- Email: [email protected]
Methylation levels of P16 and TP53 that are involved in DNA strand breakage of 16HBE cells treated by hexavalent chromium
Accepted Manuscript Title: Methylation levels of P16 and TP53 involved in DNA strand breakage of 16HBE cells treated by hexavalent chromium Author: Guiping Hu Ping Li Yang Li Tiancheng Wang Xin Gao Wenxiao Zhang Guang Jia PII: DOI: Reference:
S0378-4274(16)30039-X http://dx.doi.org/doi:10.1016/j.toxlet.2016.03.003 TOXLET 9335
To appear in:
Toxicology Letters
Received date: Revised date: Accepted date:
10-11-2015 19-1-2016 7-3-2016
Please cite this article as: Hu, Guiping, Li, Ping, Li, Yang, Wang, Tiancheng, Gao, Xin, Zhang, Wenxiao, Jia, Guang, Methylation levels of P16 and TP53 involved in DNA strand breakage of 16HBE cells treated by hexavalent chromium.Toxicology Letters http://dx.doi.org/10.1016/j.toxlet.2016.03.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Methylation levels of P16 and TP53 involved in DNA strand breakage of 16HBE cells treated by hexavalent chromium Guiping Hua, §, Ping Lia,b, §, Yang Lia, Tiancheng Wangc, Xin Gaoa, Wenxiao Zhanga, Guang Jia a, * a. Department of Occupational and Environmental Health Science, School of Public Health, Peking University, Beijing 100191, China b. Department of Nutrition Research Laboratory, Beijing Pediatric Research Institute, Beijing Children’s Hospital, Capital Medical University, Beijing, 100045, China. c. Department of Clinical Laboratory, Third Hospital of Peking University, Beijing 100191, China
*
Address correspondence to:
Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, Beijing 100191, China. Tel.: +86 10 8280 2333; fax: +86 10 8280 2333. E-mail: [email protected]
§ Author Contributions： These authors contributed equally to this work
Highlights：
The hypermethylation of CpG1, CpG31 and CpG32 of p16 were observed in Cr(VI) treated groups.
The methylation level of CpG1 of p16 can enhance cell damage by regulating
its expression or affecting some transcription factors to combine with their DNA strand sites
The CpG1 methylation level of p16 could be used as a biomarker of epigenetic effect caused by Cr(VI) treatment.
Abstract The correlations between methylation levels of p16 and TP53 with DNA strand breakage treated by hexavalent chromium [Cr(VI)] remain unknown. In this research, Human bronchial epithelial cells (16HBE cells) in vitro and bioinformatics analysis were used to analyze the epigenetic role in DNA damage and potential biomarkers. CCK-8 and single cell gel electrophoresis assay were chosen to detect the cellular biological damage. MALDI-TOF-MS was used to detect the methylation levels of p16 and TP53. qRT-PCR was used to measure their expression levels in Cr(VI) different treatment groups. The transcription factors with target sequences of p16 and TP53 were predicted using various bioinformatics software. The findings showed that the cellular toxicity and DNA strand damage was Cr(VI) concentration dependent. The hypermethylation of CpG1, CpG31 and CpG32 of p16 were observed in Cr(VI) treated groups. There was significant positive correlation between the CpG1 methylation level of p16 and cell damage. In Cr(VI) treated groups, the expression level of p16 was lower than that in control group. The expression level of TP53 increased when the Cr(VI)concentration above 5μM. About p16, there was significant negative correlation between the CpG1 methylation levels with its expression level. A lot of binding sites for transcription factors existed in our focused CpG islands of p16. All the results suggested that the CpG1 methylation level of p16 could be used as a biomarker of epigenetic effect caused by Cr(VI) treatment, which can enhance cell damage by regulating its expression or affecting some transcription factors to combine with their DNA strand sites.
Keywords: Chromium(VI); methylation; p16; TP53; DNA strand breakage; epigenetic biomarker
1. Introduction Chromium(Cr) and its compounds are basic chemical raw materials. They have been widely used in the industry and agriculture including chrome, dyes, paints, rubber and ceramics (Gao and Xia, 2011). While hexavalent chromium [Cr(VI)] is a strong oxidant which can cause multi-system disorders involving the skin and mucous membrane, liver and renal (Wang et al., 2011), immune system (Beaver et al., 2009), genetic damage and even lung cancer (Hara et al., 2010). It is widely accepted that DNA
damages
dominate
the
underlying
mechanisms
of
Cr(VI)-induced
carcinogenesis (Halasova et al., 2012; Wise and Wise, 2012). Our previous studies had proved that occupational chromate exposure can increase apoptosis (Wang et al., 2012). Many studies have also showed that apoptosis was the main reason for many diseases even cancer (Cavallo et al., 2010). Many factors can regulate apoptosis process including cell cycle regulation such as TP53 and p16 (Qi et al., 2014). when cells were stimulated by genetic damage chemicals, it can cause DNA damage, and then induce accumulation and activation of p53 protein through the NF-κB pathway to influence other proteins’ expression such as p21 and P16 (Senba et al., 2010; Shibata-Kobayashi et al., 2013). p21 and p53 can induce the cells arrest at the junction of G1/S and G2/M phase of the cell cycle and control the progression of cell cycle to provide chance for DNA damage repairing (Sikdar et al., 2015; Zhu et al., 2015). When DNA damage failed to be repaired, p53 and p16 could be up-regulated to mediate apoptosis by various pathways. Therefore, it can be assumed that the epigenetic modifications and expression levels of TP53 and p16 could play an important role in the maintenance of genome integrity and cellular survival.
Recent studies suggest that DNA damage can modify DNA methylation patterns and lead to hypomethylation and, consequently, to genomic instability. DNA methylation is a regulated biological process in which the methyl unite was transferred to the specific bases by methyl transferase, and S-Adenosylmethionine (SAM) is the methyl donor. DNA methylation can regulate gene expression to cause changes of chromatin structure, maintain the stability of DNA and affect the interaction of DNA with protein, which can play an important role in pathological process of many diseases (Ali et al., 2011; Maunakea et al., 2010; Romanoski et al., 2015). Previous studies showed that some environmental pollutants can affect TP53 and p16 expression and their aberrant CpG methylation. p16 gene methylation were significantly increased when exposed to arsenic and Polycyclic aromatic hydrocarbons (PAH) (Tyler and Allan, 2014; Zhang et al., 2015). In oral ingestion of Cr (VI) through drinking water could cause global DNA hypomethylation in blood cells from male rats (Wang et al., 2015). It is also indicated that the aberrant methylation of p53 and p16 are involved in chromium carcinogenesis (Kondo et al., 1997; Kondo et al., 2006) and the expression and methylation level of p16(INK4a) are reduced in chromate lung cancer (Kondo et al., 2006). To explore the association between methylation and DNA damage will help to reveal whether epigenetic mechanism is involved in Cr(VI)-induced DNA damage. In this research, Human bronchial epithelial cells (16HBE cells) in vitro and bioinformatics analysis were used to analyze the methylation level of TP53 and p16 and understand whether DNA methylation can be a potential biomarker related to chromium carcinogenesis.
2. Materials and Methods 2.1 Cell line and chromium treatment 16HBE cells (tumor cell library of Chinese Academy of Medical Sciences, China) were cultured in DMEM supplemented with 10% fetal bovine serum, 100U/mL penicillin, and 100μg/mL streptomycin, and maintained at 37℃ in a humidified
atmosphere containing 5% CO2 and 95% air. Cells were treated with dichromate (Cr2O72−) (Sigma, USA) stoke solution diluted in cell culture medium at different concentrations. As the control group, cells were treated with the same volume of ddH2O (Sigma, USA) instead of Cr(VI) stoke solution at the same condition. 2.2 Determination of cell proliferation and cell survival rate According to the protocol, Counting Kit-8 (CCK8) assay (Dojindo Laboratories, Japan) was used to measure the cell proliferation and cell survival rates in different Cr(VI) treatment groups (0.0μM, 0.8μM, 1.6μM, 3.1μM, 6.2μM, 12.5μM, 25.0μM, 50.0μM and 100.0μM) at different incubation time (12 hours, 24 hours and 48 hours). 2.3 Determination of DNA damage Single cell gel electrophoresis (the alkaline comet assay) is a method to detect the DNA strand damage in vitro (Tice et al., 2000). It was performed as described by Tice et al. (2000) with modifications. The indicators [tail length (TL), tail moment(TM), percentage of tail DNA(%), Olive Tail Moment(OTM)] were calculated to judge the degree of DNA damage (Liu et al., 2015; Olive and Banath, 2006; Tice et al., 2000). 2.4 Determination the CpG methylation levels of TP53 and P16 DNA methylation of TP53 and p16 at CpG sites was quantified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) of the MassArray system (Sequenom EpiTYPER assay, San Diego, CA). The sequences of CpG islands in TP53 and p16 were got using the UCSC database. The location of significant CpG sites in these CpG islands was found in the present work. Then the sequences of target regions (Supplementary Figure1) and primer (TP53-forward primer:
aggaagagagGAGGAGTTTTAGGGTTTGATGG,
cagtaatacgactcactatagggagaaggct
Reverse
CCAATTCTTTTAAAAACACT
primer: ATATTCC;
p16-forward primer: aggaagagagGGTATGGTTATTGTTTTTGGTGTTT, Reverse primer: cagtaatacgactcactatagggagaaggctCCCACCCTAACTCTAACCATT CTAT) were designed using the EpiDesigner software (www. epidesiger. com) of the
Sequenom company. The steps are as following: Firstly, Bisulfite conversion of genomic DNA was performed using the DNA Methylation kit (Zymo Research, CA) following the manufacturer’s instructions. Secondly, PCR and in vitro transcription were carried out in DNA samples by bisulfite conversion, and the target regions were amplified using the primer pairs that incorporated the T7 promoter sequence and treated by Shrimp Alkaline Phosphatase (SEQUENOM, San Diego). Then the products were used as template for in vitro transcription and base-specific cleavage with RNase A. Lastly, all cleavage products were analyzed by MALDI-TOF-MS (Sequenom, USA) according to the manufacturer’s instructions (Ehrich et al., 2007), and 10% of the parallel samples were randomly selected and duplicates tested to ensure the accuracy of the results. 2.5 Determination of P16 and TP53 expression Following the protocol, total RNA was extracted from treated 16HBE cells by the Trizol (Invitrogen TM, USA). The NanoDrop 2000c spectrophotometers (Thermo, USA) were used to measure RNA concentration. Agarose gel electrophoresis was chosen to evaluate the quality of the total RNA. The primers of these genes were designed by the Primer Premier 5.0 (Supplementary Table 1). The semiquantification was performed using PCR Master Mix for SYBR Green assays (Vazyme, USA) on Real Time-qPCR system (CFX-96, Bio-Rad Company, USA). All samples were run in triplicate, and genes expression data was normalized to β-actin as internal control. 2.6 Bioinformatics analysis The location and sequences of CpG islands and CpG sites of p16 were analyzed by the database including UCSC and Ensamble. The transcription factors which can combine with target sequences of DNA repair genes were predicted by using various bioinformatics softwares including TRANSFAC (http://www. Gene-regulation.com/pub/databses.html), TFSEARCH (http://www.cbrc.jp /research /db /TFSEARCH. html) and Consite (http: //asp.ii.
uib.no: 8090/cgi-bin/CONSITE/consite) (Volckmar et al., 2012). 2.7 Statistical analysis Epidata software was used to entry data of these experiments into computers. The whole process was utilized double-entry and logistical error check to ensure the accuracy. All analysis was performed with SPSS17.0 software, and normality was assessed by K-S test. Differences in continuous and categorical parameters were tested using ANOVA (or Mann-Whitney U nonparametric test) and χ2 test. Linear regression analysis was used to examine the associations between DNA methylation levels with their expression levels, cell survival rate and DNA damage. Statistical significance for two-sided P values were defined as P<0.05.
3. Results 3.1 Cell survival rate As was shown in Figure 1, the cell survival rate was measured by the CCK-8. Comparing with the control group, the cell survival rate decreased significantly in a concentration dependent manner when the treatment concentrations above 12.5μM during all treatment time. And the cell survival rate decreased significantly at all studied concentrations when treated for 24 hours. The model of cell survival rate was analyzed by SPSS software to calculate the IC50 for Cr(VI) treatment concentration and time (Liu et al., 2007). Based on the IC50 value and the chromium concentration in worker blood (CrB) from our previous occupational epidemiological investigation (Li et al., 2015), the final concentration set was followed as 0.0μM, 0.6μM, 1.2μM, 2.5μM, 5.0μM, 10.0μM and 20.0μM, and the incubation time was determined for 24 hours. Note: Results are mean ± standard deviation; *Comparing with the control group, P<0.05； **Comparing with the control group, P<0.001;
3.2 DNA damage of the cells As was shown in Table 1, the values of percentage of tail DNA (%), TL, TM and OTM increased in all Cr(VI) treatment groups than those in the control group (P<0.05). The values of percentage of tail DNA(%), TL, TM and OTM increased
significantly especially when the Cr(VI) concentration higher than 2.5μM (P<0.001). It was found that there was positive correlations among Cr(VI) concentration with the values of percentage of tail DNA (%), TL, TM and OTM respectively. 3.3 The methylation levels of TP53 and P16 As was revealed in Figure 2, there were no significant difference of the methylation levels of studied CpG sites from TP53 in all Cr(VI) treatment groups. The CpG1 methylation levels of p16 from 2.5μM to 20μM treatment groups were significantly higher than that in the control group (P<0.05). The methylation levels of CpG31,32 of p16 from 1.2μM to 20μM Cr(VI) treatment groups were significantly higher than that in the control group (P<0.05). Note: Results are mean ± standard deviation; a shows the methylation levels of studied CpG sites of TP53 in different Cr(VI) treatment group; b shows the methylation levels of studied CpG sites of p16 in different Cr(VI) treatment group; * proves the methylation levels from 2.5μM to 20μM Cr(VI) treatment groups were significant different than those in the control group, P<0.05; **prove the methylation levels from 1.2μM to 20μM Cr(VI) treatment groups were significant different than those in the control group, P<0.05.
3.4 The mRNA expression levels of TP53 and P16 As was shown in Figure 3, the mRNA expression levels of TP53 in the treatment concentrations of 5.0μM, 10.0μM and 20.0μM were significantly higher than that in the control group (P<0.05). The mRNA expression levels of p16 in all Cr(VI) treatment groups (0.6μM, 1.2μM, 2.5μM, 5μM, 10μM and 20μM) were significantly lower than that in the control group (P<0.05). 3.5 The correlations The methylation levels of CpG sites which had statistically significant differences between the treatment groups and the control group were used to discuss the correlations between the methylation levels of CpG1, CpG31 and CpG32 of p16 with cell survival rate, DNA damage (TL, TM and OTM), treatment concentrations and their expression levels. There were positive correlations among methylation levels of CpG1, CpG31 and CpG32 of p16 with DNA damage (TL, TM and OTM) and Cr
concentrations. There were negative correlations between methylation levels of CpG1, CpG31 and CpG32 of p16 with cell survival rate and its expression level.
3.6 Bioinformatics analysis The distribution of CpG islands had an edge effect, and the CpG islands were located at the junction of the promoter and the first exon. It is discovered that the significant CpG sites were located near the promoter region，which could affect the expression levels of corresponding mRNA to enhance the cell damage including the decrease of cell survival rate and the increase of DNA strand breakage . There are multiple transcription factors (ETF-EGF, GCF, LF-1A, TGT3, Sp-1, Ap-2, HIF-1, HC3, TCF-2, HSF and HSP70) which can combine with the CpG islands located in DNA strand of p16. These transcription factors have been predicted to have many physiological activities such as oxidative stress, immune regulation and cell cycle arrest. It suggests that the changes of methylation levels of p16 can affect the combination of these transcription factors with corresponding sites of DNA strand to cause the disorder of cellular functions to enhance the cell response challenged by Cr(VI) treatment
4. Discussion Many investigations had proved that Cr(VI) treatment can induce genetic damage and induction of cell apoptosis, which can contribute to its hazard on health (Fu et al., 2015; Xia et al., 2015). Our present research proved that the cell survival rate and the values of percentage of tail DNA(%), TL, TM and OTM were changed in a Cr concentration dependent manner. The CpG islands methylation play an important role in the transcription regulation. The inverse relationship was shown between the methylation levels and their regulations (Schubeler, 2015; Xing et al., 2013; Yang et al., 2014). Our previous study had found that there was no linear correlation but a curve fitting among Cr content in blood with 8-OHdG and micronucleus (MN) in occupational workers (Li et
al., 2014). The reason may be explained that high concentration of chromium exposure can induce apoptosis of cells with high DNA damage. The current research also showed that when the Cr(VI) concentrations were more than 5.0μM, the expression levels of TP53 were upregulated without methylation level changes of the studied CpG sites from TP53 in all Cr(VI) treatment groups. And also no correlations were observed between the methylation levels of TP53 with its expression levels. As we all know, TP53 is a tumor suppressor gene, and it has many physiological functions such as regulating DNA repair, clearing cells with serious damage and checking cell cycle progress and so on. It is consistent with the previous study, Cr(VI) treatment can induce high expression of TP53 accompanied with high DNA damage and apoptosis induction (Oikawa et al., 2005; Smith et al., 1995). The current research indicates that the methylation levels of CpG1 of p16 in the 2.5μM, 5μM, 10μM and 20μM treatment groups were significantly higher than that in the control group (P<0.05). The methylation levels of CpG31, 32 of p16 in the 1.2μM, 2.5μM, 5μM, 10μM and 20μM Cr(VI) treatment groups were significantly higher than that in the control group (P<0.05). There were positive correlations among methylation levels of CpG1, CpG31 and CpG32 of p16 with DNA damage (TL, TM and OTM) and Cr concentration. While there were negative correlations among methylation levels of CpG1, CpG31 and CpG32 of p16 with cell survival rate and its expression levels. It is indicated that the methylation level of these CpG sites responded to the Cr challenge in 16HBE cells in a concentration dependent manner and can be used as a potential effective biomarker in future epidemiologic studies. p16 is critical for cell cycle regulation, Cr (VI) can down-regulated p16 expression by increasing the methylation levels of CpG1, CpG31 and CpG32 sites in our study, which was also observed by Jackson(Jackson et al., 2012). These changes can cause G1/S and G2/M arrest and provide the chance to DNA damage repair. When p16 gene was decreased, the genetic damage had no enough time to be repaired and consequently the 8-OHdG and MN would be increased (Hu et al., 2015; Huang et al., 2015).
The bioinformatics analysis proved that CpG islands had an edge effect, and they were located at the junction of the promoter and the first exon which can affect the mRNA expression levels of corresponding genes to enhance the cell stress including cellular survival state and DNA damage (Gnad et al., 2015). What’s more, there were multiple transcription factors which can combine with the CpG islands located in DNA strand of related gene and finally lead to the disorder of cellular diversified functions.
5. Conclusions Cr(VI) treatment could up-regulate the methylation levels of CpG1, CpG31 and , CpG32 sites of p16, which inversely down-regulated its mRNA expression levels, and also can affect the combination of some transcription factors with corresponding sites of p16 gene strand to enhance cellular stress induced by Cr(VI) in HBE16 cells. It is suggested that the methylation level of these significant CpG sites could be used as a potential effective biomarker of epigenetic effect due to chromate exposure .
Conflict of interest The authors declare that there are no conflicts of interest.
Acknowledge This work was supported by the projects of National Natural Science Foundation of China (81073043) and by Doctor Fund of Ministry of Education of china (20120001110103).
References: Ali, A.H., Kondo, K., Namura, T., Senba, Y., Takizawa, H., Nakagawa, Y., Toba, H., Kenzaki, K., Sakiyama, S., Tangoku, A., 2011. Aberrant DNA methylation of some tumor suppressor genes in lung cancers from workers with chromate exposure. Mol Carcinog 50, 89-99. Beaver, L.M., Stemmy, E.J., Schwartz, A.M., Damsker, J.M., Constant, S.L., Ceryak, S.M., Patierno, S.R., 2009. Lung inflammation, injury, and proliferative response after repetitive particulate hexavalent chromium exposure. Environ Health Perspect 117, 1896-1902. Cavallo, D., Ursini, C.L., Fresegna, A.M., Ciervo, A., Maiello, R., Rondinone, B., D'Agata, V., Iavicoli, S., 2010. Direct-oxidative DNA damage and apoptosis induction in different human respiratory cells exposed to low concentrations of sodium chromate. J APPL TOXICOL 30, 218-225.
Ehrich, M., Zoll, S., Sur, S., van den Boom, D., 2007. A new method for accurate assessment of DNA quality after bisulfite treatment. NUCLEIC ACIDS RES 35, e29. Fu, S., Jin, D., Liu, S., Wang, L., Wang, Z., Mei, G., Zou, Z.L., Wu, J.Q., Xu, Z.Y., 2015. Protective Effect of Neuropeptide Substance P on Bone Marrow Mesenchymal Stem Cells against Apoptosis Induced by Serum Deprivation. STEM CELLS INT 2015, 270328. Gao, Y., Xia, J., 2011. Chromium contamination accident in China: viewing environment policy of China. ENVIRON SCI TECHNOL 45, 8605-8606. Gnad, F., Doll, S., Manning, G., Arnott, D., Zhang, Z., 2015. Bioinformatics analysis of thousands of TCGA tumors to determine the involvement
of epigenetic regulators in human cancer. BMC
GENOMICS 16 Suppl 8, S5. Halasova, E., Matakova, T., Musak, L., Polakova, V., Letkova, L., Dobrota, D., Vodicka, P., 2012. Evaluating chromosomal damage in workers exposed to hexavalent chromium and the modulating role of polymorphisms of DNA repair genes. Int Arch Occup Environ Health 85, 473-481. Hara, T., Hoshuyama, T., Takahashi, K., Delgermaa, V., Sorahan, T., 2010. Cancer risk among Japanese chromium platers, 1976-2003. Scand J Work Environ Health 36, 216-221. Hu, Z.Y., Tang, L.D., Zhou, Q., Xiao, L., Cao, Y., 2015. Aberrant promoter hypermethylation of p16 gene in endometrial carcinoma. Tumour Biol 36, 1487-1491. Huang, W., Li, T., Yang, W., Chai, X., Chen, K., Wei, L., Duan, S., Li, B., Qin, Y., 2015. Analysis of DNA methylation in plasma for monitoring hepatocarcinogenesis. Genet Test Mol Biomarkers 19, 295-302. Jackson, J.G., Pant, V., Li, Q., Chang, L.L., Quintas-Cardama, A., Garza, D., Tavana, O., Yang, P., Manshouri, T., Li, Y., El-Naggar, A.K., Lozano, G., 2012. p53-mediated senescence impairs the apoptotic response to chemotherapy and clinical outcome in breast cancer. CANCER CELL 21, 793-806. Kondo, K., Hino, N., Sasa, M., Kamamura, Y., Sakiyama, S., Tsuyuguchi, M., Hashimoto, M., Uyama, T., Monden, Y., 1997. Mutations of the p53 gene in human lung cancer from chromate-exposed workers. Biochem Biophys Res Commun 239, 95-100. Kondo, K., Takahashi, Y., Hirose, Y., Nagao, T., Tsuyuguchi, M., Hashimoto, M., Ochiai, A., Monden, Y., Tangoku, A., 2006. The reduced expression and aberrant methylation of p16(INK4a) in chromate workers with lung cancer. LUNG CANCER 53, 295-302. Li, P., Gu, Y., Yu, S., Li, Y., Yang, J., Jia, G., 2014. Assessing the suitability of 8-OHdG and micronuclei as genotoxic biomarkers in chromate-exposed workers: a cross-sectional study. BMJ OPEN 4, e5979. Li, P., Li, Y., Zhang, J., Yu, S.F., Wang, Z.L., Jia, G., 2015. Establishment of a reference value for chromium in the blood for biological monitoring among occupational chromium workers. TOXICOL IND HEALTH. Liu, W., Chaspoul, F., Lefranc, D.B., Decome, L., Gallice, P., 2007. Microcalorimetry as a tool for Cr(VI) toxicity evaluation of human dermal fibroblasts. J THERM ANAL CALORIM 89, 21-24. Liu, X., Sun, B., Wang, X., Nie, J., Chen, Z., An, Y., Tong, J., 2015. Synergistic effect of radon and sodium arsenite on DNA damage in HBE cells. Environ Toxicol Pharmacol 41, 127-131. Maunakea, A.K., Nagarajan, R.P., Bilenky, M., Ballinger, T.J., D'Souza, C., Fouse, S.D., Johnson, B.E., Hong, C., Nielsen, C., Zhao, Y., Turecki, G., Delaney, A., Varhol, R., Thiessen, N., Shchors, K., Heine, V.M., Rowitch, D.H., Xing, X., Fiore, C., Schillebeeckx, M., Jones, S.J., Haussler, D., Marra, M.A., Hirst, M., Wang, T., Costello, J.F., 2010. Conserved role of intragenic DNA methylation in regulating
alternative promoters. NATURE 466, 253-257. Oikawa, T., Okuda, M., Ma, Z., Goorha, R., Tsujimoto, H., Inokuma, H., Fukasawa, K., 2005. Transcriptional control of BubR1 by p53 and suppression of centrosome amplification by BubR1. MOL CELL BIOL 25, 4046-4061. Olive, P.L., Banath, J.P., 2006. The comet assay: a method to measure DNA damage in individual cells. NAT PROTOC 1, 23-29. Qi, Z., Liu, M., Liu, Y., Zhang, M., Yang, G., 2014. Tetramethoxychalcone, a chalcone derivative, suppresses proliferation, blocks cell cycle progression, and induces apoptosis of human ovarian cancer cells. PLOS ONE 9, e106206. Romanoski, C.E., Glass, C.K., Stunnenberg, H.G., Wilson, L., Almouzni, G., 2015. Epigenomics: Roadmap for regulation. NATURE 518, 314-316. Schubeler, D., 2015. Function and information content of DNA methylation. NATURE 517, 321-326. Senba, M., Mori, N., Fujita, S., Jutavijittum, P., Yousukh, A., Toriyama, K., Wada, A., 2010. Relationship among human papillomavirus infection, p16(INK4a), p53 and NF-kappaB
activation in
penile cancer from northern Thailand. ONCOL LETT 1, 599-603. Shibata-Kobayashi, S., Yamashita, H., Okuma, K., Shiraishi, K., Igaki, H., Ohtomo, K., Nakagawa, K., 2013. Correlation among 16 biological factors [p53, p21(waf1), MIB-1 (Ki-67), p16(INK4A), cyclin D1, E-cadherin, Bcl-2, TNF-alpha, NF-kappaB, TGF-beta, MMP-7,
COX-2, EGFR, HER2/neu, ER,
and HIF-1alpha] and clinical outcomes following curative chemoradiation therapy in 10 patients with esophageal squamous cell carcinoma. ONCOL LETT 5, 903-910. Sikdar, S., Mukherjee, A., Khuda-Bukhsh, A.R., 2015. Anti-lung cancer potential of pure esteric-glycoside condurangogenin A against nonsmall-cell lung cancer cells in vitro via p21/p53 mediated cell cycle modulation and DNA damage-induced apoptosis. PHARMACOGN MAG 11, S73-S85. Smith, M.L., Chen, I.T., Zhan, Q., O'Connor, P.M., Fornace, A.J., 1995. Involvement of the p53 tumor suppressor in repair of u.v.-type DNA damage. ONCOGENE 10, 1053-1059. Tice, R.R., Agurell, E., Anderson, D., Burlinson, B., Hartmann, A., Kobayashi, H., Miyamae, Y., Rojas, E., Ryu, J.C., Sasaki, Y.F., 2000. Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. ENVIRON MOL MUTAGEN 35, 206-221. Tyler, C.R., Allan, A.M., 2014. The Effects of Arsenic Exposure on Neurological and Cognitive Dysfunction in Human and Rodent Studies: A Review. Curr Environ Health Rep 1, 132-147. Volckmar, A.L., Bolze, F., Jarick, I., Knoll, N., Scherag, A., Reinehr, T., Illig, T., Grallert, H., Wichmann, H.E., Wiegand, S., Biebermann, H., Krude, H., Fischer-Posovszky, P., Rief, W., Wabitsch, M., Klingenspor, M., Hebebrand, J., Hinney, A., 2012. Mutation screen in the GWAS derived obesity gene SH2B1 including functional analyses of detected variants. BMC MED GENOMICS 5, 65. Wang, T., Jia, G., Zhang, J., Ma, Y., Feng, W., Liu, L., Zhang, N., Yan, L., Wang, X., Zhang, X., Liu, Z., Du X, Zhen, S., 2011. Renal impairment caused by chronic occupational chromate exposure. Int Arch Occup Environ Health 84, 393-401. Wang, T.C., Song, Y.S., Wang, H., Zhang, J., Yu, S.F., Gu, Y.E., Chen, T., Wang, Y., Shen, H.Q., Jia, G., 2012. Oxidative DNA damage and global DNA hypomethylation are related to folate deficiency in chromate manufacturing workers. J HAZARD MATER 213-214, 440-446. Wang, Y., Wu, W., Yao, C., Lou, J., Chen, R., Jin, L., Wu, N., Gao, M., Song, P., Tan, Y., Liu, K., 2015. Elevated tissue Cr levels, increased plasma oxidative markers, and global hypomethylation of blood DNA in male Sprague-Dawley rats exposed to potassium dichromate in drinking water.
ENVIRON TOXICOL. Wise, S.S., Wise, J.S., 2012. Chromium and genomic stability. Mutat Res 733, 78-82. Xia, Z., Zhang, H., Xu, D., Lao, Y., Fu, W., Tan, H., Cao, P., Yang, L., Xu, H., 2015. Xanthones from the Leaves of Garcinia cowa Induce Cell Cycle Arrest, Apoptosis, and Autophagy in Cancer Cells. MOLECULES 20, 11387-11399. Xing, C., Chen, Q., Li, G., Zhang, L., Zheng, M., Zou, Z., Hou, L., Wang, Q.F., Liu, X., Guo, X., 2013. Microsomal epoxide hydrolase (EPHX1) polymorphisms are associated with aberrant promoter methylation of ERCC3 and hematotoxicity in benzene-exposed workers. ENVIRON MOL MUTAGEN 54, 397-405. Yang, X., Han, H., De Carvalho, D.D., Lay, F.D., Jones, P.A., Liang, G., 2014. Gene body methylation can alter gene expression and is a therapeutic target in cancer. CANCER CELL 26, 577-590. Zhang, H., Li, X., Ge, L., Yang, J., Sun, J., Niu, Q., 2015. Methylation of CpG island of p14(ARK), p15(INK4b) and p16(INK4a) genes in coke oven workers. HUM EXP TOXICOL 34, 191-197. Zhu, H.L., Zou, Z.N., Lin, P.X., Li, W.X., Huang, Y.E., Shi, X.X., Shen, H., 2015. Malignant transformation rate and p53, and p16 expression in teratomatous skin of ovarian mature cystic teratoma. Asian Pac J Cancer Prev 16, 1165-1168.
Figure 1 The survival rate of 16HBE cells at different concentrations of Cr(VI) after treatment of 12, 24 and 48 hours (x ± SD)
a
b Figure 2 The methylation levels of studied CpG sites of TP53 and P16 in different Cr(VI) treatment groups(x±SD)
Figure 3 The expression levels of TP53 and P16 in Cr(VI) different treatment groups(x±SD) Note: Results are mean ± standard deviation; *proves comparing with the control group, P<0.05.
Table 1 The effect of different Cr(VI) concentration on DNA damage in16HBE cells for 24 hours (x ± SD) Treatment (μM)
Percentage of tail DNA（%）
TL (μm)
TM
OTM
0.0
2.47±2.16
7.64±5.78
0.29±0.23
0.63±0.35
0.6
4.71±3.94*
11.76±8.37*
0.82±0.39*
1.32±0.47*
1.2
4.66±2.97*
11.86±6.28*
0.66±0.65*
1.36±0.54*
2.5
11.62±7.92**
25.66±13.81**
4.11±2.64**
4.20±1.52**
5.0
15.67±5.02**
36.32±16.14**
5.88±3.62**
5.52±2.04**
10.0
16.97±6.96**
37.80±17.90**
7.30±5.16**
7.03±2.35**
20.0
31.00±11.12**
58.57±21.22**
19.27±10.48**
16.53±7.54**
Note: Results are mean ± standard deviation; *Comparing with the control group, P<0.05； **Comparing with the control group, P<0.001; TL-tail length; TM-tail moment; OTM-Olive Tail Moment. The random observed cell number was 3×102.
Table 2 The correlations between the methylation levels of CpG1 CpG31 and, CpG32 of P16 with the observed indicators Methylation levels of CpG1
Methylation levels of CpG31, 32
Correlation coefficient
P Value
Correlation coefficient
P Value
Cell survival rate
-0.774
0.041
-0.796
0.032
TL
0.802
0.030
0.861
0.013
TM
0.795
0.028
0.826
0.022
OTM
0.835
0.016
0.772
0.042
Treatment concentration
0.816
0.027
0.765
0.045
Expression levels
-0.795
0.028
-0.835
0.016
S0378-4274(16)30039-X http://dx.doi.org/doi:10.1016/j.toxlet.2016.03.003 TOXLET 9335
To appear in:
Toxicology Letters
Received date: Revised date: Accepted date:
10-11-2015 19-1-2016 7-3-2016
Please cite this article as: Hu, Guiping, Li, Ping, Li, Yang, Wang, Tiancheng, Gao, Xin, Zhang, Wenxiao, Jia, Guang, Methylation levels of P16 and TP53 involved in DNA strand breakage of 16HBE cells treated by hexavalent chromium.Toxicology Letters http://dx.doi.org/10.1016/j.toxlet.2016.03.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Methylation levels of P16 and TP53 involved in DNA strand breakage of 16HBE cells treated by hexavalent chromium Guiping Hua, §, Ping Lia,b, §, Yang Lia, Tiancheng Wangc, Xin Gaoa, Wenxiao Zhanga, Guang Jia a, * a. Department of Occupational and Environmental Health Science, School of Public Health, Peking University, Beijing 100191, China b. Department of Nutrition Research Laboratory, Beijing Pediatric Research Institute, Beijing Children’s Hospital, Capital Medical University, Beijing, 100045, China. c. Department of Clinical Laboratory, Third Hospital of Peking University, Beijing 100191, China
*
Address correspondence to:
Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, Beijing 100191, China. Tel.: +86 10 8280 2333; fax: +86 10 8280 2333. E-mail: [email protected]
§ Author Contributions： These authors contributed equally to this work
Highlights：
The hypermethylation of CpG1, CpG31 and CpG32 of p16 were observed in Cr(VI) treated groups.
The methylation level of CpG1 of p16 can enhance cell damage by regulating
its expression or affecting some transcription factors to combine with their DNA strand sites
The CpG1 methylation level of p16 could be used as a biomarker of epigenetic effect caused by Cr(VI) treatment.
Abstract The correlations between methylation levels of p16 and TP53 with DNA strand breakage treated by hexavalent chromium [Cr(VI)] remain unknown. In this research, Human bronchial epithelial cells (16HBE cells) in vitro and bioinformatics analysis were used to analyze the epigenetic role in DNA damage and potential biomarkers. CCK-8 and single cell gel electrophoresis assay were chosen to detect the cellular biological damage. MALDI-TOF-MS was used to detect the methylation levels of p16 and TP53. qRT-PCR was used to measure their expression levels in Cr(VI) different treatment groups. The transcription factors with target sequences of p16 and TP53 were predicted using various bioinformatics software. The findings showed that the cellular toxicity and DNA strand damage was Cr(VI) concentration dependent. The hypermethylation of CpG1, CpG31 and CpG32 of p16 were observed in Cr(VI) treated groups. There was significant positive correlation between the CpG1 methylation level of p16 and cell damage. In Cr(VI) treated groups, the expression level of p16 was lower than that in control group. The expression level of TP53 increased when the Cr(VI)concentration above 5μM. About p16, there was significant negative correlation between the CpG1 methylation levels with its expression level. A lot of binding sites for transcription factors existed in our focused CpG islands of p16. All the results suggested that the CpG1 methylation level of p16 could be used as a biomarker of epigenetic effect caused by Cr(VI) treatment, which can enhance cell damage by regulating its expression or affecting some transcription factors to combine with their DNA strand sites.
Keywords: Chromium(VI); methylation; p16; TP53; DNA strand breakage; epigenetic biomarker
1. Introduction Chromium(Cr) and its compounds are basic chemical raw materials. They have been widely used in the industry and agriculture including chrome, dyes, paints, rubber and ceramics (Gao and Xia, 2011). While hexavalent chromium [Cr(VI)] is a strong oxidant which can cause multi-system disorders involving the skin and mucous membrane, liver and renal (Wang et al., 2011), immune system (Beaver et al., 2009), genetic damage and even lung cancer (Hara et al., 2010). It is widely accepted that DNA
damages
dominate
the
underlying
mechanisms
of
Cr(VI)-induced
carcinogenesis (Halasova et al., 2012; Wise and Wise, 2012). Our previous studies had proved that occupational chromate exposure can increase apoptosis (Wang et al., 2012). Many studies have also showed that apoptosis was the main reason for many diseases even cancer (Cavallo et al., 2010). Many factors can regulate apoptosis process including cell cycle regulation such as TP53 and p16 (Qi et al., 2014). when cells were stimulated by genetic damage chemicals, it can cause DNA damage, and then induce accumulation and activation of p53 protein through the NF-κB pathway to influence other proteins’ expression such as p21 and P16 (Senba et al., 2010; Shibata-Kobayashi et al., 2013). p21 and p53 can induce the cells arrest at the junction of G1/S and G2/M phase of the cell cycle and control the progression of cell cycle to provide chance for DNA damage repairing (Sikdar et al., 2015; Zhu et al., 2015). When DNA damage failed to be repaired, p53 and p16 could be up-regulated to mediate apoptosis by various pathways. Therefore, it can be assumed that the epigenetic modifications and expression levels of TP53 and p16 could play an important role in the maintenance of genome integrity and cellular survival.
Recent studies suggest that DNA damage can modify DNA methylation patterns and lead to hypomethylation and, consequently, to genomic instability. DNA methylation is a regulated biological process in which the methyl unite was transferred to the specific bases by methyl transferase, and S-Adenosylmethionine (SAM) is the methyl donor. DNA methylation can regulate gene expression to cause changes of chromatin structure, maintain the stability of DNA and affect the interaction of DNA with protein, which can play an important role in pathological process of many diseases (Ali et al., 2011; Maunakea et al., 2010; Romanoski et al., 2015). Previous studies showed that some environmental pollutants can affect TP53 and p16 expression and their aberrant CpG methylation. p16 gene methylation were significantly increased when exposed to arsenic and Polycyclic aromatic hydrocarbons (PAH) (Tyler and Allan, 2014; Zhang et al., 2015). In oral ingestion of Cr (VI) through drinking water could cause global DNA hypomethylation in blood cells from male rats (Wang et al., 2015). It is also indicated that the aberrant methylation of p53 and p16 are involved in chromium carcinogenesis (Kondo et al., 1997; Kondo et al., 2006) and the expression and methylation level of p16(INK4a) are reduced in chromate lung cancer (Kondo et al., 2006). To explore the association between methylation and DNA damage will help to reveal whether epigenetic mechanism is involved in Cr(VI)-induced DNA damage. In this research, Human bronchial epithelial cells (16HBE cells) in vitro and bioinformatics analysis were used to analyze the methylation level of TP53 and p16 and understand whether DNA methylation can be a potential biomarker related to chromium carcinogenesis.
2. Materials and Methods 2.1 Cell line and chromium treatment 16HBE cells (tumor cell library of Chinese Academy of Medical Sciences, China) were cultured in DMEM supplemented with 10% fetal bovine serum, 100U/mL penicillin, and 100μg/mL streptomycin, and maintained at 37℃ in a humidified
atmosphere containing 5% CO2 and 95% air. Cells were treated with dichromate (Cr2O72−) (Sigma, USA) stoke solution diluted in cell culture medium at different concentrations. As the control group, cells were treated with the same volume of ddH2O (Sigma, USA) instead of Cr(VI) stoke solution at the same condition. 2.2 Determination of cell proliferation and cell survival rate According to the protocol, Counting Kit-8 (CCK8) assay (Dojindo Laboratories, Japan) was used to measure the cell proliferation and cell survival rates in different Cr(VI) treatment groups (0.0μM, 0.8μM, 1.6μM, 3.1μM, 6.2μM, 12.5μM, 25.0μM, 50.0μM and 100.0μM) at different incubation time (12 hours, 24 hours and 48 hours). 2.3 Determination of DNA damage Single cell gel electrophoresis (the alkaline comet assay) is a method to detect the DNA strand damage in vitro (Tice et al., 2000). It was performed as described by Tice et al. (2000) with modifications. The indicators [tail length (TL), tail moment(TM), percentage of tail DNA(%), Olive Tail Moment(OTM)] were calculated to judge the degree of DNA damage (Liu et al., 2015; Olive and Banath, 2006; Tice et al., 2000). 2.4 Determination the CpG methylation levels of TP53 and P16 DNA methylation of TP53 and p16 at CpG sites was quantified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) of the MassArray system (Sequenom EpiTYPER assay, San Diego, CA). The sequences of CpG islands in TP53 and p16 were got using the UCSC database. The location of significant CpG sites in these CpG islands was found in the present work. Then the sequences of target regions (Supplementary Figure1) and primer (TP53-forward primer:
aggaagagagGAGGAGTTTTAGGGTTTGATGG,
cagtaatacgactcactatagggagaaggct
Reverse
CCAATTCTTTTAAAAACACT
primer: ATATTCC;
p16-forward primer: aggaagagagGGTATGGTTATTGTTTTTGGTGTTT, Reverse primer: cagtaatacgactcactatagggagaaggctCCCACCCTAACTCTAACCATT CTAT) were designed using the EpiDesigner software (www. epidesiger. com) of the
Sequenom company. The steps are as following: Firstly, Bisulfite conversion of genomic DNA was performed using the DNA Methylation kit (Zymo Research, CA) following the manufacturer’s instructions. Secondly, PCR and in vitro transcription were carried out in DNA samples by bisulfite conversion, and the target regions were amplified using the primer pairs that incorporated the T7 promoter sequence and treated by Shrimp Alkaline Phosphatase (SEQUENOM, San Diego). Then the products were used as template for in vitro transcription and base-specific cleavage with RNase A. Lastly, all cleavage products were analyzed by MALDI-TOF-MS (Sequenom, USA) according to the manufacturer’s instructions (Ehrich et al., 2007), and 10% of the parallel samples were randomly selected and duplicates tested to ensure the accuracy of the results. 2.5 Determination of P16 and TP53 expression Following the protocol, total RNA was extracted from treated 16HBE cells by the Trizol (Invitrogen TM, USA). The NanoDrop 2000c spectrophotometers (Thermo, USA) were used to measure RNA concentration. Agarose gel electrophoresis was chosen to evaluate the quality of the total RNA. The primers of these genes were designed by the Primer Premier 5.0 (Supplementary Table 1). The semiquantification was performed using PCR Master Mix for SYBR Green assays (Vazyme, USA) on Real Time-qPCR system (CFX-96, Bio-Rad Company, USA). All samples were run in triplicate, and genes expression data was normalized to β-actin as internal control. 2.6 Bioinformatics analysis The location and sequences of CpG islands and CpG sites of p16 were analyzed by the database including UCSC and Ensamble. The transcription factors which can combine with target sequences of DNA repair genes were predicted by using various bioinformatics softwares including TRANSFAC (http://www. Gene-regulation.com/pub/databses.html), TFSEARCH (http://www.cbrc.jp /research /db /TFSEARCH. html) and Consite (http: //asp.ii.
uib.no: 8090/cgi-bin/CONSITE/consite) (Volckmar et al., 2012). 2.7 Statistical analysis Epidata software was used to entry data of these experiments into computers. The whole process was utilized double-entry and logistical error check to ensure the accuracy. All analysis was performed with SPSS17.0 software, and normality was assessed by K-S test. Differences in continuous and categorical parameters were tested using ANOVA (or Mann-Whitney U nonparametric test) and χ2 test. Linear regression analysis was used to examine the associations between DNA methylation levels with their expression levels, cell survival rate and DNA damage. Statistical significance for two-sided P values were defined as P<0.05.
3. Results 3.1 Cell survival rate As was shown in Figure 1, the cell survival rate was measured by the CCK-8. Comparing with the control group, the cell survival rate decreased significantly in a concentration dependent manner when the treatment concentrations above 12.5μM during all treatment time. And the cell survival rate decreased significantly at all studied concentrations when treated for 24 hours. The model of cell survival rate was analyzed by SPSS software to calculate the IC50 for Cr(VI) treatment concentration and time (Liu et al., 2007). Based on the IC50 value and the chromium concentration in worker blood (CrB) from our previous occupational epidemiological investigation (Li et al., 2015), the final concentration set was followed as 0.0μM, 0.6μM, 1.2μM, 2.5μM, 5.0μM, 10.0μM and 20.0μM, and the incubation time was determined for 24 hours. Note: Results are mean ± standard deviation; *Comparing with the control group, P<0.05； **Comparing with the control group, P<0.001;
3.2 DNA damage of the cells As was shown in Table 1, the values of percentage of tail DNA (%), TL, TM and OTM increased in all Cr(VI) treatment groups than those in the control group (P<0.05). The values of percentage of tail DNA(%), TL, TM and OTM increased
significantly especially when the Cr(VI) concentration higher than 2.5μM (P<0.001). It was found that there was positive correlations among Cr(VI) concentration with the values of percentage of tail DNA (%), TL, TM and OTM respectively. 3.3 The methylation levels of TP53 and P16 As was revealed in Figure 2, there were no significant difference of the methylation levels of studied CpG sites from TP53 in all Cr(VI) treatment groups. The CpG1 methylation levels of p16 from 2.5μM to 20μM treatment groups were significantly higher than that in the control group (P<0.05). The methylation levels of CpG31,32 of p16 from 1.2μM to 20μM Cr(VI) treatment groups were significantly higher than that in the control group (P<0.05). Note: Results are mean ± standard deviation; a shows the methylation levels of studied CpG sites of TP53 in different Cr(VI) treatment group; b shows the methylation levels of studied CpG sites of p16 in different Cr(VI) treatment group; * proves the methylation levels from 2.5μM to 20μM Cr(VI) treatment groups were significant different than those in the control group, P<0.05; **prove the methylation levels from 1.2μM to 20μM Cr(VI) treatment groups were significant different than those in the control group, P<0.05.
3.4 The mRNA expression levels of TP53 and P16 As was shown in Figure 3, the mRNA expression levels of TP53 in the treatment concentrations of 5.0μM, 10.0μM and 20.0μM were significantly higher than that in the control group (P<0.05). The mRNA expression levels of p16 in all Cr(VI) treatment groups (0.6μM, 1.2μM, 2.5μM, 5μM, 10μM and 20μM) were significantly lower than that in the control group (P<0.05). 3.5 The correlations The methylation levels of CpG sites which had statistically significant differences between the treatment groups and the control group were used to discuss the correlations between the methylation levels of CpG1, CpG31 and CpG32 of p16 with cell survival rate, DNA damage (TL, TM and OTM), treatment concentrations and their expression levels. There were positive correlations among methylation levels of CpG1, CpG31 and CpG32 of p16 with DNA damage (TL, TM and OTM) and Cr
concentrations. There were negative correlations between methylation levels of CpG1, CpG31 and CpG32 of p16 with cell survival rate and its expression level.
3.6 Bioinformatics analysis The distribution of CpG islands had an edge effect, and the CpG islands were located at the junction of the promoter and the first exon. It is discovered that the significant CpG sites were located near the promoter region，which could affect the expression levels of corresponding mRNA to enhance the cell damage including the decrease of cell survival rate and the increase of DNA strand breakage . There are multiple transcription factors (ETF-EGF, GCF, LF-1A, TGT3, Sp-1, Ap-2, HIF-1, HC3, TCF-2, HSF and HSP70) which can combine with the CpG islands located in DNA strand of p16. These transcription factors have been predicted to have many physiological activities such as oxidative stress, immune regulation and cell cycle arrest. It suggests that the changes of methylation levels of p16 can affect the combination of these transcription factors with corresponding sites of DNA strand to cause the disorder of cellular functions to enhance the cell response challenged by Cr(VI) treatment
4. Discussion Many investigations had proved that Cr(VI) treatment can induce genetic damage and induction of cell apoptosis, which can contribute to its hazard on health (Fu et al., 2015; Xia et al., 2015). Our present research proved that the cell survival rate and the values of percentage of tail DNA(%), TL, TM and OTM were changed in a Cr concentration dependent manner. The CpG islands methylation play an important role in the transcription regulation. The inverse relationship was shown between the methylation levels and their regulations (Schubeler, 2015; Xing et al., 2013; Yang et al., 2014). Our previous study had found that there was no linear correlation but a curve fitting among Cr content in blood with 8-OHdG and micronucleus (MN) in occupational workers (Li et
al., 2014). The reason may be explained that high concentration of chromium exposure can induce apoptosis of cells with high DNA damage. The current research also showed that when the Cr(VI) concentrations were more than 5.0μM, the expression levels of TP53 were upregulated without methylation level changes of the studied CpG sites from TP53 in all Cr(VI) treatment groups. And also no correlations were observed between the methylation levels of TP53 with its expression levels. As we all know, TP53 is a tumor suppressor gene, and it has many physiological functions such as regulating DNA repair, clearing cells with serious damage and checking cell cycle progress and so on. It is consistent with the previous study, Cr(VI) treatment can induce high expression of TP53 accompanied with high DNA damage and apoptosis induction (Oikawa et al., 2005; Smith et al., 1995). The current research indicates that the methylation levels of CpG1 of p16 in the 2.5μM, 5μM, 10μM and 20μM treatment groups were significantly higher than that in the control group (P<0.05). The methylation levels of CpG31, 32 of p16 in the 1.2μM, 2.5μM, 5μM, 10μM and 20μM Cr(VI) treatment groups were significantly higher than that in the control group (P<0.05). There were positive correlations among methylation levels of CpG1, CpG31 and CpG32 of p16 with DNA damage (TL, TM and OTM) and Cr concentration. While there were negative correlations among methylation levels of CpG1, CpG31 and CpG32 of p16 with cell survival rate and its expression levels. It is indicated that the methylation level of these CpG sites responded to the Cr challenge in 16HBE cells in a concentration dependent manner and can be used as a potential effective biomarker in future epidemiologic studies. p16 is critical for cell cycle regulation, Cr (VI) can down-regulated p16 expression by increasing the methylation levels of CpG1, CpG31 and CpG32 sites in our study, which was also observed by Jackson(Jackson et al., 2012). These changes can cause G1/S and G2/M arrest and provide the chance to DNA damage repair. When p16 gene was decreased, the genetic damage had no enough time to be repaired and consequently the 8-OHdG and MN would be increased (Hu et al., 2015; Huang et al., 2015).
The bioinformatics analysis proved that CpG islands had an edge effect, and they were located at the junction of the promoter and the first exon which can affect the mRNA expression levels of corresponding genes to enhance the cell stress including cellular survival state and DNA damage (Gnad et al., 2015). What’s more, there were multiple transcription factors which can combine with the CpG islands located in DNA strand of related gene and finally lead to the disorder of cellular diversified functions.
5. Conclusions Cr(VI) treatment could up-regulate the methylation levels of CpG1, CpG31 and , CpG32 sites of p16, which inversely down-regulated its mRNA expression levels, and also can affect the combination of some transcription factors with corresponding sites of p16 gene strand to enhance cellular stress induced by Cr(VI) in HBE16 cells. It is suggested that the methylation level of these significant CpG sites could be used as a potential effective biomarker of epigenetic effect due to chromate exposure .
Conflict of interest The authors declare that there are no conflicts of interest.
Acknowledge This work was supported by the projects of National Natural Science Foundation of China (81073043) and by Doctor Fund of Ministry of Education of china (20120001110103).
References: Ali, A.H., Kondo, K., Namura, T., Senba, Y., Takizawa, H., Nakagawa, Y., Toba, H., Kenzaki, K., Sakiyama, S., Tangoku, A., 2011. Aberrant DNA methylation of some tumor suppressor genes in lung cancers from workers with chromate exposure. Mol Carcinog 50, 89-99. Beaver, L.M., Stemmy, E.J., Schwartz, A.M., Damsker, J.M., Constant, S.L., Ceryak, S.M., Patierno, S.R., 2009. Lung inflammation, injury, and proliferative response after repetitive particulate hexavalent chromium exposure. Environ Health Perspect 117, 1896-1902. Cavallo, D., Ursini, C.L., Fresegna, A.M., Ciervo, A., Maiello, R., Rondinone, B., D'Agata, V., Iavicoli, S., 2010. Direct-oxidative DNA damage and apoptosis induction in different human respiratory cells exposed to low concentrations of sodium chromate. J APPL TOXICOL 30, 218-225.
Ehrich, M., Zoll, S., Sur, S., van den Boom, D., 2007. A new method for accurate assessment of DNA quality after bisulfite treatment. NUCLEIC ACIDS RES 35, e29. Fu, S., Jin, D., Liu, S., Wang, L., Wang, Z., Mei, G., Zou, Z.L., Wu, J.Q., Xu, Z.Y., 2015. Protective Effect of Neuropeptide Substance P on Bone Marrow Mesenchymal Stem Cells against Apoptosis Induced by Serum Deprivation. STEM CELLS INT 2015, 270328. Gao, Y., Xia, J., 2011. Chromium contamination accident in China: viewing environment policy of China. ENVIRON SCI TECHNOL 45, 8605-8606. Gnad, F., Doll, S., Manning, G., Arnott, D., Zhang, Z., 2015. Bioinformatics analysis of thousands of TCGA tumors to determine the involvement
of epigenetic regulators in human cancer. BMC
GENOMICS 16 Suppl 8, S5. Halasova, E., Matakova, T., Musak, L., Polakova, V., Letkova, L., Dobrota, D., Vodicka, P., 2012. Evaluating chromosomal damage in workers exposed to hexavalent chromium and the modulating role of polymorphisms of DNA repair genes. Int Arch Occup Environ Health 85, 473-481. Hara, T., Hoshuyama, T., Takahashi, K., Delgermaa, V., Sorahan, T., 2010. Cancer risk among Japanese chromium platers, 1976-2003. Scand J Work Environ Health 36, 216-221. Hu, Z.Y., Tang, L.D., Zhou, Q., Xiao, L., Cao, Y., 2015. Aberrant promoter hypermethylation of p16 gene in endometrial carcinoma. Tumour Biol 36, 1487-1491. Huang, W., Li, T., Yang, W., Chai, X., Chen, K., Wei, L., Duan, S., Li, B., Qin, Y., 2015. Analysis of DNA methylation in plasma for monitoring hepatocarcinogenesis. Genet Test Mol Biomarkers 19, 295-302. Jackson, J.G., Pant, V., Li, Q., Chang, L.L., Quintas-Cardama, A., Garza, D., Tavana, O., Yang, P., Manshouri, T., Li, Y., El-Naggar, A.K., Lozano, G., 2012. p53-mediated senescence impairs the apoptotic response to chemotherapy and clinical outcome in breast cancer. CANCER CELL 21, 793-806. Kondo, K., Hino, N., Sasa, M., Kamamura, Y., Sakiyama, S., Tsuyuguchi, M., Hashimoto, M., Uyama, T., Monden, Y., 1997. Mutations of the p53 gene in human lung cancer from chromate-exposed workers. Biochem Biophys Res Commun 239, 95-100. Kondo, K., Takahashi, Y., Hirose, Y., Nagao, T., Tsuyuguchi, M., Hashimoto, M., Ochiai, A., Monden, Y., Tangoku, A., 2006. The reduced expression and aberrant methylation of p16(INK4a) in chromate workers with lung cancer. LUNG CANCER 53, 295-302. Li, P., Gu, Y., Yu, S., Li, Y., Yang, J., Jia, G., 2014. Assessing the suitability of 8-OHdG and micronuclei as genotoxic biomarkers in chromate-exposed workers: a cross-sectional study. BMJ OPEN 4, e5979. Li, P., Li, Y., Zhang, J., Yu, S.F., Wang, Z.L., Jia, G., 2015. Establishment of a reference value for chromium in the blood for biological monitoring among occupational chromium workers. TOXICOL IND HEALTH. Liu, W., Chaspoul, F., Lefranc, D.B., Decome, L., Gallice, P., 2007. Microcalorimetry as a tool for Cr(VI) toxicity evaluation of human dermal fibroblasts. J THERM ANAL CALORIM 89, 21-24. Liu, X., Sun, B., Wang, X., Nie, J., Chen, Z., An, Y., Tong, J., 2015. Synergistic effect of radon and sodium arsenite on DNA damage in HBE cells. Environ Toxicol Pharmacol 41, 127-131. Maunakea, A.K., Nagarajan, R.P., Bilenky, M., Ballinger, T.J., D'Souza, C., Fouse, S.D., Johnson, B.E., Hong, C., Nielsen, C., Zhao, Y., Turecki, G., Delaney, A., Varhol, R., Thiessen, N., Shchors, K., Heine, V.M., Rowitch, D.H., Xing, X., Fiore, C., Schillebeeckx, M., Jones, S.J., Haussler, D., Marra, M.A., Hirst, M., Wang, T., Costello, J.F., 2010. Conserved role of intragenic DNA methylation in regulating
alternative promoters. NATURE 466, 253-257. Oikawa, T., Okuda, M., Ma, Z., Goorha, R., Tsujimoto, H., Inokuma, H., Fukasawa, K., 2005. Transcriptional control of BubR1 by p53 and suppression of centrosome amplification by BubR1. MOL CELL BIOL 25, 4046-4061. Olive, P.L., Banath, J.P., 2006. The comet assay: a method to measure DNA damage in individual cells. NAT PROTOC 1, 23-29. Qi, Z., Liu, M., Liu, Y., Zhang, M., Yang, G., 2014. Tetramethoxychalcone, a chalcone derivative, suppresses proliferation, blocks cell cycle progression, and induces apoptosis of human ovarian cancer cells. PLOS ONE 9, e106206. Romanoski, C.E., Glass, C.K., Stunnenberg, H.G., Wilson, L., Almouzni, G., 2015. Epigenomics: Roadmap for regulation. NATURE 518, 314-316. Schubeler, D., 2015. Function and information content of DNA methylation. NATURE 517, 321-326. Senba, M., Mori, N., Fujita, S., Jutavijittum, P., Yousukh, A., Toriyama, K., Wada, A., 2010. Relationship among human papillomavirus infection, p16(INK4a), p53 and NF-kappaB
activation in
penile cancer from northern Thailand. ONCOL LETT 1, 599-603. Shibata-Kobayashi, S., Yamashita, H., Okuma, K., Shiraishi, K., Igaki, H., Ohtomo, K., Nakagawa, K., 2013. Correlation among 16 biological factors [p53, p21(waf1), MIB-1 (Ki-67), p16(INK4A), cyclin D1, E-cadherin, Bcl-2, TNF-alpha, NF-kappaB, TGF-beta, MMP-7,
COX-2, EGFR, HER2/neu, ER,
and HIF-1alpha] and clinical outcomes following curative chemoradiation therapy in 10 patients with esophageal squamous cell carcinoma. ONCOL LETT 5, 903-910. Sikdar, S., Mukherjee, A., Khuda-Bukhsh, A.R., 2015. Anti-lung cancer potential of pure esteric-glycoside condurangogenin A against nonsmall-cell lung cancer cells in vitro via p21/p53 mediated cell cycle modulation and DNA damage-induced apoptosis. PHARMACOGN MAG 11, S73-S85. Smith, M.L., Chen, I.T., Zhan, Q., O'Connor, P.M., Fornace, A.J., 1995. Involvement of the p53 tumor suppressor in repair of u.v.-type DNA damage. ONCOGENE 10, 1053-1059. Tice, R.R., Agurell, E., Anderson, D., Burlinson, B., Hartmann, A., Kobayashi, H., Miyamae, Y., Rojas, E., Ryu, J.C., Sasaki, Y.F., 2000. Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. ENVIRON MOL MUTAGEN 35, 206-221. Tyler, C.R., Allan, A.M., 2014. The Effects of Arsenic Exposure on Neurological and Cognitive Dysfunction in Human and Rodent Studies: A Review. Curr Environ Health Rep 1, 132-147. Volckmar, A.L., Bolze, F., Jarick, I., Knoll, N., Scherag, A., Reinehr, T., Illig, T., Grallert, H., Wichmann, H.E., Wiegand, S., Biebermann, H., Krude, H., Fischer-Posovszky, P., Rief, W., Wabitsch, M., Klingenspor, M., Hebebrand, J., Hinney, A., 2012. Mutation screen in the GWAS derived obesity gene SH2B1 including functional analyses of detected variants. BMC MED GENOMICS 5, 65. Wang, T., Jia, G., Zhang, J., Ma, Y., Feng, W., Liu, L., Zhang, N., Yan, L., Wang, X., Zhang, X., Liu, Z., Du X, Zhen, S., 2011. Renal impairment caused by chronic occupational chromate exposure. Int Arch Occup Environ Health 84, 393-401. Wang, T.C., Song, Y.S., Wang, H., Zhang, J., Yu, S.F., Gu, Y.E., Chen, T., Wang, Y., Shen, H.Q., Jia, G., 2012. Oxidative DNA damage and global DNA hypomethylation are related to folate deficiency in chromate manufacturing workers. J HAZARD MATER 213-214, 440-446. Wang, Y., Wu, W., Yao, C., Lou, J., Chen, R., Jin, L., Wu, N., Gao, M., Song, P., Tan, Y., Liu, K., 2015. Elevated tissue Cr levels, increased plasma oxidative markers, and global hypomethylation of blood DNA in male Sprague-Dawley rats exposed to potassium dichromate in drinking water.
ENVIRON TOXICOL. Wise, S.S., Wise, J.S., 2012. Chromium and genomic stability. Mutat Res 733, 78-82. Xia, Z., Zhang, H., Xu, D., Lao, Y., Fu, W., Tan, H., Cao, P., Yang, L., Xu, H., 2015. Xanthones from the Leaves of Garcinia cowa Induce Cell Cycle Arrest, Apoptosis, and Autophagy in Cancer Cells. MOLECULES 20, 11387-11399. Xing, C., Chen, Q., Li, G., Zhang, L., Zheng, M., Zou, Z., Hou, L., Wang, Q.F., Liu, X., Guo, X., 2013. Microsomal epoxide hydrolase (EPHX1) polymorphisms are associated with aberrant promoter methylation of ERCC3 and hematotoxicity in benzene-exposed workers. ENVIRON MOL MUTAGEN 54, 397-405. Yang, X., Han, H., De Carvalho, D.D., Lay, F.D., Jones, P.A., Liang, G., 2014. Gene body methylation can alter gene expression and is a therapeutic target in cancer. CANCER CELL 26, 577-590. Zhang, H., Li, X., Ge, L., Yang, J., Sun, J., Niu, Q., 2015. Methylation of CpG island of p14(ARK), p15(INK4b) and p16(INK4a) genes in coke oven workers. HUM EXP TOXICOL 34, 191-197. Zhu, H.L., Zou, Z.N., Lin, P.X., Li, W.X., Huang, Y.E., Shi, X.X., Shen, H., 2015. Malignant transformation rate and p53, and p16 expression in teratomatous skin of ovarian mature cystic teratoma. Asian Pac J Cancer Prev 16, 1165-1168.
Figure 1 The survival rate of 16HBE cells at different concentrations of Cr(VI) after treatment of 12, 24 and 48 hours (x ± SD)
a
b Figure 2 The methylation levels of studied CpG sites of TP53 and P16 in different Cr(VI) treatment groups(x±SD)
Figure 3 The expression levels of TP53 and P16 in Cr(VI) different treatment groups(x±SD) Note: Results are mean ± standard deviation; *proves comparing with the control group, P<0.05.
Table 1 The effect of different Cr(VI) concentration on DNA damage in16HBE cells for 24 hours (x ± SD) Treatment (μM)
Percentage of tail DNA（%）
TL (μm)
TM
OTM
0.0
2.47±2.16
7.64±5.78
0.29±0.23
0.63±0.35
0.6
4.71±3.94*
11.76±8.37*
0.82±0.39*
1.32±0.47*
1.2
4.66±2.97*
11.86±6.28*
0.66±0.65*
1.36±0.54*
2.5
11.62±7.92**
25.66±13.81**
4.11±2.64**
4.20±1.52**
5.0
15.67±5.02**
36.32±16.14**
5.88±3.62**
5.52±2.04**
10.0
16.97±6.96**
37.80±17.90**
7.30±5.16**
7.03±2.35**
20.0
31.00±11.12**
58.57±21.22**
19.27±10.48**
16.53±7.54**
Note: Results are mean ± standard deviation; *Comparing with the control group, P<0.05； **Comparing with the control group, P<0.001; TL-tail length; TM-tail moment; OTM-Olive Tail Moment. The random observed cell number was 3×102.
Table 2 The correlations between the methylation levels of CpG1 CpG31 and, CpG32 of P16 with the observed indicators Methylation levels of CpG1
Methylation levels of CpG31, 32
Correlation coefficient
P Value
Correlation coefficient
P Value
Cell survival rate
-0.774
0.041
-0.796
0.032
TL
0.802
0.030
0.861
0.013
TM
0.795
0.028
0.826
0.022
OTM
0.835
0.016
0.772
0.042
Treatment concentration
0.816
0.027
0.765
0.045
Expression levels
-0.795
0.028
-0.835
0.016