- Email: [email protected]
Methylation of neurofilament light polypeptide promoter is associated with cell invasion and metastasis in NSCLC
Biochemical and Biophysical Research Communications 470 (2016) 627e634
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Methylation of neurofilament light polypeptide promoter is associated with cell invasion and metastasis in NSCLC Zhuojian Shen a, b, 1, Baishen Chen a, b, 1, Xiangfeng Gan g, Weicheng Hu f, Guangzheng Zhong e, Haifeng Li c, Xuan Xie a, b, Yeqing Liu c, Haigang Li c, Xia Xu a, b, Zhiquan Huang d, *, Ju Chen a, b, ** a
Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Department of Thoracic Surgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120, PR China Lung Cancer Research Center of Sun Yat-Sen University, Sun Yat-Sen University, Guangzhou 510275, PR China c Department of Pathology, Sun Yat-Sen Memorial Hospital, Guangzhou 510120, PR China d Department of Oral and Maxillofacial Surgery, Sun Yat-Sen Memorial Hospital, Guangzhou 510120, PR China e Department of Urology Surgery, Sun Yat-Sen Memorial Hospital, Guangzhou 510120, PR China f Department of Thoracic Surgery, Zengcheng People's Hospital, Sun Yat-Sen University, Zengcheng 511330, PR China g Department of Thoracic Surgery, General Hospital of Ningxia Medical University, Ningxia Medical University, Yinchuan 750004, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 January 2016 Accepted 15 January 2016 Available online 20 January 2016
The role of NEFL in NSCLC remains largely unknown. Immunohistochemistry was performed to investigate the expression of NEFL in 108 lung cancer specimens. NEFL expression was associated with decreased lymph node metastases and favorable prognosis. Furthermore, real-time PCR and Western blot were used to investigate the expression of the NEFL gene in NSCLC cell lines. Subsequently, lentivirusmediated RNA interference and overexpression were used to demonstrate that knocked-down of NEFL enhanced the invasion and migration of A549 and H460 NSCLC cells, whereas NEFL overexpression resulted in a suppression of the invasion and migration of GLC-82 and L78 cells in vitro. In addition, bisulfite sequence PCR assay demonstrated that NEFL downregulation was associated with promoter methylation, and NEFL expression was restored after treatment with 5-Aza-dC. Finally, we demonstrated that NEFL inhibited the NF-kB pathway, thereby suppressing the expression of uPA and decreasing NSCLC invasiveness and migration. Our studies suggest that NEFL methylation is a novel mechanism for NSCLC invasion and metastasis and that NEFL may represent a candidate biomarker for recurrence and survival in patients with NSCLC. © 2016 Elsevier Inc. All rights reserved.
Keywords: NEFL NSCLC methylation NF-kB uPA
1. Introduction The majority of lung cancers (56%) are diagnosed during the late stages of disease because early disease is typically asymptomatic; only 15% of cases are diagnosed at a local stage [1]. Surgical resection, when possible, remains the only curative treatment for early stage NSCLC. However, nearly 50% of resected patients
* Corresponding author. ** Corresponding author. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Department of Thoracic Surgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120, PR China. E-mail addresses: [email protected] (Z. Huang), dydchenju@163. com (J. Chen). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.bbrc.2016.01.094 0006-291X/© 2016 Elsevier Inc. All rights reserved.
experience recurrence and have a dismal prognosis [2]. Tumor cell invasion and metastasis may occur in the early stages of disease, making the current multimodality therapy ineffective. Therefore, searching for novel diagnostic and therapeutic strategies would be helpful to improve the survival rate. The mechanisms underlying the invasiveness and metastasis of lung cancer are not fully understood. Many factors, including tumor suppressors and oncogenes, are involved in pulmonary tumorigenesis or progression. Inactivation of tumor suppressor genes (TSGs) by promoter CpG island hypermethylation contributes to tumor initiation and progression, and methylated DNA is a potential source of cancer-specific biomarkers for clinical assessment [3]. Our previous studies on differentially hypermethylated genes in human head and neck cancer (HNC) used DNA microarray analysis to identify a set of genes differentially expressed between cisplatin-
628
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
sensitive and cisplatin-resistant HNC cell lines. Among those genes, neurofilament light polypeptide (NEFL) was selected for analysis due to its chromosome location of 8p21, a genetic locus previously reported to be rich in TSGs. Frequent deletion of chromosome 8p has been observed in several common cancers, including HNC and lung cancer [4,5]. The NEFL gene encodes the light subunit of neurofilaments, which functionally maintain neuronal caliber and play an important role in intracellular transport to axons and dendrites [6]. Mutations in NEFL cause Charcot-Marie-Tooth(CMT) disease types 1F and 2E [7]. Our previous study was the first study to demonstrate the role of NEFL in malignant tumors. We found that NEFL methylation was a novel mechanism for HNC chemoresistance [8] and might play a role in HNC cancer cell apoptosis and invasion [9]. Our findings confirmed that NEFL is associated with tumor progress. However, the mechanism of action of NEFL in NSCLC invasion and metastasis remains poorly characterized. In this study, we further examined NEFL methylation and expression in a panel of NSCLC cell lines and patient tumors. We also investigated the functional role of NEFL and its potential mechanisms of action in NSCLC invasion and migration. Taken together, our results suggest that promoter hypermethylationmediated silencing of NEFL is a novel mechanism underlying NSCLC invasion and migration. Furthermore, methylated NEFL may represent a candidate biomarker predictive of metastasis and survival in patients with NSCLC. 2. Materials and methods 2.1. Patient samples 108 paraffin-embedded specimens of NSCLC were collected from 2004 to 2008 at the department of Pathology, Sun Yat-Sen Memorial Hospital. The diagnoses were determined according to the criteria of the World Health Organization classification and were classified according to the NCCN TNM classification criteria (2015). The study was approved by the Institutional Research Ethics Committee of Sun Yat-Sen Memorial Hospital at Sun Yat-Sen University. Consent was obtained from the patients and the clinical research materials were collected from the patients prior to clinical treatment. Clinicopathologic features of all patients were described in Supplementary Table S1 and S2. 2.2. Cell culture and drug treatment A total of 5 NSCLC cell lines were used in this study; all cell lines were kindly provided by the Department of Thoracic Surgery, Sun Yat-Sen University Cancer Center (Guangzhou, China). These cell lines were cultured according to supplier's instructions. For experiments with 5-Aza-2'-deoxycytidine (5-Aza-dC), cells were incubated with media containing 5 mM 5-Aza-dC for 96 h.
cell lines using an EZ DNA Methylation-Gold Kit (ZYMO Research, Irvine, CA, USA) according to the standard protocol from the manufacturer. The methylation status of individual CpG islands in the 50 flanking genomic regions (þ514 to þ871) of the NEFL gene in 4 cell lines was determined by plasmid cloning and bisulfite DNA sequencing. Bisulfite-treated DNA samples (1 ml) from each of above cell lines were amplified in 50-ml PCR reactions according to the protocol (EpiTaq™ HS, TaKaRa, Otsu, Japan). Primers for the amplification of the NEFL transcript were as follows: forward, TGTTGTAGTTATTTTTTTAGTTTTGGAT; and reverse, TACACAAAATCTCCTCCAACCCTTC. PCR amplification was performed for 40 cycles of 98 C for 30 s, 55 C for 30 s, and 72 C for 30 s, with 5 min at 95 C for initial denaturation and 5 min at 72 C for final elongation. PCR products were verified by ethidium bromide staining, and 1 mL of the products was cloned into a pMD19-T Vector according to the protocol (pMD19-T Vector Cloning Kit, TaKaRa, Otsu, Japan). Ten clones from each cell line were selected for sequencing. 2.5. Lentiviral infection Short hairpin RNA (shRNA), including sh-NEFL1, sh-NEFL2 (SigmaeAldrich, St. Louis., MO, USA) and the negative control, were cloned into GV248 lentiviral vectors (Genechem, Shanghai, China). Subsequently, the constructed GV248 vectors and the packaging plasmids pMD2.G and psPAX2 were used to co-transfect the 293T packing cells with X-treme GENE HP DNA Transfection Reagent (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer's protocols. The medium was refreshed 24 h after transfection, and the cells were cultured for an additional 24 h. Conditioned medium was collected and cleared of debris by filtering through a 0.45 mm filter (Millipore, Bedford, MA, USA). The NEFL overexpression construct and the negative control (LV6) were individually subcloned into lentivirus vector LV6 (Genepharma, Jiangsu, China). After infection of the lentivirus, the cells were selected with 2 mg/mL puromycin (SigmaeAldrich) for 2 weeks. The knockdown efficiency was assessed using RT-PCR and Western blotting. 2.6. Wound-healing assay Culture cells were grown to confluent monolayer in six-well plates using medium containing 10% fetal bovine serum (FBS). Then the medium was replaced with FBS-free media, and the monolayer cells were wounded with 200 mL tip. At the indicated times (0 and 48 h) after scraping, the cells were washed twice in PBS, and the migration of cells into the wound zone was observed. The uncovered area was analyzed using Image-pro Plus 5.0 software (Media Cybernetics, Silver Spring, MD, USA). 2.7. In vitro migration and invasion assays
2.3. Immunohistochemistry Immunohistochemistry and the evaluations of the stained tissue sections were performed as previously described [10]. Sections of human lung tissues staining positive with NEFL polyclonal rabbit antibody (1:100; BIOWORLD, MN, USA) were used as the positive control for NEFL, and Phosphate Buffered Saline (PBS) was used instead of the primary antibody for the negative control. 2.4. Methylation analysis Genomic DNA from A549, H460, GLC-82 and L78 cell lines were included in BSP analysis. Methylation analysis of the 50 genomic DNA sequences was conducted on bisulfite-converted DNA from
For the transwell migration assays, 5 104 cells were plated in the top chamber of each insert (Corning, Corning, New York, US). For the invasion assays, 3 104 cells were plated in the upper chamber of each insert, which were previously been coated with 150 mg of Matrigel (BD Biosciences, Oakville, Ontario, Canada). The cells in both assays were trypsinised and resuspended in FBS-free medium. Six hundred microliters of medium supplemented with 10% FBS or 20% FBS was added to the lower chambers in the migration assay wells or invasion assay wells, respectively. After incubation of the migration and invasion assays at 37 C for 12 h or 24 h, respectively, the cells remaining in the top chambers or on the upper membranes of the inserts were removed, and the cells that had migrated or invaded into the lower chambers were fixed and
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
629
stained with a solution of 0.1% crystal violet and 4% paraformaldehyde. The migrating and invading cells were imaged and counted using an IX71 inverted microscope (Olympus, Tokyo, Japan). 2.8. RNA extraction and RT-PCR RNA extraction and RT-PCR were performed as previously described [8]. Primers for NEFL and GAPDH were as follows: 50 TCAACGTGAAGATGGCTTTG -30 , 50 -AGCGGGTGGACATCAGATAG-30 , and 50 -ACAACTTTGGTATCGTGGAAGG-30 , 50 -GCCATCACGCCACAGTTTC-3’. 2.9. Western blot analysis Western blot analysis was performed as previously described [8]. The anti-NEFL antibody (CST, Boston, Massachusetts, USA), NfkB (including p65 and phospho-p65, Gene Tex, Irvine, California, US), anti-uPA antibody (Gene Tex, Irvine, California, US) were used to probe the alterations of the protein. GAPDH (CST, Boston, Massachusetts, USA) and PAPR (CST, Boston, Massachusetts, USA) were used as cytoplasm and nucleus protein loading controls, respectively. 2.10. Enzyme-linked immunosorbent assays (ELISA) Cells for assessment were incubated in 6-well plates for 24 h, the supernatant of the culture medium of the NSCLC cells was collected and centrifuged at 1000 g for 20min in room temperature. The uPA concentrations in the supernatant of the culture medium were quantified using an uPA ELISA Kit (Cloud-clone Corp, Houston, TX, USA) according to the manufacturers' recommended protocols. The sample analyses were executed in triplicate and were repeated a minimum of three times. 2.11. Statistical analysis All data were presented as the mean ± standard deviation (SD). The associations between NEFL and clinicopathological parameters were assessed using the c2-test and Fisher's exact test. Prognostic value of NEFL expression for patient survivals was assessed by KaplaineMeier analysis. Multivariable and univariate overall survival analyses were performed with the Cox proportional hazards model. The other datas were analyzed with Student's t-test, and pvalues <0.05 were considered significant. All statistical analyses were performed with the SPSS program package 17.0 (SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Downregulation of NEFL was associated with lymph node metastases in primary NSCLC tumors and was closely correlated with poor prognosis of NSCLC patients To observe NEFL expression in primary tumors, we performed IHC staining using an NEFL-specific antibody on primary tumor tissues from 108 patients with NSCLC (Fig. 1AeD). NEFL expression was detected in 26.13% of the tumor tissues (23/108), and 73.87% of the tumor tissues were negative for NEFL expression. The downregulation of NEFL was closely associated with lymphatic metastasis. In NEFL-positive cases, only 21.74% (5/23) of the patients exhibited lymph node metastasis, whereas 56.47% (48/85) of cases with weak NEFL staining were node-negative. The IHC revealed a statistically significant correlation between higher protein expression and negative nodal status (p ¼ 0.003). No significant
Fig. 1. Representative images of NEFL immunohistochemical staining. Positive staining of NEFL in (A)squamous cell carcinoma, (B)adenocarcinoma, (C) negative control (without NEFL antibody) pattern and (D)positive control (scale bar: 50 mm). (E) The survival analysis of NEFL. Higher NEFL expression in tumor tissue was closely correlated with favorable overall survival (p ¼ 0.005).
association was detected between NEFL expression and other clinicopathological characteristics, including patient gender, smoking history, histologic type, stage, differentiation or tumor diameter (Supplementary Table S2). To examine the relationship between NEFL expression and the clinical prognosis of NSCLC patients, we conducted survival analyses using univariate and multivariate Cox's proportional hazards regression model. NEFL expression, gender, tumor stage and lymph node status were statistically significant factors for OS in multivariate analysis (Supplementary Table S3). KaplaneMeier survival plots were used to examine whether NEFL expression was associated with survival (Fig. 1E). Overexpression of NEFL predicted longer patient survival, with an average survival of 43.0 months (95%CI, 38.5e47.4); patients negative for NEFL expression exhibited a median overall survival of 27.0 months (95%CI, 22.8e31.3). The difference in overall survival between NEFL-positive and NEFL-negative patients was highly significant (p ¼ 0.004, log-rank test), and elevated expression of NEFL was a favorable predictor of longer OS. Together, our results demonstrate that NEFL is significantly associated with the clinical prognosis of NSCLC patients and that NEFL may represent a prognostic marker for NSCLC.
630
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
631
Fig. 3. DNA methylation of NEFL in NSCLC cell lines. (A) The results of the methylation analysis of the 5' flanking genomic regions of NEFL in A549, H460, GLC-82 and L78 cell lines. Each circle in the figure represents a single CpG site. For each sample, ten clones were sequenced. Methylated CpG sites are represented as closed circles, and unmethylated CpG sites are represented by open circles. (B, unmethylated; C, methylated). NEFL expression at mRNA levels (B) and protein levels (C) in NSCLC cell lines. NEFL was hypermethylated and silenced in GLC-82 and L78 but hypomethylated and highly expressed in A549 and H460. After 96-hr treatment with 5mm of 5-Aza-dC, a methyltransferase inhibitor, NEFL expression was markedly restored in GLC-82 and L78 cells but not in A549 and H460 cells (*, p<0.05; **, p<0.01).
3.2. NEFL expression is functionally associated with the NSCLC cellular response to invasion and migration Having demonstrated clinical significant of NEFL, we next investigated the functional relevance of aberrant NEFL expression and its roles in NSCLC. Firstly, we detected the relative expression of NEFL in 5 NSCLC cell lines by Western blot and RT-PCR, and the two highest (A549 and H460) and two lowest (GLC-82 and L78) expressing cell lines were chosen for further study.(Supplementary Fig. S1 A-B). Then we constructed GV248-shRNA (shNEFL1 and shNEFL2) lentiviral vector to block NEFL expression in A549 and H460 cells. NEFL over-expression lentivirus and the scramble vector(LV6) were transfected GLC-82 and L78. As shown in Fig. 2A, 48 h after the scratch was created, cells transfected with shNEFL1 and shNEFL2 migrated into and largely covered the original wound area, whereas those cells transfected with the negative control GV248 failed to cover a substantial portion of the wound. Furthermore, we observed a significant delay in wound closure after NEFL re-expression compared with the LV6 lentivirustransfected group. A significant increase in cells invasive and migratory activy was observed in shNEFL-transfected A549 and H460 cells compared with the negative control transfected cells. On the other side, the overexpression of NEFL in GLC-82 and L78 cells strongly decreased the invasion and migration ability than control cells(Fig. 2 BeE). 3.3. Silencing of NEFL expression was associated with DNA methylation, and NEFL expression can be restored by 5-aza-dC treatment We measured the DNA methylation status of the 50 upstream
region of NEFL, which contains 30 CG sites. Representative results of the bisulfite sequencing analysis of NEFL are presented in Fig. 3A. Promoter hypermethylation was observed in GLC82 and L78 cells, which express low levels of NEFL. However, in A549 and H460 cells, which express high levels of NEFL, this region was unmethylated or hypomethylated. To confirm that CpG island methylation was indeed responsible for the silencing of NEFL, we treated the hypermethylated cell line and the hypomethylated cell line with 5-Aza-dC, a methyltransferase inhibitor. NEFL expression was noticeably increased after the treatment in GLC-82 and L78 cells (Fig. 3). However, no significant change in NEFL expression was observed in A549 and H460 cells. These results demonstrate that CpG methylation directly contributes to the silencing of NEFL in NSCLC cells. 3.4. NEFL inhibited the NF-kB pathway, thereby suppressing the expression of uPA and decreasing NSCLC invasiveness and migration To further investigate the mechanism underlying NEFLmediated invasion and migration, we examined potential pathways modulated by NEFL. Several studies have demonstrated that NF-kB might play a crucial role in the transactivation of uPA in several cancers [11,12]. Therefore, we explored whether NEFL expression could be attributed to the downregulation of NF-kB signaling and the suppression of uPA. The expression of NF-kB in nuclear (phospho -p65) and cytoplasmic (p65) in NSCLC cells was analyzed by Western blot to assess the possible inhibitory effect of NEFL on NF-kB translocation from cytoplasm to nucleus. (Fig. 4A). Restoration of NEFL expression using lentivirus suppressed p65 and phospho-p65 in GLC-82 and L78 cells, whereas knockdown of NEFL expression resulted in
Fig. 2. NEFL inhibited cell migration and invasion. (A)In wound-healing assays, a monolayer of negative control and transfected A549, H460, GLC-82 and L78 cells were scraped with micropipette tips and cultured in FBS-free media. A representative picture demonstrating repair of the lesion by cell migration was photographed 48 h after wounding (scale bar: 0.1 mm). For transwell assays, the total number of invading cells through the matrigel was quantified under the microscope(400 ). Each bar represents the mean ± SD of three wells. The results are representative of three separate experiments. Cell invasion (B, D) and migration (C, E) were quantified after NEFL downregulation and overexpression in NSCLC cell lines(*p < 0.05, **p < 0.01).
632
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
Fig. 4. NEFL downregulated the expression of uPA via suppressed the activity of NF-kB in NSCLC cell lines. (A) The expression levels of p65 and phospho-p65 were measured from cytoplasm and nucleus, respectively. GAPDH and PAPR were used as cytoplasm and nucleus protein loading controls, respectively. (B) Western blot analysis revealed that downregulation of NEFL led to an increase in uPA, whereas overexpression of NEFL resulted in the suppression of uPA expression. (C) uPA protein levels in cell supernatants were quantified using ELISA. The columns represent the mean of three independent experiments. Blots are representative of three independent experiments (mean ± SEM, *, p < 0.05; **, p < 0.01).
increased p65 and phospho-p65 in A549 and H460 cells. Western blot analysis demonstrated that the upregulation of NEFL was associated with suppressed expression of uPA, whereas the downregulation of NEFL resulted in increased uPA expression (Fig. 4B). Similar results were observed when uPA secretion was examined using ELISA assay (Fig. 4C).
4. Discussion Neurofilaments are type IV intermediate filament heteropolymers composed of light (NEFL), medium (NEFM), and heavy (NEFH) chains [13]. Neurofilaments comprise the axoskeleton and functionally maintain the morphological integrity of neurons and the speed of impulses. Neurofilaments may also play a role in
intracellular transport to axons and dendrites. Mutations in Neurofilament Light Polypeptide (NEFL) cause Charcot-Marie-Tooth disease types 1F (CMT1F) and 2E (CMT2E) [7], disorders of the peripheral nervous system that are characterized by distinct neuropathies. Furthermore, NEFL may act as a TSG in a variety of common human cancers [8,14]. NEFL has been proposed to act as a potential TSG due to its location at chromosome 8p21, which has been identified as one of the genetic loci frequently affected by both heterozygous and homozygous deletions in many common human cancers, including prostate and breast cancer [15,16]. Lerebours has reported the loss of heterozygosity at the NEFL locus in NSCLC cases, and this loss has been shown to predict poor prognosis in patients with NSCLC [5]. Second, NEFH, a functional partner of NEFL and a subunit of
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
neurofilament heteropolymers, has recently been shown to be a putative TSG frequently inactivated by promoter hypermethylation in esophageal cancers [17]. Third, NEFL has been shown to interact with a number of functional molecular targets found in several critical cancer-associated pathways. Our previously study demonstrated that methylation-mediated silencing of NEFL expression led to functional activation of the mTOR pathway and consequentially conferred cisplatin resistance in HNC cell lines. Taken together, these studies strongly suggest that NEFL may play a critical role in suppressing cancer initiation and/or progression. As shown in our present study, NEFL was typically (26.13%, 23/ 108) downregulated in NSCLC, and the downregulation of NEFL was closely associated with lymphatic metastasis. KaplaneMeier analysis indicated that higher NEFL expression was associated with favorable outcomes in NSCLC patients, further supporting a tumor suppressor role for NEFL in NSCLC. Because the residual patient samples were too scarce to perform MSP analysis, we were unable to analyze the association between the methylation status of the NSCLC patients and their clinicopathological features. Thus, we chose the two highest (A549 and H460) and two lowest (GLC-82 and L78) expressing cell lines for BSP analysis. As shown in Fig. 3A, NEFL exhibited a higher methylation frequency in GLC-82 and L78 cells, whereas no or little methylation was observed in A549 and H460 cells. We also confirmed that NEFL expression was restored in GLC-82 and L78 cells after treatment with the DNA methyltransferase inhibitor 5-aza-dC. These results indicated that hypermethylation of the promoter CpG islands might be critical for the silencing of NEFL in NSCLC. Our study directly demonstrated that NEFL is epigenetically silenced in a human cancer and confirmed the possibility that NEFL may be the putative TSG candidate located at chromosome 8p21. These findings may have important implications for a broad range of common cancers with frequent 8p21 deletions, including prostate, breast, bladder, lung, and liver cancers [15,16]. Tumor invasion and metastasis are multifactorial biological processes. Tumor cells migrate to the basement membranes of tissues and eventually reach the circulatory system, which results in the development of metastatic lesions [18]. During the extravasation of cancer cells that have adhered strongly to the endothelial cells of blood vessels, cancer cells degrade the basement membrane or extracellular matrix using proteases produced either by the cancer cells themselves or by fibroblasts and/or other stromal cells. Subsequently, the cancer cells migrate through the cleaved basement membrane or matrix and invade the surrounding area [19]. The uPA system has been reported to play a major role in extracellular matrix proteolysis and tumor invasion [20e22]. Studies have demonstrated that uPA activation may facilitate the metastasis of human breast cancer by several mechanisms, including the Ras-ERK, p38 MAPK [23] and NF-kB pathways [24]. Consistent with these findings, our study demonstrated that NEFL inhibited p65 and phospho-p65 expression in conjunction with reductions in the expression and secretion levels of uPA, indicating a potential underlying mechanism for NEFL-induced inhibition of uPA expression. Although the functional role of NEFL in NSCLC cells remains unclear, we altered the expression of NEFL in four NSCLC cell lines using lentivirus expression. The forced expression of NEFL in GLC82 and L78 cells inhibited invasion and migration in vitro. By contrast, suppressed expression of NEFL in A549 and H460 cells promoted cell invasion and migration. These findings are consistent with our previous study concerning the role of NEFL in cell growth and invasion of HNCSC cell lines. Clinically, NEFL methylation was strongly associated with cancer cell invasion and migration. This is the first report to identify downregulation of NEFL expression by promoter methylation as a novel and important mechanism underlying NSCLC cell invasion and migration.
633
In conclusion, these findings provide convincing evidence that increased uPA expression and activation of the NF-kB pathway, a consequence of NEFL downregulation by promoter hypermethylation, are two mechanisms underlying invasion and migration in NSCLC. Conflict of interest The authors declared that they have no conflict of interest. Acknowledgments This study was supported by the Fundamental Research Funds for the Central Universities (#13ykpy26), the Guangdong Province Natural Science Foundation (#S2015A030313046), and the National Natural Science Foundation of China Youth Science Fund Project (81201732). This work was supported by Grant [2013]163 from Key Laboratory of Malignant Tumor Molecular Mechanism and Translational Medicine of Guangzhou Bureau of Science and Information Technology; Grant KLB09001 from the Key Laboratory of Malignant Tumor Gene Regulation and Target Therapy of Guangdong Higher Education Institutes, Sun-Yat-Sen University. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.01.094. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2016.01.094. References [1] R. Siegel, C. DeSantis, K. Virgo, et al., Cancer treatment and survivorship statistics, 2012, CA Cancer J. Clin. 62 (2012) 220e241. [2] P. Goldstraw, D. Ball, J.R. Jett, et al., Non-small-cell lung cancer, Lancet 378 (2011) 1727e1740. [3] P.A. Jones, S.B. Baylin, The fundamental role of epigenetic events in cancer, Nat. Rev. Genet. 3 (2002) 415e428. [4] S.W. Coon, A.T. Savera, R.J. Zarbo, et al., Prognostic implications of loss of heterozygosity at 8p21 and 9p21 in head and neck squamous cell carcinoma, Int. J. Cancer 111 (2004) 206e212. [5] F. Lerebours, S. Olschwang, B. Thuille, et al., Fine deletion mapping of chromosome 8p in non-small-cell lung carcinoma, Int. J. Cancer 81 (1999) 854e858. [6] S.C. Previtali, B. Zerega, D.L. Sherman, et al., Myotubularin-related 2 protein phosphatase and neurofilament light chain protein, both mutated in CMT neuropathies, interact in peripheral nerve, Hum. Mol. Genet. 12 (2003) 1713e1723. [7] G.M. Fabrizi, T. Cavallaro, C. Angiari, et al., Charcot-Marie-Tooth disease type 2E, a disorder of the cytoskeleton, Brain 130 (2007) 394e403. [8] B. Chen, J. Chen, M.G. House, et al., Role of neurofilament light polypeptide in head and neck cancer chemoresistance, Mol. Cancer Res. 10 (2012) 305e315. [9] Z. Huang, Y. Zhuo, Z. Shen, et al., The role of NEFL in cell growth and invasion in head and neck squamous cell carcinoma cell lines, J. Oral Pathol. Med. 43 (2014) 191e198. [10] Z. Huang, H. Li, Q. Huang, et al., SERPINB2 down-regulation contributes to chemoresistance in head and neck cancer, Mol. Carcinog. 53 (2014) 777e786. [11] S.D. Killeen, J.H. Wang, E.J. Andrews, et al., Bacterial endotoxin enhances colorectal cancer cell adhesion and invasion through TLR-4 and NF-kappaBdependent activation of the urokinase plasminogen activator system, Br. J. Cancer 100 (2009) 1589e1602. [12] K. Tsunoda, G. Kitange, T. Anda, et al., Expression of the constitutively activated RelA/NF-kappaB in human astrocytic tumors and the in vitro implication in the regulation of urokinase-type plasminogen activator, migration, and invasion, Brain Tumor Pathol. 22 (2005) 79e87. [13] R.K. Liem, S.H. Yen, G.D. Salomon, et al., Intermediate filaments in nervous tissues, J. Cell Biol. 79 (1978) 637e645. [14] S. Kang, B. Kim, S.B. Park, et al., Stage-specific methylome screen identifies that NEFL is downregulated by promoter hypermethylation in breast cancer, Int. J. Oncol. 43 (2013) 1659e1665.
634
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
[15] M.A. Knowles, M.E. Shaw, A.J. Proctor, Deletion mapping of chromosome 8 in cancers of the urinary bladder using restriction fragment length polymorphisms and microsatellite polymorphisms, Oncogene 8 (1993) 1357e1364. [16] J.A. Macoska, T.M. Trybus, P.D. Benson, et al., Evidence for three tumor suppressor gene loci on chromosome 8p in human prostate cancer, Cancer Res. 55 (1995) 5390e5395. [17] M.S. Kim, X. Chang, C. LeBron, et al., Neurofilament heavy polypeptide regulates the Akt-beta-catenin pathway in human esophageal squamous cell carcinoma, PLoS One 5 (2010) e9003. [18] A.F. Chambers, A.C. Groom, I.C. MacDonald, Dissemination and growth of cancer cells in metastatic sites, Nat. Rev. Cancer 2 (2002) 563e572. [19] J.A. Joyce, J.W. Pollard, Microenvironmental regulation of metastasis, Nat. Rev. Cancer 9 (2009) 239e252.
[20] T. Kaneko, H. Konno, M. Baba, et al., Urokinase-type plasminogen activator expression correlates with tumor angiogenesis and poor outcome in gastric cancer, Cancer Sci. 94 (2003) 43e49. [21] M.J. Duffy, The urokinase plasminogen activator system: role in malignancy, Curr. Pharm. Des. 10 (2004) 39e49. [22] B.V. Offersen, P. Pfeiffer, P. Andreasen, et al., Urokinase plasminogen activator and plasminogen activator inhibitor type-1 in nonsmall-cell lung cancer: relation to prognosis and angiogenesis, Lung Cancer-J Iaslc 56 (2007) 43e50. [23] L. Tang, X. Han, The urokinase plasminogen activator system in breast cancer invasion and metastasis, Biomed. Pharmacother. 67 (2013) 179e182. [24] M. Moreau, S. Mourah, C. Dosquet, beta-Catenin and NF-kappaB cooperate to regulate the uPA/uPAR system in cancer cells, Int. J. Cancer 128 (2011) 1280e1292.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Methylation of neurofilament light polypeptide promoter is associated with cell invasion and metastasis in NSCLC Zhuojian Shen a, b, 1, Baishen Chen a, b, 1, Xiangfeng Gan g, Weicheng Hu f, Guangzheng Zhong e, Haifeng Li c, Xuan Xie a, b, Yeqing Liu c, Haigang Li c, Xia Xu a, b, Zhiquan Huang d, *, Ju Chen a, b, ** a
Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Department of Thoracic Surgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120, PR China Lung Cancer Research Center of Sun Yat-Sen University, Sun Yat-Sen University, Guangzhou 510275, PR China c Department of Pathology, Sun Yat-Sen Memorial Hospital, Guangzhou 510120, PR China d Department of Oral and Maxillofacial Surgery, Sun Yat-Sen Memorial Hospital, Guangzhou 510120, PR China e Department of Urology Surgery, Sun Yat-Sen Memorial Hospital, Guangzhou 510120, PR China f Department of Thoracic Surgery, Zengcheng People's Hospital, Sun Yat-Sen University, Zengcheng 511330, PR China g Department of Thoracic Surgery, General Hospital of Ningxia Medical University, Ningxia Medical University, Yinchuan 750004, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 January 2016 Accepted 15 January 2016 Available online 20 January 2016
The role of NEFL in NSCLC remains largely unknown. Immunohistochemistry was performed to investigate the expression of NEFL in 108 lung cancer specimens. NEFL expression was associated with decreased lymph node metastases and favorable prognosis. Furthermore, real-time PCR and Western blot were used to investigate the expression of the NEFL gene in NSCLC cell lines. Subsequently, lentivirusmediated RNA interference and overexpression were used to demonstrate that knocked-down of NEFL enhanced the invasion and migration of A549 and H460 NSCLC cells, whereas NEFL overexpression resulted in a suppression of the invasion and migration of GLC-82 and L78 cells in vitro. In addition, bisulfite sequence PCR assay demonstrated that NEFL downregulation was associated with promoter methylation, and NEFL expression was restored after treatment with 5-Aza-dC. Finally, we demonstrated that NEFL inhibited the NF-kB pathway, thereby suppressing the expression of uPA and decreasing NSCLC invasiveness and migration. Our studies suggest that NEFL methylation is a novel mechanism for NSCLC invasion and metastasis and that NEFL may represent a candidate biomarker for recurrence and survival in patients with NSCLC. © 2016 Elsevier Inc. All rights reserved.
Keywords: NEFL NSCLC methylation NF-kB uPA
1. Introduction The majority of lung cancers (56%) are diagnosed during the late stages of disease because early disease is typically asymptomatic; only 15% of cases are diagnosed at a local stage [1]. Surgical resection, when possible, remains the only curative treatment for early stage NSCLC. However, nearly 50% of resected patients
* Corresponding author. ** Corresponding author. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Department of Thoracic Surgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120, PR China. E-mail addresses: [email protected] (Z. Huang), dydchenju@163. com (J. Chen). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.bbrc.2016.01.094 0006-291X/© 2016 Elsevier Inc. All rights reserved.
experience recurrence and have a dismal prognosis [2]. Tumor cell invasion and metastasis may occur in the early stages of disease, making the current multimodality therapy ineffective. Therefore, searching for novel diagnostic and therapeutic strategies would be helpful to improve the survival rate. The mechanisms underlying the invasiveness and metastasis of lung cancer are not fully understood. Many factors, including tumor suppressors and oncogenes, are involved in pulmonary tumorigenesis or progression. Inactivation of tumor suppressor genes (TSGs) by promoter CpG island hypermethylation contributes to tumor initiation and progression, and methylated DNA is a potential source of cancer-specific biomarkers for clinical assessment [3]. Our previous studies on differentially hypermethylated genes in human head and neck cancer (HNC) used DNA microarray analysis to identify a set of genes differentially expressed between cisplatin-
628
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
sensitive and cisplatin-resistant HNC cell lines. Among those genes, neurofilament light polypeptide (NEFL) was selected for analysis due to its chromosome location of 8p21, a genetic locus previously reported to be rich in TSGs. Frequent deletion of chromosome 8p has been observed in several common cancers, including HNC and lung cancer [4,5]. The NEFL gene encodes the light subunit of neurofilaments, which functionally maintain neuronal caliber and play an important role in intracellular transport to axons and dendrites [6]. Mutations in NEFL cause Charcot-Marie-Tooth(CMT) disease types 1F and 2E [7]. Our previous study was the first study to demonstrate the role of NEFL in malignant tumors. We found that NEFL methylation was a novel mechanism for HNC chemoresistance [8] and might play a role in HNC cancer cell apoptosis and invasion [9]. Our findings confirmed that NEFL is associated with tumor progress. However, the mechanism of action of NEFL in NSCLC invasion and metastasis remains poorly characterized. In this study, we further examined NEFL methylation and expression in a panel of NSCLC cell lines and patient tumors. We also investigated the functional role of NEFL and its potential mechanisms of action in NSCLC invasion and migration. Taken together, our results suggest that promoter hypermethylationmediated silencing of NEFL is a novel mechanism underlying NSCLC invasion and migration. Furthermore, methylated NEFL may represent a candidate biomarker predictive of metastasis and survival in patients with NSCLC. 2. Materials and methods 2.1. Patient samples 108 paraffin-embedded specimens of NSCLC were collected from 2004 to 2008 at the department of Pathology, Sun Yat-Sen Memorial Hospital. The diagnoses were determined according to the criteria of the World Health Organization classification and were classified according to the NCCN TNM classification criteria (2015). The study was approved by the Institutional Research Ethics Committee of Sun Yat-Sen Memorial Hospital at Sun Yat-Sen University. Consent was obtained from the patients and the clinical research materials were collected from the patients prior to clinical treatment. Clinicopathologic features of all patients were described in Supplementary Table S1 and S2. 2.2. Cell culture and drug treatment A total of 5 NSCLC cell lines were used in this study; all cell lines were kindly provided by the Department of Thoracic Surgery, Sun Yat-Sen University Cancer Center (Guangzhou, China). These cell lines were cultured according to supplier's instructions. For experiments with 5-Aza-2'-deoxycytidine (5-Aza-dC), cells were incubated with media containing 5 mM 5-Aza-dC for 96 h.
cell lines using an EZ DNA Methylation-Gold Kit (ZYMO Research, Irvine, CA, USA) according to the standard protocol from the manufacturer. The methylation status of individual CpG islands in the 50 flanking genomic regions (þ514 to þ871) of the NEFL gene in 4 cell lines was determined by plasmid cloning and bisulfite DNA sequencing. Bisulfite-treated DNA samples (1 ml) from each of above cell lines were amplified in 50-ml PCR reactions according to the protocol (EpiTaq™ HS, TaKaRa, Otsu, Japan). Primers for the amplification of the NEFL transcript were as follows: forward, TGTTGTAGTTATTTTTTTAGTTTTGGAT; and reverse, TACACAAAATCTCCTCCAACCCTTC. PCR amplification was performed for 40 cycles of 98 C for 30 s, 55 C for 30 s, and 72 C for 30 s, with 5 min at 95 C for initial denaturation and 5 min at 72 C for final elongation. PCR products were verified by ethidium bromide staining, and 1 mL of the products was cloned into a pMD19-T Vector according to the protocol (pMD19-T Vector Cloning Kit, TaKaRa, Otsu, Japan). Ten clones from each cell line were selected for sequencing. 2.5. Lentiviral infection Short hairpin RNA (shRNA), including sh-NEFL1, sh-NEFL2 (SigmaeAldrich, St. Louis., MO, USA) and the negative control, were cloned into GV248 lentiviral vectors (Genechem, Shanghai, China). Subsequently, the constructed GV248 vectors and the packaging plasmids pMD2.G and psPAX2 were used to co-transfect the 293T packing cells with X-treme GENE HP DNA Transfection Reagent (Roche Applied Science, Indianapolis, IN, USA) according to the manufacturer's protocols. The medium was refreshed 24 h after transfection, and the cells were cultured for an additional 24 h. Conditioned medium was collected and cleared of debris by filtering through a 0.45 mm filter (Millipore, Bedford, MA, USA). The NEFL overexpression construct and the negative control (LV6) were individually subcloned into lentivirus vector LV6 (Genepharma, Jiangsu, China). After infection of the lentivirus, the cells were selected with 2 mg/mL puromycin (SigmaeAldrich) for 2 weeks. The knockdown efficiency was assessed using RT-PCR and Western blotting. 2.6. Wound-healing assay Culture cells were grown to confluent monolayer in six-well plates using medium containing 10% fetal bovine serum (FBS). Then the medium was replaced with FBS-free media, and the monolayer cells were wounded with 200 mL tip. At the indicated times (0 and 48 h) after scraping, the cells were washed twice in PBS, and the migration of cells into the wound zone was observed. The uncovered area was analyzed using Image-pro Plus 5.0 software (Media Cybernetics, Silver Spring, MD, USA). 2.7. In vitro migration and invasion assays
2.3. Immunohistochemistry Immunohistochemistry and the evaluations of the stained tissue sections were performed as previously described [10]. Sections of human lung tissues staining positive with NEFL polyclonal rabbit antibody (1:100; BIOWORLD, MN, USA) were used as the positive control for NEFL, and Phosphate Buffered Saline (PBS) was used instead of the primary antibody for the negative control. 2.4. Methylation analysis Genomic DNA from A549, H460, GLC-82 and L78 cell lines were included in BSP analysis. Methylation analysis of the 50 genomic DNA sequences was conducted on bisulfite-converted DNA from
For the transwell migration assays, 5 104 cells were plated in the top chamber of each insert (Corning, Corning, New York, US). For the invasion assays, 3 104 cells were plated in the upper chamber of each insert, which were previously been coated with 150 mg of Matrigel (BD Biosciences, Oakville, Ontario, Canada). The cells in both assays were trypsinised and resuspended in FBS-free medium. Six hundred microliters of medium supplemented with 10% FBS or 20% FBS was added to the lower chambers in the migration assay wells or invasion assay wells, respectively. After incubation of the migration and invasion assays at 37 C for 12 h or 24 h, respectively, the cells remaining in the top chambers or on the upper membranes of the inserts were removed, and the cells that had migrated or invaded into the lower chambers were fixed and
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
629
stained with a solution of 0.1% crystal violet and 4% paraformaldehyde. The migrating and invading cells were imaged and counted using an IX71 inverted microscope (Olympus, Tokyo, Japan). 2.8. RNA extraction and RT-PCR RNA extraction and RT-PCR were performed as previously described [8]. Primers for NEFL and GAPDH were as follows: 50 TCAACGTGAAGATGGCTTTG -30 , 50 -AGCGGGTGGACATCAGATAG-30 , and 50 -ACAACTTTGGTATCGTGGAAGG-30 , 50 -GCCATCACGCCACAGTTTC-3’. 2.9. Western blot analysis Western blot analysis was performed as previously described [8]. The anti-NEFL antibody (CST, Boston, Massachusetts, USA), NfkB (including p65 and phospho-p65, Gene Tex, Irvine, California, US), anti-uPA antibody (Gene Tex, Irvine, California, US) were used to probe the alterations of the protein. GAPDH (CST, Boston, Massachusetts, USA) and PAPR (CST, Boston, Massachusetts, USA) were used as cytoplasm and nucleus protein loading controls, respectively. 2.10. Enzyme-linked immunosorbent assays (ELISA) Cells for assessment were incubated in 6-well plates for 24 h, the supernatant of the culture medium of the NSCLC cells was collected and centrifuged at 1000 g for 20min in room temperature. The uPA concentrations in the supernatant of the culture medium were quantified using an uPA ELISA Kit (Cloud-clone Corp, Houston, TX, USA) according to the manufacturers' recommended protocols. The sample analyses were executed in triplicate and were repeated a minimum of three times. 2.11. Statistical analysis All data were presented as the mean ± standard deviation (SD). The associations between NEFL and clinicopathological parameters were assessed using the c2-test and Fisher's exact test. Prognostic value of NEFL expression for patient survivals was assessed by KaplaineMeier analysis. Multivariable and univariate overall survival analyses were performed with the Cox proportional hazards model. The other datas were analyzed with Student's t-test, and pvalues <0.05 were considered significant. All statistical analyses were performed with the SPSS program package 17.0 (SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Downregulation of NEFL was associated with lymph node metastases in primary NSCLC tumors and was closely correlated with poor prognosis of NSCLC patients To observe NEFL expression in primary tumors, we performed IHC staining using an NEFL-specific antibody on primary tumor tissues from 108 patients with NSCLC (Fig. 1AeD). NEFL expression was detected in 26.13% of the tumor tissues (23/108), and 73.87% of the tumor tissues were negative for NEFL expression. The downregulation of NEFL was closely associated with lymphatic metastasis. In NEFL-positive cases, only 21.74% (5/23) of the patients exhibited lymph node metastasis, whereas 56.47% (48/85) of cases with weak NEFL staining were node-negative. The IHC revealed a statistically significant correlation between higher protein expression and negative nodal status (p ¼ 0.003). No significant
Fig. 1. Representative images of NEFL immunohistochemical staining. Positive staining of NEFL in (A)squamous cell carcinoma, (B)adenocarcinoma, (C) negative control (without NEFL antibody) pattern and (D)positive control (scale bar: 50 mm). (E) The survival analysis of NEFL. Higher NEFL expression in tumor tissue was closely correlated with favorable overall survival (p ¼ 0.005).
association was detected between NEFL expression and other clinicopathological characteristics, including patient gender, smoking history, histologic type, stage, differentiation or tumor diameter (Supplementary Table S2). To examine the relationship between NEFL expression and the clinical prognosis of NSCLC patients, we conducted survival analyses using univariate and multivariate Cox's proportional hazards regression model. NEFL expression, gender, tumor stage and lymph node status were statistically significant factors for OS in multivariate analysis (Supplementary Table S3). KaplaneMeier survival plots were used to examine whether NEFL expression was associated with survival (Fig. 1E). Overexpression of NEFL predicted longer patient survival, with an average survival of 43.0 months (95%CI, 38.5e47.4); patients negative for NEFL expression exhibited a median overall survival of 27.0 months (95%CI, 22.8e31.3). The difference in overall survival between NEFL-positive and NEFL-negative patients was highly significant (p ¼ 0.004, log-rank test), and elevated expression of NEFL was a favorable predictor of longer OS. Together, our results demonstrate that NEFL is significantly associated with the clinical prognosis of NSCLC patients and that NEFL may represent a prognostic marker for NSCLC.
630
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
631
Fig. 3. DNA methylation of NEFL in NSCLC cell lines. (A) The results of the methylation analysis of the 5' flanking genomic regions of NEFL in A549, H460, GLC-82 and L78 cell lines. Each circle in the figure represents a single CpG site. For each sample, ten clones were sequenced. Methylated CpG sites are represented as closed circles, and unmethylated CpG sites are represented by open circles. (B, unmethylated; C, methylated). NEFL expression at mRNA levels (B) and protein levels (C) in NSCLC cell lines. NEFL was hypermethylated and silenced in GLC-82 and L78 but hypomethylated and highly expressed in A549 and H460. After 96-hr treatment with 5mm of 5-Aza-dC, a methyltransferase inhibitor, NEFL expression was markedly restored in GLC-82 and L78 cells but not in A549 and H460 cells (*, p<0.05; **, p<0.01).
3.2. NEFL expression is functionally associated with the NSCLC cellular response to invasion and migration Having demonstrated clinical significant of NEFL, we next investigated the functional relevance of aberrant NEFL expression and its roles in NSCLC. Firstly, we detected the relative expression of NEFL in 5 NSCLC cell lines by Western blot and RT-PCR, and the two highest (A549 and H460) and two lowest (GLC-82 and L78) expressing cell lines were chosen for further study.(Supplementary Fig. S1 A-B). Then we constructed GV248-shRNA (shNEFL1 and shNEFL2) lentiviral vector to block NEFL expression in A549 and H460 cells. NEFL over-expression lentivirus and the scramble vector(LV6) were transfected GLC-82 and L78. As shown in Fig. 2A, 48 h after the scratch was created, cells transfected with shNEFL1 and shNEFL2 migrated into and largely covered the original wound area, whereas those cells transfected with the negative control GV248 failed to cover a substantial portion of the wound. Furthermore, we observed a significant delay in wound closure after NEFL re-expression compared with the LV6 lentivirustransfected group. A significant increase in cells invasive and migratory activy was observed in shNEFL-transfected A549 and H460 cells compared with the negative control transfected cells. On the other side, the overexpression of NEFL in GLC-82 and L78 cells strongly decreased the invasion and migration ability than control cells(Fig. 2 BeE). 3.3. Silencing of NEFL expression was associated with DNA methylation, and NEFL expression can be restored by 5-aza-dC treatment We measured the DNA methylation status of the 50 upstream
region of NEFL, which contains 30 CG sites. Representative results of the bisulfite sequencing analysis of NEFL are presented in Fig. 3A. Promoter hypermethylation was observed in GLC82 and L78 cells, which express low levels of NEFL. However, in A549 and H460 cells, which express high levels of NEFL, this region was unmethylated or hypomethylated. To confirm that CpG island methylation was indeed responsible for the silencing of NEFL, we treated the hypermethylated cell line and the hypomethylated cell line with 5-Aza-dC, a methyltransferase inhibitor. NEFL expression was noticeably increased after the treatment in GLC-82 and L78 cells (Fig. 3). However, no significant change in NEFL expression was observed in A549 and H460 cells. These results demonstrate that CpG methylation directly contributes to the silencing of NEFL in NSCLC cells. 3.4. NEFL inhibited the NF-kB pathway, thereby suppressing the expression of uPA and decreasing NSCLC invasiveness and migration To further investigate the mechanism underlying NEFLmediated invasion and migration, we examined potential pathways modulated by NEFL. Several studies have demonstrated that NF-kB might play a crucial role in the transactivation of uPA in several cancers [11,12]. Therefore, we explored whether NEFL expression could be attributed to the downregulation of NF-kB signaling and the suppression of uPA. The expression of NF-kB in nuclear (phospho -p65) and cytoplasmic (p65) in NSCLC cells was analyzed by Western blot to assess the possible inhibitory effect of NEFL on NF-kB translocation from cytoplasm to nucleus. (Fig. 4A). Restoration of NEFL expression using lentivirus suppressed p65 and phospho-p65 in GLC-82 and L78 cells, whereas knockdown of NEFL expression resulted in
Fig. 2. NEFL inhibited cell migration and invasion. (A)In wound-healing assays, a monolayer of negative control and transfected A549, H460, GLC-82 and L78 cells were scraped with micropipette tips and cultured in FBS-free media. A representative picture demonstrating repair of the lesion by cell migration was photographed 48 h after wounding (scale bar: 0.1 mm). For transwell assays, the total number of invading cells through the matrigel was quantified under the microscope(400 ). Each bar represents the mean ± SD of three wells. The results are representative of three separate experiments. Cell invasion (B, D) and migration (C, E) were quantified after NEFL downregulation and overexpression in NSCLC cell lines(*p < 0.05, **p < 0.01).
632
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
Fig. 4. NEFL downregulated the expression of uPA via suppressed the activity of NF-kB in NSCLC cell lines. (A) The expression levels of p65 and phospho-p65 were measured from cytoplasm and nucleus, respectively. GAPDH and PAPR were used as cytoplasm and nucleus protein loading controls, respectively. (B) Western blot analysis revealed that downregulation of NEFL led to an increase in uPA, whereas overexpression of NEFL resulted in the suppression of uPA expression. (C) uPA protein levels in cell supernatants were quantified using ELISA. The columns represent the mean of three independent experiments. Blots are representative of three independent experiments (mean ± SEM, *, p < 0.05; **, p < 0.01).
increased p65 and phospho-p65 in A549 and H460 cells. Western blot analysis demonstrated that the upregulation of NEFL was associated with suppressed expression of uPA, whereas the downregulation of NEFL resulted in increased uPA expression (Fig. 4B). Similar results were observed when uPA secretion was examined using ELISA assay (Fig. 4C).
4. Discussion Neurofilaments are type IV intermediate filament heteropolymers composed of light (NEFL), medium (NEFM), and heavy (NEFH) chains [13]. Neurofilaments comprise the axoskeleton and functionally maintain the morphological integrity of neurons and the speed of impulses. Neurofilaments may also play a role in
intracellular transport to axons and dendrites. Mutations in Neurofilament Light Polypeptide (NEFL) cause Charcot-Marie-Tooth disease types 1F (CMT1F) and 2E (CMT2E) [7], disorders of the peripheral nervous system that are characterized by distinct neuropathies. Furthermore, NEFL may act as a TSG in a variety of common human cancers [8,14]. NEFL has been proposed to act as a potential TSG due to its location at chromosome 8p21, which has been identified as one of the genetic loci frequently affected by both heterozygous and homozygous deletions in many common human cancers, including prostate and breast cancer [15,16]. Lerebours has reported the loss of heterozygosity at the NEFL locus in NSCLC cases, and this loss has been shown to predict poor prognosis in patients with NSCLC [5]. Second, NEFH, a functional partner of NEFL and a subunit of
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
neurofilament heteropolymers, has recently been shown to be a putative TSG frequently inactivated by promoter hypermethylation in esophageal cancers [17]. Third, NEFL has been shown to interact with a number of functional molecular targets found in several critical cancer-associated pathways. Our previously study demonstrated that methylation-mediated silencing of NEFL expression led to functional activation of the mTOR pathway and consequentially conferred cisplatin resistance in HNC cell lines. Taken together, these studies strongly suggest that NEFL may play a critical role in suppressing cancer initiation and/or progression. As shown in our present study, NEFL was typically (26.13%, 23/ 108) downregulated in NSCLC, and the downregulation of NEFL was closely associated with lymphatic metastasis. KaplaneMeier analysis indicated that higher NEFL expression was associated with favorable outcomes in NSCLC patients, further supporting a tumor suppressor role for NEFL in NSCLC. Because the residual patient samples were too scarce to perform MSP analysis, we were unable to analyze the association between the methylation status of the NSCLC patients and their clinicopathological features. Thus, we chose the two highest (A549 and H460) and two lowest (GLC-82 and L78) expressing cell lines for BSP analysis. As shown in Fig. 3A, NEFL exhibited a higher methylation frequency in GLC-82 and L78 cells, whereas no or little methylation was observed in A549 and H460 cells. We also confirmed that NEFL expression was restored in GLC-82 and L78 cells after treatment with the DNA methyltransferase inhibitor 5-aza-dC. These results indicated that hypermethylation of the promoter CpG islands might be critical for the silencing of NEFL in NSCLC. Our study directly demonstrated that NEFL is epigenetically silenced in a human cancer and confirmed the possibility that NEFL may be the putative TSG candidate located at chromosome 8p21. These findings may have important implications for a broad range of common cancers with frequent 8p21 deletions, including prostate, breast, bladder, lung, and liver cancers [15,16]. Tumor invasion and metastasis are multifactorial biological processes. Tumor cells migrate to the basement membranes of tissues and eventually reach the circulatory system, which results in the development of metastatic lesions [18]. During the extravasation of cancer cells that have adhered strongly to the endothelial cells of blood vessels, cancer cells degrade the basement membrane or extracellular matrix using proteases produced either by the cancer cells themselves or by fibroblasts and/or other stromal cells. Subsequently, the cancer cells migrate through the cleaved basement membrane or matrix and invade the surrounding area [19]. The uPA system has been reported to play a major role in extracellular matrix proteolysis and tumor invasion [20e22]. Studies have demonstrated that uPA activation may facilitate the metastasis of human breast cancer by several mechanisms, including the Ras-ERK, p38 MAPK [23] and NF-kB pathways [24]. Consistent with these findings, our study demonstrated that NEFL inhibited p65 and phospho-p65 expression in conjunction with reductions in the expression and secretion levels of uPA, indicating a potential underlying mechanism for NEFL-induced inhibition of uPA expression. Although the functional role of NEFL in NSCLC cells remains unclear, we altered the expression of NEFL in four NSCLC cell lines using lentivirus expression. The forced expression of NEFL in GLC82 and L78 cells inhibited invasion and migration in vitro. By contrast, suppressed expression of NEFL in A549 and H460 cells promoted cell invasion and migration. These findings are consistent with our previous study concerning the role of NEFL in cell growth and invasion of HNCSC cell lines. Clinically, NEFL methylation was strongly associated with cancer cell invasion and migration. This is the first report to identify downregulation of NEFL expression by promoter methylation as a novel and important mechanism underlying NSCLC cell invasion and migration.
633
In conclusion, these findings provide convincing evidence that increased uPA expression and activation of the NF-kB pathway, a consequence of NEFL downregulation by promoter hypermethylation, are two mechanisms underlying invasion and migration in NSCLC. Conflict of interest The authors declared that they have no conflict of interest. Acknowledgments This study was supported by the Fundamental Research Funds for the Central Universities (#13ykpy26), the Guangdong Province Natural Science Foundation (#S2015A030313046), and the National Natural Science Foundation of China Youth Science Fund Project (81201732). This work was supported by Grant [2013]163 from Key Laboratory of Malignant Tumor Molecular Mechanism and Translational Medicine of Guangzhou Bureau of Science and Information Technology; Grant KLB09001 from the Key Laboratory of Malignant Tumor Gene Regulation and Target Therapy of Guangdong Higher Education Institutes, Sun-Yat-Sen University. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.01.094. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2016.01.094. References [1] R. Siegel, C. DeSantis, K. Virgo, et al., Cancer treatment and survivorship statistics, 2012, CA Cancer J. Clin. 62 (2012) 220e241. [2] P. Goldstraw, D. Ball, J.R. Jett, et al., Non-small-cell lung cancer, Lancet 378 (2011) 1727e1740. [3] P.A. Jones, S.B. Baylin, The fundamental role of epigenetic events in cancer, Nat. Rev. Genet. 3 (2002) 415e428. [4] S.W. Coon, A.T. Savera, R.J. Zarbo, et al., Prognostic implications of loss of heterozygosity at 8p21 and 9p21 in head and neck squamous cell carcinoma, Int. J. Cancer 111 (2004) 206e212. [5] F. Lerebours, S. Olschwang, B. Thuille, et al., Fine deletion mapping of chromosome 8p in non-small-cell lung carcinoma, Int. J. Cancer 81 (1999) 854e858. [6] S.C. Previtali, B. Zerega, D.L. Sherman, et al., Myotubularin-related 2 protein phosphatase and neurofilament light chain protein, both mutated in CMT neuropathies, interact in peripheral nerve, Hum. Mol. Genet. 12 (2003) 1713e1723. [7] G.M. Fabrizi, T. Cavallaro, C. Angiari, et al., Charcot-Marie-Tooth disease type 2E, a disorder of the cytoskeleton, Brain 130 (2007) 394e403. [8] B. Chen, J. Chen, M.G. House, et al., Role of neurofilament light polypeptide in head and neck cancer chemoresistance, Mol. Cancer Res. 10 (2012) 305e315. [9] Z. Huang, Y. Zhuo, Z. Shen, et al., The role of NEFL in cell growth and invasion in head and neck squamous cell carcinoma cell lines, J. Oral Pathol. Med. 43 (2014) 191e198. [10] Z. Huang, H. Li, Q. Huang, et al., SERPINB2 down-regulation contributes to chemoresistance in head and neck cancer, Mol. Carcinog. 53 (2014) 777e786. [11] S.D. Killeen, J.H. Wang, E.J. Andrews, et al., Bacterial endotoxin enhances colorectal cancer cell adhesion and invasion through TLR-4 and NF-kappaBdependent activation of the urokinase plasminogen activator system, Br. J. Cancer 100 (2009) 1589e1602. [12] K. Tsunoda, G. Kitange, T. Anda, et al., Expression of the constitutively activated RelA/NF-kappaB in human astrocytic tumors and the in vitro implication in the regulation of urokinase-type plasminogen activator, migration, and invasion, Brain Tumor Pathol. 22 (2005) 79e87. [13] R.K. Liem, S.H. Yen, G.D. Salomon, et al., Intermediate filaments in nervous tissues, J. Cell Biol. 79 (1978) 637e645. [14] S. Kang, B. Kim, S.B. Park, et al., Stage-specific methylome screen identifies that NEFL is downregulated by promoter hypermethylation in breast cancer, Int. J. Oncol. 43 (2013) 1659e1665.
634
Z. Shen et al. / Biochemical and Biophysical Research Communications 470 (2016) 627e634
[15] M.A. Knowles, M.E. Shaw, A.J. Proctor, Deletion mapping of chromosome 8 in cancers of the urinary bladder using restriction fragment length polymorphisms and microsatellite polymorphisms, Oncogene 8 (1993) 1357e1364. [16] J.A. Macoska, T.M. Trybus, P.D. Benson, et al., Evidence for three tumor suppressor gene loci on chromosome 8p in human prostate cancer, Cancer Res. 55 (1995) 5390e5395. [17] M.S. Kim, X. Chang, C. LeBron, et al., Neurofilament heavy polypeptide regulates the Akt-beta-catenin pathway in human esophageal squamous cell carcinoma, PLoS One 5 (2010) e9003. [18] A.F. Chambers, A.C. Groom, I.C. MacDonald, Dissemination and growth of cancer cells in metastatic sites, Nat. Rev. Cancer 2 (2002) 563e572. [19] J.A. Joyce, J.W. Pollard, Microenvironmental regulation of metastasis, Nat. Rev. Cancer 9 (2009) 239e252.
[20] T. Kaneko, H. Konno, M. Baba, et al., Urokinase-type plasminogen activator expression correlates with tumor angiogenesis and poor outcome in gastric cancer, Cancer Sci. 94 (2003) 43e49. [21] M.J. Duffy, The urokinase plasminogen activator system: role in malignancy, Curr. Pharm. Des. 10 (2004) 39e49. [22] B.V. Offersen, P. Pfeiffer, P. Andreasen, et al., Urokinase plasminogen activator and plasminogen activator inhibitor type-1 in nonsmall-cell lung cancer: relation to prognosis and angiogenesis, Lung Cancer-J Iaslc 56 (2007) 43e50. [23] L. Tang, X. Han, The urokinase plasminogen activator system in breast cancer invasion and metastasis, Biomed. Pharmacother. 67 (2013) 179e182. [24] M. Moreau, S. Mourah, C. Dosquet, beta-Catenin and NF-kappaB cooperate to regulate the uPA/uPAR system in cancer cells, Int. J. Cancer 128 (2011) 1280e1292.