- Email: [email protected]
Metronidazole-resistant Helicobacter pylori isolates without rdxA mutations obtained from Iranian dyspeptic patients
Journal Pre-proof Metronidazole-resistant Helicobacter pylori isolates without rdxA mutations obtained from Iranian dyspeptic patients Shiva Rezaei, Amin Talebi Bezmin Abadi, Ashraf Mohabati Mobarez PII:
S2052-2975(19)30133-7
DOI:
https://doi.org/10.1016/j.nmni.2019.100636
Reference:
NMNI 100636
To appear in:
New Microbes and New Infections
Received Date: 31 July 2019 Revised Date:
3 December 2019
Accepted Date: 10 December 2019
Please cite this article as: Rezaei S, Bezmin Abadi AT, Mobarez AM, Metronidazole-resistant Helicobacter pylori isolates without rdxA mutations obtained from Iranian dyspeptic patients, New Microbes and New Infections, https://doi.org/10.1016/j.nmni.2019.100636. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.
TITLE PAGE
Title: Metronidazole-resistant Helicobacter pylori isolates without rdxA mutations obtained from Iranian dyspeptic patients Running title: metronidazole-resistant Helicobacter pylori Author’s names: Shiva Rezaei [1], Amin Talebi Bezmin Abadi [1], Ashraf Mohabati Mobarez [1] [1]
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran.
_____________________
Corresponding author: Amin Talebi Bezmin Abadi, (Ph. D) Assistant professor, Phone: 00982182884883 Corresponding author address: Tarbiat Modares University, Dept of Bacteriology, P.O. Box: 14115-111, Tehran, Iran e-mail: [email protected]
Financial Support and Acknowledgments: This study was financially supported by the research deputy of Tarbiat Modares University, Tehran, Iran.
Metronidazole-resistant Helicobacter pylori isolates without rdxA mutations obtained from Iranian dyspeptic patients Abstract Introduction: Since the emergence of antibiotic resistance is now accepted as the inevitable factor of H. pylori treatment failure, a survey on antibiotic susceptibility profile is welcomed. Additionally, the main molecular mechanism conferring the antibiotic resistance in H. pylori is not fully determined, particularly about metronidazole. Our single-center study was designed to evaluate the local antibiotic resistance profile on H. pylori strains recovered from dyspeptic patients. Materials and Methods: Gastric biopsy specimens from 200 patients were applied to the bacterial culture of H. pylori, thereafter, bacterial identification will be confirmed by positive reports from biochemical and genotypic universal protocols. Antibiotic susceptibility tests were performed for all seventy-three isolates by both disc diffusion and E-test methods. DNA extraction was done on single colonies of H. pylori confirmed by biochemical tests, then PCR to amplify the rdxA and 23sRNA genes were conducted. Metronidazole and clarithromycin resistance phenotypes were also checked to detect possible mutations at rdxA and 23S rRNA genes. Results: Successful bacterial culture was reported in 73/200 included patients. Overall, 73 patients (27 male 36% and 46 female 63%) were entered in our survey with an age range from 25 to 80 years (mean age of 54 years). None of patients were reported the pre-treatment. Among the 73 biochemically and genotypically confirmed H. pylori isolates in this analysis, antibiotic resistance rates were: 45% (33/73) for metronidazole and 23% (17/73) for clarithromycin. Additionally, we have found ten H. pylori isolates as multidrug resistant (13%). According to the antibiogram analysis, 13/17 (76%) had the A2142G mutation, however, 3/17 (17%) samples were also showed A2143G. None of our investigated resistant isolates were carrying the A2142C and A2144G mutations. Moreover, none of the metronidazole resistant strains were shown any of the point mutations. Conclusion: Identification of H. pylori isolates without rdxA mutation reveals the necessaire for an urgent investigation to select an effective antibiotic before drug prescription by gastroenterologists. Keywords: antibiotic resistance, clarithromycin, E-test, Helicobacter pylori, metronidazole, mutation 1
Running title: Metronidazole-resistant H. pylori Introduction The news of Helicobacter pylori (H. pylori) association with a wide range of gastroduodenal diseases was a renaissance in the gastroenterology over the last century (1). This spiral but the rapidly motile bacterium stays long-life in human gastric mucosa, if effective antibiotics are not prescribed (2). It is more than 30 years that we have acknowledged an essential role of H. pylori as a causative agent of chronic gastritis as well as being a major risk factor in the development of gastric cancer (3, 4). The designation of an effective therapy conferring the
successful
eradication of H. pylori is a key point in the management of the aforementioned digestive diseases (5, 6). To date, the generally accepted anti-H. pylori therapy is consists of a classic proton-pump inhibitors (PPIs) in combination with two antibiotics from amoxicillin, clarithromycin and metronidazole (2). The mentioned therapeutic regimen termed standard triple therapy may be under question if the rate of clarithromycin resistance rises up to 15% (7, 8). Given acceptable antibacterial effect of metronidazole on H. pylori even during the in vivo experiments, it is now considered as permanent member of antibacterial regimens used in clinical approaches by gastroenterologists (9, 10). So far, clarithromycin is also an inevitable drug in all anti-H. pylori treatment formulations (11), however, rising trend of its resistance rate hampered many of recommended therapies to eradicate this persistent bacterium (12, 13). In order to determine the susceptibility profile, there are different but consistent methods available for microbiologists. Disk diffusion as the easiest and most cost-effective approach was primarily applied to screen the H. pylori antibiotic-resistant isolates (14). Epsilometer agar diffusion gradient test (E-test) is also a quantitative variant of the disk diffusion method which exhibits a good correlation with other methods (14). An updated meta-analysis proved that successful eradication of H. pylori is clearly bound with reduced occurrence of gastric cancer and such 2
severe gastroduodenal diseases (15). The mentioned clinical reasons highlighted the importance of having an up to date data on antibiotic resistance of this bacterium. Unfortunately, the ongoing lacking is that no active surveillance system is running to track those resistant strains by Iranian health authorities (16). Hereby, we aimed to determine the prevalence of antibiotic resistance against both clarithromycin and metronidazole among H. pylori isolates recovered from antral biopsies of patients admitted to the Imam-Khomeini Hospital at Tehran, Iran, during 2015-2018. Materials and methods Patients A total number of 200 antral biopsy specimens were collected from subjects suffering from different gastroduodenal disorders who were admitted to gastroenterology unit of Imam Khomeini Hospital (Tehran, Iran) during the 2015-2018. Exclusion criteria were as follow; report of severe systemic diseases (e.g. abdominal surgery) in last 6 months, age under 18 years old, consumption of antibiotics in last two months prior to the endoscopy, consumption of bismuth salts in last month before the endoscopy, and antiplatelet drugs within one week of admission. The H. pylori strains were isolated from antral biopsies of dyspeptic patients which had been subjected to endoscopy after the first visit due to the gastroduodenal complains registered by expert clinicians. In this survey, written informed consent form was taken from each participating patient, while our study was approved by the ethical committee of Tarbiat Modares
University
following
a
rigorous
IR.TMU.REC.1395.514). Antral biopsy collection and H. pylori culture
3
peer-review
process,
(Ethics
code:
Two biopsy specimens were first taken, the first one was sent for pathology department for histopathological examination, second piece was also shipped within 2-4 hours to the laboratory in Eppendorf tubes containing thioglycolate broth medium at cold-box (14). Bacterial culture was conducted briefly described as follow; biopsy specimen was gently vortexed, then the homogenate was inoculated in to the Brucella agar (Merck, Germany) plates supplemented with 5% defibrinated sheep blood (Bahar-Azma, Iran), 10% fetal bovine serum (FBS) (Sigma, USA), Campylobacter selective supplement (Merck, Germany), and 5 mg/l of amphotericin B (Merck, Germany) (14). Incubation period was 7-14 days while the student was requested to check the plates for suspected colonies after the 5 days. Microaerophilic condition (10% CO2, 5% O2 and 85% N2) was used during the incubation period to provide the situation to let the H. pylori to optimally grow. Following the incubation period, the H. pylori cultures were investigated by the first, Gram staining, translucent colonies determined by naked eyes and three common biochemical tests (catalase, oxidase and urease)(14). The confirmed isolates were chosen for second bacterial culture to achieve single colony (to avoid mixed infections). The selected isolates were the subject of susceptibility tests and PCR. Antibiotic susceptibility test Modified Disk Diffusion Method (MDDM) was used to investigate the susceptibility of H. pylori isolate to clarithromycin (15 mg) and metronidazole (5 mg) (HIMEDIA, India). For this purpose, bacterial suspensions were prepared in the sterile saline (2 ml) equivalent to 3 McFarland standard (~9.0×108CFU/mL). The suspensions were streaked onto Muller Hinton agar supplemented with 5% sheep blood (Bahar-Afshan, Iran). After 10 minutes of inoculation, antibiotic disks were placed and incubated in microaerophilic atmosphere at 37°C for 5-8 days. Susceptibility testing and interpretive criteria were interpreted according to Clinical and 4
Laboratory Standards Institute (CLSI) guideline; inhibition zone for metronidazole was <16 mm and no inhibition zone for clarithromycin. Determination of Minimum inhibitory concentration (MIC) In our study, MICs were determined by the E-test (E-test, Biomerieux, France). A bacterial suspension equal to the concentration equivalent to 3 McFarland standard (~9.0×108CFU/mL) was used to identify MIC for those selected H. pylori strains. To perform E-test (AB Biodisk, Solna, Sweden), suspensions from primary plates were prepared in sterile saline solution at a concentration of equivalent to concentration equivalent of 3 McFarland and streaked onto Muller Hinton agar medium (Mueller Hinton Agar, Merck, Germany) plates supplemented with sheep blood 5% vol/vol (Bahar-Azma, Tehran, Iran). The clean E-test strips were located onto the dried surface of inoculated agar plates. The plates were incubated in a microaerophilic condition at 37°C for 72 hours or maximally two more days until a visible inhibition ellipse was disclosed. As suggested in the European Committee on Antimicrobial Susceptibility Testing recommendations (EUCAST, 2013), MIC values of 0.5 and 8 mg/L are the cut-offs above which H. pylori is deemed resistant to clarithromycin and metronidazole, respectively. In our survey, the MIC was measured and reported at the lowest antibiotic concentration where H. pylori growth was inhibited. H. pylori 26695 reference strain was used as quality control to ensure accuracy of these findings. Polymerase chain reactions (PCR) DNA was extracted from all resistant H. pylori isolates and reference strain. Bacterial DNA isolation from H. pylori single colonies was done by using “Yekta-Tajhiz-Azma” as described by the manufacturer instructions with minor modifications. DNA samples were the subject of glmM 5
(as specific species gene for H. pylori) PCR to confirm biochemical tests. Later, the remaining DNA was subsequently stored at -20°C until further usage. Resistant isolates were selected to evaluate the mutation profile of the rdxA and 23srRNA genes. Using an automatic Thermocycler (Eppendorf Personal 5332, Germany), PCR was done based on the published protocols with minor changes. Table 1 provides details of the primer sequences and PCR conditions. Statistical analysis: In order to report significant association between presence of mutations and gastroduodenal diseases, age and gender, we have used Fisher‘s exact test while the P value less than 0.05 was considered as statistically significant. Moreover, data analysis was performed by software SPSS version 18.0. Results: Over the three years (2015-2018), two hundreds patients who underwent the upper gastroscopy in Imam Khomeini hospital, Tehran Iran were included in our analysis. In this duration, a total number of 73 isolates of H. pylori were obtained and confirmed as single colony according to the bacterial culture and glmM specific PCR method. Overall, 73 patients (27 male 36% and 46 female 63%) were included with a wide age range from 25 to 80 years (mean age of 54 years). Following the endoscopic investigation and histological analysis of each H. pylori positive biopsy specimens revealed that of the 73 subjects, 44 were gastritis (60 %), 16 were gastric ulcer (22 %), 10 were duodenal ulcers (13.6 %), and 3 were gastric cancer (4%). Table 2 shows antibiotic susceptibility profile against different patients according to the age range and gender. Table 3 presents various diseases groups found for patients carrying the antibiotic susceptible and resistant H. pylori isolates. However, no significant association was detected between 6
clinical outcome, age, gender and antibiotic resistance among the H. pylori isolates (Tables 2, 3) (P>0.05). Overall antibiotic resistance rates were: 45% (33/73) for metronidazole and 23% (17/73) for clarithromycin. Current results revealed that 10 isolates (13.6%) were multidrug resistant (Table 3). None of our resistant isolates to metronidazole were positive for any rdxA mutations. According to the antibiogram analysis, 13/17 (76%) had the A2142G mutation, however, 3/17 (17%) samples were also showed A2143G. Additionally, none of our resistant isolates were carrying the A2142C and A2144G mutations. Discussion During the last years, the success of triple therapy against H. pylori was endangered since antibiotic resistance was rapidly rising. Many recent meta-analysis were confirmed the increasing trend of antibiotic resistance among the H. pylori strains is alarming; thus an urgent input especially by microbiologists and gastroenterologists are required (17, 18). Looking back in to the national and international records, it concluded that H. pylori treatment becoming tough, therefore, updated guideline with better modification seems the clinical solution (19, 20). The antibiotic resistance to clarithromycin is alarming since it has reached more than 20% in many regions (2, 21, 22), a similar finding to what we found in our study (23%). In Iran, the prevalence of clarithromycin-resistant H. pylori ranges 15-45%, which is in line with the results of current report (23%) (19, 23, 24). The prevalence of metronidazole-resistant H. pylori varies from 20 to 40% among the western countries (25, 26), however, this rate is at least two folds in developing countries, includes Iran (19, 27, 28). Although the rate of metronidazole resistance among the H. pylori strains in our survey was not higher than others but we think that small size of population was the main reason for this determined rate. We have sequenced the rdxA fragment and we understood that no predicted mutation was observed, a novel findings which had never been 7
reported, at least among the Iranian population. Although the prevalence of clarithromycin in this study was also in expected range of developing countries, it is recommended that alternative regimens should be chosen if the clarithromycin resistance rate is higher than 15%. Interestingly, debets ossenkopp et al, showed that the 200bp deletion in the rdxA gene was necessary to induce the resistance to metronidazole among the H. pylori NCTC11637, however, we have found metronidazole resistant strains without rdxA mutations (26). Close to our findings, mohammadi et al reported that only 5% of metronidazole resistant strains are carrying at least a mutation in rdxA gene (16). In contrast, abdollahi et al, found that 22% of resistant strains exhibited that rdxA deletion mutation. However, these two recent Iranian studies showed controversial result in comparison with our experiment (29). The main limitation in this research was the relatively low number of sample size. Indeed, successful bacterial culture found for 36.5% of registered patients; a relatively low rate which clearly indicates on difficulties in H. pylori culture due to the various fungal contaminations. In other hand, since our findings have shown no mutation in rdxA gene attributed to the resistance phenotype, we assume that other genes or different mechanisms might be influencing in emergence of metronidazole resistance of H. pylori. Chisholm et al evaluated more than 46 clinical isolates to find any mutations contributing in metronidazole resistance phenotype, but, no mutations were reported (30). Based on our result, using the rdxA as a marker gene for detection of responsible mutation for metronidazole resistance genotype may not be useful in clinical settings. Conclusion Current results highlight the critical role of H. pylori molecular susceptibility approaches for gastroenterologists in order to define improved therapeutic regimen against this persistent bacterium. Our findings will be helpful to design more effective and logic antibiotic therapy to 8
successfully eradicate the H. pylori in patients with severe gastroduodenal disorders. Detecting the H. pylori isolates with no responsible mutation at rdxA gene shows the necessaire for new studies to check other possible molecular mechanisms conferring the resistance phenotype to H. pylori resistant to metronidazole. Acknowledgments This study was financially supported by the research deputy of Tarbiat Modares University, Tehran, Iran. References 1. Mégraud F. A humble bacterium sweeps this year's Nobel Prize. Cell. 2005;123(6):975-6. 2. Fallone CA, Moss SF, Malfertheiner P. Reconciliation of Recent Helicobacter pylori Treatment Guidelines in a Time of Increasing Resistance to Antibiotics. Gastroenterology. 2019. 3. Suerbaum S, Michetti P. Helicobacter pylori infection. New England Journal of Medicine. 2002;347(15):1175-86. 4. Lee Y-C, Chiang T-H, Liou J-M, Chen H-H, Wu M-S, Graham DY. Mass eradication of Helicobacter pylori to prevent gastric cancer: theoretical and practical considerations. Gut and liver. 2016;10(1):12. 5. Malfertheiner P, Megraud F, O'morain C, Gisbert J, Kuipers E, Axon A, et al. Management of Helicobacter pylori infection—the Maastricht V/Florence consensus report. Gut. 2017;66(1):6-30. 6. Mégraud F. Time to change approaches to Helicobacter pylori management. The Lancet Gastroenterology & Hepatology. 2017;2(10):692-3. 7. Phan TN, Santona A, Tran VH, Tran TNH, Cappuccinelli P, Rubino S, et al. High rate of levofloxacin resistance in a background of clarithromycin-and metronidazole-resistant Helicobacter pylori in Vietnam. International journal of antimicrobial agents. 2015;45(3):244-8. 8. Hu Y, Zhang M, Lu B, Dai J. Helicobacter pylori and antibiotic resistance, a continuing and intractable problem. Helicobacter. 2016;21(5):349-63. 9. O'Connor A, Lamarque D, Gisbert JP, O'Morain C. Treatment of Helicobacter pylori infection 2017. Helicobacter. 2017;22:e12410. 10. Boyanova L, Evstatiev I, Yordanov D, Markovska R, Mitov I. Three unsuccessful treatments of Helicobacter pylori infection by a highly virulent strain with quadruple antibiotic resistance. Folia microbiologica. 2016;61(4):307-10. 11. Shokri-Shirvani J, Zamani V, Zamani M. global emergence of Helicobacter pylori antibiotic resistance–unanswered questions. Alimentary pharmacology & therapeutics. 2016;43(11):1249-. 12. Park JY, Dunbar KB, Mitui M, Arnold CA, Lam-Himlin DM, Valasek MA, et al. Helicobacter pylori clarithromycin resistance and treatment failure are common in the USA. Digestive diseases and sciences. 2016;61(8):2373-80. 13. Thung I, Aramin H, Vavinskaya V, Gupta S, Park J, Crowe S, et al. the global emergence of Helicobacter pylori antibiotic resistance. Alimentary pharmacology & therapeutics. 2016;43(4):514-33. 9
14. Mégraud F, Lehours P. Helicobacter pylori detection and antimicrobial susceptibility testing. Clinical microbiology reviews. 2007;20(2):280-322. 15. Lee Y-C, Chiang T-H, Chou C-K, Tu Y-K, Liao W-C, Wu M-S, et al. Association between Helicobacter pylori eradication and gastric cancer incidence: a systematic review and meta-analysis. Gastroenterology. 2016;150(5):1113-24. e5. 16. Mohammadi M, Doroud D, Mohajerani N, Massarrat S. Helicobacter pylori antibiotic resistance in Iran. World journal of gastroenterology: WJG. 2005;11(38):6009. 17. Savoldi A, Carrara E, Graham DY, Conti M, Tacconelli E. Prevalence of antibiotic resistance in Helicobacter pylori: a systematic review and meta-analysis in World Health Organization regions. Gastroenterology. 2018;155(5):1372-82. e17. 18. Muñoz N, Sánchez-Delgado J, Baylina M, Puig I, López-Góngora S, Suarez D, et al. Systematic review, meta-analysis, and meta-regression: Successful second-line treatment for Helicobacter pylori. Helicobacter. 2018;23(3):e12488. 19. Yousefi-Avarvand A, Vaez H, Tafaghodi M, Sahebkar AH, Arzanlou M, Khademi F. Antibiotic resistance of Helicobacter pylori in Iranian children: a systematic review and meta-analysis. Microbial Drug Resistance. 2018;24(7):980-6. 20. Zamani M, Ebrahimtabar F, Zamani V, Miller W, Alizadeh-Navaei R, Shokri-Shirvani J, et al. Systematic review with meta-analysis: the worldwide prevalence of Helicobacter pylori infection. Alimentary pharmacology & therapeutics. 2018;47(7):868-76. 21. Siddique O, Ovalle A, Siddique AS, Moss SF. Helicobacter pylori infection: an update for the internist in the age of increasing global antibiotic resistance. The American journal of medicine. 2018;131(5):473-9. 22. Kageyama C, Sato M, Sakae H, Obayashi Y, Kawahara Y, Mima T, et al. Increase in antibiotic resistant Helicobacter pylori in a University Hospital in Japan. Infection and drug resistance. 2019;12:597. 23. Haghighi MB, Dara N, Mansour Ghanaie R, Azimi L, Hosseini A, Tajalli S, et al. Evaluation of Clarithromycin and Metronidazole Resistance of Helicobacter Pylori Infection in Symptomatic Iranian Children. International Journal of Pediatrics. 2019;7(2):8925-33. 24. Amin M, Shayesteh AA, Serajian A, Goodarzi H. Assessment of Metronidazole and Clarithromycin Resistance Among Helicobacter pylori Isolates of Ahvaz (Southwest of Iran) During 2015 - 2016 by Phenotypic and Molecular Methods. Jundishapur J Microbiol. 2019;12(4):e80156. 25. Marques B, Donato MM, Cardoso O, Luxo C, Martinho A, Almeida N. Study of rdxA and frxA genes mutations in metronidazole-resistant and-susceptible Helicobacter pylori clinical isolates from the central region of Portugal. Journal of global antimicrobial resistance. 2019;17:300-4. 26. Deyi VYM, Burette A, Ntounda R, Elkilic O, Cadranel S, Bontems P, et al. Update of primary Helicobacter pylori resistance to antimicrobials in Brussels, Belgium. Diagnostic microbiology and infectious disease. 2019:114875. 27. Pourakbari B, Mahmoudi S, Parhiz J, Sadeghi R, Monajemzadeh M, Mamishi S. High frequency of metronidazole and clarithromycin-resistant Helicobacter pylori in formalin-fixed, paraffin-embedded gastric biopsies. British journal of biomedical science. 2018;75(2):61-5. 28. Saniee P, Hosseini F, Kadkhodaei S, Siavoshi F, Khalili-Samani S. Helicobacter pylori Multidrug Resistance Due to Misuse of Antibiotics in Iran. Archives of Iranian Medicine (AIM). 2018;21(7). 29. Abdollahi H, Savari M, Zahedi MJ, DARVISH MS, HAYATBAKHSH AM. A study of rdxA gene deletion in metronidazole resistant and sensitive Helicobacter pylori isolates in Kerman, Iran. 2011. 30. Chisholm SA, Owen RJ. Mutations in Helicobacter pylori rdxA gene sequences may not contribute to metronidazole resistance. Journal of Antimicrobial Chemotherapy. 2003;51(4):995-9.
10
Table 1: Primers sequence and PCR condition Genes
Primer sequence (5` ͢ 3`)
PCR
PCR conditions
References
94°C , 5 mins,94°C ,45s, 57°C ,1min, 72°C , 30s(35
[6]
product (bp)
glmM
AAGCTTACTTTCTAACACTA
294
cycles) AAGCTTTTAGGGGTGTT
rdxA
GCAACTATCCAATCCCATCAAG
360
94°C , 5 mins 94°C ,45s, 55°C ,1min, 72°C , 30s(35
[6]
cycles) GCCAGACTATCGCCAAGC
rdxA
AATTTGAGCATGGGGCAGA
850
94°C , 5 mins 94°C ,45s, 58°C ,1min, 72°C , 30s(35
[6]
cycles) GAAACGCTTGAAAACACCCCT
23srRNA
CCACAGCGATGTGGTCTCAGCAAA
ATGACTCCATAAGAGCCAAAGCCCT
429
95°C , 5 mins 95°C ,30s, 54°C ,30S, 72°C , 30s(35 cycles)
[6]
Table 2: Antibiotic resistance profile of various patients according to the age range and gender
Antibiotic susceptibility Number of isolates (%) Gender
CLR
MTZ P value
R
S
33 (45.3)
40 (54.7)
Age group (25-35)
18 (F) 4
15 (M) 3
18 (F) 6
22 (M) 5
Age group (36-45)
2
5
5
Age group (46-55)
5
2
0
Age group (56-65)
0
2
Age group (66-75)
3
3
Age group (>75)
4
0
>0.05 >0.05
P value
R
S
17 (23.3)
56 (76.7)
>0.05
>0.05
8 (F) 2
9 (M) 3
24 (F) 6
32 (M) 6
>0.05
1
>0.05
1
0
2
6
>0.05
3
>0.05
0
0
4
3
>0.05
2
4
>0.05
3
2
2
6
>0.05
4
4
>0.05
2
1
4
6
>0.05
1
5
>0.05
0
3
6
5
>0.05
Abbreviations: MTZ: Metronidazole, CLR: Clarithromycin, R: Resistance, S: Susceptible, F: Female, M: Male
>0.05
Table 3: Diseases distribution of 73 patients infected with H. pylori versus resistance status
CLR-Resistant
MTZ-Resistant
Multidrug resistant isolates
G N=44
8
19
6
>0.05
DU N=10
5
4
2
>0.05
GU N=16
4
9
2
>0.05
0 (n=17)
1 (n=33)
0 (n=10)
>0.05
Resistance
Resistance status
P value
Diseases
GC N=3 Total numbers (n=73) Abbreviations:
GC: Gastric cancer, G: Gastritis, DU: Duodenal ulcer, GU: Gastric ulcer, MTZ: Metronidazole, CLR: Clarithromycin,
S2052-2975(19)30133-7
DOI:
https://doi.org/10.1016/j.nmni.2019.100636
Reference:
NMNI 100636
To appear in:
New Microbes and New Infections
Received Date: 31 July 2019 Revised Date:
3 December 2019
Accepted Date: 10 December 2019
Please cite this article as: Rezaei S, Bezmin Abadi AT, Mobarez AM, Metronidazole-resistant Helicobacter pylori isolates without rdxA mutations obtained from Iranian dyspeptic patients, New Microbes and New Infections, https://doi.org/10.1016/j.nmni.2019.100636. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.
TITLE PAGE
Title: Metronidazole-resistant Helicobacter pylori isolates without rdxA mutations obtained from Iranian dyspeptic patients Running title: metronidazole-resistant Helicobacter pylori Author’s names: Shiva Rezaei [1], Amin Talebi Bezmin Abadi [1], Ashraf Mohabati Mobarez [1] [1]
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran.
_____________________
Corresponding author: Amin Talebi Bezmin Abadi, (Ph. D) Assistant professor, Phone: 00982182884883 Corresponding author address: Tarbiat Modares University, Dept of Bacteriology, P.O. Box: 14115-111, Tehran, Iran e-mail: [email protected]
Financial Support and Acknowledgments: This study was financially supported by the research deputy of Tarbiat Modares University, Tehran, Iran.
Metronidazole-resistant Helicobacter pylori isolates without rdxA mutations obtained from Iranian dyspeptic patients Abstract Introduction: Since the emergence of antibiotic resistance is now accepted as the inevitable factor of H. pylori treatment failure, a survey on antibiotic susceptibility profile is welcomed. Additionally, the main molecular mechanism conferring the antibiotic resistance in H. pylori is not fully determined, particularly about metronidazole. Our single-center study was designed to evaluate the local antibiotic resistance profile on H. pylori strains recovered from dyspeptic patients. Materials and Methods: Gastric biopsy specimens from 200 patients were applied to the bacterial culture of H. pylori, thereafter, bacterial identification will be confirmed by positive reports from biochemical and genotypic universal protocols. Antibiotic susceptibility tests were performed for all seventy-three isolates by both disc diffusion and E-test methods. DNA extraction was done on single colonies of H. pylori confirmed by biochemical tests, then PCR to amplify the rdxA and 23sRNA genes were conducted. Metronidazole and clarithromycin resistance phenotypes were also checked to detect possible mutations at rdxA and 23S rRNA genes. Results: Successful bacterial culture was reported in 73/200 included patients. Overall, 73 patients (27 male 36% and 46 female 63%) were entered in our survey with an age range from 25 to 80 years (mean age of 54 years). None of patients were reported the pre-treatment. Among the 73 biochemically and genotypically confirmed H. pylori isolates in this analysis, antibiotic resistance rates were: 45% (33/73) for metronidazole and 23% (17/73) for clarithromycin. Additionally, we have found ten H. pylori isolates as multidrug resistant (13%). According to the antibiogram analysis, 13/17 (76%) had the A2142G mutation, however, 3/17 (17%) samples were also showed A2143G. None of our investigated resistant isolates were carrying the A2142C and A2144G mutations. Moreover, none of the metronidazole resistant strains were shown any of the point mutations. Conclusion: Identification of H. pylori isolates without rdxA mutation reveals the necessaire for an urgent investigation to select an effective antibiotic before drug prescription by gastroenterologists. Keywords: antibiotic resistance, clarithromycin, E-test, Helicobacter pylori, metronidazole, mutation 1
Running title: Metronidazole-resistant H. pylori Introduction The news of Helicobacter pylori (H. pylori) association with a wide range of gastroduodenal diseases was a renaissance in the gastroenterology over the last century (1). This spiral but the rapidly motile bacterium stays long-life in human gastric mucosa, if effective antibiotics are not prescribed (2). It is more than 30 years that we have acknowledged an essential role of H. pylori as a causative agent of chronic gastritis as well as being a major risk factor in the development of gastric cancer (3, 4). The designation of an effective therapy conferring the
successful
eradication of H. pylori is a key point in the management of the aforementioned digestive diseases (5, 6). To date, the generally accepted anti-H. pylori therapy is consists of a classic proton-pump inhibitors (PPIs) in combination with two antibiotics from amoxicillin, clarithromycin and metronidazole (2). The mentioned therapeutic regimen termed standard triple therapy may be under question if the rate of clarithromycin resistance rises up to 15% (7, 8). Given acceptable antibacterial effect of metronidazole on H. pylori even during the in vivo experiments, it is now considered as permanent member of antibacterial regimens used in clinical approaches by gastroenterologists (9, 10). So far, clarithromycin is also an inevitable drug in all anti-H. pylori treatment formulations (11), however, rising trend of its resistance rate hampered many of recommended therapies to eradicate this persistent bacterium (12, 13). In order to determine the susceptibility profile, there are different but consistent methods available for microbiologists. Disk diffusion as the easiest and most cost-effective approach was primarily applied to screen the H. pylori antibiotic-resistant isolates (14). Epsilometer agar diffusion gradient test (E-test) is also a quantitative variant of the disk diffusion method which exhibits a good correlation with other methods (14). An updated meta-analysis proved that successful eradication of H. pylori is clearly bound with reduced occurrence of gastric cancer and such 2
severe gastroduodenal diseases (15). The mentioned clinical reasons highlighted the importance of having an up to date data on antibiotic resistance of this bacterium. Unfortunately, the ongoing lacking is that no active surveillance system is running to track those resistant strains by Iranian health authorities (16). Hereby, we aimed to determine the prevalence of antibiotic resistance against both clarithromycin and metronidazole among H. pylori isolates recovered from antral biopsies of patients admitted to the Imam-Khomeini Hospital at Tehran, Iran, during 2015-2018. Materials and methods Patients A total number of 200 antral biopsy specimens were collected from subjects suffering from different gastroduodenal disorders who were admitted to gastroenterology unit of Imam Khomeini Hospital (Tehran, Iran) during the 2015-2018. Exclusion criteria were as follow; report of severe systemic diseases (e.g. abdominal surgery) in last 6 months, age under 18 years old, consumption of antibiotics in last two months prior to the endoscopy, consumption of bismuth salts in last month before the endoscopy, and antiplatelet drugs within one week of admission. The H. pylori strains were isolated from antral biopsies of dyspeptic patients which had been subjected to endoscopy after the first visit due to the gastroduodenal complains registered by expert clinicians. In this survey, written informed consent form was taken from each participating patient, while our study was approved by the ethical committee of Tarbiat Modares
University
following
a
rigorous
IR.TMU.REC.1395.514). Antral biopsy collection and H. pylori culture
3
peer-review
process,
(Ethics
code:
Two biopsy specimens were first taken, the first one was sent for pathology department for histopathological examination, second piece was also shipped within 2-4 hours to the laboratory in Eppendorf tubes containing thioglycolate broth medium at cold-box (14). Bacterial culture was conducted briefly described as follow; biopsy specimen was gently vortexed, then the homogenate was inoculated in to the Brucella agar (Merck, Germany) plates supplemented with 5% defibrinated sheep blood (Bahar-Azma, Iran), 10% fetal bovine serum (FBS) (Sigma, USA), Campylobacter selective supplement (Merck, Germany), and 5 mg/l of amphotericin B (Merck, Germany) (14). Incubation period was 7-14 days while the student was requested to check the plates for suspected colonies after the 5 days. Microaerophilic condition (10% CO2, 5% O2 and 85% N2) was used during the incubation period to provide the situation to let the H. pylori to optimally grow. Following the incubation period, the H. pylori cultures were investigated by the first, Gram staining, translucent colonies determined by naked eyes and three common biochemical tests (catalase, oxidase and urease)(14). The confirmed isolates were chosen for second bacterial culture to achieve single colony (to avoid mixed infections). The selected isolates were the subject of susceptibility tests and PCR. Antibiotic susceptibility test Modified Disk Diffusion Method (MDDM) was used to investigate the susceptibility of H. pylori isolate to clarithromycin (15 mg) and metronidazole (5 mg) (HIMEDIA, India). For this purpose, bacterial suspensions were prepared in the sterile saline (2 ml) equivalent to 3 McFarland standard (~9.0×108CFU/mL). The suspensions were streaked onto Muller Hinton agar supplemented with 5% sheep blood (Bahar-Afshan, Iran). After 10 minutes of inoculation, antibiotic disks were placed and incubated in microaerophilic atmosphere at 37°C for 5-8 days. Susceptibility testing and interpretive criteria were interpreted according to Clinical and 4
Laboratory Standards Institute (CLSI) guideline; inhibition zone for metronidazole was <16 mm and no inhibition zone for clarithromycin. Determination of Minimum inhibitory concentration (MIC) In our study, MICs were determined by the E-test (E-test, Biomerieux, France). A bacterial suspension equal to the concentration equivalent to 3 McFarland standard (~9.0×108CFU/mL) was used to identify MIC for those selected H. pylori strains. To perform E-test (AB Biodisk, Solna, Sweden), suspensions from primary plates were prepared in sterile saline solution at a concentration of equivalent to concentration equivalent of 3 McFarland and streaked onto Muller Hinton agar medium (Mueller Hinton Agar, Merck, Germany) plates supplemented with sheep blood 5% vol/vol (Bahar-Azma, Tehran, Iran). The clean E-test strips were located onto the dried surface of inoculated agar plates. The plates were incubated in a microaerophilic condition at 37°C for 72 hours or maximally two more days until a visible inhibition ellipse was disclosed. As suggested in the European Committee on Antimicrobial Susceptibility Testing recommendations (EUCAST, 2013), MIC values of 0.5 and 8 mg/L are the cut-offs above which H. pylori is deemed resistant to clarithromycin and metronidazole, respectively. In our survey, the MIC was measured and reported at the lowest antibiotic concentration where H. pylori growth was inhibited. H. pylori 26695 reference strain was used as quality control to ensure accuracy of these findings. Polymerase chain reactions (PCR) DNA was extracted from all resistant H. pylori isolates and reference strain. Bacterial DNA isolation from H. pylori single colonies was done by using “Yekta-Tajhiz-Azma” as described by the manufacturer instructions with minor modifications. DNA samples were the subject of glmM 5
(as specific species gene for H. pylori) PCR to confirm biochemical tests. Later, the remaining DNA was subsequently stored at -20°C until further usage. Resistant isolates were selected to evaluate the mutation profile of the rdxA and 23srRNA genes. Using an automatic Thermocycler (Eppendorf Personal 5332, Germany), PCR was done based on the published protocols with minor changes. Table 1 provides details of the primer sequences and PCR conditions. Statistical analysis: In order to report significant association between presence of mutations and gastroduodenal diseases, age and gender, we have used Fisher‘s exact test while the P value less than 0.05 was considered as statistically significant. Moreover, data analysis was performed by software SPSS version 18.0. Results: Over the three years (2015-2018), two hundreds patients who underwent the upper gastroscopy in Imam Khomeini hospital, Tehran Iran were included in our analysis. In this duration, a total number of 73 isolates of H. pylori were obtained and confirmed as single colony according to the bacterial culture and glmM specific PCR method. Overall, 73 patients (27 male 36% and 46 female 63%) were included with a wide age range from 25 to 80 years (mean age of 54 years). Following the endoscopic investigation and histological analysis of each H. pylori positive biopsy specimens revealed that of the 73 subjects, 44 were gastritis (60 %), 16 were gastric ulcer (22 %), 10 were duodenal ulcers (13.6 %), and 3 were gastric cancer (4%). Table 2 shows antibiotic susceptibility profile against different patients according to the age range and gender. Table 3 presents various diseases groups found for patients carrying the antibiotic susceptible and resistant H. pylori isolates. However, no significant association was detected between 6
clinical outcome, age, gender and antibiotic resistance among the H. pylori isolates (Tables 2, 3) (P>0.05). Overall antibiotic resistance rates were: 45% (33/73) for metronidazole and 23% (17/73) for clarithromycin. Current results revealed that 10 isolates (13.6%) were multidrug resistant (Table 3). None of our resistant isolates to metronidazole were positive for any rdxA mutations. According to the antibiogram analysis, 13/17 (76%) had the A2142G mutation, however, 3/17 (17%) samples were also showed A2143G. Additionally, none of our resistant isolates were carrying the A2142C and A2144G mutations. Discussion During the last years, the success of triple therapy against H. pylori was endangered since antibiotic resistance was rapidly rising. Many recent meta-analysis were confirmed the increasing trend of antibiotic resistance among the H. pylori strains is alarming; thus an urgent input especially by microbiologists and gastroenterologists are required (17, 18). Looking back in to the national and international records, it concluded that H. pylori treatment becoming tough, therefore, updated guideline with better modification seems the clinical solution (19, 20). The antibiotic resistance to clarithromycin is alarming since it has reached more than 20% in many regions (2, 21, 22), a similar finding to what we found in our study (23%). In Iran, the prevalence of clarithromycin-resistant H. pylori ranges 15-45%, which is in line with the results of current report (23%) (19, 23, 24). The prevalence of metronidazole-resistant H. pylori varies from 20 to 40% among the western countries (25, 26), however, this rate is at least two folds in developing countries, includes Iran (19, 27, 28). Although the rate of metronidazole resistance among the H. pylori strains in our survey was not higher than others but we think that small size of population was the main reason for this determined rate. We have sequenced the rdxA fragment and we understood that no predicted mutation was observed, a novel findings which had never been 7
reported, at least among the Iranian population. Although the prevalence of clarithromycin in this study was also in expected range of developing countries, it is recommended that alternative regimens should be chosen if the clarithromycin resistance rate is higher than 15%. Interestingly, debets ossenkopp et al, showed that the 200bp deletion in the rdxA gene was necessary to induce the resistance to metronidazole among the H. pylori NCTC11637, however, we have found metronidazole resistant strains without rdxA mutations (26). Close to our findings, mohammadi et al reported that only 5% of metronidazole resistant strains are carrying at least a mutation in rdxA gene (16). In contrast, abdollahi et al, found that 22% of resistant strains exhibited that rdxA deletion mutation. However, these two recent Iranian studies showed controversial result in comparison with our experiment (29). The main limitation in this research was the relatively low number of sample size. Indeed, successful bacterial culture found for 36.5% of registered patients; a relatively low rate which clearly indicates on difficulties in H. pylori culture due to the various fungal contaminations. In other hand, since our findings have shown no mutation in rdxA gene attributed to the resistance phenotype, we assume that other genes or different mechanisms might be influencing in emergence of metronidazole resistance of H. pylori. Chisholm et al evaluated more than 46 clinical isolates to find any mutations contributing in metronidazole resistance phenotype, but, no mutations were reported (30). Based on our result, using the rdxA as a marker gene for detection of responsible mutation for metronidazole resistance genotype may not be useful in clinical settings. Conclusion Current results highlight the critical role of H. pylori molecular susceptibility approaches for gastroenterologists in order to define improved therapeutic regimen against this persistent bacterium. Our findings will be helpful to design more effective and logic antibiotic therapy to 8
successfully eradicate the H. pylori in patients with severe gastroduodenal disorders. Detecting the H. pylori isolates with no responsible mutation at rdxA gene shows the necessaire for new studies to check other possible molecular mechanisms conferring the resistance phenotype to H. pylori resistant to metronidazole. Acknowledgments This study was financially supported by the research deputy of Tarbiat Modares University, Tehran, Iran. References 1. Mégraud F. A humble bacterium sweeps this year's Nobel Prize. Cell. 2005;123(6):975-6. 2. Fallone CA, Moss SF, Malfertheiner P. Reconciliation of Recent Helicobacter pylori Treatment Guidelines in a Time of Increasing Resistance to Antibiotics. Gastroenterology. 2019. 3. Suerbaum S, Michetti P. Helicobacter pylori infection. New England Journal of Medicine. 2002;347(15):1175-86. 4. Lee Y-C, Chiang T-H, Liou J-M, Chen H-H, Wu M-S, Graham DY. Mass eradication of Helicobacter pylori to prevent gastric cancer: theoretical and practical considerations. Gut and liver. 2016;10(1):12. 5. Malfertheiner P, Megraud F, O'morain C, Gisbert J, Kuipers E, Axon A, et al. Management of Helicobacter pylori infection—the Maastricht V/Florence consensus report. Gut. 2017;66(1):6-30. 6. Mégraud F. Time to change approaches to Helicobacter pylori management. The Lancet Gastroenterology & Hepatology. 2017;2(10):692-3. 7. Phan TN, Santona A, Tran VH, Tran TNH, Cappuccinelli P, Rubino S, et al. High rate of levofloxacin resistance in a background of clarithromycin-and metronidazole-resistant Helicobacter pylori in Vietnam. International journal of antimicrobial agents. 2015;45(3):244-8. 8. Hu Y, Zhang M, Lu B, Dai J. Helicobacter pylori and antibiotic resistance, a continuing and intractable problem. Helicobacter. 2016;21(5):349-63. 9. O'Connor A, Lamarque D, Gisbert JP, O'Morain C. Treatment of Helicobacter pylori infection 2017. Helicobacter. 2017;22:e12410. 10. Boyanova L, Evstatiev I, Yordanov D, Markovska R, Mitov I. Three unsuccessful treatments of Helicobacter pylori infection by a highly virulent strain with quadruple antibiotic resistance. Folia microbiologica. 2016;61(4):307-10. 11. Shokri-Shirvani J, Zamani V, Zamani M. global emergence of Helicobacter pylori antibiotic resistance–unanswered questions. Alimentary pharmacology & therapeutics. 2016;43(11):1249-. 12. Park JY, Dunbar KB, Mitui M, Arnold CA, Lam-Himlin DM, Valasek MA, et al. Helicobacter pylori clarithromycin resistance and treatment failure are common in the USA. Digestive diseases and sciences. 2016;61(8):2373-80. 13. Thung I, Aramin H, Vavinskaya V, Gupta S, Park J, Crowe S, et al. the global emergence of Helicobacter pylori antibiotic resistance. Alimentary pharmacology & therapeutics. 2016;43(4):514-33. 9
14. Mégraud F, Lehours P. Helicobacter pylori detection and antimicrobial susceptibility testing. Clinical microbiology reviews. 2007;20(2):280-322. 15. Lee Y-C, Chiang T-H, Chou C-K, Tu Y-K, Liao W-C, Wu M-S, et al. Association between Helicobacter pylori eradication and gastric cancer incidence: a systematic review and meta-analysis. Gastroenterology. 2016;150(5):1113-24. e5. 16. Mohammadi M, Doroud D, Mohajerani N, Massarrat S. Helicobacter pylori antibiotic resistance in Iran. World journal of gastroenterology: WJG. 2005;11(38):6009. 17. Savoldi A, Carrara E, Graham DY, Conti M, Tacconelli E. Prevalence of antibiotic resistance in Helicobacter pylori: a systematic review and meta-analysis in World Health Organization regions. Gastroenterology. 2018;155(5):1372-82. e17. 18. Muñoz N, Sánchez-Delgado J, Baylina M, Puig I, López-Góngora S, Suarez D, et al. Systematic review, meta-analysis, and meta-regression: Successful second-line treatment for Helicobacter pylori. Helicobacter. 2018;23(3):e12488. 19. Yousefi-Avarvand A, Vaez H, Tafaghodi M, Sahebkar AH, Arzanlou M, Khademi F. Antibiotic resistance of Helicobacter pylori in Iranian children: a systematic review and meta-analysis. Microbial Drug Resistance. 2018;24(7):980-6. 20. Zamani M, Ebrahimtabar F, Zamani V, Miller W, Alizadeh-Navaei R, Shokri-Shirvani J, et al. Systematic review with meta-analysis: the worldwide prevalence of Helicobacter pylori infection. Alimentary pharmacology & therapeutics. 2018;47(7):868-76. 21. Siddique O, Ovalle A, Siddique AS, Moss SF. Helicobacter pylori infection: an update for the internist in the age of increasing global antibiotic resistance. The American journal of medicine. 2018;131(5):473-9. 22. Kageyama C, Sato M, Sakae H, Obayashi Y, Kawahara Y, Mima T, et al. Increase in antibiotic resistant Helicobacter pylori in a University Hospital in Japan. Infection and drug resistance. 2019;12:597. 23. Haghighi MB, Dara N, Mansour Ghanaie R, Azimi L, Hosseini A, Tajalli S, et al. Evaluation of Clarithromycin and Metronidazole Resistance of Helicobacter Pylori Infection in Symptomatic Iranian Children. International Journal of Pediatrics. 2019;7(2):8925-33. 24. Amin M, Shayesteh AA, Serajian A, Goodarzi H. Assessment of Metronidazole and Clarithromycin Resistance Among Helicobacter pylori Isolates of Ahvaz (Southwest of Iran) During 2015 - 2016 by Phenotypic and Molecular Methods. Jundishapur J Microbiol. 2019;12(4):e80156. 25. Marques B, Donato MM, Cardoso O, Luxo C, Martinho A, Almeida N. Study of rdxA and frxA genes mutations in metronidazole-resistant and-susceptible Helicobacter pylori clinical isolates from the central region of Portugal. Journal of global antimicrobial resistance. 2019;17:300-4. 26. Deyi VYM, Burette A, Ntounda R, Elkilic O, Cadranel S, Bontems P, et al. Update of primary Helicobacter pylori resistance to antimicrobials in Brussels, Belgium. Diagnostic microbiology and infectious disease. 2019:114875. 27. Pourakbari B, Mahmoudi S, Parhiz J, Sadeghi R, Monajemzadeh M, Mamishi S. High frequency of metronidazole and clarithromycin-resistant Helicobacter pylori in formalin-fixed, paraffin-embedded gastric biopsies. British journal of biomedical science. 2018;75(2):61-5. 28. Saniee P, Hosseini F, Kadkhodaei S, Siavoshi F, Khalili-Samani S. Helicobacter pylori Multidrug Resistance Due to Misuse of Antibiotics in Iran. Archives of Iranian Medicine (AIM). 2018;21(7). 29. Abdollahi H, Savari M, Zahedi MJ, DARVISH MS, HAYATBAKHSH AM. A study of rdxA gene deletion in metronidazole resistant and sensitive Helicobacter pylori isolates in Kerman, Iran. 2011. 30. Chisholm SA, Owen RJ. Mutations in Helicobacter pylori rdxA gene sequences may not contribute to metronidazole resistance. Journal of Antimicrobial Chemotherapy. 2003;51(4):995-9.
10
Table 1: Primers sequence and PCR condition Genes
Primer sequence (5` ͢ 3`)
PCR
PCR conditions
References
94°C , 5 mins,94°C ,45s, 57°C ,1min, 72°C , 30s(35
[6]
product (bp)
glmM
AAGCTTACTTTCTAACACTA
294
cycles) AAGCTTTTAGGGGTGTT
rdxA
GCAACTATCCAATCCCATCAAG
360
94°C , 5 mins 94°C ,45s, 55°C ,1min, 72°C , 30s(35
[6]
cycles) GCCAGACTATCGCCAAGC
rdxA
AATTTGAGCATGGGGCAGA
850
94°C , 5 mins 94°C ,45s, 58°C ,1min, 72°C , 30s(35
[6]
cycles) GAAACGCTTGAAAACACCCCT
23srRNA
CCACAGCGATGTGGTCTCAGCAAA
ATGACTCCATAAGAGCCAAAGCCCT
429
95°C , 5 mins 95°C ,30s, 54°C ,30S, 72°C , 30s(35 cycles)
[6]
Table 2: Antibiotic resistance profile of various patients according to the age range and gender
Antibiotic susceptibility Number of isolates (%) Gender
CLR
MTZ P value
R
S
33 (45.3)
40 (54.7)
Age group (25-35)
18 (F) 4
15 (M) 3
18 (F) 6
22 (M) 5
Age group (36-45)
2
5
5
Age group (46-55)
5
2
0
Age group (56-65)
0
2
Age group (66-75)
3
3
Age group (>75)
4
0
>0.05 >0.05
P value
R
S
17 (23.3)
56 (76.7)
>0.05
>0.05
8 (F) 2
9 (M) 3
24 (F) 6
32 (M) 6
>0.05
1
>0.05
1
0
2
6
>0.05
3
>0.05
0
0
4
3
>0.05
2
4
>0.05
3
2
2
6
>0.05
4
4
>0.05
2
1
4
6
>0.05
1
5
>0.05
0
3
6
5
>0.05
Abbreviations: MTZ: Metronidazole, CLR: Clarithromycin, R: Resistance, S: Susceptible, F: Female, M: Male
>0.05
Table 3: Diseases distribution of 73 patients infected with H. pylori versus resistance status
CLR-Resistant
MTZ-Resistant
Multidrug resistant isolates
G N=44
8
19
6
>0.05
DU N=10
5
4
2
>0.05
GU N=16
4
9
2
>0.05
0 (n=17)
1 (n=33)
0 (n=10)
>0.05
Resistance
Resistance status
P value
Diseases
GC N=3 Total numbers (n=73) Abbreviations:
GC: Gastric cancer, G: Gastritis, DU: Duodenal ulcer, GU: Gastric ulcer, MTZ: Metronidazole, CLR: Clarithromycin,