Mice genetically deficient in neuromedin U receptor 2, but not neuromedin U receptor 1, have impaired nociceptive responses

Pain 130 (2007) 267–278 www.elsevier.com/locate/pain

Mice genetically deficient in neuromedin U receptor 2, but not neuromedin U receptor 1, have impaired nociceptive responses Richard Torres a,*, Susan D. Croll a,b,c, Jeffrey Vercollone a, Joel Reinhardt a, Jennifer Griffiths a, Stephanie Zabski a, Keith D. Anderson a, Niels C. Adams a,1, Lori Gowen a, Mark W. Sleeman a, David M. Valenzuela a, Stanley J. Wiegand a, George D. Yancopoulos a, Andrew J. Murphy a a

b

Regeneron Pharmaceuticals, 777 Old Saw Mill River Road, Tarrytown, NY 10591, USA Department of Psychology, Queens College of CUNY, 65-30 Kissena Blvd. Flushing, NY 11367, USA c Neuropsychology & Neuroscience Subprograms, Graduate Center of CUNY, NY, USA Received 9 March 2006; received in revised form 28 December 2006; accepted 29 January 2007

Abstract Neuromedin U (NMU) has recently been reported to have a role in nociception and inflammation. To clarify the function of the two known NMU receptors, NMU receptor 1 (NMUR1) and NMU receptor 2 (NMUR2), during nociception and inflammation in vivo, we generated mice in which the genes for each receptor were independently deleted. Compared to wild type littermates, mice deficient in NMUR2 showed a reduced thermal nociceptive response in the hot plate, but not in the tail flick, test. In addition, the NMUR2 mutant mice showed a reduced behavioral response and a marked reduction in thermal hyperalgesia following capsaicin injection. NMUR2-deficient mice also showed an impaired pain response during the chronic, but not acute, phase of the formalin test. In contrast, NMUR1-deficient mice did not show any nociceptive differences compared to their wild type littermates in any of the behavioral tests used. We observed the same magnitude of inflammation in both lines of NMU receptor mutant mice compared to their wild type littermates after injection with complete Freund’s adjuvant (CFA), suggesting no requirement for either receptor in this response. Thus, the pro-nociceptive effects of NMU in mice appear to be mediated through NMUR2, not NMUR1.  2007 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved. Keywords: Neuromedin U; NMUR1; NMUR2; Capsaicin; Formalin; CFA

1. Introduction Neuromedin U (NMU) was originally isolated from porcine spinal cord based on its ability to stimulate uterine smooth muscle contraction (Minamino et al., 1985). This neuropeptide is expressed in the central nervous system and in peripheral tissues such as the gastrointes*

Corresponding author. Tel.: +1 914 345 7571; fax: +1 914 345 7453. E-mail address: [email protected] (R. Torres). 1 Present address: Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, UK.

tinal tract (Domin et al., 1987; Ballesta et al., 1988; Fujii et al., 2000; Hedrick et al., 2000; Szekeres et al., 2000; Funes et al., 2002). Numerous physiological activities, such as induction of stress response hormones through the hypothalamic–pituitary–adrenal (HPA) axis, increases in grooming and locomotor activity, and decreases in food intake and body weight, have been attributed to NMU (Howard et al., 2000; Nakazato et al., 2000; Hanada et al., 2001; Wren et al., 2002; Hanada et al., 2003; Hanada et al., 2004; Nakahara et al., 2004). Recently, through electrophysiological and behavioral experiments, it has been shown that NMU has pro-nociceptive activity in mice and rats

0304-3959/$32.00  2007 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.pain.2007.01.036

268

R. Torres et al. / Pain 130 (2007) 267–278

(Cao et al., 2003; Yu et al., 2003; Moriyama et al., 2004; Nakahara et al., 2004). Additional evidence of a role for NMU during nociception has been obtained through studies with the NMU-deficient mice. These mice have a reduced response in two nociceptive behavioral tests, the hot plate and formalin tests (Nakahara et al., 2004). In another set of experiments, the NMU knockout mice did not develop CFA-induced inflammation (Moriyama et al., 2005). The actions of NMU are mediated by two GPCRs, NMUR1 and NMUR2. NMUR1 is expressed in peripheral tissues such as the lung and immune cells, and NMUR2 is expressed in the central nervous system (Fujii et al., 2000; Hosoya et al., 2000; Howard et al., 2000; Raddatz et al., 2000; Shan et al., 2000; Szekeres et al., 2000; Funes et al., 2002). However, NMUR1 was also reported to be expressed in DRG (Yu et al., 2003), a site involved in nociception, and the function of NMUR1 and NMUR2 in the modulation of pain and CFA-induced inflammation has not been described up to date. In order to study the in vivo functions of NMU receptors during nociception, we created two lines of mutant mice in which NMUR2 or NMUR1 coding sequences were replaced by a lacZ reporter gene. We found strong lacZ expression in the dorsal horn of the spinal cord in the NMUR2 mutant mice, suggesting a nociceptive role for this receptor. We demonstrated that mice deficient in NMUR2 have reduced nociceptive behavioral responses in acute thermal pain, and in the capsaicin and formalin tests of chemical pain. In the CFA-induced peripheral inflammation model, NMUR2-null mice developed inflammation and inflammation-induced hyperalgesia to the same extent as their wild type littermates. NMUR1-deficient mice did not show any nociceptive differences as compared to their wild type littermates in any of the behavioral tests that we utilized. Thus, we propose that NMUR2, and not NMUR1, mediates the pronociceptive actions of NMU in mice during both thermal pain and chemically induced hyperalgesia, but that neither known NMU receptor is required for CFA-induced inflammation.

homology arms for both genes. The NMUR2–LacZ fusion was engineered so that the LacZ was inserted in-frame immediately after the initiation ATG codon. The LacZNeo cassette replaced an 11 kb genomic region spanning from exon 1 through exon 3, deleting sequences encoding amino acids 2 through 305 (NP_694719). For NMUR1, the LacZ-Neo cassette replaced a 1.7 kb genomic region containing 2 exons. The LacZ was inserted in-frame after amino acid 17 deleting sequences encoding amino acids 18 through 387 (NP_034471). The targeted NMUR2 and NMUR1 BACvecs were linearized with Not1 and electroporated into CJ7 (129S1/Sv-derived) and F1H4 (129B6/F1-derived) ES cells (Valenzuela et al., 2003), respectively. ES clones for both NMUR2 and NMUR1 were screened for homologous recombination events by a real-time PCR-based loss of native allele (LONA) assay using LONA probes near the 5’ and 3’ ends of the deletions, plus LacZ and Neo probes as described previously (Valenzuela et al., 2003). Correctly targeted ES clones were microinjected into C57BL/6Tac blastocysts and chimera mice generated. Once germ line transmission was confirmed, the F1 heterozygote mice were backcrossed to the C57BL/6Tac strain. Homozygote mice were obtained by intercrossing heterozygotes. Animals genetically deficient in both NMUR1 and NMUR2 were generated at the completion of the analysis of the single knockout mice to evaluate the possibility that the presence of one receptor was able to compensate for the loss of the other. To generate these mice, NMUR1 mutant mice were crossed with NMUR2 mutants. The resultant NMUR1/ NMUR2 double knockout mice used in our studies were in a 93% C57BL/6Tac background. 2.2. Real-time PCR RNA was isolated with the RNeasy kit (Qiagen). The RTPCR analysis was performed as previously described (Daly et al., 2004) on an Applied Biosystems 7900HT real-time PCR system using specific NMUR2 and NMUR1 primers and probes as follows: NMUR2 – primers TGTCACCACGGTTAGC ATTGA and GGCTCGGAACGGATGGA; probe: CGC TACGTGGCCATT. NMUR1 – primers CGTCATCCTGCG CAAC AAG and GCGAGGCTGAAGAGGTAGAAGTT; probe: CTATGCGCACGCCCA. The results are expressed as the ratio of the amount of the NMUR2 or NMUR1 RNA to the amount of the control GAPDH RNA. 2.3. b-Galactosidase and immunohistochemical staining

2. Methods 2.1. Generation of NMUR2 and NMUR1 knockout mice NMUR2 and NMUR1 mutant mice were generated by the previously described high-throughput VelociGene technology (Valenzuela et al., 2003). Mouse bacterial artificial chromosomes (BACs) were obtained by screening a mouse 129/SvJ BAC genomic library with open reading frame probes for both NMUR2 and NMUR1. For NMUR2 and NMUR1, 60 and 140 kb BACs were isolated, respectively, and used for bacterial homologous recombinations with a cassette containing a LacZ-PGK-Neo flanked by short

Adult NMUR2+/+, NMUR2+/ and NMUR2 / mice were perfused transcardially with heparinized isotonic saline and then fixed by perfusion with 2% paraformaldehyde in phosphate buffer. Spinal cords were removed, and were either processed as whole mounts or were cryoprotected, mounted in OCT (Tissue Tek), and sectioned on the cryostat at 10 or 20 lm. Staining for b-galactosidase was visualized by incubating spinal cord whole mounts or sections (20 lm) in buffered 1 mg/ml X-Gal, as previously described (Suri et al., 1996). Sections were counterstained with pyronin Y. Immunohistochemical double-staining for b-galactosidase and Substance P was performed with NMUR2+/ spinal

R. Torres et al. / Pain 130 (2007) 267–278

269

cord sections (10 lm) utilizing a goat anti-b-galactosidase antibody (Biogenesis 1:1000) and rabbit anti-Substance P (Bachem 1:500) followed by chicken anti-goat Alexa Fluor 594 antibody (Molecular Probes 1:200) and anti-rabbit Alexa Fluor 488 antibody (Molecular Probes 1:1000). Photomicrographs were taken with a Leica TCS SP2 confocal microscope.

2.5.2. Hot plate test Mice were tested on a hot plate apparatus (model 39, IITC Life Science) at 55C. The latency to lick a hindpaw or to jump was recorded for each animal. The maximum time allowed in the hot plate was 40 s to avoid tissue damage. In experiments using NMUR1/NMUR2 double knockouts, temperatures of 52 and 58 C were also included.

2.4. In situ hybridization

2.5.3. Locomotor activity Activity parameters were obtained using an Oxymax Comprehensive Lab Animal Monitoring System (Columbus Instruments International Corp., Columbus, OH). Briefly, ambulation counts were tabulated by frequency of beam breaks measured over a 48 h period, including two 12-h light and two 12-h dark cycles. NMUR2+/+ and NMUR2 / mice fed with standard chow (Purina #5020, St. Louis, MO) were evaluated at 9 weeks of age.

In situ hybridizations were performed as described (Holash et al., 1999). Briefly, the lumbar section of the spinal cord from C57BL/6Tac mice was cryo-protected. Sections (10 lm) were generated and probed with a 35S-labeled 1.1 kbp cRNA spanning the entire open reading frame of the mouse NMUR2 gene. Slide mounted sections were immersed in radiographic emulsion (NTB-1: Kodak, Rochester, New York) and exposed for 21 days. After developing the slides, they were photographed on a Zeiss Axioplan 2 with darkfield optics using a Zeiss Axiocam. 2.5. Behavioral testing Adult male mice were used for all behavioral studies. Animals were housed in a standard temperature and humidity-controlled colony room on a 12h:12h light/dark cycle. Food and water were available ad libitum. Mice were transferred to the behavioral testing room at least 1 h before testing to acclimate them to the room. All behavioral measures were taken by experimenters blind to the genotype of the mice. Every test that showed statistically significant differences between genotypes was conducted at least twice to verify the reliability of the results. Data were only reported as significant if the same result was obtained in at least two separate cohorts of mice. Mice were excluded from analyses if they experienced bleeding from the capsaicin, formalin, or CFA injection sites; showed undue stress from injections; or had data which fell more than two standard deviations from the group mean. These exclusions represented fewer than 10% of all animals tested, and occurred with equal prevalence in wild type and knockout mice. All mice were tested in the hot plate and tail flick tests and in either the capsaicin, formalin, or CFA test. Once we had three cohorts of mice showing the same effect in the hot plate and tail flick tests, no further mice were used in these two acute thermal tests. All experimental work was approved by the Regeneron Institutional Animal Care and Use Committee. 2.5.1. Tail flick test A tail flick apparatus (model 33T, IITC Life Science) was used at an active intensity setting of 30%, which produces a steady-state reading of 53 C on a thermometer placed under the light beam. In experiments using NMUR1/NMUR2 double knockout mice active intensities of 25% (steady state reading of 49 C) and 35% (steady state reading of 59 C) were also included. Each animal’s tail was placed under the beam and a built-in timer automatically recorded the latency for an animal to flick its tail out of the beam of light. A cut-off time of 15 s was used to avoid tissue damage. Each mouse received three consecutive tail flicks, on three separate spots along the tail, and the median latency was used for analysis.

2.5.4. Capsaicin test Injections of capsaicin (Biomol) were given as described previously (Gilchrist et al., 1996; Laird et al., 2001). Briefly, male mice were injected with 30 lg of capsaicin in 10ll volume into the dorsal side of the left hindpaw. Animals were observed continuously for 15 min after injection and the time spent licking the injected hindpaw was measured. A greater than 10-fold difference between the capsaicin and buffer control injections was observed. Thermal sensitivity at 15 and 90 min after the capsaicin injection was measured on the hot plate at 55 C. These time points were chosen as those giving the most consistent sensitization in wild type mice. 2.5.5. Formalin test Injections of 20 ll of a 5% formalin solution (EMS) were administered into the dorsal side of the left hindpaw of male mice. The proportion of time spent licking and biting the injected paw during the 60 min following the formalin injection was recorded at 5 min intervals. The first 5 min of the test was the acute phase (I), whereas 30–60 min was the chronic phase (II). 2.5.6. Complete Freund’s adjuvant (CFA) test Left hindpaws were injected (intraplantar) with a 50% solution of CFA (10 lg, Sigma) in PBS while the mice were under isoflurane anesthesia. Animals were evaluated for paw inflammation and either mechanical nociception or thermal nociception at baseline and at 3 h and days 1–7 post-injection. Inflammation of the injected paw was measured with a fine caliper. The mechanical sensitivity was measured with the von Frey test (Stoelting, Touch test). For this test, mice were tested after being acclimated for 2–3 h for 4 days in an apparatus with a wire mesh floor. The test was performed by applying, in ascending order, a series of von Frey hairs through the wire mesh onto the plantar surface of the CFA-injected hindpaw. A response was considered positive if the paw was raised from the platform in response to application of the filament. Starting from the thinnest hair, each von Frey filament was applied up to five times until a response was observed. To study thermal nociception following a CFA paw injection, the Hargreaves’ test was used. After acclimating the mice to the Hargreaves’ apparatus (model 336, IITC Life Science) for 2–3 h per day for 3 days, they were tested with an active

270

R. Torres et al. / Pain 130 (2007) 267–278

intensity setting of 17%. A cut-off time of 25 s was used to avoid tissue damage. For each mouse three readings were obtained during a period of 30 min per day and the median latency was used for analysis. 2.5.7. Data analysis The results are expressed as means ± standard error of the mean (SEM). Comparisons of wild types versus knockouts on single measures were made using a Student’s independent groups t test. Comparisons across genotype and time in thermal pain after capsaicin and licking after formalin were made using a 2 (genotype) · 2 (time) mixed Factorial ANOVA. Significant main effects and interactions were probed with a Tukey HSD post hoc test. Alpha was set at 0.05 for all analyses.

3. Results 3.1. Mice with targeted NMUR2 or NMUR1 gene mutations A targeting vector containing the LacZ reporter and a neomycin selection cassette was used to replace open reading frames for both NMUR2 and NMUR1 genes (Figs. 1A and B) in mouse ES cells using VelociGene technology (Valenzuela et al., 2003). Targeting of the LacZ-containing alleles was verified by the LONA assay in F2 mice (Figs. 1C and D). Southern blotting was also performed to confirm the replacement of the genes with the LacZ-containing alleles (data not shown). Both NMU receptor-null homozygote mice were obtained with the expected Mendelian frequency and appeared healthy, fertile, and with no obvious gross anatomical or behavioral abnormalities. We performed quantitative RT-PCR to confirm that transcripts were not present in the NMUR2- and NMUR1-deficient mice. As expected, in the spinal cord, NMUR2 transcripts were detected in NMUR2+/+ and NMUR2+/ mice but not in NMUR2 / mice (Fig. 1E). In the lung, a tissue known to express NMUR1 and not NMUR2, transcripts were ablated in the NMUR1 / mice (Fig. 1F). 3.2. Expression patterns of NMUR2 and NMUR1 Expression of the murine NMUR2 gene has been previously localized to the central nervous system (Hosoya et al., 2000; Raddatz et al., 2000; Shan et al., 2000; Funes et al., 2002). Within the brain, we found lacZ staining in our NMUR2 lacZ knock-in mice in parts of the thalamus, hypothalamus, and hippocampus as had been previously shown (Brighton et al., 2004). Additionally, we found staining for LacZ in neurons and/or fibers in the olfactory bulbs, inferior colliculi, cochlear nucleus, lateral lemniscus, pons, nucleus of the solitary tract, area postrema, the spinal trigeminal nucleus, and sparsely, in the medulla (data not shown). Besides the CNS, we found it on the gastrointestinal tract region as previously

reported (Brighton et al., 2004). No expression was detected in the dorsal root ganglia (DRG) or any other structure of the brain. b-Galactosidase staining studies revealed strong LacZ expression throughout the entire length of the dorsal horn of the spinal cord, from the sacral to the cervical region in the NMUR2 mutant mice (Figs. 2A and B, data not shown for all regions). Expression of NMUR2 in the dorsal horn was confirmed by in situ hybridization studies of wild type mice with a murine 35S-labeled NMUR2 probe (Fig. 2C). To further define the expression pattern of NMUR2 in spinal nociceptive pathways, we used anti-b-galactosidase antibodies to track NMUR2 expression and performed co-localization studies with Substance P (SP), a known mediator of nociception that is localized to laminae I and II of the dorsal horn (Malmberg and Basbaum, 1998). As shown in Figs. 3D–F, b-galactosidase/ NMUR2 is expressed in the same laminae as SP. We were unable to detect b-galactosidase staining in the NMUR1 mutant mice (data not shown), although NMUR1 RNA has been shown by others to be expressed in the DRGs (Yu et al., 2003). We were however able to detect NMUR1 transcripts in the lung by RT-PCR (Fig. 1F). In addition, we also confirmed NMUR1 transcripts in DRG by in situ hybridization and this hybridization was lost in the DRG of NMUR1 / mice (data not shown). 3.3. Nociceptive behavioral responses in mice lacking either NMUR2 or NMUR1 We first studied the role of the NMU receptors during acute noxious thermal stimuli in both the tail flick and hot plate tests. No statistically significant differences were observed in the latency to respond in the tail flick test between wild type and null-homozygote mice for either NMU receptor (p > 0.05, t tests, Figs. 3A and C). The similarity in latency between NMUR2+/+ and NMUR2 / in the tail flick test was also confirmed in NMUR2 mutant mice that were backcrossed three more generations into the C57BL/6Tac background (N5F2, data not shown). However, on a hot plate test at 55 C, we found a statistically significant increase in the latency to respond in the NMUR2-deficient mice compared to their wild type littermates (p < 0.03, t test, Fig. 3B, left). The data shown for the N2F2 mice contained the combined data of two cohorts that had the same effect. This statistically significant increase in latency in the hot plate was also obtained in NMUR2null homozygote mice generated from heterozygotes that were backcrossed three more generations (N5F2) into the C57BL/6Tac background (p < 0.04, t test, Fig. 3B, right). The data shown for the N5F2 are for one large cohort of mice to verify the results obtained with the N2F2 mice. To rule out the possibility that a decrease in locomotor activity accounts for the increase

R. Torres et al. / Pain 130 (2007) 267–278

A

NMUR2

, 5 HB

B

271

NMUR1

, 5 HB

, 3 HB

, 3 HB

1 kb

1kb

8

neo

LacZ

neo

LacZ

neo

LacZ

neo

D

LacZ NMUR2

7 6 5 4 3 2 1 0

Δ Ct

Δ Ct

C

LacZ

HET HET WT WT WT HET KO KO HET

F

0.70 0.60 0.50 0.40 0.30 0.20 0.10

LacZ NMUR1

4 3 2 1 0 HET HET WT

Relative NMUR1 transcript levels

Relative NMUR2 transcript levels

E

8 7 6 5

KO HET HET WT HET KO

0.11 0.10 0.08 0.06 0.04 0.02 0

0

KO

Het

Lung

WT

KO

Het

WT

Spinal Cord

KO

Het

Lung

WT

KO

Het

WT

Spinal Cord

Fig. 1. Generation of two separate NMU receptor-deficient mice. (A and B) Schematic drawings depicting the genomic regions (top) for NMUR2and NMUR1-encoding exons (orange boxes) that were used for bacterial homologous recombinations with the LacZ-Neo reporter cassette (middle). The resulting modified genomic regions are shown for NMUR2 (A, bottom) and NMUR1 (B, bottom). The LONA probes within the endogenous genes are shown as small red stars. (C and D) Representative genotyping data using the LONA assay showing quantitative differences between WT, Het, and KO mice for NMUR2 and NMUR1 genes and the introduced LacZ gene. (E and F) NMUR2 and NMUR1 mutant mice do not have NMUR2 and NMUR1 transcripts, respectively. RNA was isolated from lungs and spinal cords of WT, Het, and KO mice and the relative levels of NMUR2 and NMUR1 (both normalized to GAPDH) were determined by real-time PCR.

in latency in the NMUR2 / mice, locomotor activity was measured over a 48 h period. The NMUR2+/+ (n = 5) had light cycle activity (counts) of 423 ± 50 and dark cycle activity (counts) of 1510 ± 127. The NMUR2 / (n = 7) mice had light cycle activity (counts) of 359 ± 34 and dark cycle activity (counts) of 1643 ± 141. A Student’s independent groups t test was conducted for each cycle and no statistically significant differences were detected between genotypes in either the light or the dark cycle activities. No difference was observed between NMUR1+/+ and NMUR1 / mice in the hot plate test (p > 0.78, t test, Fig. 3D). The equivalent performance of NMUR1 knockout mice to their wild type littermates in the hot plate and tail flick tests was observed in multiple cohorts across different generations. Next, we asked whether the NMU receptors play a role in an acute chemical pain assay, the capsaicin test. Capsaicin is a noxious chemical that activates C-fibers (Gilchrist et al., 1996). In this test, NMUR2-deficient

mice showed a statistically significant 39% reduction in the time spent engaging in the target pain behavior (licking) in the 15 min following a hindpaw capsaicin injection relative to their wild type littermates (p < 0.004, t test; Fig. 4A). In contrast, no differences that reached statistical significance were detected between the NMUR1 knockout mice and their wild type littermates (36.08 ± 9.22 s for the NMUR1+/+ mice (n = 8) vs. 29.96 ± 6.49 for the NMUR1 / mice (n = 8), p > 0.18, t test). A state of thermal hyperalgesia is known to occur following an intradermal capsaicin injection (Gilchrist et al., 1996; Laird et al., 2001). To study the role of the NMU receptors during this hyperalgesia we examined the knockout mice on a hot plate at 55 C 15 and 90 min following capsaicin injections. No statistically significant difference in the time spent on the hot plate was observed 15 min following the capsaicin injection for either of the two NMU receptors-null homozygote mice. However, NMUR2 / mice showed

272

R. Torres et al. / Pain 130 (2007) 267–278

Fig. 2. Expression of the NMUR2 gene in the dorsal horns of the spinal cord. b-galactosidase staining (blue) of spinal cord cross sections of (A) a chimera whole mount and of (B) a homozygous null mutant pyronin Y-counterstained section demonstrates expression in the superficial dorsal horns. (C) In situ hybridization with a murine NMUR2 35S-labeled probe confirms the LacZ expression in the dorsal horns of the spinal cord in a wild type mouse. (D–F) Immunostaining of b-galactosidase (NMUR2–lacZ) and SP in the superficial dorsal horns revealed that both are localized to laminae I and II. Immunofluorescent studies with NMUR2+/ spinal cord sections were performed with antibodies against b-galactosidase (red, panels D and F) and SP (green, panels E and F). Confocal microscopy revealed NMUR2–lacZ reporter gene expression among the SP immunopositive fibers of dorsal horn laminae I and II.

a statistically significant attenuation of the hyperalgesic response observed 90 min after capsaicin treatment compared to their wild type littermates, which had a 53% reduction in latency compared to the 15 min time point (genotype p < 0.006, two way mixed Factorial ANOVA; Fig. 4B). In contrast, NMUR1 / mice showed no difference compared to NMUR1+/+ mice (15 min: 15.61 ± 2.98 s for the NMUR1+/+ mice (n = 8) vs. 18.64 ± 2.71 for the NMUR1 / mice (n = 8), 90 min: 11.99 ± 1.92 s for the NMUR1+/+ mice (n = 8) vs. 11.19 ± 2.30 for the NMUR1 / mice (n = 8); genotype p > 0.719, two way mixed Factorial ANOVA). To determine the importance of the NMU receptors in more persistent pain models, we tested both NMU receptor-null mutant mice in the formalin and CFA tests. The formalin test produces a distinct biphasic behavioral response following a subcutaneous injection into the hindpaw: an initial acute efferent barrage stage (phase I) and a more prolonged chronic stage (phase II) (Tjolsen et al., 1992). In the acute phase, neither NMU receptor-null homozygote had a statistically significant reduction in licking and biting behaviors. During phase II, NMUR2-deficient mice spent statistically significantly less time (38%) licking and biting the formalininjected hindpaw compared to their wild type littermates (genotype p < 0.035, two way mixed Factorial ANOVA with Tukey HSD post hoc test; Figs. 4C and D). This

marked reduction in phase II, and not in phase I, was also observed with the NMUR2-null mice (N5F2) that were backcrossed three more generations into the C57BL/6Tac strain (264.8 ± 27.9 s for the NMUR2+/+ mice (n = 5) vs. 139.9 ± 50.1 s for the NMUR2 / mice (n = 5); genotype p < 0.0347, two way mixed Factorial ANOVA). Similar to the capsaicin test, no differences were detected between the NMUR1 / mice and their wild type littermates (phase I: 32.19 ± 5.15 s for the NMUR1+/+ mice (n = 10) vs. 29.27 ± 3.69 for the NMUR1 / mice (n = 10), phase II: 262.05 ± 50.79 s for the NMUR1+/+ (n = 10) vs. 219.21 ± 34.17 s for the NMUR1 / mice (n = 10); genotype p > 0.547 two way mixed Factorial ANOVA). To investigate a more chronic peripheral inflammatory model, we injected CFA subcutaneously into a hindpaw, which causes a local inflammatory response that lasts for several days (Iadarola et al., 1988). We studied inflammation by measuring a commonly used surrogate marker, paw thickness, before injection and again starting at 3 h for up to day 7 post-CFA hindpaw injection. No differences in the magnitude of the paw swellings were detected for either NMU receptor null-deficient mutant (genotypes p > 0.05, two way mixed Factorial ANOVA; Figs. 5A and B). Mechanical nociceptive behavior was monitored after the CFA injection in the NMUR2 / and NMUR2+/+ mice. No differences were detected between genotypes in the mechanical hyperalgesia response with

R. Torres et al. / Pain 130 (2007) 267–278

273

NMUR2

A

B

Tail Flick Test

Hot Plate Test

*

25 Mean latency to respond (sec)

7 Mean latency to flick (sec)

30

6 5 4 3 2 1

20

* 15 10 5 0

0 WT

KO

WT

KO

WT

KO

NMUR1 4

D

Hot plate test 14

3.5

Mean latency to respond (sec)

Mean latency to flick (sec)

C

Tail flick test

3 2.5 2 1.5 1 0.5 0

12 10 8 6 4 2 0

WT

KO

WT

KO

Fig. 3. Baseline nociceptive responses of the NMU receptors-deficient mice to thermal tests. (A and C) No difference was observed in the tail flick test between wild type and homozygote mice for both NMU receptors (n = 22, NMUR2+/+; n = 25, NMUR2 / ; n = 21, NMUR1+/+; n = 23, NMUR1 / ); p > 0.05, t tests. (B, left) However, in the hot plate test, we found a statistically significant decrease in nociceptive responses in the NMUR2-null homozygote mice (N2F2, 75% C57BL/6Tac) (n = 24, NMUR2+/+; n = 25, NMUR2 / ); *p < 0.03, t test. (B, right) This reduced response was confirmed with NMUR2-null mice that were obtained after three more generations into the C57BL/6Tac (N5F2 > 96%) strain, (n = 22, NMUR2+/+; n = 25, NMUR2 / ); *p < 0.024 t test. (D) No difference was detected between NMUR1-null homozygote mice and their wild type littermates (n = 17, NMUR1+/+; n = 17, NMUR1 / ); p > 0.05, t test.

the use of von Frey hairs at any time point up to day 7 post-CFA injection (genotype p > 0.05 two way mixed Factorial ANOVA; Fig. 5C). 3.4. Nociceptive behavioral responses in mice lacking both NMUR1 and NMUR2 Although our data in the NMUR1 and NMUR2 knockouts suggest that NMU’s nociceptive effects are mediated by NMUR2, we cannot rule out the possibility that compensatory changes by NMUR2 mask any contribution of NMUR1. To rule out this possibility, mice were generated which were deficient in both NMUR1 and NMUR2. Similar to the single NMUR1 / and NMUR2 / mice, no differences between the NMUR1/NMUR2

double knockouts and their wild type littermates were detected in the paw thickness after CFA injection at any time point examined (genotype p > 0.05 two way mixed Factorial ANOVA; Fig. 6A). To study thermal nociceptive behavior following a paw injection of CFA, the Hargreaves’ test was performed. Paw withdrawal latencies to a defined radiant heat stimulus showed no difference between the double NMUR1/ NMUR2-deficient mice and their wild type littermates (genotype p > 0.05 two way mixed Factorial ANOVA; Fig. 6B). Both showed equivalent development of thermal hyperalgesia. Since we noted in Figs. 3A and B that the NMUR2 / mice had decreased thermal nociceptive responses in the hot plate test and not in the tail flick test at one single temperature in each test, we next wanted to compare

274

R. Torres et al. / Pain 130 (2007) 267–278

NMUR2 Paw diameter test

A Mean % Baseline Paw Diameter

250 225 200 175 150 125

WT KO

100 75 Baseline

3 hr

Day 1

Day 3

Day 7

Time after CFA

Mean % Baseline Paw Diameter

B

NMUR1 Paw diameter test

250 225 200 175 150 125

WT KO

100 75 Baseline

3 hr

Day 1

Day 3

Day 7

Time after CFA

Mean % baseline mechanical threshold

C

Fig. 4. NMUR2-null mice have significantly reduced responses to both capsaicin- and formalin- induced nociception. (A) NMUR2 / mice as compared to their wild type littermates showed a statistically significant reduction in the time spent licking in the 15 min following a capsaicin injection into the left hindpaw (n = 10 per group); *p < 0.004, t test. (B) To study thermal hyperalgesia due to capsaicin we examined the NMUR2-deficient mice in the hot plate test at 15 min and 90 min following the capsaicin injection. NMUR2 knockouts showed a significant attenuation of the hyperalgesic response observed 90 min after capsaicin treatment in the wild type littermates (n = 10 per genotype); genotype, *p < 0.006, two way mixed Factorial ANOVA. (C and D) Following a formalin injection, NMUR2 knockouts spent significantly less time licking and biting the injected hindpaw during the chronic phase 2 as compared to their wild type littermates (n = 8 per genotype); genotype *p < 0.035 two way mixed Factorial ANOVA with Tukey HSD post hoc test.

NMUR2 von Frey test

120 100

WT 80

KO

60 40 20 0 Day 0

Day 1

Day 3

Day 7

Time after CFA

Fig. 5. CFA model of inflammatory pain in NMU receptors mutant mice. Paw thickness was measured with fine calipers before (baseline) and after 3 h, days 1, 3 and 7 post-CFA injection. No difference in paw diameter was detected at any time point for (A) NMUR2+/+ vs. NMUR2 / (n = 8, NMUR2+/+; n = 6, NMUR2 / ) and (B) NMUR1+/+ vs. NMUR1 / (n = 9, NMUR1+/+; n = 12, NMUR1 / ); p > 0.05 two way mixed Factorial ANOVA. (C) No difference between genotypes was detected for up to 7 days in the mechanical sensitivity test following the CFA test for NMUR2+/+ vs. NMUR2 / (n = 12 per genotype); p > 0.05 two way mixed Factorial ANOVA.

the NMUR2-null mice to the double NMUR1/ NMUR2-null mice in these two baseline thermal tests. Therefore, we studied cohorts of male mice in the same

R. Torres et al. / Pain 130 (2007) 267–278

Paw diameter test

Hargreaves' test

B R1WT/R2WT R1KO/R2KO

250 225 200 175 150 125 100

R1WT/R2WT R1KO/R2KO

10

% change from baseline

Mean % Baseline Paw Diameter

A

0 -10 -20 -30 -40 -50 -60 -70 -80

75

-90 Baseline

3 hr

Day 1

Day 3

Baseline

Day 7

Tail flick test

C

R1WT/R2WT

Day 3

Day 7

R1KO/R2KO 10

5

0 59 °

R1WT/R2WT

20

Mean latency to respond (sec)

R1WT/R2KO

53 °

Day 1

Hot plate test

D

15

49 °

3 hr

Time after CFA

Time after CFA

Mean latency to flick (sec)

275

R1WT/R2KO R1KO/R2KO

15

10

5

0 52 °

55 °

58 °

temperature

temperature

Fig. 6. Inflammation and nociception in NMUR1/NMUR2 double knockout mice. Mice deficient in both NMUR1 and NMUR2 were tested in the CFA model of inflammatory pain. These mice showed no differences from their wild type littermates in either the paw diameter test (A) or thermal hyperalgesia as measured by the Hargreaves’ test (B) after CFA hindpaw injection (for both A and B: n = 10, NMUR1+/+/NMUR2+/+; n = 11, NMUR1 / /NMUR2 / ); p > 0.05 two way mixed Factorial ANOVA. In addition, in thermal studies done with mice of the same background and generation, NMUR1/NMUR2 double knockout mice showed a similar thermal nociceptive profile to mice deficient in NMUR2 in both the tail flick test (C) and hot plate test (D) (n = 14, NMUR1+/+/NMUR2+/+; n = 14, NMUR1 / /NMUR2 / ; n = 12, NMUR2 / ); genotype p > 0.67, two way mixed Factorial ANOVA for the tail flick and genotype p < 0.002 for the hot plate.

background strain (93% C57BL/6Tac) and generation in both thermal tests, the tail flick and the hot plate, at three different temperatures each. Littermates were obtained and studied of three different genotypes: single NMUR2-deficient mice, double NMUR1/NMUR2deficient mice, and wild type mice. As shown in Fig. 6C, similar to the previous tail flick test experiments at 53 C, no statistically significant differences were detected at this temperature between the NMUR2-deficient mice and the wild type mice. At none of the three temperatures tested, 49, 53 or 59 C, were increases in latencies detected for the double NMUR1 / NMUR2 / mice compared to the single NMUR2 / or to their wild type littermates; genotype p > 0.67, two way mixed Factorial ANOVA. In the hot plate test, we observed that the NMUR1/NMUR2-deficient mice had statistically significant increased latencies to respond relative to the wild types (genotype p < 0.002,

Fig. 6D). These increases were equivalent to those observed in their NMUR2-deficient littermates tested at the same time. Therefore, it appears that neither NMUR1 nor NMUR2 played a role in the tail flick test at the three temperatures tested. In the hot plate test, deletion of NMUR1 adds no further change in nociceptive thresholds over deletion of NMUR2 alone, suggesting that only NMUR2 mediates increases in hot plate latencies. 4. Discussion NMU has recently been demonstrated to have a pronociceptive role in both rats and mice through a combination of electrophysiological and behavioral experiments (Cao et al., 2003; Yu et al., 2003; Moriyama et al., 2004; Nakahara et al., 2004; Moriyama et al., 2005). Utilizing mouse knockout models, we made

276

R. Torres et al. / Pain 130 (2007) 267–278

separate null homozygote mice for the two known receptors for the NMU peptide, NMUR2 and NMUR1. In the present study, we detected expression of NMUR2 in the dorsal horn of the spinal cord and in regions of the brain that have been implicated in pain, such as the nucleus of the solitary tract and the ventromedial nucleus of the hypothalamus (Hosoi et al., 1999; Gamboa-Esteves et al., 2004). In contrast, the only detectable neural localization of NMUR1 was in the DRGs. In behavioral studies, we found that NMUR2 / mice, but not NMUR1 / mice, have a decrease in nociceptive response in the hot plate, capsaicin, and formalin tests. Moriyama et al. (2004) found that NMU is expressed in the deeper laminae of the dorsal horn and suggested that NMU-expressing neurons could be making synapses with NMUR2-containing neurons in the uppermost laminae. Our data suggest that at least in the in vivo pain tests reported in their study, hot plate and formalin, NMU is indeed acting predominantly through NMUR2 and not NMUR1. The lack of contribution of NMUR1 in the hot plate test is further supported by the finding that mice deficient in both NMUR1 and NMUR2 have hot plate latencies similar to mice deficient only in NMUR2. Another neuropeptide that shares homology to NMU was recently identified and named Neuromedin S (NMS) due to its expression in the suprachiasmatic nuclei of the hypothalamus. NMS also signals through NMUR1 and NMUR2, but its role during nociception is currently unknown (Mori et al., 2005). In baseline thermal tests, NMUR2-deficient mice, but not NMUR1-deficient mice, had a significant increase in the latency to respond in the hot plate test. This result cannot be accounted for by a locomotor defect since no differences in locomotor activity were observed between NMUR2+/+ and NMUR2 / mice. Published results utilizing mice deficient in NMU, like the NMUR2 / mice reported here, display a longer latency compared to their wild type littermates in the hot plate test (Nakahara et al., 2004). It would be interesting to examine the NMU / mice in the tail flick test, to see if they show normal responses similar to the NMUR2 / , NMUR1 / , and NMUR1 / /NMUR2 / mice. If the NMU mutant mice were to respond differently in the tail flick test, that effect would likely be mediated by mechanisms independent of these receptors. The fact that we only see a difference between wild type and knockout mice in the hot plate, which involves licking a hindpaw or jumping, and not in the tail flick test, which measures spinal pain reflexes, suggests that supraspinal mechanisms mediate the nociceptive actions of NMUR2. Since, for example, we detect LacZ expression in the NMUR2-knockout line in the nucleus of the solitary tract in the medulla and light staining in the ventromedial nucleus of the hypothalamus, known brain

regions involved in pain, NMUR2 function during pain states could depend on either or both spinal cord and brain site of actions (Hosoi et al., 1999; GamboaEsteves et al., 2004). Further studies will be required to understand this potential role of NMUR2 in higher cerebral functions modulating pain perception. Mice rendered genetically deficient in other genes, such as SP and Kinin B1 receptor, have also been reported to have a reduced response in the hot plate test but not in the tail flick test (Zimmer et al., 1998; Pesquero et al., 2000). It would be of interest to see if the NMUR2 signaling pathway interacts with these or any other nociceptive pathways. Injection of capsaicin, the pungent component of hot pepper, into the hindpaw of NMUR2 / mice resulted in a 39% reduction in the time spent licking as compared to the NMUR2+/+ mice. Hyperalgesia has been shown to occur following a capsaicin injection (Gilchrist et al., 1996; Laird et al., 2001). At 90 min post-injection, we observed a lack of hyperalgesia in the NMUR2 / mice, as compared to the NMUR2+/+ mice, which showed thermal hyperalgesia. In a short-term inflammatory chemical pain model, the formalin test, we saw a reduction in the licking and biting in phase II for the NMUR2 / mice vs. the NMUR2+/+ mice. Phase II of the formalin test is thought to be due to peripheral inflammation and central sensitization that occurs due to changes in the excitability of the neurons in the spinal cord that is set up by the first phase (Tjolsen et al., 1992). The observed reduction of behavior in the second phase of formalin in the NMUR2-null homozygote mice implicates NMUR2 signaling in the inflammation and/or the central sensitization components of the formalin test. NMUR1deficient mice did not show any significant nociceptive differences from their wild type littermates in the capsaicin or formalin tests. Similar to the NMUR2-null mice, NMU-null mice have been reported to have a decrease in nociceptive behavior only in phase II, not in phase I, of the formalin test (Nakahara et al., 2004). Our results suggest that, similar to the hot plate test, NMU acts through NMUR2 and not NMUR1 in the formalin test. NMU was recently reported to have a role in promoting CFA-induced hindpaw inflammation. Moriyama et al. (2005) showed that hindpaw inflammation was detected in the wild type mice, but not in the NMU-deficient mice when paw swelling was examined at 3 h and day 1 post-CFA injection. In the current report, we observed paw swelling in both NMU receptor mutants of similar magnitude to their wild type littermates at all time points examined, from 3 h up to 7 days postCFA injection. Thus, neither NMUR1 nor NMUR2 is required for paw swelling. Besides the lack of an inflammation phenotype detected with either of the two receptor knockouts, we also did not detect a difference between NMUR2 / and NMUR2+/+ mice in the

R. Torres et al. / Pain 130 (2007) 267–278

mechanical sensitivity following a CFA injection. This finding further suggests that NMUR2 plays no role during CFA-induced inflammatory pain. The possibility that receptor redundancy between NMUR1 and NMUR2 results in a lack of effect in the CFA test is ruled out by the finding that mice deficient in both genes also show normal inflammatory and thermal nociceptive responses to CFA. Alternatively, the NMU knockout mice described by Moriyama et al. could be deficient in some activity that is mediated by neither NMUR1 nor NMUR2. Strain differences are known to affect nociceptive behaviors in mice (Mogil et al., 1999). Indeed, the magnitude of the hot plate effect in NMUR2 mutant mice appeared to rely partially on the background strain of the mice. That is, mice that were 96% C57BL/5Tac (N5F2) showed a greater increase in hot plate latency than those that were 75% C57BL/6Tac (N2F2). However, the differences detected in the pain phenotypes for the NMUR1 and NMUR2 mutant mice are not likely to be attributed to differences in mouse strain since both lines that were studied were in greater than 90% C57BL/6Tac. NMUR1 did not play a discernable role in any of the pain tests reported here, as evidenced both by the lack of effect of genetic deletion of NMUR1 and the similarity of the NMUR1/NMUR2 double knockouts to the NMUR2 knockout mice in those paradigms studied. It was recently reported that NMUR1 is expressed in T helper cells and that NMU induced pro-inflammatory cytokines in these cells (Johnson et al., 2004). Therefore, it remains possible that NMUR1 participates in some other form of inflammation other than that induced by CFA. The nociceptive involvement of NMUR1 is currently not known.

Acknowledgements We thank the VelociGene group at Regeneron for the preparation of the targeting vectors, blastocyst injections and genotyping of the mice. We thank Dr. Tom DeChiara, Mary Simmons, and Melissa Meola for the coordinated breeding of mice. We thank Robert Roman for his technical assistance. We also acknowledge Y. Gopi Shanker for useful comments on the manuscript and Vicki Lan and Scott Stanton for graphic support. We acknowledge both Dr. Nicholas W. Gale and Scott Stanton for their help with the cover picture.

References Ballesta J, Carlei F, Bishop AE, Steel JH, Gibson SJ, Fahey M, et al. Occurrence and developmental pattern of neuromedin U-immunoreactive nerves in the gastrointestinal tract and brain of the rat. Neuroscience 1988;25:797–816.

277

Brighton PJ, Szekeres PG, Willars GB. Neuromedin U and its receptors: structure, function, and physiological roles. Pharmacol Rev 2004;56:231–48. Cao CQ, Yu XH, Dray A, Filosa A, Perkins MN. A pro-nociceptive role of neuromedin U in adult mice. Pain 2003;104:609–16. Daly C, Wong V, Burova E, Wei Y, Zabski S, Griffiths J, et al. Angiopoietin-1 modulates endothelial cell function and gene expression via the transcription factor FKHR (FOXO1). Genes Dev 2004;18:1060–71. Domin J, Ghatei MA, Chohan P, Bloom SR. Neuromedin U – a study of its distribution in the rat. Peptides 1987;8:779–84. Fujii R, Hosoya M, Fukusumi S, Kawamata Y, Habata Y, Hinuma S, et al. Identification of neuromedin U as the cognate ligand of the orphan G protein-coupled receptor FM-3. J Biol Chem 2000;275:21068–74. Funes S, Hedrick JA, Yang S, Shan L, Bayne M, Monsma Jr FJ, et al. Cloning and characterization of murine neuromedin U receptors. Peptides 2002;23:1607–15. Gamboa-Esteves FO, McWilliam PN, Batten TF. Substance P (NK1) and somatostatin (sst2A) receptor immunoreactivity in NTSprojecting rat dorsal horn neurones activated by nociceptive afferent input. J Chem Neuroanat 2004;27:251–66. Gilchrist HD, Allard BL, Simone DA. Enhanced withdrawal responses to heat and mechanical stimuli following intraplantar injection of capsaicin in rats. Pain 1996;67:179–88. Hanada R, Nakazato M, Murakami N, Sakihara S, Yoshimatsu H, Toshinai K, et al. A role for neuromedin U in stress response. Biochem Biophys Res Commun 2001;289:225–8. Hanada R, Teranishi H, Pearson JT, Kurokawa M, Hosoda H, Fukushima N, et al. Neuromedin U has a novel anorexigenic effect independent of the leptin signaling pathway. Nat Med 2004;10:1067–73. Hanada T, Date Y, Shimbara T, Sakihara S, Murakami N, Hayashi Y, et al. Central actions of neuromedin U via corticotropin-releasing hormone. Biochem Biophys Res Commun 2003;311:954–8. Hedrick JA, Morse K, Shan L, Qiao X, Pang L, Wang S, et al. Identification of a human gastrointestinal tract and immune system receptor for the peptide neuromedin U. Mol Pharmacol 2000;58:870–5. Holash J, Maisonpierre PC, Compton D, Boland P, Alexander CR, Zagzag D, et al. Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF. Science 1999;284:1994–8. Hosoi M, Oka T, Abe M, Hori T, Yamamoto H, Mine K, et al. Prostaglandin E(2) has antinociceptive effect through EP(1) receptor in the ventromedial hypothalamus in rats. Pain 1999;83:221–7. Hosoya M, Moriya T, Kawamata Y, Ohkubo S, Fujii R, Matsui H, et al. Identification and functional characterization of a novel subtype of neuromedin U receptor. J Biol Chem 2000;275:29528–32. Howard AD, Wang R, Pong SS, Mellin TN, Strack A, Guan XM, et al. Identification of receptors for neuromedin U and its role in feeding. Nature 2000;406:70–4. Iadarola MJ, Brady LS, Draisci G, Dubner R. Enhancement of dynorphin gene expression in spinal cord following experimental inflammation: stimulus specificity, behavioral parameters and opioid receptor binding. Pain 1988;35:313–26. Johnson EN, Appelbaum ER, Carpenter DC, Cox RF, Disa J, Foley JJ, et al. Neuromedin U elicits cytokine release in murine Th2-type T cell clone D10.G4.1. J Immunol 2004;173:7230–8. Laird JM, Roza C, De Felipe C, Hunt SP, Cervero F. Role of central and peripheral tachykinin NK1 receptors in capsaicin-induced pain and hyperalgesia in mice. Pain 2001;90:97–103. Malmberg AB, Basbaum AI. Partial sciatic nerve injury in the mouse as a model of neuropathic pain: behavioral and neuroanatomical correlates. Pain 1998;76:215–22.

278

R. Torres et al. / Pain 130 (2007) 267–278

Minamino N, Kangawa K, Matsuo H. Neuromedin U-8 and U-25: novel uterus stimulating and hypertensive peptides identified in porcine spinal cord. Biochem Biophys Res Commun 1985;130:1078–85. Mogil JS, Wilson SG, Bon K, Lee SE, Chung K, Raber P, et al. Heritability of nociception I: responses of 11 inbred mouse strains on 12 measures of nociception. Pain 1999;80:67–82. Mori K, Miyazato M, Ida T, Murakami N, Serino R, Ueta Y, et al. Identification of neuromedin S and its possible role in the mammalian circadian oscillator system. EMBO J 2005;24:325–35. Moriyama M, Furue H, Katafuchi T, Teranishi H, Sato T, Kano T, et al. Presynaptic modulation by neuromedin U of sensory synaptic transmission in rat spinal dorsal horn neurones. J Physiol 2004;559:707–13. Moriyama M, Sato T, Inoue H, Fukuyama S, Teranishi H, Kangawa K, et al. The neuropeptide neuromedin U promotes inflammation by direct activation of mast cells. J Exp Med 2005;202:217–24. Nakahara K, Kojima M, Hanada R, Egi Y, Ida T, Miyazato M, et al. Neuromedin U is involved in nociceptive reflexes and adaptation to environmental stimuli in mice. Biochem Biophys Res Commun 2004;323:615–20. Nakazato M, Hanada R, Murakami N, Date Y, Mondal MS, Kojima M, et al. Central effects of neuromedin U in the regulation of energy homeostasis. Biochem Biophys Res Commun 2000;277:191–4. Pesquero JB, Araujo RC, Heppenstall PA, Stucky CL, Silva Jr JA, Walther T, et al. Hypoalgesia and altered inflammatory responses in mice lacking kinin B1 receptors. Proc Natl Acad Sci USA 2000;97:8140–5.

Raddatz R, Wilson AE, Artymyshyn R, Bonini JA, Borowsky B, Boteju LW, et al. Identification and characterization of two neuromedin U receptors differentially expressed in peripheral tissues and the central nervous system. J Biol Chem 2000;275:32452–9. Shan L, Qiao X, Crona JH, Behan J, Wang S, Laz T, et al. Identification of a novel neuromedin U receptor subtype expressed in the central nervous system. J Biol Chem 2000;275:39482–6. Suri C, Jones PF, Patan S, Bartunkova S, Maisonpierre PC, Davis S, et al. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 1996;87:1171–80. Szekeres PG, Muir AI, Spinage LD, Miller JE, Butler SI, Smith A, et al. Neuromedin U is a potent agonist at the orphan G proteincoupled receptor FM3. J Biol Chem 2000;275:20247–50. Tjolsen A, Berge OG, Hunskaar S, Rosland JH, Hole K. The formalin test: an evaluation of the method. Pain 1992;51:5–17. Valenzuela DM, Murphy AJ, Frendewey D, Gale NW, Economides AN, Auerbach W, et al. High-throughput engineering of the mouse genome coupled with high-resolution expression analysis. Nat Biotechnol 2003;21:652–9. Wren AM, Small CJ, Abbott CR, Jethwa PH, Kennedy AR, Murphy KG, et al. Hypothalamic actions of neuromedin U. Endocrinology 2002;143:4227–34. Yu XH, Cao CQ, Mennicken F, Puma C, Dray A, O’Donnell D, et al. Pro-nociceptive effects of neuromedin U in rat. Neuroscience 2003;120:467–74. Zimmer A, Zimmer AM, Baffi J, Usdin T, Reynolds K, Konig M, et al. Hypoalgesia in mice with a targeted deletion of the tachykinin 1 gene. Proc Natl Acad Sci USA 1998;95:2630–5.