- Email: [email protected]
Methylation of human papillomavirus-52 and -58 is a candidate biomarker in cervical neoplasia
Journal of Clinical Virology 58 (2013) 149–154
Contents lists available at SciVerse ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Methylation of human papillomavirus-52 and -58 is a candidate biomarker in cervical neoplasia Isao Murakami a , Takuma Fujii a,∗,1 , Katsuaki Dan b , Miyuki Saito a , Akiko Ohno a , Takashi Iwata a , Daisuke Aoki a a
Department of Obstetrics and Gynecology, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan Collaborative Research Resources, Core Instrumentation Facility, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan b
a r t i c l e
i n f o
Article history: Received 26 March 2013 Received in revised form 1 June 2013 Accepted 19 June 2013 Keywords: Biomarker Cervical neoplasia DNA methylation Human papillomavirus 52 Human papillomavirus 58
a b s t r a c t Background: Previous studies of human papillomavirus (HPV)16/18 genome methylation have concluded that methylation status of the L1 gene might act as a biomarker for cervical intraepithelial neoplasia (CIN). Objectives: We investigated the correlation between methylation status in the L1 gene and the long control region (LCR) of HPV52/58 and CIN. Study design: Exfoliated cervical cells were taken from 54 HPV52-positive and 41 HPV58-positive women. The HPV genome was examined using bisulfite modification, polymerase chain reaction amplification, and sequencing. Results: The CpGs were unmethylated or hypomethylated in the HPV52/58 LCR. In contrast, the methylation status of the HPV52 L1 gene was correlated with the severity of cervical neoplasia, with average percentages of 15%, 34%, and 52% for cervicitis/CIN1, CIN2, and CIN3, respectively (P < 0.05). Methylation status of the HPV52 L1 gene was also correlated with the prognosis of CIN1/2, with median percentages of 15% and 35% for regression and persistence/progression, respectively (P < 0.05). The methylation status of the HPV58 L1 gene was correlated with the severity of cervical neoplasia, with average percentages of 12%, 38%, and 61% for cervicitis/CIN1, CIN2, and CIN3, respectively (P < 0.05). Conclusions: The increased methylation at the CpG sites in the HPV52/58 L1 gene was correlated with the severity of cervical neoplasia, similar to HPV16/18 in previous studies. These data suggest that HPV methylation status of the L1 gene is a candidate biomarker of CIN for detecting CIN2 and CIN3. © 2013 Elsevier B.V. All rights reserved.
1. Background Cervical cancer is the second most common malignant tumor in women worldwide and is associated with persistent infection with high-risk human papillomavirus (HPV) [1]. High-risk HPV types are associated with 99% of all cervical carcinomas. Among these types, HPV16 and HPV18 account for about two-thirds of these malignant lesions worldwide [1]. The available prophylactic bivalent or quadrivalent vaccine is expected to reduced cervical cancer in ∼70% of women at present. However, other high-risk HPV types, such as HPV52 and HPV58, are one of the major causes of cervical
Abbreviations: CIN, cervical intraepithelial neoplasia; HPV, human papillomavirus; LCR, long control region; PCR, polymerase chain reaction. ∗ Corresponding author. Tel.: +81 3 3353 1211x62397; fax: +81 3 3226 1667. E-mail addresses: [email protected], [email protected] (T. Fujii). 1 Present address: Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, 1-98 Dengakugakubo, Kutsukake-cho, Toyoake, Aichi 470-1192, Japan. 1386-6532/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jcv.2013.06.026
intraepithelial neoplasia (CIN) and squamous cell carcinoma (SCC) in Asia, especially in Japan. Masumoto et al. performed HPV typing in 3000 Japanese women who attended hospital for cervical cancer screening, or follow-up or treatment of previous cervical neoplasia. HPV52 DNA was detected in 3.9% of patients with CIN1, 12.1% with CIN2, 22.0% with CIN3, and 7.1% with SCC [2]. Onuki et al. performed HPV typing in 2282 Japanese women who attended hospital for cervical cancer screening, treatment of cervical neoplasia, or for other reasons [3]. HPV52 DNA was detected in 9.4% of women with normal cytology, 11.4% with CIN1, 17.5% with CIN2 and CIN3, and 8.4% with SCC. HPV58 DNA was detected in 7.0% of women with normal cytology, 6.8% with CIN1, 10.7% with CIN2 and CIN3, and 3.1% with SCC. Currently, there is no prophylactic vaccine for HPV52 and HPV58. Therefore, it is important to investigate new diagnostic biomarkers for CIN caused by HPV52 and HPV58 to prevent cervical cancer. Epigenetic mechanisms, which influence chromatin conformations that favor or repress gene expression, have been shown to play a major role in modulating HPV transcription [4,5]. DNA methylation at CpG sites is one of several mechanisms that affect
150
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
chromatin conformation. Methylated CpG sites bind repressors that alter the conformation of nucleosomes through their interaction with histone deacetylases in a manner unfavorable to transcription. There is thus increasing interest in understanding the relationships between HPV DNA methylation and viral gene expression, viral life cycle, virus persistence and replicative behavior, and immune responses [6]. The methylation status of HPV16 and HPV18 has recently been studied by several groups investigating the HPV life cycle and potential new biomarkers [7–22]. In these previous studies, the L1 genes of HPV16 and HPV18 were shown to be hypermethylated in carcinomas, in contrast to their hypomethylated state in premalignant or HPV-positive lesions. They reported that increased methylation at CpG sites in the L1 genes of HPV16 and HPV18 is correlated with severity of cervical neoplasia. These findings suggest that the methylation status of the L1 gene may be a biomarker of clinical progression in HPV16- and HPV18-associated neoplastic lesions. So far, the methylation status of other HPV types, such as HPV52 and HPV58, has not been reported. 2. Objectives The methylation status of HPV52 and HPV58 was examined to establish whether it was correlated with the severity and regression or progression of cervical neoplasia. 3. Study design 3.1. Clinical specimens and HPV52/HPV58 DNA genotyping HPV52-infected women with diagnoses of cervicitis (n = 8), CIN1 (n = 9), CIN2 (n = 15), and CIN3 (n = 22) of the uterine cervix and HPV58-infected women with diagnoses of cervicitis (n = 10), CIN1 (n = 10), CIN2 (n = 9), and CIN3 (n = 12) of the uterine cervix were included. All 95 patients were recruited at the Department of Obstetrics and Gynecology, Keio University Hospital, Tokyo, Japan, between November 2006 and March 2010. Exfoliated cervical cells were treated with proteinase K and buffer containing 150 mM NaCl, 10 mM Tris–HCl (pH 8.0), 10 mM EDTA, and 0.1% sodium dodecyl sulfate for 1 h at 55 ◦ C, followed by overnight treatment at 37 ◦ C. DNA was then extracted by phenol/chloroform extraction followed by ethanol precipitation. HPV52 and HPV58 DNA detection was performed using the Clinichip HPV (Sekisui Medical, Tokyo, Japan) [23]. 3.2. Bisulfite modification DNA samples extracted from exfoliated cells were modified using the DNA Methylation-Gold Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. The converted DNA was eluted with 30 L TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA). The bisulfite-modified DNA was stored at −20 ◦ C until use. 3.3. Amplification of bisulfite-treated DNA and DNA sequencing Six primer pairs were designed to amplify the bisulfitemodified HPV52 containing part of the L1 gene or the long control region (LCR), and seven primer pairs were designed to amplify the bisulfite-modified HPV58 containing part of the L1 gene or LCR, using the MethPrimer Design program (http://www.urogene.org/methprimer/index1.html). The primers are listed in Table 1. Twenty-six CpG sites in the HPV52 L1 gene, 15 in the HPV52 LCR, 25 in the HPV58 L1 gene, and eight in the HPV58 LCR were included. Polymerase chain reaction (PCR) was performed using the bisulfite-modified DNA samples in a final volume of 50 L. The PCR amplification conditions for each primer set were optimized for MgCl2 concentration (2.0–4.0 mM) and annealing and
elongation temperature (54 or 60 ◦ C). Each PCR contained 1.25 U AmpliTaq Gold (Roche Applied Science, Indianapolis, IN, USA). The PCR conditions were 95 ◦ C for 10 min, followed by five cycles of 1 min at 95 ◦ C, 2 min at 54 or 60 ◦ C, and 3 min at 72 ◦ C, and 35 cycles of 1 min at 95 ◦ C, 2 min at 60 ◦ C, and 2 min at 72 ◦ C. A final extension step was performed for 10 min at 72 ◦ C. PCRs were performed in a Veriti 96-Well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). The presence of each PCR product was verified by electrophoresis in ethidium-bromide-stained agarose gels. PCR products were sequenced by Big Dye Terminator v3.1 Cycle Sequencing (Applied Biosystems), which shows cytosine if the original cytosine is methylated, or thymine if the original cytosine is unmethylated. To determine that CpG sites were methylated or unmethylated, the PCR products were sequenced in both directions. 3.4. Follow-up study Follow-up data for patients with CIN1 and CIN2 who had not undergone any treatments were examined retrospectively. Followup visits occurred every 4–6 months and histology, cytology, and colposcopy examinations were performed at each visit. If cytology was abnormal, the patients had colposcopically directed biopsy in their following visit, even if the colposcopic impression was normal in the previous visit. Regression was defined as one negative histological result. Persistence was defined as several continually positive histological results indicating CIN1 or CIN2 for at least 1 year. Progression was defined as the appearance of histologically confirmed CIN3 during follow-up. 3.5. Statistical analysis Differences were analyzed using two-sided Student’s t tests. Differences with P < 0.05 were considered significant. 4. Results 4.1. HPV52 and HPV58 methylation status of the L1 gene and LCR Five CpGs in the HPV52 L1 gene (positions 5730, 5763, 5884, 5972, and 6883), two CpGs in the HPV52 LCR (positions 7557 and 7563), three CpGs in the HPV58 L1 gene (positions 5730, 6868, and 7035), and three CpGs in the HPV58 LCR (positions 7489, 7495, and 7511) could not be amplified by PCR. Therefore, we determined the methylation frequencies at each of the 21 CpG sites in the HPV52 L1 gene, 13 in the HPV52 LCR, 22 in the HPV58 L1 gene, and five in the HPV58 LCR. The average methylation percentages at each measured CpG site in the HPV52/HPV58 L1 gene in DNA from exfoliated cervical cells from patients with cervicitis/CIN1 (A/D), CIN2 (B/E), and CIN3 (C/F) are shown in Fig. 1. The average methylation percentages at all measured CpG sites in the HPV52/HPV58 L1 gene and the LCR in DNA from exfoliated cervical cells from patients with cervicitis/CIN1, CIN2, and CIN3 are shown in Table 2. As shown in Fig. 1 and Table 2, CpGs were hypermethylated in the HPV52 and HPV58 L1 gene with increasing cervical dyskaryosis. The average percentages of all CpGs that were methylated in the HPV52 L1 gene were 15% (range 0–43%) for cervicitis/CIN1, 34% (range 0–83%) for CIN2, and 52% (range 8–85%) for CIN3 (Fig. 1 and Table 2A). The average percentages of all CpGs that were methylated in the HPV58 L1 gene were 12% (range 0–61%) for cervicitis/CIN1, 38% (range 0–100%) for CIN2, and 61% (range 11–100%) for CIN3 (Fig. 1 and Table 2B). The methylation percentages at each CpG site in the HPV52 and HPV58 L1 genes differed significantly among different grades of cervical neoplasia (P < 0.05). However, the average percentages of all CpGs that were methylated in the HPV52 LCR were 2.5% (range 0–16%) for cervicitis/CIN1, 1.3% (range 0–16%) for CIN2, and 3.2% (range 0–25%) for CIN3 (Table 2A). The CpG sites were unmethylated in
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
151
Table 1 PCR primers for amplification of bisulfite-converted HPV52 (A) and HPV58 (B). A Pairs 1 2 3 4 5 6
Positiona
Sequence
PCR amplicon (bps)
FW: 5514–5543 RV: 5656–5680 FW: 6220–6249 RV: 6444–6469 FW: 6496–6525 RV: 6836–6863 FW: 7024–7053 RV: 7197–7226 FW: 7632–7656 RV: 7839–7868 FW: 7838–7867 RV: 97–122
TTTTTTTTGTTTTTATAGTTTTTATAGTTT AAATACACAATAACCTCACTAAACC TTATTAATAGTGTAATATAGGATGGGGATA CCTAACACAAAATCACCTAAAATACC TTGGTAATATTGTTATTGTATAAAGTAGTG TTACCAATCCTCTAAAATAATAACATCC TAGATTTAGATTAGTTTTTTTTAGGTAGAA TAATTACCTTTTAACCTATTTTTAACATAC ATTGTTTAATTTTTTGGTTTTTTGT ATTCAATTATATTTTACAAAACATATTTAA GTTAAATATGTTTTGTAAAATATAATTGAA TATTACTAAATCCTCAAACATAACC
167
Positionb
Sequence
PCR amplicon (bps)
FW: 5538–5568 RV: 5680–5704 FW: 5752–5777 RV: 5956–5981 FW: 5954–5971 RV: 6135–6159 FW: 6351–6377 RV: 6595–6619 FW: 6610–6637 RV: 6822–6845 FW: 7054–7082 RV: 7250–7278 FW: 7725–7854 RV: 85–109
AATTTTTTTTAATATTATAATTGTGGATGG ACCTTAAACACAAACACAAAAAACA TTGGTAGTTTTAGATTTTTGGTTGTT TAACTATCCCCTACCTATTTCAAAAC AGGTTTTGAAATAGGTAGGGGATAGT CTTTACCCCAATACTCACCAATAAA TGGTTAGTGAATTTTATGGGGATAG ACCCCAACAAATACCATTATTATAAC TTGTTGGGGTAATTAGTTATTTGTTAT ACCAATCCTCCAAAATATTAAAATC AGGTTTTAAAGTAAAGTTTAGATTAAAA AAAAACTAACAAAAACATAAAACATATAC TAAATTATGTTTTGTAAAAGTGATTTATTA TAATCCTACAATAACCTACCAAAAA
166
250 368 203 237 227
B Pairs 1 2 3 4 5 6 7
230 206 269 236 225 209
FW, forward primer; RV, reverse primer. a Nucleotide number in the HPV52 genome (GenBank accession no. X74481). b Nucleotide number in the HPV58 genome (GenBank accession no. D90400).
the HPV58 LCR (Table 2B). There were no significant differences in methylation percentages in both the HPV52 and HPV58 LCRs among different grades of cervical neoplasia. 4.2. Correlation between prognosis of cervical neoplasia and methylation status of the HPV L1 gene
CpG sites that were methylated in the HPV52 L1 gene in patients with CIN1 and CIN2 were 15% (range 0–28%) and 35% (range 5–50%), for regression and persistence/progression, respectively (Fig. 2B). The difference in methylation percentages between regression and persistence/progression was significant (P = 0.02). 5. Discussion
We investigated the correlation between the prognosis of cervical neoplasia and the methylation status of the HPV52 L1 gene. Among all 55 patients, six clinical cases of HPV52-positive CIN1 and nine HPV52-positive CIN2 cases, who had not undergone any treatment, were analyzed (Fig. 2A). The median follow-up period was 12.6 months (range 4–30 months). The median percentages of all Table 2 HPV52 (A) and HPV58 (B) methylation status. A L1 gene (%) Cervicitis & CIN1 (n = 17) CIN2 (n = 15) CIN3 (n = 22)
*
LCR (%)
15 34* 52*
2.5 1.3 3.2
L1 gene (%)
LCR (%)
12† 38† 61†
0 0 0
B
Cervicitis & CIN1 (n = 20) CIN2 (n = 9) CIN3 (n = 12)
Methylation status of HPV52 and HPV58 are defined as the average methylation percentages at all measured CpG sites. * P < 0.05 (Student’s t test). † P < 0.05 (Student’s t test).
Increasing epidemiological, etiological and molecular data suggest that high-risk HPV types are biologically distinct and may confer different pathogenic risks. Moreover, the prophylactic bivalent or quadrivalent vaccines protect women from infection with HPV16 and HPV18. It is therefore necessary to investigate not only HPV16 and HPV18, but also other high-risk HPV types to elucidate the HPV life cycle fully and to discover new biomarkers. The current study investigated the correlation between the methylation status of HPV52 and HPV58, which are major causes of CIN and SCC in Japan, and cervical neoplasia in clinical specimens. To the best of our knowledge, this is the first study to investigate the methylation status of HPV52 and HPV58. Previous studies found significantly higher methylation status of HPV16 and HPV18 L1 genes in CIN3 compared with clinical specimens with cervicitis, CIN1, and CIN2 [5–7,9,10,15]. We found that increased methylation at CpG sites in the HPV52 and HPV58 L1 genes was correlated with the severity of cervical neoplasia; similar to HPV16 and HPV18. These data suggest that HPV methylation status of the L1 gene is a candidate biomarker for detecting CIN2 and CIN3. In contrast, methylation at CpG sites in the HPV52 and HPV58 LCRs was unrelated to the severity of cervical neoplasia. Although the HPV LCR plays an important role in the regulation of viral gene expression, the results for methylation status of the HPV16 LCR are controversial [5,8,9,12,16–19]. Moreover, only a few studies have
152
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
Fig. 1. HPV52 and HPV58 methylation status of the L1 gene in patients with cervicitis/CIN1, CIN2, and CIN3. HPV52 and HPV58 DNA was extracted from exfoliated cells and examined using bisulfite modification, PCR amplification, and sequencing. The average methylation percentages at each measured CpG site in the HPV52 L1 gene of DNA from exfoliated cervical cells of cervicitis/CIN1 (A), CIN2 (B), and CIN3 (C) are shown. The average methylation percentages at each measured CpG site in the HPV58 L1 gene of DNA from exfoliated cervical cells of cervicitis/CIN1 (D), CIN2 (E), and CIN3 (F) are shown. The number below the figure denotes the HPV52 and HPV58 genome position of the CpG sites.
investigated the HPV18 LCR. They concluded that the HPV18 LCR is methylated in cervical cancer, but not as consistently as the HPV18 L1 gene [20,22]. The reasons for the discrepancies between these observations are unknown, but they might have arisen from the variability in the CpG methylation assays that used different studies and sampling procedures, or inconsistent methylation status of individual CpG sites. Limitations of this study include small sample size and the sensitivity of colposcopy for finding precancerous lesions during follow-up [24,25]. Despite the limitations, our data demonstrated that: (i) increased methylation at CpG sites in the HPV52 and HPV58 L1 genes was correlated with the severity of cervical neoplasia; and (ii) the difference in methylation percentages in the HPV52 L1 gene
between regression and persistence/progression was significant. There was, however, no significant difference between regression and persistence/progression in the HPV58 L1 gene, possibly due to the small sample size. Our findings demonstrate a potential biomarker for cervical neoplasia, and need to be confirmed in a larger, multicenter study, combined with clinical follow-up data. New prognostic biomarkers have recently been investigated. Matsumoto et al. reported that genotype-specific HPV testing for women infected with HPV with CIN1 or CIN2 helped to predict the risk of disease persistence and progression [26]. Other studies reported that the incidence of p16INK4a-positive CIN1 is significantly higher in patients with disease progression compared with
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
153
A
Case Methylation frequencies (%)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
0 5 21 9 27 28 5 10 23 24 35 43 43 50 50
regression
persistence
progression 2
%
Average methylation percentages
B
4
6
8
10 12 14 16 18 20
30 months Cervicitis CIN1
100
CIN2 CIN3
90 80 70 60
p = 0.02
50 40 30 20 10 0
Fig. 2. (A and B) Prognosis of HPV52-positive patients with CIN1 (6 cases) and CIN2 (9 cases) who had not undergone any treatment was analyzed. The median follow-up period was 12.6 months (range 4–30 months). Methylation frequencies of HPV52 were defined as the average methylation frequencies at all measured CpG sites. Regression was defined as one negative histological result. Persistence was defined as several continually positive histological results of CIN1 or CIN2 for at least 1 year. Progression was defined as the appearance of histologically confirmed CIN3 during follow-up. White circles indicate cervicitis, black circles indicate CIN1, black squares indicate CIN2, and black diamonds indicate CIN3. The difference in methylation frequencies between regression and persistence/progression was significant (P = 0.02).
regression. They concluded that p16INK4a shows potential as a predictor of regression/progression of CIN1 [27–30]. In conclusion, in accordance with previous studies of the HPV16 L1 and HPV18 L1 genes, our study indicates that the methylation frequency of the HPV52 L1 and HPV58 L1 genes is correlated with the severity of cervical neoplasia. We and previous authors have demonstrated that HPV L1 gene methylation status may thus constitute a potential biomarker for detecting CIN2 and CIN3. In future, a cohort study combined with those potential biomarkers will be conducted. Subsequent studies of HPV genome methylation may have a considerable impact on the development of biomarkers.
ments. Isao Murakami analyzed the data and wrote the paper. All authors read and approved the final manuscript. Funding The authors received a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan (23791855, 23592462). Competing interests None declared.
Authors’ contributions Ethical approval Isao Murakami, Takuma Fujii, Akiko Ohno, Takashi Iwata, and Daisuke Aoki conceived and designed the experiments. Isao Murakami, Katsuaki Dan, and Miyuki Saito performed the experi-
This study was approved by an Institutional Ethical Committee (20-180).
154
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
References [1] Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, et al. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med 2003;348:518–27. [2] Masumoto N, Fujii T, Ishikawa M, Mukai M, Saito M, Iwata T, et al. Papanicolaou tests and molecular analyses using new fluid-based specimen collection technology in 3000 Japanese women. Br J Cancer 2003;88:1883–8. [3] Onuki M, Matsumoto K, Satoh T, Oki A, Okada S, Minaguchi T, et al. Human papillomavirus infections among Japanese women: age-related prevalence and type-specific risk for cervical cancer. Cancer Sci 2009;100:1312–6. [4] Stünkel W, Bernard HU. The chromatin structure of the long control region of human papillomavirus type 16 represses viral oncoprotein expression. J Virol 1999;73:1918–30. [5] Zhao W, Noya F, Chen WY, Townes TM, Chow LT, Broker T. Trichostatin a up-regulates human papillomavirus type 11 upstream regulatory region-E6 promoter activity in undifferentiated primary human keratinocytes. J Virol 1999;73:5026–33. [6] Hoelzer K, Shackelton LA, Parrish CR. Presence and role of cytosine methylation in DNA viruses of animals. Nucleic Acids Res 2008;36:2852–937. [7] Kalantari M, Calleja-Macias IE, Tewari D, Hagmar B, Lie K, Barrera-Saldana HA, et al. Conserved methylation patterns of human papillomavirus type 16 DNA in asymptomatic infection and cervical neoplasia. J Virol 2004;78:12762–72. [8] Turan T, Kalantari M, Calleja-Macias IE, Cubie HA, Cuscieri K, Villa LL, et al. Methylation of the human papillomavirus-18 L1 gene: a biomarker of neoplastic progression? Virology 2006;349:175–83. [9] Turan T, Kalantari M, Cuscieri K, Cubie HA, Skomedal H, Bernard HU. Highthroughput detection of human papillomavirus-18 L1 gene methylation, a candidate biomarker for the progression of cervical neoplasia. Virology 2007;361:185–93. [10] Ding DC, Chiang MH, Lai HC, Hsiung CA, Hsieh CY, Chu TY. Methylation of the long control region of HPV16 is related to the severity of cervical neoplasia. Eur J Obstet Gynecol Reprod Biol 2009;147:215–20. [11] Brandsma JL, Sun Y, Lizardi PM, Tuck DP, Zelterman D, Haines III GK, et al. Distinct human papillomavirus type 16 methylomes in cervical cells at different stages of premalignancy. Virology 2009;389:100–7. [12] Sun C, Reimers L, Burk RD. Methylation of HPV16 genome CpG sites is associated with cervix precancer and cancer. Gynecol Oncol 2011;121:59–63. [13] Piyathilake CJ, Macaluso M, Alvarez RD, Chen M, Badiga S, Edberg JC, et al. A higher degree of methylation of the HPV 16 E6 gene is associated with a lower likelihood of being diagnosed with cervical intraepithelial neoplasia. Cancer 2011;117:957–63. [14] Hong D, Ye F, Lu W, Hu Y, Wan X, Chen Y, et al. Methylation status of the long control region of HPV 16 in clinical cervical specimens. Mol Med Rep 2008;1:555–60. [15] Kalantari M, Villa LL, Calleja-Macias IE, Bernard HU. Human papillomavirus-16 and -18 in penile carcinomas: DNA methylation, chromosomal recombination and genomic variation. Int J Cancer 2008;123:1832–40. [16] Kalantari M, Lee D, Calleja-Macias IE, Lambert PF, Bernard HU. Effects of cellular differentiation, chromosomal integration and 5-aza-2 -deoxycytidine
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
treatment on human papillomavirus-16 DNA methylation in cultured cell lines. Virology 2008;374:292–303. Kalantari M, Chase DM, Tewari KS, Bernard HU. Recombination of human papillomavirus-16 and host DNA in exfoliated cervical cells: a pilot study of L1 gene methylation and chromosomal integration as biomarkers of carcinogenic progression. J Med Virol 2010;82:311–20. Badal V, Chuang LSH, Tan EHH, Badal S, Villa LL, Wheeler CM, et al. CpG methylation of human papillomavirus type 16 DNA in cervical cancer cell lines and in clinical specimens: genomic hypomethylation correlates with carcinogenic progression. J Virol 2003;77:6227–34. Kalantari M, Garcia-Carranca A, Morales-Vazquez CD, Zuna R, Montiel DP, Calleja-Macias IE, et al. Laser capture microdissection of cervical human papillomavirus infection: copy number of the virus in cancerous and normal tissue and heterogeneous DNA methylation. Virology 2009;380:261–7. Fernandez AF, Rosales C, Lopez-Nieva P, Grana O, Ballestar E, Ropero S, et al. The dynamic DNA methylomes of double-stranded DNA viruses associated with human cancer. Genome Res 2009;19:438–51. Bhattacharjee B, Sengupta S. CpG methylation of HPV 16 LCR at E2 binding site proximal to P97 is associated with cervical cancer in presence of intact E2. Virology 2003;77:6227–34. Badal S, Badal V, Calleja-Macias IE, Kalantari M, Chuang LSH, Li BFL, et al. The human papillomavirus-18 genome is efficiently targeted by cellular DNA methylation. Virology 2004;324:483–92. Satoh T, Matsumoto K, Fujii T, Sato O, Gemma N, Onuki M, et al. Rapid genotyping of carcinogenic human papillomavirus by loop-mediated isothermal amplification using a new automated DNA test (Clinichip HPV). J Virol Methods 2013;188:83–93. Pretorius RG, Zhang WH, Belinson JK, Huang MN, Wu LY, Zhang X, et al. Colposcopically directed biopsy, random cervical biopsy, and endocervical curettage in the diagnosis of cervical intraepithelial neoplasia II or worse. Am J Obstet Gynecol 2004;191:430–4. Gage JC, Hanson VW, Abbey K, Dippery S, Gardner S, Kubota J, et al. Number of cervical biopsies and sensitivity of colposcopy. Obstet Gynecol 2006;108:264–72. Matsumoto K, Oki A, Furuta R, Maeda H, Yasugi T, Takatsuka N, et al. Predicting the progression of cervical precursor lesions by human papillomavirus genotyping: a prospective cohort study. Int J Cancer 2011;128: 2898–910. Hariri J, Oster A. The negative predictive value of p16INK4a to assess the outcome of cervical intraepithelial neoplasia 1 in the uterine cervix. Int J Gynecol Pathol 2007;26:223–8. Negari G, Vittadello F, Romano F, Kasal A, Rivasi F, Girlando S, et al. p16INK4a expression and progression risk of low-grade intraepithelial neoplasia of the cervix uteri. Virchows Arch 2004;445:616–20. del Pino M, Garcia S, Fusté V, Alonso I, Fusté P, Torné A, et al. Value of p16INK4a as a marker of progression/regression in cervical intraepithelial neoplasia grade 1. Am J Obstet Gynecol 2009;201:488e1–7. Ozaki S, Zen Y, Inoue M. Biomarker expression in cervical intraepithelial neoplasia: potential progression predictive factors for low-grade lesions. Hum Pathol 2011;42:1007–12.
Contents lists available at SciVerse ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Methylation of human papillomavirus-52 and -58 is a candidate biomarker in cervical neoplasia Isao Murakami a , Takuma Fujii a,∗,1 , Katsuaki Dan b , Miyuki Saito a , Akiko Ohno a , Takashi Iwata a , Daisuke Aoki a a
Department of Obstetrics and Gynecology, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan Collaborative Research Resources, Core Instrumentation Facility, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan b
a r t i c l e
i n f o
Article history: Received 26 March 2013 Received in revised form 1 June 2013 Accepted 19 June 2013 Keywords: Biomarker Cervical neoplasia DNA methylation Human papillomavirus 52 Human papillomavirus 58
a b s t r a c t Background: Previous studies of human papillomavirus (HPV)16/18 genome methylation have concluded that methylation status of the L1 gene might act as a biomarker for cervical intraepithelial neoplasia (CIN). Objectives: We investigated the correlation between methylation status in the L1 gene and the long control region (LCR) of HPV52/58 and CIN. Study design: Exfoliated cervical cells were taken from 54 HPV52-positive and 41 HPV58-positive women. The HPV genome was examined using bisulfite modification, polymerase chain reaction amplification, and sequencing. Results: The CpGs were unmethylated or hypomethylated in the HPV52/58 LCR. In contrast, the methylation status of the HPV52 L1 gene was correlated with the severity of cervical neoplasia, with average percentages of 15%, 34%, and 52% for cervicitis/CIN1, CIN2, and CIN3, respectively (P < 0.05). Methylation status of the HPV52 L1 gene was also correlated with the prognosis of CIN1/2, with median percentages of 15% and 35% for regression and persistence/progression, respectively (P < 0.05). The methylation status of the HPV58 L1 gene was correlated with the severity of cervical neoplasia, with average percentages of 12%, 38%, and 61% for cervicitis/CIN1, CIN2, and CIN3, respectively (P < 0.05). Conclusions: The increased methylation at the CpG sites in the HPV52/58 L1 gene was correlated with the severity of cervical neoplasia, similar to HPV16/18 in previous studies. These data suggest that HPV methylation status of the L1 gene is a candidate biomarker of CIN for detecting CIN2 and CIN3. © 2013 Elsevier B.V. All rights reserved.
1. Background Cervical cancer is the second most common malignant tumor in women worldwide and is associated with persistent infection with high-risk human papillomavirus (HPV) [1]. High-risk HPV types are associated with 99% of all cervical carcinomas. Among these types, HPV16 and HPV18 account for about two-thirds of these malignant lesions worldwide [1]. The available prophylactic bivalent or quadrivalent vaccine is expected to reduced cervical cancer in ∼70% of women at present. However, other high-risk HPV types, such as HPV52 and HPV58, are one of the major causes of cervical
Abbreviations: CIN, cervical intraepithelial neoplasia; HPV, human papillomavirus; LCR, long control region; PCR, polymerase chain reaction. ∗ Corresponding author. Tel.: +81 3 3353 1211x62397; fax: +81 3 3226 1667. E-mail addresses: [email protected], [email protected] (T. Fujii). 1 Present address: Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, 1-98 Dengakugakubo, Kutsukake-cho, Toyoake, Aichi 470-1192, Japan. 1386-6532/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jcv.2013.06.026
intraepithelial neoplasia (CIN) and squamous cell carcinoma (SCC) in Asia, especially in Japan. Masumoto et al. performed HPV typing in 3000 Japanese women who attended hospital for cervical cancer screening, or follow-up or treatment of previous cervical neoplasia. HPV52 DNA was detected in 3.9% of patients with CIN1, 12.1% with CIN2, 22.0% with CIN3, and 7.1% with SCC [2]. Onuki et al. performed HPV typing in 2282 Japanese women who attended hospital for cervical cancer screening, treatment of cervical neoplasia, or for other reasons [3]. HPV52 DNA was detected in 9.4% of women with normal cytology, 11.4% with CIN1, 17.5% with CIN2 and CIN3, and 8.4% with SCC. HPV58 DNA was detected in 7.0% of women with normal cytology, 6.8% with CIN1, 10.7% with CIN2 and CIN3, and 3.1% with SCC. Currently, there is no prophylactic vaccine for HPV52 and HPV58. Therefore, it is important to investigate new diagnostic biomarkers for CIN caused by HPV52 and HPV58 to prevent cervical cancer. Epigenetic mechanisms, which influence chromatin conformations that favor or repress gene expression, have been shown to play a major role in modulating HPV transcription [4,5]. DNA methylation at CpG sites is one of several mechanisms that affect
150
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
chromatin conformation. Methylated CpG sites bind repressors that alter the conformation of nucleosomes through their interaction with histone deacetylases in a manner unfavorable to transcription. There is thus increasing interest in understanding the relationships between HPV DNA methylation and viral gene expression, viral life cycle, virus persistence and replicative behavior, and immune responses [6]. The methylation status of HPV16 and HPV18 has recently been studied by several groups investigating the HPV life cycle and potential new biomarkers [7–22]. In these previous studies, the L1 genes of HPV16 and HPV18 were shown to be hypermethylated in carcinomas, in contrast to their hypomethylated state in premalignant or HPV-positive lesions. They reported that increased methylation at CpG sites in the L1 genes of HPV16 and HPV18 is correlated with severity of cervical neoplasia. These findings suggest that the methylation status of the L1 gene may be a biomarker of clinical progression in HPV16- and HPV18-associated neoplastic lesions. So far, the methylation status of other HPV types, such as HPV52 and HPV58, has not been reported. 2. Objectives The methylation status of HPV52 and HPV58 was examined to establish whether it was correlated with the severity and regression or progression of cervical neoplasia. 3. Study design 3.1. Clinical specimens and HPV52/HPV58 DNA genotyping HPV52-infected women with diagnoses of cervicitis (n = 8), CIN1 (n = 9), CIN2 (n = 15), and CIN3 (n = 22) of the uterine cervix and HPV58-infected women with diagnoses of cervicitis (n = 10), CIN1 (n = 10), CIN2 (n = 9), and CIN3 (n = 12) of the uterine cervix were included. All 95 patients were recruited at the Department of Obstetrics and Gynecology, Keio University Hospital, Tokyo, Japan, between November 2006 and March 2010. Exfoliated cervical cells were treated with proteinase K and buffer containing 150 mM NaCl, 10 mM Tris–HCl (pH 8.0), 10 mM EDTA, and 0.1% sodium dodecyl sulfate for 1 h at 55 ◦ C, followed by overnight treatment at 37 ◦ C. DNA was then extracted by phenol/chloroform extraction followed by ethanol precipitation. HPV52 and HPV58 DNA detection was performed using the Clinichip HPV (Sekisui Medical, Tokyo, Japan) [23]. 3.2. Bisulfite modification DNA samples extracted from exfoliated cells were modified using the DNA Methylation-Gold Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. The converted DNA was eluted with 30 L TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA). The bisulfite-modified DNA was stored at −20 ◦ C until use. 3.3. Amplification of bisulfite-treated DNA and DNA sequencing Six primer pairs were designed to amplify the bisulfitemodified HPV52 containing part of the L1 gene or the long control region (LCR), and seven primer pairs were designed to amplify the bisulfite-modified HPV58 containing part of the L1 gene or LCR, using the MethPrimer Design program (http://www.urogene.org/methprimer/index1.html). The primers are listed in Table 1. Twenty-six CpG sites in the HPV52 L1 gene, 15 in the HPV52 LCR, 25 in the HPV58 L1 gene, and eight in the HPV58 LCR were included. Polymerase chain reaction (PCR) was performed using the bisulfite-modified DNA samples in a final volume of 50 L. The PCR amplification conditions for each primer set were optimized for MgCl2 concentration (2.0–4.0 mM) and annealing and
elongation temperature (54 or 60 ◦ C). Each PCR contained 1.25 U AmpliTaq Gold (Roche Applied Science, Indianapolis, IN, USA). The PCR conditions were 95 ◦ C for 10 min, followed by five cycles of 1 min at 95 ◦ C, 2 min at 54 or 60 ◦ C, and 3 min at 72 ◦ C, and 35 cycles of 1 min at 95 ◦ C, 2 min at 60 ◦ C, and 2 min at 72 ◦ C. A final extension step was performed for 10 min at 72 ◦ C. PCRs were performed in a Veriti 96-Well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). The presence of each PCR product was verified by electrophoresis in ethidium-bromide-stained agarose gels. PCR products were sequenced by Big Dye Terminator v3.1 Cycle Sequencing (Applied Biosystems), which shows cytosine if the original cytosine is methylated, or thymine if the original cytosine is unmethylated. To determine that CpG sites were methylated or unmethylated, the PCR products were sequenced in both directions. 3.4. Follow-up study Follow-up data for patients with CIN1 and CIN2 who had not undergone any treatments were examined retrospectively. Followup visits occurred every 4–6 months and histology, cytology, and colposcopy examinations were performed at each visit. If cytology was abnormal, the patients had colposcopically directed biopsy in their following visit, even if the colposcopic impression was normal in the previous visit. Regression was defined as one negative histological result. Persistence was defined as several continually positive histological results indicating CIN1 or CIN2 for at least 1 year. Progression was defined as the appearance of histologically confirmed CIN3 during follow-up. 3.5. Statistical analysis Differences were analyzed using two-sided Student’s t tests. Differences with P < 0.05 were considered significant. 4. Results 4.1. HPV52 and HPV58 methylation status of the L1 gene and LCR Five CpGs in the HPV52 L1 gene (positions 5730, 5763, 5884, 5972, and 6883), two CpGs in the HPV52 LCR (positions 7557 and 7563), three CpGs in the HPV58 L1 gene (positions 5730, 6868, and 7035), and three CpGs in the HPV58 LCR (positions 7489, 7495, and 7511) could not be amplified by PCR. Therefore, we determined the methylation frequencies at each of the 21 CpG sites in the HPV52 L1 gene, 13 in the HPV52 LCR, 22 in the HPV58 L1 gene, and five in the HPV58 LCR. The average methylation percentages at each measured CpG site in the HPV52/HPV58 L1 gene in DNA from exfoliated cervical cells from patients with cervicitis/CIN1 (A/D), CIN2 (B/E), and CIN3 (C/F) are shown in Fig. 1. The average methylation percentages at all measured CpG sites in the HPV52/HPV58 L1 gene and the LCR in DNA from exfoliated cervical cells from patients with cervicitis/CIN1, CIN2, and CIN3 are shown in Table 2. As shown in Fig. 1 and Table 2, CpGs were hypermethylated in the HPV52 and HPV58 L1 gene with increasing cervical dyskaryosis. The average percentages of all CpGs that were methylated in the HPV52 L1 gene were 15% (range 0–43%) for cervicitis/CIN1, 34% (range 0–83%) for CIN2, and 52% (range 8–85%) for CIN3 (Fig. 1 and Table 2A). The average percentages of all CpGs that were methylated in the HPV58 L1 gene were 12% (range 0–61%) for cervicitis/CIN1, 38% (range 0–100%) for CIN2, and 61% (range 11–100%) for CIN3 (Fig. 1 and Table 2B). The methylation percentages at each CpG site in the HPV52 and HPV58 L1 genes differed significantly among different grades of cervical neoplasia (P < 0.05). However, the average percentages of all CpGs that were methylated in the HPV52 LCR were 2.5% (range 0–16%) for cervicitis/CIN1, 1.3% (range 0–16%) for CIN2, and 3.2% (range 0–25%) for CIN3 (Table 2A). The CpG sites were unmethylated in
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
151
Table 1 PCR primers for amplification of bisulfite-converted HPV52 (A) and HPV58 (B). A Pairs 1 2 3 4 5 6
Positiona
Sequence
PCR amplicon (bps)
FW: 5514–5543 RV: 5656–5680 FW: 6220–6249 RV: 6444–6469 FW: 6496–6525 RV: 6836–6863 FW: 7024–7053 RV: 7197–7226 FW: 7632–7656 RV: 7839–7868 FW: 7838–7867 RV: 97–122
TTTTTTTTGTTTTTATAGTTTTTATAGTTT AAATACACAATAACCTCACTAAACC TTATTAATAGTGTAATATAGGATGGGGATA CCTAACACAAAATCACCTAAAATACC TTGGTAATATTGTTATTGTATAAAGTAGTG TTACCAATCCTCTAAAATAATAACATCC TAGATTTAGATTAGTTTTTTTTAGGTAGAA TAATTACCTTTTAACCTATTTTTAACATAC ATTGTTTAATTTTTTGGTTTTTTGT ATTCAATTATATTTTACAAAACATATTTAA GTTAAATATGTTTTGTAAAATATAATTGAA TATTACTAAATCCTCAAACATAACC
167
Positionb
Sequence
PCR amplicon (bps)
FW: 5538–5568 RV: 5680–5704 FW: 5752–5777 RV: 5956–5981 FW: 5954–5971 RV: 6135–6159 FW: 6351–6377 RV: 6595–6619 FW: 6610–6637 RV: 6822–6845 FW: 7054–7082 RV: 7250–7278 FW: 7725–7854 RV: 85–109
AATTTTTTTTAATATTATAATTGTGGATGG ACCTTAAACACAAACACAAAAAACA TTGGTAGTTTTAGATTTTTGGTTGTT TAACTATCCCCTACCTATTTCAAAAC AGGTTTTGAAATAGGTAGGGGATAGT CTTTACCCCAATACTCACCAATAAA TGGTTAGTGAATTTTATGGGGATAG ACCCCAACAAATACCATTATTATAAC TTGTTGGGGTAATTAGTTATTTGTTAT ACCAATCCTCCAAAATATTAAAATC AGGTTTTAAAGTAAAGTTTAGATTAAAA AAAAACTAACAAAAACATAAAACATATAC TAAATTATGTTTTGTAAAAGTGATTTATTA TAATCCTACAATAACCTACCAAAAA
166
250 368 203 237 227
B Pairs 1 2 3 4 5 6 7
230 206 269 236 225 209
FW, forward primer; RV, reverse primer. a Nucleotide number in the HPV52 genome (GenBank accession no. X74481). b Nucleotide number in the HPV58 genome (GenBank accession no. D90400).
the HPV58 LCR (Table 2B). There were no significant differences in methylation percentages in both the HPV52 and HPV58 LCRs among different grades of cervical neoplasia. 4.2. Correlation between prognosis of cervical neoplasia and methylation status of the HPV L1 gene
CpG sites that were methylated in the HPV52 L1 gene in patients with CIN1 and CIN2 were 15% (range 0–28%) and 35% (range 5–50%), for regression and persistence/progression, respectively (Fig. 2B). The difference in methylation percentages between regression and persistence/progression was significant (P = 0.02). 5. Discussion
We investigated the correlation between the prognosis of cervical neoplasia and the methylation status of the HPV52 L1 gene. Among all 55 patients, six clinical cases of HPV52-positive CIN1 and nine HPV52-positive CIN2 cases, who had not undergone any treatment, were analyzed (Fig. 2A). The median follow-up period was 12.6 months (range 4–30 months). The median percentages of all Table 2 HPV52 (A) and HPV58 (B) methylation status. A L1 gene (%) Cervicitis & CIN1 (n = 17) CIN2 (n = 15) CIN3 (n = 22)
*
LCR (%)
15 34* 52*
2.5 1.3 3.2
L1 gene (%)
LCR (%)
12† 38† 61†
0 0 0
B
Cervicitis & CIN1 (n = 20) CIN2 (n = 9) CIN3 (n = 12)
Methylation status of HPV52 and HPV58 are defined as the average methylation percentages at all measured CpG sites. * P < 0.05 (Student’s t test). † P < 0.05 (Student’s t test).
Increasing epidemiological, etiological and molecular data suggest that high-risk HPV types are biologically distinct and may confer different pathogenic risks. Moreover, the prophylactic bivalent or quadrivalent vaccines protect women from infection with HPV16 and HPV18. It is therefore necessary to investigate not only HPV16 and HPV18, but also other high-risk HPV types to elucidate the HPV life cycle fully and to discover new biomarkers. The current study investigated the correlation between the methylation status of HPV52 and HPV58, which are major causes of CIN and SCC in Japan, and cervical neoplasia in clinical specimens. To the best of our knowledge, this is the first study to investigate the methylation status of HPV52 and HPV58. Previous studies found significantly higher methylation status of HPV16 and HPV18 L1 genes in CIN3 compared with clinical specimens with cervicitis, CIN1, and CIN2 [5–7,9,10,15]. We found that increased methylation at CpG sites in the HPV52 and HPV58 L1 genes was correlated with the severity of cervical neoplasia; similar to HPV16 and HPV18. These data suggest that HPV methylation status of the L1 gene is a candidate biomarker for detecting CIN2 and CIN3. In contrast, methylation at CpG sites in the HPV52 and HPV58 LCRs was unrelated to the severity of cervical neoplasia. Although the HPV LCR plays an important role in the regulation of viral gene expression, the results for methylation status of the HPV16 LCR are controversial [5,8,9,12,16–19]. Moreover, only a few studies have
152
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
Fig. 1. HPV52 and HPV58 methylation status of the L1 gene in patients with cervicitis/CIN1, CIN2, and CIN3. HPV52 and HPV58 DNA was extracted from exfoliated cells and examined using bisulfite modification, PCR amplification, and sequencing. The average methylation percentages at each measured CpG site in the HPV52 L1 gene of DNA from exfoliated cervical cells of cervicitis/CIN1 (A), CIN2 (B), and CIN3 (C) are shown. The average methylation percentages at each measured CpG site in the HPV58 L1 gene of DNA from exfoliated cervical cells of cervicitis/CIN1 (D), CIN2 (E), and CIN3 (F) are shown. The number below the figure denotes the HPV52 and HPV58 genome position of the CpG sites.
investigated the HPV18 LCR. They concluded that the HPV18 LCR is methylated in cervical cancer, but not as consistently as the HPV18 L1 gene [20,22]. The reasons for the discrepancies between these observations are unknown, but they might have arisen from the variability in the CpG methylation assays that used different studies and sampling procedures, or inconsistent methylation status of individual CpG sites. Limitations of this study include small sample size and the sensitivity of colposcopy for finding precancerous lesions during follow-up [24,25]. Despite the limitations, our data demonstrated that: (i) increased methylation at CpG sites in the HPV52 and HPV58 L1 genes was correlated with the severity of cervical neoplasia; and (ii) the difference in methylation percentages in the HPV52 L1 gene
between regression and persistence/progression was significant. There was, however, no significant difference between regression and persistence/progression in the HPV58 L1 gene, possibly due to the small sample size. Our findings demonstrate a potential biomarker for cervical neoplasia, and need to be confirmed in a larger, multicenter study, combined with clinical follow-up data. New prognostic biomarkers have recently been investigated. Matsumoto et al. reported that genotype-specific HPV testing for women infected with HPV with CIN1 or CIN2 helped to predict the risk of disease persistence and progression [26]. Other studies reported that the incidence of p16INK4a-positive CIN1 is significantly higher in patients with disease progression compared with
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
153
A
Case Methylation frequencies (%)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
0 5 21 9 27 28 5 10 23 24 35 43 43 50 50
regression
persistence
progression 2
%
Average methylation percentages
B
4
6
8
10 12 14 16 18 20
30 months Cervicitis CIN1
100
CIN2 CIN3
90 80 70 60
p = 0.02
50 40 30 20 10 0
Fig. 2. (A and B) Prognosis of HPV52-positive patients with CIN1 (6 cases) and CIN2 (9 cases) who had not undergone any treatment was analyzed. The median follow-up period was 12.6 months (range 4–30 months). Methylation frequencies of HPV52 were defined as the average methylation frequencies at all measured CpG sites. Regression was defined as one negative histological result. Persistence was defined as several continually positive histological results of CIN1 or CIN2 for at least 1 year. Progression was defined as the appearance of histologically confirmed CIN3 during follow-up. White circles indicate cervicitis, black circles indicate CIN1, black squares indicate CIN2, and black diamonds indicate CIN3. The difference in methylation frequencies between regression and persistence/progression was significant (P = 0.02).
regression. They concluded that p16INK4a shows potential as a predictor of regression/progression of CIN1 [27–30]. In conclusion, in accordance with previous studies of the HPV16 L1 and HPV18 L1 genes, our study indicates that the methylation frequency of the HPV52 L1 and HPV58 L1 genes is correlated with the severity of cervical neoplasia. We and previous authors have demonstrated that HPV L1 gene methylation status may thus constitute a potential biomarker for detecting CIN2 and CIN3. In future, a cohort study combined with those potential biomarkers will be conducted. Subsequent studies of HPV genome methylation may have a considerable impact on the development of biomarkers.
ments. Isao Murakami analyzed the data and wrote the paper. All authors read and approved the final manuscript. Funding The authors received a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan (23791855, 23592462). Competing interests None declared.
Authors’ contributions Ethical approval Isao Murakami, Takuma Fujii, Akiko Ohno, Takashi Iwata, and Daisuke Aoki conceived and designed the experiments. Isao Murakami, Katsuaki Dan, and Miyuki Saito performed the experi-
This study was approved by an Institutional Ethical Committee (20-180).
154
I. Murakami et al. / Journal of Clinical Virology 58 (2013) 149–154
References [1] Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, et al. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med 2003;348:518–27. [2] Masumoto N, Fujii T, Ishikawa M, Mukai M, Saito M, Iwata T, et al. Papanicolaou tests and molecular analyses using new fluid-based specimen collection technology in 3000 Japanese women. Br J Cancer 2003;88:1883–8. [3] Onuki M, Matsumoto K, Satoh T, Oki A, Okada S, Minaguchi T, et al. Human papillomavirus infections among Japanese women: age-related prevalence and type-specific risk for cervical cancer. Cancer Sci 2009;100:1312–6. [4] Stünkel W, Bernard HU. The chromatin structure of the long control region of human papillomavirus type 16 represses viral oncoprotein expression. J Virol 1999;73:1918–30. [5] Zhao W, Noya F, Chen WY, Townes TM, Chow LT, Broker T. Trichostatin a up-regulates human papillomavirus type 11 upstream regulatory region-E6 promoter activity in undifferentiated primary human keratinocytes. J Virol 1999;73:5026–33. [6] Hoelzer K, Shackelton LA, Parrish CR. Presence and role of cytosine methylation in DNA viruses of animals. Nucleic Acids Res 2008;36:2852–937. [7] Kalantari M, Calleja-Macias IE, Tewari D, Hagmar B, Lie K, Barrera-Saldana HA, et al. Conserved methylation patterns of human papillomavirus type 16 DNA in asymptomatic infection and cervical neoplasia. J Virol 2004;78:12762–72. [8] Turan T, Kalantari M, Calleja-Macias IE, Cubie HA, Cuscieri K, Villa LL, et al. Methylation of the human papillomavirus-18 L1 gene: a biomarker of neoplastic progression? Virology 2006;349:175–83. [9] Turan T, Kalantari M, Cuscieri K, Cubie HA, Skomedal H, Bernard HU. Highthroughput detection of human papillomavirus-18 L1 gene methylation, a candidate biomarker for the progression of cervical neoplasia. Virology 2007;361:185–93. [10] Ding DC, Chiang MH, Lai HC, Hsiung CA, Hsieh CY, Chu TY. Methylation of the long control region of HPV16 is related to the severity of cervical neoplasia. Eur J Obstet Gynecol Reprod Biol 2009;147:215–20. [11] Brandsma JL, Sun Y, Lizardi PM, Tuck DP, Zelterman D, Haines III GK, et al. Distinct human papillomavirus type 16 methylomes in cervical cells at different stages of premalignancy. Virology 2009;389:100–7. [12] Sun C, Reimers L, Burk RD. Methylation of HPV16 genome CpG sites is associated with cervix precancer and cancer. Gynecol Oncol 2011;121:59–63. [13] Piyathilake CJ, Macaluso M, Alvarez RD, Chen M, Badiga S, Edberg JC, et al. A higher degree of methylation of the HPV 16 E6 gene is associated with a lower likelihood of being diagnosed with cervical intraepithelial neoplasia. Cancer 2011;117:957–63. [14] Hong D, Ye F, Lu W, Hu Y, Wan X, Chen Y, et al. Methylation status of the long control region of HPV 16 in clinical cervical specimens. Mol Med Rep 2008;1:555–60. [15] Kalantari M, Villa LL, Calleja-Macias IE, Bernard HU. Human papillomavirus-16 and -18 in penile carcinomas: DNA methylation, chromosomal recombination and genomic variation. Int J Cancer 2008;123:1832–40. [16] Kalantari M, Lee D, Calleja-Macias IE, Lambert PF, Bernard HU. Effects of cellular differentiation, chromosomal integration and 5-aza-2 -deoxycytidine
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
treatment on human papillomavirus-16 DNA methylation in cultured cell lines. Virology 2008;374:292–303. Kalantari M, Chase DM, Tewari KS, Bernard HU. Recombination of human papillomavirus-16 and host DNA in exfoliated cervical cells: a pilot study of L1 gene methylation and chromosomal integration as biomarkers of carcinogenic progression. J Med Virol 2010;82:311–20. Badal V, Chuang LSH, Tan EHH, Badal S, Villa LL, Wheeler CM, et al. CpG methylation of human papillomavirus type 16 DNA in cervical cancer cell lines and in clinical specimens: genomic hypomethylation correlates with carcinogenic progression. J Virol 2003;77:6227–34. Kalantari M, Garcia-Carranca A, Morales-Vazquez CD, Zuna R, Montiel DP, Calleja-Macias IE, et al. Laser capture microdissection of cervical human papillomavirus infection: copy number of the virus in cancerous and normal tissue and heterogeneous DNA methylation. Virology 2009;380:261–7. Fernandez AF, Rosales C, Lopez-Nieva P, Grana O, Ballestar E, Ropero S, et al. The dynamic DNA methylomes of double-stranded DNA viruses associated with human cancer. Genome Res 2009;19:438–51. Bhattacharjee B, Sengupta S. CpG methylation of HPV 16 LCR at E2 binding site proximal to P97 is associated with cervical cancer in presence of intact E2. Virology 2003;77:6227–34. Badal S, Badal V, Calleja-Macias IE, Kalantari M, Chuang LSH, Li BFL, et al. The human papillomavirus-18 genome is efficiently targeted by cellular DNA methylation. Virology 2004;324:483–92. Satoh T, Matsumoto K, Fujii T, Sato O, Gemma N, Onuki M, et al. Rapid genotyping of carcinogenic human papillomavirus by loop-mediated isothermal amplification using a new automated DNA test (Clinichip HPV). J Virol Methods 2013;188:83–93. Pretorius RG, Zhang WH, Belinson JK, Huang MN, Wu LY, Zhang X, et al. Colposcopically directed biopsy, random cervical biopsy, and endocervical curettage in the diagnosis of cervical intraepithelial neoplasia II or worse. Am J Obstet Gynecol 2004;191:430–4. Gage JC, Hanson VW, Abbey K, Dippery S, Gardner S, Kubota J, et al. Number of cervical biopsies and sensitivity of colposcopy. Obstet Gynecol 2006;108:264–72. Matsumoto K, Oki A, Furuta R, Maeda H, Yasugi T, Takatsuka N, et al. Predicting the progression of cervical precursor lesions by human papillomavirus genotyping: a prospective cohort study. Int J Cancer 2011;128: 2898–910. Hariri J, Oster A. The negative predictive value of p16INK4a to assess the outcome of cervical intraepithelial neoplasia 1 in the uterine cervix. Int J Gynecol Pathol 2007;26:223–8. Negari G, Vittadello F, Romano F, Kasal A, Rivasi F, Girlando S, et al. p16INK4a expression and progression risk of low-grade intraepithelial neoplasia of the cervix uteri. Virchows Arch 2004;445:616–20. del Pino M, Garcia S, Fusté V, Alonso I, Fusté P, Torné A, et al. Value of p16INK4a as a marker of progression/regression in cervical intraepithelial neoplasia grade 1. Am J Obstet Gynecol 2009;201:488e1–7. Ozaki S, Zen Y, Inoue M. Biomarker expression in cervical intraepithelial neoplasia: potential progression predictive factors for low-grade lesions. Hum Pathol 2011;42:1007–12.