susceptibility to Vibrio harveyi in golden pompano (Trachinotus ovatus)

Fish and Shellfish Immunology 80 (2018) 302–310

Contents lists available at ScienceDirect

Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

MHC class IIα polymorphism and its association with resistance/ susceptibility to Vibrio harveyi in golden pompano (Trachinotus ovatus)

T

Zhenjie Caoa,c,e, Lu Wanga,b, Yajing Xianga,b, Xiaocen Liua,b, Zhigang Tud, Yun Suna,c,∗∗, Yongcan Zhoua,c,∗ a

State Key Laboratory of Marine Resource Utilization in South China Sea, Hainan University, PR China Key Laboratory of Tropical Biological Resources of Ministry of Education, Hainan University, PR China c Hainan Provincial Key Laboratory for Tropical Hydrobiology and Biotechnology, College of Marine Science, Hainan University, PR China d Hainan Academy of Ocean and Fisheries Sciences, Haikou, Hainan, China e Institute of Tropical Agriculture and Forestry, Hainan University, PR China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Trachinotus ovatus Major histocompatibility complex class IIα Polymorphism Vibrio harveyi Disease resistance

The major histocompatibility complex (MHC) plays an important role in the vertebrate immune response to antigenic peptides, and it is essential for recognizing foreign pathogens in organisms. In this study, MHC class IIα (Trov-MHC IIα) from the golden pompano (Trachinotus ovatus) was first cloned and identified. The gene structure of Trov-MHC IIα was contained four exons and three introns. High levels of polymorphism were found in the exon 2 of Trov-MHC IIα. A total of 29 different MHC class IIα alleles with high polymorphism were identified from 80 individuals. The ratio of non-synonymous substitutions (dN) to synonymous substitutions (dS) was 3.157 (> 1) in the peptide binding regions (PBRs) of Trov-MHC IIα, suggesting positive balancing selection. Six alleles were selected to analyze the association between alleles and resistance/susceptibility to Vibrio harveyi in golden pompano. The results showed that Trov-DAA*6401 and Trov-DAA*6702 alleles were associated with the resistance to V. harveyi in golden pompano, while alleles Trov-DAA*6304 and Trov-DAA*7301 were associated with the susceptibility to V. harveyi in golden pompano. This study confirmed the association between alleles of MHC class IIα and disease resistance, and also detected some alleles which might be correlated with high V. harveyi-resistance. These disease resistance-related MHC alleles could be used as potential genetic markers for molecular marker-assisted selective breeding in the golden pompano.

1. Introduction The major histocompatibility complex (MHC) is a multigene family and plays a key role in the immune system of vertebrates; it recognizes and presents self and non-self antigens to CD8+ and CD4+ T lymphocytes [1–6]. Based on the molecular structure, function and pattern of expression, MHC is mainly classified as two classes: class I and class II [1,2]. In mammals, MHC class II (MHC II) molecules are primarily expressed on the surface of antigen-presenting cells. Generally, the MHC II molecules present extracellular pathogens to CD4+ T lymphocytes that are related to defense against extracellular pathogens [2–4]. MHC II molecules are heterodimers, which can be divided into two polypeptide chains (“α” and “β”, encoding IIα and IIβ proteins) [5,6]. MHC II genes exhibit a prominent character with a high degree of polymorphism, which is mainly concentrated within exon 2 region, according to previous studies [7–13]. Exon 2 encodes the α1/β1

∗

domains of the MHC II molecule. Together, the α1/β1 domains can form the peptide binding regions (PBRs) that govern the recognition of different pathogens [11–18]. Several major hypotheses, including gene recombination [19], gene duplication [20] and pathogen-driven balancing selection [21,22], have been put forward to explain the maintenance of high polymorphism of MHC II. Among these hypotheses, many lines of evidences have been demonstrated in support of the balancing selection supposition [10,23]. The peptide binding ability of MHC molecules are predominantly controlled by the composition of the peptide binding residues [18]. The MHC alleles present in different haplotypes influence the response of an organism towards certain pathogens [24–26]. Briefly, when certain MHC molecules fail to recognize some pathogens, the organism is therefore highly susceptible to these pathogens [24]. Alternatively, specific MHC molecules with a high affinity for certain pathogens can result in the organism exhibiting a high level of resistance to the

Corresponding author. College of Marine Sciences, Hainan University, 58 Renmin Avenue, Haikou, 570228, PR China. Corresponding author. College of Marine Sciences, Hainan University, 58 Renmin Avenue, Haikou, 570228, PR China. E-mail addresses: [email protected] (Y. Sun), [email protected] (Y. Zhou).

∗∗

https://doi.org/10.1016/j.fsi.2018.06.020 Received 6 March 2018; Received in revised form 13 May 2018; Accepted 11 June 2018 Available online 12 June 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved.

Fish and Shellfish Immunology 80 (2018) 302–310

Z. Cao et al.

2.2. RNA/DNA isolation and cDNA synthesis

pathogens [25,26]. Hence, it is very necessary to research the MHC alleles that confer resistance in economically important farmed vertebrate species in order to support the molecular marker-assisted selective breeding programs. To date, the associations between disease susceptibility/resistance and specific MHC alleles have been well documented in many vertebrates [27–31]. In chicken, one MHC haplotype was reported to be significantly linked with the resistance to Marek's disease [27]. In rainbow trout, the alleles Onmy-DAB*0201/*0904/*1102 were associated with susceptibility to IHNV, whereas the alleles OnmyDAB*0103/*0601/*1402 were associated with resistance [31]. In Japanese flounder, an association between the diversity of MHC class IIβ alleles and Vibrio anguillarum resistance had been reported [8]. The golden pompano, Trachinotus ovatus, is the common economic marine fish and the main species for offshore cage culture in southern China [32]. As its culture density has increased, many bacterial diseases have emerged, resulting in serious economic losses in golden pompano [33–35]. Vibrio harveyi (V. harveyi) is a serious pathogen of marine fish and invertebrates, causing high mortality in golden pompano [33]. Molecular marker-assisted selective breeding is an attractive alternative route to direct breed fish with improved resistance to some major pathogens [36,37]. To date, MHC genes are considered as candidate molecular markers for marine aquaculture species [18,29]. To our knowledge, there are no reports currently published on the association between MHC class IIα gene polymorphism and their resistance/susceptibility to pathogens in golden pompano. In this study, the full-length cDNA sequences and the complete genomic sequence of Trov-MHC IIα were characterized. In addition, the molecular polymorphism of the exon 2 of Trov-MHC IIα was analyzed, and the association between certain alleles and their resistance/susceptibility to V. harveyi in golden pompano was investigated. The goal of this study is to provide valuable information for marker-assisted selective breeding program in golden pompano.

Total RNA was extracted from head kidney tissue of adult individuals (T. ovatus) by the MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) following the manual. Genomic DNA was extracted from the liver of T. ovatus by using Tissue DNA Kit (OMEGA, USA). The quality of RNA/DNA was determined by electrophoresis and the concentration was measured with the NanoDrop Spectrophotometer. First-strand cDNA was synthesized with PrimeScript™ Ⅱ1st Strand cDNA Synthesis Kit (Takara, Dalian, China). 2.3. Fish and challenge test Healthy golden pompano (average body weight, 30 ± 2.1 g) were purchased from a commercial fish farm in Lingao City (Hainan province, China). The fish were acclimated in fresh seawater at 25–28 °C for one week and were fed with a commercial pellet twice daily [38]. Before experiments, fish were randomly sampled to confirm that they were in fact free of any bacteria. For euthanasia of the fish, tricaine methanesulfonate (Sigma, St. Louis, MO, USA) was used before dissection and tissue collection as previously reported by Wang [39]. V. harveyi strain QT520 with strong pathogenicity to T. ovatus was obtained from our laboratory [33]. The challenge experiment contained two groups, A (bacterial challenge group), B (control group). Group A, 300 fish were injected with 100 μL of V. harveyi with a dose of 3.0 × 106 CFU/mL. Group B, 60 fish were injected with 100 μL of phosphate-buffered saline (PBS). This test lasted for 2 weeks, mortality was counted every day. 2.4. Sampling and DNA isolation Fin clips were collected from the first 40 dead individuals of HS group and randomly 40 living individuals of HR group and stored in 95% ethanol to further examine whether the MHC IIα exon 2 alleles were associated with resistance or susceptibility to V. harveyi. Genomic DNA was extracted from the fin samples performed as given above. Finally, the concentrations of DNA samples were adjusted to 100 ng/μL and stored at −20 °C for further use.

2. Materials and methods 2.1. Primer design, polymerase chain reaction (PCR) amplification and cloning To clone the complete cDNA sequence and the genome sequences of Trov-MHC IIα, all the primers used in this study were presented in Table 1. The purified PCR products were ligated into the pEASY®-T1 Simple Cloning Vector (Transgen, Beijing, China) and transformed into Trans1-T1 Phage Resistant Chemically Competent Cell (Transgen, Beijing, China), then the positive clones were chosen by blue/white selection and detected via PCR using the M13 ± primers. Lastly, the positive clones were separately sequenced from both forward and reverse directions with vector M13 primers using ABI 3730 automated sequencer.

2.5. Primer design, PCR amplification and sequencing of exon 2 of TrovMHC IIα To amplify the exon 2 of Trov-MHC IIα, specific primers, MHCIIαF3/MHCIIα-R3 (Table 1) were designed based on the obtained cDNA and genomic DNA sequences of T. ovatus. Exon 2 fragment was amplified using genomic DNA of fins as template in a 25 μl PCR reaction mixture. The reaction mixture contained 2.5 μl of 10 × Taq polymerase buffer, 0.2 mM dNTP Mix, 0.2 μM each of the forward and reverse primers, 1 unit of Taq polymerase (Takara, Dalian, China), and 1 μl of template DNA. The cycling condition was set as follows: 94 °C for 4 min; followed by 30 cycles of 94 °C for 30 s, 56 °C for 40 s and 72 °C for 30 s;

Table 1 Primers used in this study. Primer name

Primer sequences (5′-3′)

Amplification target

MHCIIα-F1 MHCIIα-R1 3′-IIα 5′-IIα 5′and 3′-UPM MHCIIα-F2 MHCIIα-R2 MHCIIα-F3 MHCIIα-R3

GATCTGTCAYGTGACTGGTTTC AATCAKCTGCACTCGTTYCYTTTG TCTACCCTGCTCCCGTCAAAGTCTACTG GGTCCAGTAGACTTTGACGGGAGCAGGGTA CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT ATGAAGACGATGATGAAGGTG GCTGCACTCGTTTCCTTTGATG GTCTCCATGTGGACCTGTCTAT CGTTTTCCAGTGGGATGTC

cDNA fragment of Trov-MHC IIα

Notes: degeneracy base, Y=C/T, K = G/T. 303

3′race of Trov-MHC IIα 5′race of Trov-MHC IIα 5′ and 3′race of Trov-MHC IIα Genome of Trov-MHC IIα Exon 2 of Trov-MHC IIα

Fish and Shellfish Immunology 80 (2018) 302–310

Z. Cao et al.

and a final extension step of 72 °C for 10 min. The PCR products were separated on 1.2% agarose gel electrophoresis and purified using a Gel Extraction Kit (OMEGA, USA). Then the purified PCR products were ligated and transformed as mentioned above. Finally, an average of 5 positive clones per individual of HR and HS groups were selected and sequenced with M13 primers.

olivaceus (P. olivaceus) (Fig. 1B). Exon 1 includes a 53bp 5′ UTR and encodes a leader peptide (LP). Exons 1 and 2 are separated by intron 1 that is 367bp long. Exon 2 encodes the α1 domain, followed by intron 2 of 896bp long. Exon 3 encodes the α2 domain, followed by intron 3, which is 144bp long. Exon 4 encodes the connecting peptide (CP), the transmembrane region (TM) and the cytoplasmic domain (CY) and also includes the 3′ UTR region (Fig. 1B).

2.6. Bioinformation analysis 3.2. Sequence alignment and phylogenetic analysis of Trov-MHC IIα

The amino acid sequences were deduced using the DNAStar software. The signal peptide was predicted by the SignalP 4.1 online server (http://www.cbs.dtu.dk/services/). The protein structures were analyzed using the SMART program (http://smart.embl-heidelberg.de/). The PredictProtein Server was used to predict the protein secondary structure (https://www.predictprotein.org/). The DNAMAN software was used to perform multiple alignments of Trov-MHC IIα. MEGA 6 was used to construct the phylogenetic trees, using the neighbor-joining method.

Analysis of the deduced peptide sequence showed that Trov-MHC IIα was composed of a leader peptide (LP), α1 domain, α2 domain and CP/TM/CY domains. Four cysteine residues conserved among fish and human MHC IIα were found in the α1 and α2 domains, which mainly involve in forming two disulfide bonds that maintain the stability of the MHC molecule [46]. Alignment of the deduced amino acid sequence showed that Trov-MHC IIα exhibited 27.6%–78.6% identities with human and other teleosts (Fig. 2). The phylogenetic analysis showed that Trov-MHC IIα was clustered together with Epinephelus coioides, Larimichthys crocea and Dicentrarchus labrax, all of which belong to the Perciformes (Fig. 3); then clustered together with other teleosts, forming an independent group from the human.

2.7. Genotyping, sequence analysis, and selective pressure analysis The new alleles were determined according to previous research [40]. The antigen binding sites (ABS) were predicted based on the molecular structure of human MHC II [41]. The MEGA 6 was used to perform the calculation of the rates of non-synonymous (dN) and synonymous substitutions (dS) according to the method proposed by Nei & Gojobori [42] using Jukes–Cantor correction. A ratio of dN/dS < 1 indicates a purifying selection; dN/dS = 1 indicates a neutral selection; and dN/dS > 1 indicates a positive selection [10,20]. The polymorphism data for the sequence was analyzed with DNAsp 5.0 software packages [43].

3.3. Molecular polymorphism analysis of exon 2 of Trov-MHC IIα Dead individuals were defined as the high-susceptibility (HS) group, and the last survivors were defined as the high-resistance (HR) group. At the period of challenge test, no fish died in the control group. V. harveyi was the only bacteria isolated from the dead fish. In total, 400 fragments (249bp) of exon 2 of Trov-MHC IIα were obtained and confirmed based on sequence alignment with Trov-MHC IIα (GenBank accession No. KY129955). In this analysis, these fragments revealed 29 different sequences and they belonged to 19 major allele types according to the established allele nomenclature [40]. These 29 different sequences were assigned as Trov-DAA*6001–7801 (GenBank accession numbers: MG882533-MG882561, Table 2). The amino acid alignment of the 29 alleles of Trov-MHC IIα exon 2 was shown in Fig. S1. The full alignment of these 249bp sequences was observed no deletion/insertion or mutation with frame-shift. Among the 249bp nucleotides, 56/249 (22.49%) nucleotide sites were variable, of which 42 parsimony informative sites were observed. Among nucleotide regions, 8 two-nucleotide, 3 three-nucleotide and 1 four-nucleotide mutations were observed. Analysis of the single-nucleotide polymorphism (SNP) sites showed that the SNP variation sites contained 2 types of nucleotide substitution, transition mutation (Serial No. 4, 5, 11, 15, 16, 35) and transversion mutation (Serial No. 3, 6, 10, 17, 20, 21, 22, 26, 27, 29, 31, 33, 37) in Table 3. The 249bp nucleotide sequence was corresponded with a putative 83 amino acids peptide and 29 out of 83 (34.94%) was variable. Among 83 putative amino acids peptide, 19 antigen binding sites (Fig. S1) were predicted based on the corresponding antigen binding sites identified in humans [42]. According to the codon-based test of positive selection by the Nei-Gojobori method, the nonsynonymous substitution (dN) rates and the synonymous substitution (dS) rates were calculated and presented in Table 4. The results showed that the dN rate was 3.157 (> 1) times significantly higher than the dS rate in PBRs with the P-value 0.017 (< 0.05). Moreover, in non-PBRs and the whole exon 2 of TrovMHC IIα, the dN/dS ratios were 1.750 and 2.047, respectively. These data provide evidence for positive balancing selection maintaining the extensive variability in this domain. The nucleotide diversity within the exon 2 sequences of the MHC IIα for the 29 alleles denoted by Theta-W was shown in Fig. 4. The results indicated that the theta-W value ranged from 0.010 to 0.107 and the highest nucleotide diversity level occurred at point 200.

2.8. Statistical analysis Sample mortality was calculated based on the daily record during challenge test. The Statistic analysis was performed by SPSS 17.0 software. Significant difference of allele frequencies between HR and HS groups was estimated by χ2 test. Statistically significant were considered at a probability (p) value of < 0.05. 3. Results 3.1. cDNA and genomic sequences characterization of Trov-MHC IIα A full-length 2460bp Trov-MHC IIα genomic DNA (GenBank accession No. KY797161, Fig. 1A) and a full-length 1053bp Trov-MHC IIα cDNA fragment (GenBank accession No. KY129955, Fig. 1A) were obtained, respectively. The cDNA sequence includes a 5′terminal untranslated region (UTR) of 53bp, an encoding region (CDS) of 726bp and a 3′UTR of 274bp. The encoding region is composed of 241 amino acid residues with a predicted molecular mass of 26.66 kDa. The 3′UTR contains a canonical polyadenylation signal sequence (AATAAA) and a 21bp polyA tail. A conserved GxxxGxxGxxG motif (where x is any hydrophobic residue other than Gly) was found in Trov-MHC IIα, which is believed to be important for the correct interaction with the MHC IIβ chain [44,45]. One N-linked glycosylation site was observed in the α2 domain region. Two protein kinase C phosphorylation sites were found in the α2 domain region and five casein kinase II phosphorylation sites were identified in both the a1 and a2 domain regions. Six N-myristoylation sites were found in the α1, α2, and transmembrane regions. In addition, one immunoglobulin and major histocompatibility complex protein signature was observed in the a2 domain region (Fig. 1A). Compared with the obtained cDNA sequence, the genomic organization of Trov-MHC IIα contains four exons and three introns, and the same exon-intron organization was also observed in Oreochromis niloticus (O. niloticus), Verasper variegatus (V. variegatus), and Paralichthys 304

Fish and Shellfish Immunology 80 (2018) 302–310

Z. Cao et al.

Fig. 1. Genomic sequence (A) and genomic organization (B) of Trov-MHC IIα. (A) Exons are shown in uppercase and introns are in lowercase. The start codon is circled and the stop codon is indicated by an asterisk (*). N-linked glycosylation site is underlined with a straight line; casein kinaseⅡphosphorylation sites are represented with a bold curved line; protein kinase C phosphorylation sites are represented with a box; N-myristoylation sites are shown with shadow; one immunoglobulin and major histocompatibility complex protein signature is underlined with a double straight line; GxxxGxxGxxG is underlined with a dashed line. (B) The exon-intron organization of Trov-MHC IIα compared with other teleosts. The exons were represented by boxes and introns by lines. The numbers above boxes and lines were shown the length of the exons and introns, except that numbers above the exon 1 were the length of LP. LP: leader peptide; CP: connecting peptide; TM: transmembrane; CY: cytoplasmic domain.

indicated that there were at least two loci of MHC IIα gene in the genomic DNA of golden pompano. In addition, 52 (65%) of 80 individuals displayed at least two different MHC IIα sequences (Table S1). The frequency distribution of each allele was displayed in Table S2. Some of 29 different alleles were found in both HR and HS groups with different frequencies, whereas some alleles existed only in HR group or

3.4. Association between alleles and resistance/susceptibility to V. harveyi A total of 29 different alleles were obtained from 80 individuals. The distribution of alleles per individual was exhibited in Table S1. Numbers of alleles per individual ranged from 1 to 3. Considering an average of 5 positive clones in each individual was sequenced, this 305

Fish and Shellfish Immunology 80 (2018) 302–310

Z. Cao et al.

Fig. 2. Alignment of the deduced amino acid sequences of Trov-MHC IIα with those of other vertebrates. Gaps used to maximize the alignment are indicated by dots. The complete conserved amino acid residues are shown in black. The amino acid residues with conservative degree higher than 75% are shown in pink. The conserved cysteine residues are indicated with the red boxes. LP: leader peptide; CP: connecting peptide; TM: transmembrane; CY: cytoplasmic domain. The numbers in brackets are indicated the identity of the deduced amino acid sequences Trov-MHC IIα with other vertebrates, respectively. The GenBank accession numbers of the aligned sequences are: Dicentrarchus labrax, ABH09449.1; Epinephelus coioides, ACU46019.1; Larimichthys crocea, ABV48906.1; Paralichthys olivaceus, AAY18782.1; Salmo salar, CAD27782.1; Oncorhynchus mykiss, ADM95868.1; Cyprinus carpio, CAA64707.1; Danio rerio, AAA16367.1; Homo sapiens, NP_006111.2. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Fig. 3. Phylogenetic tree of Trov-MHC IIα and other vertebrates were conducted using MEGA 6 by the neighbor-joining method. Numbers on the nodes show the percentage of bootstrapping of 1000 replications. The GenBank accession numbers of other species were shown in Fig. 2.

Table 2 Alleles and GenBank accession numbers for exon 2 of Trov-MHC IIα. Allele

GenBank accession no.

Allele

GenBank accession no.

Trov-DAA*6001 Trov-DAA*6101 Trov-DAA*6201 Trov-DAA*6202 Trov-DAA*6301 Trov-DAA*6302 Trov-DAA*6303 Trov-DAA*6304 Trov-DAA*6401 Trov-DAA*6402 Trov-DAA*6501 Trov-DAA*6502 Trov-DAA*6601 Trov-DAA*6602 Trov-DAA*6701

MG882533 MG882534 MG882535 MG882536 MG882537 MG882538 MG882539 MG882540 MG882541 MG882542 MG882543 MG882544 MG882545 MG882546 MG882547

Trov-DAA*6702 Trov-DAA*6801 Trov-DAA*6901 Trov-DAA*6902 Trov-DAA*7001 Trov-DAA*7101 Trov-DAA*7201 Trov-DAA*7301 Trov-DAA*7302 Trov-DAA*7401 Trov-DAA*7501 Trov-DAA*7601 Trov-DAA*7701 Trov-DAA*7801

MG882548 MG882549 MG882550 MG882551 MG882552 MG882553 MG882554 MG882555 MG882556 MG882557 MG882558 MG882559 MG882560 MG882561

306

Fish and Shellfish Immunology 80 (2018) 302–310

Z. Cao et al.

Table 3 Distribution of single-nucleotide polymorphism (SNP) sites within exon 2 of MHC IIα sequences. Number

Position

Base type

Allele no. (n = 29)

Frequency

Number

Position

Base type

Allele no. (n = 29)

Frequency

1

25

A T G C A T G C G A A T G C T G AAG CTG ATG CTC CG TT G T C C A T A TTG TGA CGA CA TC A T G C T A C G A C TA CT GT AG A G

20 2 5 2 6 5 12 6 12 17 16 13 23 6 28 1 14 12 2 1 26 3 23 4 2 26 3 6 23 25 3 1 28 1 17 4 5 3 26 3 28 1 25 4 28 1 28 1 10 19

0.690 0.069 0.172 0.069 0.207 0.172 0.414 0.207 0.414 0.586 0.552 0.448 0.793 0.207 0.966 0.034 0.483 0.414 0.069 0.034 0.897 0.103 0.793 0.138 0.069 0.897 0.103 0.207 0.793 0.862 0.103 0.034 0.966 0.034 0.586 0.138 0.172 0.103 0.897 0.103 0.966 0.034 0.862 0.138 0.966 0.034 0.966 0.034 0.345 0.655

21

161

22

167

23

168

24

169

25

170

26

171

27

178

28

181

29

183

30

190–191

31

197

32

199–202

33

208

34

211–212

35

213

36

215–216

37

218

38

221–222

39

224–226

C T A G A C T G C A G A C A C G A A C G T G GT AC AT G A TCAG TCAA CAGA A G AA AC CT GT C G GC TA GG CC T G AA TG CCT GTA CCA

23 6 28 1 19 9 1 10 10 9 9 17 3 22 7 28 1 21 5 3 24 5 1 2 26 19 10 2 7 20 28 1 15 9 3 2 13 16 11 11 5 2 4 25 18 11 1 11 17

0.793 0.207 0.966 0.034 0.655 0.310 0.034 0.345 0.345 0.310 0.310 0.586 0.103 0.759 0.241 0.966 0.034 0.724 0.172 0.103 0.828 0.172 0.034 0.069 0.897 0.655 0.345 0.069 0.241 0.690 0.966 0.034 0.517 0.310 0.103 0.069 0.448 0.552 0.379 0.379 0.172 0.069 0.138 0.862 0.621 0.379 0.034 0.379 0.586

2

26

3

52

4

53

5

54

6

69

7

79–81

8

114–115

9

117

10

121

11

122

12

134–136

13

139–140

14

142

15

143

16

144

17

145

18

148–149

19

151–152

20

160

Table 4 The rates of non-synonymous substitutions (dN) and synonymous substitutions (dS) in the peptide binding regions (PBRs) and non-peptide binding regions (non-PBRs) of MHC IIα exon 2. Region

No. of codons

dN ± SE

dS ± SE

dN/dS

P-valuea

all PBR non-PBR

83 19 64

0.088 ± 0.019 0.161 ± 0.053 0.070 ± 0.022

0.043 ± 0.017 0.051 ± 0.040 0.040 ± 0.019

2.047 3.157 1.750

0.021* 0.017* 0.150

a P-value: the probability of rejecting the null hypothesis of neutrality (dN = dS) using the Z-test of selection and indicated by ns (nonsignificant). *P < 0.05.

HS group. However, a little of alleles had very low frequencies with insignificant meaning for analyzing the association between alleles and resistance/susceptibility to disease. In this study, 6 alleles with higher frequencies were selected for association analysis (Fig. 5). Our results indicated that Trov-DAA*6401 and Trov-DAA*6702 alleles were significantly more frequent in HR group than in HS group (p < 0.05),

Fig. 4. Nucleotide diversity within the exon 2 sequences of the MHC IIα for the 29 alleles denoted by Theta-W. Sliding window length: 50; step size 25.

307

Fish and Shellfish Immunology 80 (2018) 302–310

Z. Cao et al.

suggesting various mutated regions may have evolved from different stages of the evolution of golden pompano. Furthermore, our results showed 52 out of 80 individuals exhibited at least 2 different alleles, indicating a high degree of heterozygosity in golden pompano, similar observations were reported in Japanese flounder [29], and turbot [60]. Pathogen-driven balancing selection is considered to be the factor most responsible for genetic variation in MHC genes [4,22,23,56]. The ratio of non-synonymous/synonymous substitutions (ω = dN/dS) is regarded as the indicator for determining the type of selection acting on MHC genes [10,68,69]. Ratios of dN/dS < 1, = 1 and > 1 indicate purifying selection, neutral selection and positive selection, respectively [10,20,69]. In orange-spotted grouper and miiuy croaker, the dN of the PBR sites of MHC IIα were both higher than that of dS, suggesting the locus were evolving under balancing selection [11,18]. In the present study, the dN were significantly higher than the dS in the PBRs and non-PBRs of exon 2. These data may indicate that Trov-MHC IIα follow a strong positively balancing selection for maintaining the polymorphism of MHC II genes in the golden pompano. To date, many studies have reported that in teleosts, polymorphisms of MHC alleles are likely associated with disease resistance/susceptibility [8,29,31,70–72]. For example, in E. coioides, the EPCODAA*0101 allele was significantly associated with susceptibility to SGIV, whereas the EPCO-DAA*0104, EPCODAA*0601, EPCODAA*1101, and EPCO-DAA*1201 alleles were significantly associated with resistance to SGIV [18]. In P. olivaceus, Paol-DAA*1301, PaolDAA*1401 and Paol-DAA*2201 were demonstrated to be associated with resistance against V. anguillarum, while the Paol-DAA*1001 and Paol-DAA*1501 alleles were significantly associated with increased susceptibility to V. anguillarum [29]. In S. fontinalis, the allele SafoDAB*0101 had a significant association with the resistance against Aeromonas salmonicida [72]. To our knowledge, this study was the first to report on the association between MHC class IIα polymorphism and association with resistance/susceptibility to a bacterial pathogen, V. harveyi, in T. ovatus. The Trov-DAA*6401 and Trov-DAA*6702 alleles were observed to be associated with the resistance to V. harveyi. The alleles Trov-DAA*6304 and Trov-DAA*7301 were discovered might link with susceptibility to V. harveyi in golden pompano. Due to a reduced influence caused by variations in the background (family) genetics, analysis of the association between alleles and pathogens would be better examined among different families than in different populations [73]. However, this study was performed between the different populations to analyze the association between alleles and pathogens. Therefore, in future studies, we will pay more attention to construct the V. harveyi-resistant families of golden pompano. Furthermore, the fitness of alleles may be different in the context of infections with different pathogens [72]. Thus, future studies should be conducted to investigate and compare the association between alleles and various common pathogens of golden pompano. In conclusion, Trov-MHC IIα of golden pompano was characterized, and high molecular polymorphism of the exon 2 of Trov-MHC IIα was detected. Associations between specific Trov-MHC IIα alleles and resistance/susceptibility to V. harveyi were observed. The TrovDAA*6401 and Trov-DAA*6702 alleles were associated with the resistance to V. harveyi, while alleles Trov-DAA*6304 and TrovDAA*7301 were associated with the susceptibility to V. harveyi in golden pompano. These results may provide strategies to enhance the disease-resistance of golden pompano and guidance for selection breeding of golden pompano.

Fig. 5. Distribution of MHC IIα alleles in high-resistance group (HR) and high-susceptibility group (HS) of golden pompano. The significant differences (p < 0.05) were indicated by the asterisks.

while alleles Trov-DAA*6304 and Trov-DAA*7301 were significantly more frequent in HS group than in HR group (p < 0.05). The TrovDAA*7601 and Trov-DAA*7701 alleles owned high frequencies in both HR and HS groups but showed no difference between the HR and HS groups. Therefore, the Trov-DAA*6401 and Trov-DAA*6702 alleles were inferred to be associated with resistance to V. harveyi in golden pompano, and the alleles Trov-DAA*6304 and Trov-DAA*7301 were inferred to be associated with susceptibility to V. harveyi in golden pompano. 4. Discussion In previous studies, MHC genes of many teleosts have been characterized [47–58]. In the present study, we cloned the MHC class IIα cDNA of golden pompano, characterized the genomic structure, and analyzed the polymorphisms and their association with resistance/ susceptibility to V. harveyi. Our sequences analysis indicated that Trov-MHC IIα possesses similar features to that of classical class IIα in other teleosts and humans, sharing 27.6%–78.6% homology with human and other teleosts [49–51,61–63]. As was observed in other species, Trov-MHC IIα consisted of a leader peptide, two extracellular domains and CP/TM/CY domains [59–61]. Comparing to other teleosts, Trov-MHC IIα also exhibited four highly conserved cysteine residues, which have been reported to maintain the stability of the MHC molecule in humans [48–57,62]. N-linked glycosylation site within the a2 domain was found in Trov-MHC IIα, which was also observed in MHC IIα of Japanese flounder [29], turbot [60], half-smooth tongue sole [45], and so on. The genomic structure of Trov-MHC IIα consists of four exons and three introns, similar to the structure observed in nile tilapia [59], turbot [60], and other teleosts [45,64–66]. These similar architectures may indicate that Trov-MHC IIα is functionally similar to that of other vertebrates. It has been reported that MHC IIα exhibits a high degree of polymorphism in vertebrates [48–57]. In this study, it was observed that the exon 2 of Trov-MHC IIα was highly polymorphic in T. ovatus. High level of polymorphisms in MHC genes were associated with the disease resistance, and may be an adaptive strategy to defend against the large number of pathogens in most mammals [14–17,67]. In Atlantic salmon, the single residue mutation in PBR domain had an important effect on peptide-binding efficiency and could be associated with disease resistance [7]. In our study, 12 continuous multi-nucleotide co-mutation sites among 56 variable nucleotides were involved in 39 mutation regions, indicating allelic recombination occurred in these mutated regions. SNP variation sites displayed unequal distribution frequencies,

Acknowledgments This research was supported financially by Key Research Project of Hainan Province (ZDKJ2016011), National Natural Science Foundation of China (No. 31702379, No. 31560725), National Marine Public Welfare Research Project of China (No. 201405020-4), Postdoctoral Science Foundation of Hainan Province (BSH-RST-2018001). 308

Fish and Shellfish Immunology 80 (2018) 302–310

Z. Cao et al.

Appendix A. Supplementary data

[30] R. Zhu, Z.Y. Chen, J. Wang, J.D. Yuan, X.Y. Liao, J.F. Gui, Q.Y. Zhang, Extensive diversification of MHC in Chinese giant salamanders Andrias davidianus (AndaMHC) reveals novel splice variants, Dev. Comp. Immunol. 42 (2014) 311–322. [31] J. Yang, Z. Liu, H.N. Shi, J.P. Zhang, J.F. Wang, J.Q. Huang, Y.J. Kang, Association between MHC II beta chain gene polymorphisms and resistance to infectious haematopoietic necrosis virus in rainbow trout (Oncorhynchus mykiss, Walbaum, 1792), Aquacult. Res. 47 (2016) 570–578. [32] F. Yin, P. Sun, B. Tang, X. Dan, A. Li, Immunological, ionic and biochemical responses in blood serum of the marine fish Trachinotus ovatus to poly-infection by Cryptocaryon irritans, Exp. Parasitol. 154 (2015) 113–117. [33] Z.G. Tu, H.Y. Li, X. Zhang, Y. Sun, Y.C. Zhou, Complete genome sequence and comparative genomics of the golden pompano (Trachinotus ovatus) pathogen, Vibrio harveyi strain QT520, Peerj 5 (2017) e4127. [34] Q. Zhang, H.R. Yu, T. Tong, W.P. Tong, L.F. Dong, M. Xu, Z. Wang, Dietary supplementation of Bacillus subtilis and fructooligosaccharide enhance the growth, nonspecific immunity of juvenile ovate pompano, Trachinotus ovatus and its disease resistance against Vibrio vulnificus, Fish Shellfish Immunol. 38 (2014) 7–14. [35] C.P. Zhou, H.Z. Lin, X.P. Ge, J. Niu, J. Wang, Y. Wang, L.X. Chen, Z. Huang, W. Y, X.H. T, The effects of dietary soybean isoflavones on growth, innate immune responses, hepatic antioxidant abilities and disease resistance of juvenile golden pompano Trachinotus ovatus, Fish Shellfish Immunol. 43 (2015) 158–166. [36] P.J. Midtlyng, A. Storset, C. Michel, W.J. Slierendrecht, N. Okamoto, Breeding for disease resistance in fish, Bull. Eur. Assoc. Fish Pathol. 22 (2002) 166–172. [37] J.F. Gui, Z.Y. Zhu, Molecular basis and genetic improvement of economically important traits in aquaculture animals, Chin. Sci. Bull. 57 (2012) 1751–1760. [38] L. Wang, H. Guo, N. Zhang, Z. Ma, S. Jiang, D. Zhang, Molecular characterization and functional analysis of a peroxiredoxin 1 cDNA from golden pompano (Trachinotus ovatus), Dev. Comp. Immunol. 51 (2015) 261–270. [39] T. Wang, J. Zhang, CsPTX1, a pentraxin of Cynoglossus semilaevis, is an innate immunity factor with antibacterial effects, Fish Shellfish Immunol. 56 (2016) 12–20. [40] J. Klein, R.E. Bontrop, R.L. Dawkins, H.A. Erlich, U.B. Gyllensten, E.R. Heise, P.P. Jones, P. Parham, E.K. Wakeland, D.I. Watkins, Nomenclature for the major histocompatibility complexes of different species: a proposal, Immunogenetics 31 (1990) 217–219. [41] J.H. Brown, T.S. Jardetzky, J.C. Gorga, L.J. Stern, R.G. Urban, J.L. Strominger, D.C. Wiley, Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1, Nature 364 (1989) 33–39. [42] M. Nei, T. Gojobori, Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions, Mol. Biol. Evol. 3 (1986) 418–426. [43] P. Librado, J. Rozas, DnaSP v5: a software for comprehensive analysis of DNA polymorphism data, Bioinformatics 25 (2009) 1451–1452. [44] P. Cosson, J.S. Bonifacino, Role of transmembrane domain interactions in the assembly of class II MHC molecules, Science 258 (1992) 659. [45] T.J. Xu, S.L. Chen, X.S. Ji, Z.X. Sha, Molecular cloning, genomic structure, polymorphism and expression analysis of major histocompatibility complex class IIA and IIB genes of half-smooth tongue sole (Cynoglossus semilaevis), Fish Shellfish Immunol. 27 (2009) 192–201. [46] F. Kishi, M. Tabuchi, Complete nucleotide sequence of human Nramp2 cDNA, Mol. Immunol. 34 (1997) 839–842. [47] K.Ł. Rakus, G.F. Wiegertjes, P. Jurecka, P.D. Walker, A. Pilarczyk, I. Irnazarow, Major histocompatibility (mh) class II b, gene polymorphism influences disease resistance of common carp ( Cyprinus carpio, l.), Aquaculture 288 (2009) 44–50. [48] J. Glamann, Complete coding sequence of rainbow trout MHC II beta chain, Scand. J. Immunol. 41 (1995) 365–372. [49] T.J. Xu, Y.N. Sun, G. Shi, Y.Z. Cheng, R.X. Wang, Characterization of the major histocompatibility complex class II genes in miiuy croaker, PLoS One 6 (2011) e23823. [50] F. Buonocore, E. Randelli, D. Casani, S. Costantini, A. Facchiano, G. Scapigliati, R.J.M. Stet, Molecular cloning, differential expression and 3D structural analysis of the MHC class II chain from sea bass (Dicentrarchus labrax L.), Fish Shellfish Immunol. 23 (2007) 853–866. [51] S.H. Yu, J.Q. Ao, X.H. Chen, Molecular characterization and expression analysis of MHC class II alpha and beta genes in large yellow croaker (Pseudosciaena crocea), Mol. Biol. Rep. 37 (2010) 1295–1307. [52] I. Hordvik, U. Grimholt, V.M. Fosse, ø. Lie, C. Endresen, Cloning and sequence analysis of cDNA encoding the MHC class IIB chain in Atlantic salmon (Salmo salar), Immunogenetics 37 (1994) 437–486. [53] S.H.M. Van Erp, E. Egberts, R.J. Stet, Characterization of class IIA and B genes in a gynogenetic carp clone, Immunogenetics 44 (1996) 192–202. [54] T. Shen, S. Xu, M. Yang, S. Pang, G. Yang, Molecular cloning, expression pattern, and 3D structural analysis of the MHC class IIB gene in the Chinese longsnout catfish (Leiocassis longirostris), Vet. Immunol. Immunopathol. 141 (2011) 33–45. [55] M.J. Osborne, T.F. Turner, Isolation and characterization of major histocompatibility class II genes in an endangered North American cyprinid fish, the Rio Grande silvery minnow (Hybognathus amarus), Fish Shellfish Immunol. 30 (2011) 1275–1282. [56] J.P. Scharsack, M. Kalbe, H. Schaschl, Characterization of antisera raised against stickleback (Gasterosteus aculeatus) MHC class I and class II molecules, Fish Shellfish Immunol. 23 (2007) 991–1002. [57] T. Wang, S. Tan, Z. Cai, Characterization and expression of MHC class II alpha and II beta genes in mangrove red snapper (Lutjanus argentimaculatus), Mol. Immunol. 68 (2015) 373–381. [58] S.W. Edwards, P.W. Hedrick, Evolution and ecology of MHC molecules, from genomics to sexual selection, Trends Ecol. Evol. 13 (1998) 305–311. [59] J.C. Pang, F.Y. Gao, M.X. Lu, X. Ye, H.P. Zhu, X.L. Ke, Major histocompatibility complex class IIa and IIb genes of nile tilapia Oreochromis niloticus: genomic

Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.fsi.2018.06.020. References [1] K.I. Welsh, Natural history of the major histocompatibility complex, Immunology 60 (1987) 621. [2] R. Konig, L.Y. Huang, R.N. Germain, MHC class II interaction with CD4 mediated by a region analogous to the MHC class I binding site for CD8, Nature 30 (1992) 796–798. [3] J.B. Rothbard, M.L. Gefter, Interactions between immunogenic peptides and MHC proteins, Annu. Rev. Immunol. 9 (1991) 527–565. [4] L. Bernatchez, C. Landry, MHC studies in nonmodel vertebrates: what have we learned about natural selection in 15 years? J. Evol. Biol. 16 (2003) 363–377. [5] J. Klein, F. Figueroa, Evolution of the major histocompatibility complex, CRC. Crit. Rev. Immunol. 6 (1986) 295–386. [6] F.M. Brodsky, L.E. Guagliardi, The cell biology of antigen processing and presentation, Annu. Rev. Immunol. 9 (1991) 707–744. [7] A. Langefors, J. Lohm, M. Grahn, O. Andersen, T. von Schantz, Association between major histocompatibility complex class IIB alleles and resistance to Aeromonas salmonicida in Atlantic salmon, Proc. Biol. Sci. 268 (2011) 479–485. [8] Y.X. Zhang, S.L. Chen, Y.G. Liu, Z.X. Sha, Z.J. Liu, Major histocompatibility complex II B allele polymorphism and its association with resistance/susceptibility to Vibrio anguillarum in Japanese Flounder (Paralichthys olivaceus), Mar. Biotechnol. 8 (2006) 600–610. [9] R.F. Xu, K. Li, G.H. Chen, H. Xu, B.Z. Qiang, C.C. Li, B. Liu, Characterization of genetic polymorphism of novel MHC B-LB II alleles in Chinese indigenous chickens, J. Genet. Genomics 34 (2007) 109–118. [10] J. Axtner, S. Sommer, Gene duplication, allelic diversity, selection processes and adaptive value of MHC class II DRB genes of the bank vole, Clethrionomys glareolus, Immunogenetics 59 (2007) 417–426. [11] J. Liu, Y. Sun, T. Xu, Identification of 48 full-length MHC-DAB functional alleles in miiuy croaker and evidence for positive selection, Fish Shellfish Immunol. 54 (2016) 544–550. [12] T. Xu, J. Liu, Y. Sun, Z. Zhu, T. Liu, Characterization of 40 full-length MHC class IIA functional alleles in miiuy croaker: polymorphism and positive selection, Dev. Comp. Immunol. 55 (2016) 138–143. [13] J.H. Brown, T.S. Jardetzky, J.C. Gorga, L.J. Stern, R.G. Urban, J.L. Strominger, D.C. Wiley, Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1, Nature 364 (1993) 33–39. [14] J.A. Borghans, J.B. Beltman, R.J. De Boer, MHC polymorphism under host-pathogen coevolution, Immunogenetics 55 (2004) 732–739. [15] L.D. Bacon, Influence of the major histocompatibility complex on disease resistance and productivity, Poultry Sci. 66 (1987) 802–811. [16] K.A. Glover, U. Grimholt, H.G. Bakke, F. Nilsen, A. Storset, ø. Skaala, Major histocompatibility complex (MHC) variation and susceptibility to the sea louse Lepeophtheirus salmonis in Atlantic salmon Salmo Salar, Dis. Aquat. Org. 76 (2007) 57–65. [17] J.W. Wynne, M.T. Cook, B.F. Nowak, N.G. Elliott, Major histocompatibility polymorphism associated with resistance towards amoebic gill disease in Atlantic salmon (Salmo salar L.), Fish Shellfish Immunol. 22 (2007) 707–717. [18] M. Yang, J.G. Wei, P.F. Li, S.N. Wei, Y.H. Huang, Q.W. Qin, MHC class IIα polymorphisms and their association with resistance/susceptibility to Singapore grouper iridovirus (SGIV) in orange-spotted grouper, Epinephelus coioides, Aquaculture 462 (2016) 10–16. [19] A. Bahr, A.B. Wilson, The evolution of MHC diversity: evidence of intralocus gene conversion and recombination in a single-locus system, Gene 497 (2012) 52–57. [20] W. Babik, M. Pabijan, J. Radwan, Contrasting patterns of variation in MHC loci in the Alpine newt, Mol. Ecol. 17 (2008) 2339–2355. [21] N. Takahata, M. Nei, Allelic genealogy under overdominant and frequency dependent selection and polymorphism of major histocompatibility complex loci, Genetics 124 (1990) 967–978. [22] P. Parham, T. Ohta, Population biology of antigen presentation by MHC class I molecules, Science 272 (1996) 67–74. [23] T.J. Xu, S.L. Chen, X.S. Ji, Y.S. Tian, MHC polymorphism and disease resistance to Vibrio anguillarum in 12 selective Japanese flounder (Paralichthys olivaceus) families, Fish Shellfish Immunol. 25 (2008) 213–221. [24] W.K. Potts, P.R. Slev, Pathogen-based models favoring MHC genetic diversity, Immunol. Rev. 143 (1995) 181–197. [25] J. Sidney, H.M. Grey, R.T. Kubo, A. Sette, Practical, biochemical and evolutionary implications of the discovery of HLA class I supermotifs, Immunol. Today 17 (1996) 261–266. [26] J. Klein, A. Sato, N. Nikolaidis, MHC, TSP, and origin of species: from immunogenetics to evolutionary genetics, Annu. Rev. Genet. 41 (2007) 281–304. [27] L.D. Bacon, Influence of the major histocompatibility complex on disease resistance and productivity, Poultry Sci. 66 (1987) 802–811. [28] Y. Zhao, H. Xu, L. Shi, J. Zhang, Polymorphisms in Exon 2 of MHC class II DRB3 gene of 10 domestic goats in southwest China, Asian Aust. J. Anim. Sci. 24 (2011) 752–756. [29] T.J. Xu, S.L. Chen, Y.X. Zhang, MHC class II alpha gene polymorphism and its association with resistance/susceptibility to vibrio anguillarum in Japanese flounder (Paralichthys olivaceus), Dev. Comp. Immunol. 34 (2010) 1042–1050.

309

Fish and Shellfish Immunology 80 (2018) 302–310

Z. Cao et al.

[60]

[61] [62] [63] [64]

[65]

[66]

[67]

structure, molecular polymorphism and expression patterns, Fish Shellfish Immunol. 34 (2013) 486–496. Y.X. Zhang, S.L. Chen, Molecular identification, polymorphism and expression analysis of major histocompatibility complex class II A and B genes of turbot (Scophthalmus maximus), Mar. Biotechnol. 8 (2006) 611–623. F. Kishi, M. Tabuchi, Complete nucleotide sequence of human Nramp2 cDNA, Mol. Immunol. 34 (1997) 839–842. A. Kelly, S.H. Powis, R. Glynne, E. Radley, S. Beck, J. Trowsdale, Second proteasome-related gene in the human MHC class II region, Nature 353 (1991) 667–668. P. Cosson, J.S. Bonifacino, Role of transmembrane domain interactions in the assembly of class II MHC molecules, Science 258 (1992) 659. H.J. Li, L.X. Jiang, J.B. Han, H. Su, Q. Yang, C.B. He, Major histocompatibility complex class IIA and IIB genes of the spotted halibut Verasper variegatus: genomic structure, molecular polymorphism, and expression analysis, Fish Physiol. Biochem. 37 (2011) 167–180. R.J. Stet, B. de Vries, K. Mudde, T. Hermsen, J. van Heerwaarden, B.P. Shum, U. Grimholt, Unique haplotypes of co-segregating major histocompatibility class II A and class II B alleles in Atlantic salmon (Salmo salar) give rise to diverse class II genotypes, Immunogenetics 54 (2002) 320–331. P. Srisapoome, T. Ohira, I. Hirono, T. Aoki, Cloning, characterization and expression of cDNA containing major histocompatibility complex class I, IIa and IIb genes of Japanese flounder Paralichthys olivaceus, Fish. Sci. 70 (2004) 264–276. R. Rui, J. Ruan, X.L. Wan, Y. Zheng, M.M. Chen, J.S. Zheng, D. Wang, Organization

[68]

[69]

[70]

[71]

[72]

[73]

310

and characteristics of the major histocompatibility complex class ii region in the yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis), Sci. Rep. 6 (2016) 22471. S. Consuegra, H.J. Megens, H. Schaschl, K. Leon, R.J.M. Stet, W.C. Jordan, Rapid evolution of the MHC class I locus results in different allelic compositions in recently diverged populations of atlantic salmon, Mol. Biol. Evol. 21 (2005) 1041–1053. S. Consuegra, H. Megens, K. Leon, R. Stet, W. Jordan, Patterns of variability at the major histocompatibility class II alpha locus in Atlantic salmon contrast with those at the class I locus, Immunogenetics 57 (2005) 16–24. U. Grimholt, S. Larsen, R. Nordmo, P. Midtlyng, S. Kjoeglum, A. Storset, S. Saebo, R.J. Stet, MHC polymorphism and disease resistance in Atlantic salmon (Salmo salar); facing pathogens with single expressed major histocompatibility class I and class II loci, Immunogenetics 55 (2003) 210–219. S. Kjøglum, S. Larsen, H.G. Bakke, U. Grimholt, How specific MHC class I and class II combinations affect disease resistance against infectious salmon anaemia in Atlantic salmon (Salmo salar), Fish Shellfish Immunol. 21 (2006) 431–441. S. Croisetiere, P.D. Tarte, L. Bernatchez, P. Belhumeur, Identification of MHC class II resistance/susceptibility alleles to Aernmonas salmonicida in brook charr (Salvelinus fontinalis), Mol. Immunol. 45 (2008) 3107–3116. K. Glover, T. Aasmundstad, F. Nilsen, A. Storset, Ø. Skaala, Variation of Atlantic salmon families (Salmo salar L.) in susceptibility to the sea lice Lepeophtheirus salmonis and Caligus elongates, Aquaculture 245 (2005) 19–30.