatal dopaminergic neuron damage and motor deficits in mice, J. Neuroinflammation 9 (2012) 124. [47] C. Escartin, G. Bonvento, Targeted activation of astrocytes: a potential neuroprotective strategy, Mol. Neurobiol. 38 (2008) 231–241. [48] M.E. Hamby, M.V. Sofroniew, Reactive astrocytes as therapeutic targets for CNS disorders, Neurotherapeutics : J. Am. Soc. Exp. Neurother. 7 (2010) 494–506. [49] J.M. Wilson, K.S. Kalasinsky, A.I. Levey, C. Bergeron, G. Reiber, R.M. Anthony, G.A. Schmunk, K. Shannak, J.W. Haycock, S.J. Kish, Striatal dopamine nerve terminal markers in human, chronic methamphetamine users, Nat. Med. 2 (1996) 699–703. [50] F. Fumagalli, R.R. Gainetdinov, K.J. Valenzano, M.G. Caron, Role of dopamine transporter in methamphetamine-induced neurotoxicity: evidence from mice lacking the transporter, J. Neurosci. : Off. J. Soc. Neurosci. 18 (1998) 4861–4869.

146

Chemico-Biological Interactions 305 (2019) 134–147

P.-T. Nguyen, et al.

mice, J. Neurochem. 107 (2008) 1102–1112. [83] C.E. Grace, T.L. Schaefer, N.R. Herring, D.L. Graham, M.R. Skelton, G.A. Gudelsky, M.T. Williams, C.V. Vorhees, Effect of a neurotoxic dose regimen of (+)-methamphetamine on behavior, plasma corticosterone, and brain monoamines in adult C57BL/6 mice, Neurotoxicol. Teratol. 32 (2010) 346–355. [84] L.G. Lenard, B. Beer, Relationship of brain levels of norepinephrine and dopamine to avoidance behavior in rats after intraventricular administration of 6-hydoxydopamine, Pharmacol. Biochem. Behav. 3 (1975) 895–899.

[80] N. Granado, S. Ares-Santos, E. O'Shea, C. Vicario-Abejon, M.I. Colado, R. Moratalla, Selective vulnerability in striosomes and in the nigrostriatal dopaminergic pathway after methamphetamine administration : early loss of TH in striosomes after methamphetamine, Neurotox. Res. 18 (2010) 48–58. [81] N. Granado, I. Escobedo, E. O'Shea, I. Colado, R. Moratalla, Early loss of dopaminergic terminals in striosomes after MDMA administration to mice, Synapse 62 (2008) 80–84. [82] N. Granado, E. O'Shea, J. Bove, M. Vila, M.I. Colado, R. Moratalla, Persistent MDMA-induced dopaminergic neurotoxicity in the striatum and substantia nigra of

147