Mice Lacking α-Synuclein have an Attenuated Loss of Striatal Dopamine Following Prolonged Chronic MPTP Administration

NeuroToxicology 25 (2004) 761–769

Mice Lacking a-Synuclein have an Attenuated Loss of Striatal Dopamine Following Prolonged Chronic MPTP Administration Robert E. Drolet3, Bahareh Behrouz2, Keith J. Lookingland1,3, John L. Goudreau1,2,3,* 1

Department of Pharmacology and Toxicology, Michigan State University, East Lansing, MI, USA Department of Neurology, Michigan State University, East Lansing, MI, USA 3 The Neuroscience Program, Michigan State University, B-436 Life Sciences Building, East Lansing, MI 48824, USA 2

Received 6 December 2003; accepted 6 May 2004 Available online 25 June 2004

Abstract The functional role of a-synuclein in the pathogenesis of Parkinson’s disease (PD) is not fully understood. Systemic exposure of a-synuclein-deficient mice to neurotoxins provides a direct approach to evaluate how a-synuclein may mediate cell death in a common murine model of PD. To this end, wild-type and homozygous a-synuclein knock-out mice were treated with sub-chronic and prolonged, chronic exposure to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). In the sub-chronic model, wild-type and a-synuclein knock-out mice were treated for five consecutive days with MPTP (1–25 mg/kg, s.c.) or vehicle, and sacrificed 3 days following the last injection. The prolonged, chronic model consisted of two injections of MPTP (1–20 mg/kg, s.c.) per week for 5 weeks, with co-administration of probenecid (250 mg/kg, i.p.), and animals were sacrificed 3 weeks following the last injection. Sub-chronic administration of MPTP caused a dramatic, dose-dependent decrease in striatal dopamine (DA) concentrations, while an attenuated response was observed in a-synuclein knock-out mice. Similarly, prolonged, chronic administration of MPTP produced a dosedependent decrease in striatal DA concentrations, and a corresponding loss of striatal vesicular monoamine transporter (VMAT-2) protein in wild-type mice. However, mice lacking a-synuclein had an attenuated loss of striatal DA concentrations, while no loss of striatal VMAT-2 protein was observed. Both sub-chronic and prolonged, chronic administration of MPTP caused an increase in the 3,4-dihydroxyphenylacetic acid (DOPAC) to DA ratio in wild-type mice, but not in mice lacking a-synuclein. Despite attenuated toxicity, elevated lactate concentrations were observed in asynuclein knock-out mice following prolonged, chronic MPTP administration. The results of this study provide evidence that a-synuclein null mice have an attenuated response to the toxic effects of MPTP exposure, even over prolonged periods of time and that the biochemical sequela of a protracted insult to nigrostriatal DA neurons are distinct between mice with and without a-synuclein expression. # 2004 Elsevier Inc. All rights reserved.

Keywords: Parkinson’s disease; MPTP; a-Synuclein; Dopamine

INTRODUCTION Parkinson’s disease (PD) is a chronic, progressive neurodegenerative disorder characterized by the development of movement abnormalities including * Corresponding author. Tel.: þ1 517 353 9347; fax: þ1 517 353 8915. E-mail address: [email protected] (J.L. Goudreau).

resting tremor, bradykinesia, postural instability and rigidity (Dauer and Przedborski, 2003). The salient pathological features of PD are the loss of dopamine (DA) neurons of the substantia nigra pars compacta, and the presence of Lewy bodies in the remaining cells which represent a complex aggregate of insoluble proteins (Spillantini et al., 1997). a-Synuclein, a 19 kDa protein localized primarily to the presynaptic nerve terminal, is a major component of the

0161-813X/$ – see front matter # 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.neuro.2004.05.002

762

R.E. Drolet et al. / NeuroToxicology 25 (2004) 761–769

Lewy-body and mutations or triplications in the asynuclein gene are associated with autosomal dominant parkinsonism (Kruger et al., 1998; Polymeropoulos et al., 1997; Singleton et al., 2003). Understanding the role of a-synuclein in DA neuronal degeneration and Lewy-body formation could provide key information about the pathogenesis of PD. One approach to evaluating the role that a-synuclein plays in PD is to determine how this protein alters the response of the nigrostriatal DA system to neurotoxins used in animal models of this disorder. 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) is a neurotoxin that produces a Parkinson-like syndrome in humans (Langston et al., 1983). Following systemic administration MPTP crosses the blood brain barrier and is taken up primarily by glial cells, converted to its active metabolite 1-methyl-4-phenylpyridinium (MPPþ) by monoamine oxidase, and released. MPPþ is then selectively taken up by DA neurons through the DA transporter (DAT) (Dauer and Przedborski, 2003). MPTP administration reliably depletes striatal DA concentrations and causes destruction of DA neurons within the substantia nigra. Toxicity is directly related to MPPþ-induced inhibition of mitochondrial NADH:ubiquinone oxido-reductase (complex I) activity (Nicklas et al., 1985) which produces a depletion of cellular energy, and increases the production of oxygen free-radical species (Chan et al., 1991; Fabre et al., 1999; Hasegawa et al., 1990, 1997). MPTP may induce neurodegeneration via apoptosis or necrosis depending on its administration regimen, and the degree of toxicity is species and strain-dependent (Jackson-Lewis et al., 1995; Smeyne et al., 2001; Tatton and Kish, 1997). Although acute MPTP exposure produces irreversible parkinsonism in humans (Ballard et al., 1985), acute and sub-chronic MPTP exposure in mice and nonhuman primates results in loss of nigrostriatal DA neuronal function that is not progressive and may eventually recover over time (Eidelberg et al., 1986; Petroske et al., 2001). An exposure paradigm has been developed using prolonged, chronic exposure to MPTP that produces both a long-lasting and progressive loss of nigrostriatal DA neurons (Meredith et al., 2002; Petroske et al., 2001). Because PD is both a chronic and progressive disorder, it is important that animal models replicating the disease produce chronic and progressive loss of nigrostriatal DA neurons. Specific deletion of the a-synuclein gene by homologous recombination techniques appears to attenuate the destruction of nigrostriatal DA neurons following acute and sub-chronic MPTP administration (Dauer

et al., 2002; Schlu¨ter et al., 2003). However, Schlu¨ter et al. (2003) also reported that mice with a spontaneous deletion of a 2 cM region surrounding the native asynuclein gene have a decrease in striatal DA concentration following a single dose of MPTP that is similar to wild-type controls. This latter finding raises the possibility of confounding differences in background strain as an alternative explanation for the attenuated response to MPTP seen in the a-synuclein null mice generated by homologous recombination, and highlights the need for further confirmatory studies in other a-synuclein knock-out mouse lines. Furthermore, if asynuclein knock-out mice are resistant to the toxic effects of MPTP, the precise mechanism by which the absence of a-synuclein translates into reduced sensitivity to systemic MPTP administration is not known. a-Synuclein has been suggested to modulate DA homeostasis by regulating DA vesicular storage, uptake and synthesis (Lee et al., 2001; Lotharius and Brundin, 2002; Perez et al., 2002). The purpose of the present study was to evaluate DA vesicular storage and neurochemical indices of DA neuronal activity in mice lacking a-synuclein following prolonged, chronic exposure to MPTP. Wild-type and a-synuclein knock-out male mice were given sub-chronic or prolonged, chronic MPTP, and striatal DA, 3,4-dihydroxyphenylacetic acid (DOPAC), vesicular monoamine transporter (VMAT-2), and substantia nigra lactate concentrations were measured as primary endpoints of neurotoxicity. Striatal DA concentrations reflect storage at the nerve terminal, while DOPAC and the DOPAC/DA ratio are an index of DA neuron activity associated with DA release, reuptake and metabolism (DeMaria et al., 1999; Westerink and Spaan, 1982). VMAT-2 protein expression is a reliable indicator of vesicular concentration and provides a more accurate measure of nerve terminal density compared to other plastic phenotypic markers such as DA transporter and tyrosine hydroxylase protein levels, immunohistochemical staining or ligand binding (Hogan et al., 2000; Kilbourn et al., 2000; Reveron et al., 2002; Wilson and Kish, 1996; Wilson et al., 1996). Lactate concentrations were measured as an indirect assessment of mitochondrial function in the substantia nigra (Kindt et al., 1987). The results of this study show that loss of striatal DA and VMAT-2 protein concentrations following sub-chronic and prolonged, chronic MPTP treatment is attenuated in mice lacking a-synuclein. In addition, the increase in DA neuronal activity seen in wild-type mice is absent in a-synuclein knock-out mice, whereas the a-synuclein-deficient mice have persistent deficits in mitochondrial function compared

R.E. Drolet et al. / NeuroToxicology 25 (2004) 761–769

to wild-type mice following prolonged, chronic MPTP exposure.

MATERIALS AND METHODS Animals Homozygous a-synuclein knock-out mice were obtained in breeding pairs from Jackson Labs (B6;129X-SncatmlRosl, stock #3692, Bar Harbor, MA). The generation, viability, fertility and basic biochemical features of this strain have been previously described (Abeliovich et al., 2000). a-Synuclein knock-out mice were crossed with the inbred strain (C57/Bl6) used as the host for the blastocyst during the original generation of the a-synuclein knock-out mice (Abeliovich et al., 2000) to yield heterozygous mice (F1). Heterozygous mice were then crossed and the offspring of this cross (F2) were used to maintain a stable breeding colony. Additional heterozygous (F2  F2 and F3  F3) crosses were performed to expand and maintain the colony for the experiments described herein. University-trained technicians maintained the breeding colony. Animal genotype was confirmed by PCR analysis of genomic DNA (isolated from tail samples) using primers specific for exon 2 of the a-synuclein gene to identify native a-synuclein, and the neomycin resistance gene insert to identify the knock-out sequence. As shown in Fig. 1, animal genotype was confirmed for all animals used in this study by PCR amplification of genomic DNA using primers bracketing exon 2 of the a-synuclein gene (GGCGACGTGAAGGAGCCAGGGA-F; CAGCGAAAGGAAAGCCGAGTGATGTACT-R) or the neomycin resistance gene (CTTGGGTGGAGAGGCTATTC-F; AGGTGAGATGACAGGAGATC). PCR reaction parameters may be found at (http://jaxmice.jax.org/ pub-cgi /protocols / protocols.sh ? objtype ¼ protocol&

Fig. 1. Genotyping of wild-type (þ/þ), a-synuclein homozygous knock-out (/), heterozygous (þ/) mice, and control blanks (0). Ethidium bromide stained 3% agarose gel following electrophoresis of PCR amplification products of exon 2 of the a-synuclein gene (320 bp) and the neomycin resistance construct (280 bp).

763

protocol_id¼456). Male wild-type (a-synuclein þ/þ) and knock-out (a-synuclein /) mice (age 8–12 weeks) from identical offspring generations of F4 and F5 heterozygotes were used for both the subchronic and prolonged, chronic MPTP experiments. Wild-type and homozygous a-synuclein knock-out littermates from several litters were randomly distributed to both control and MPTP treatment groups to minimize the potential influence that variations in background strain could produce. Animals were housed two to four per cage, maintained in a temperature (22 8C  1) and light controlled (12L:12D) room, and provided with food and tap water ad libitum. The Michigan State University, All University Committee on Animal Use and Care approved all experiments using live animals. Drugs MPTP-hydrochloride (Sigma, St. Louis, MO) was dissolved in 0.9% sterile saline and doses reflect the hydrochloride salt. Dipropylsulfamoyl-benzoic acid (probenecid, Sigma) was dissolved in dimethyl sulfoxide (DMSO, Sigma). MPTP Administration Sub-Chronic Regimen Male homozygous a-synuclein knock-out and wildtype littermate control (age 8–12 weeks, 8 per group) mice received subcutaneous injections of vehicle (1 ml/kg) or MPTP (1, 5, or 25 mg/kg) once daily for five consecutive days. Three days following the last injection animals were decapitated and the brains were quickly removed and frozen over dry ice and stored at 80 8C until analysis. Prolonged Chronic Regimen Male homozygous a-synuclein knock-out mice and wild-type littermate control mice (age 8–12 weeks, 6–8 per group) received subcutaneous injections of vehicle (1 ml/kg) or MPTP (1, 5, 10, or 20 mg/kg) twice a week, alternating morning and afternoon every 3.5 days, for a total of 10 total injections over 5 weeks. Probenecid (250 mg/kg; i.p.) was co-administered with each dose of MPTP to increase the plasma and central nervous system half-life of MPTP and MPPþ, respectively (Petroske et al., 2001). Neither DMSO nor probenecid produce an effect per se on nigrostriatal DA neurons (Lau et al., 1990). All experiments using MPTP were performed using previously published safety guidelines (Przedborski et al., 2001). Animals

764

R.E. Drolet et al. / NeuroToxicology 25 (2004) 761–769

were killed by decapitation 3 weeks following the last injection and tissue was processed as described above. Neurochemical Analysis of Striatal DA and DOPAC Coronal brain sections (500 mm) were prepared using a cryostat (10 8C), and the striatum and substantia nigra were dissected using a modification of the technique of Palkovits (Palkovits, 1973). Briefly, a cannula with a 1 mm inner diameter was used to take tissue punches of the striatum. Striatum samples containing approximately 25 mg of total protein per sample were placed in 100 ml of 0.1 M phosphate–citrate buffer containing 15% methanol and stored at 20 8C until assayed for DA and DOPAC using high performance liquid chromatography coupled with electrochemical detection (Lindley et al., 1990). DA and DOPAC concentrations were determined by normalizing samples to protein concentrations (Lowry et al., 1951). Portions of the striatum and substantia nigra were frozen directly on dry ice and stored at 80 8C until assayed for VMAT-2 protein and lactate concentrations, respectively.

Lactate Measurements Microdissected substantia nigra samples were placed in 100 ml of 0.1 M phosphate–citrate buffer containing 15% methanol and sonicated with 1 s bursts until dissolved. Samples were centrifuged at 10,000  g for 10 min at 4 8C. Lactate was measured using a Lactate Assay kit (Sigma) and instructions were followed as directed by the manufacturer method #735. The supernatant was removed and 10 ml was added to 1.0 ml of lactate reagent (Sigma). Absorbance was read at 540 nm (Bio-Tek Instruments) and concentrations of lactate were normalized to protein concentration (Lowry et al., 1951). Statistics Sigma Stat software version 2.03 was used to make statistical comparisons among groups in dose response experiments using one-way analysis of variance, followed by Tukey’s test. Differences with a probability of error of less than 5% were considered significant.

RESULTS Western Blot Analysis of Striatal VMAT-2 Protein

DA and DOPAC Concentrations in the Striatum

Microdissected striata were homogenized in 100 ml of buffer containing 50 mM Tris (pH 8), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 5% SDS, 1% Triton X100, 0.5% sodium deoxycholate, 2 mg/ml leupeptin, 2 mg/ml aprotinin, 1 mg/ml pepstatin, and 1 mM PMFS. Proteins (20 mg) were separated on 10% polyacrylamide precast gels (Biorad #1611458) and transferred to a 0.45 mm nitrocellulose membrane. Blots were then incubated with rabbit polyclonal anti-VMAT-2 (Chemicon, Temecula, CA 1:1500) directed against the Cterminus of VMAT-2. Mouse monoclonal anti-b-IIItubulin (MAB1637, Chemicon, Temecula, CA 1:2000) was used to control for variations in loading. Bound antibodies were detected with peroxidase-conjugated goat anti-rabbit (Vector Labs #PI-1000, 1:20,000) or horse anti-mouse (Vector Labs #PI-2000, 1:20,000) secondary antibodies and visualized with enhanced chemiluminescence reagents (Super Signal West Pico, Pierce Chemical, Rockford, IL). Densitometric analysis was performed using NIH Image software and background subtracted densities of the VMAT-2 bands were normalized to the b-III-tubulin signals to yield relative density units (RDU) of VMAT concentrations.

Sub-chronic administration of MPTP produced a dose-dependent decrease in striatal DA concentrations in wild-type mice (Fig. 2A), resulting in 80% depletion using the highest dose (25 mg/kg). Although subchronic administration of 25 mg/kg MPTP decreased striatal DA concentrations in a-synuclein knock-out mice, this was attenuated when compared with wildtype mice. Concentrations of DOPAC changed in parallel with that of DA, with a dose-dependent decrease in wild-type mice, which was attenuated in knock-out mice (Fig. 2B). The ratio of DOPAC/DAwas increased in wild-type mice but not in a-synuclein knock-out mice following 25 mg/kg sub-chronic MPTP (Fig. 2C). Prolonged, chronic MPTP treatment produced dosedependent depletion of striatal DA in wild-type mice while a rightward shift in the dose-toxicity curve was observed in mice lacking a-synuclein (Fig. 3A). Prolonged, chronic administration of either 10 or 20 mg/ kg of MPTP depleted DA concentrations in wild-type mice. However, only the highest dose (20 mg/kg) produced a decrease in striatal DA concentrations in knock-out animals. There was a dose-dependent decrease in DOPAC concentrations in the striatum in

R.E. Drolet et al. / NeuroToxicology 25 (2004) 761–769

Sub-Chronic WT

120

DA (% of Saline)

Prolonged Chronic

(A) 120

KO

100 80

#

60

*

*

40 20

DA (% of saline)

(A)

765

100 80

*

20 0

0

5

*

40

1 1

#

*

60

25

5

10

20

MPTP Dose (mg/kg)

MPTP Dose (mg/kg)

DOPAC (% of Saline)

100 80

* *

60 40

DOPAC (% of Saline)

(B) 120 (B) 120

100 80

#

*

60 40

*

20 0

20

1

5

10

20

0

1

5

MPTP Dose (mg/kg)

25

MPTP Dose (mg/kg) (C)

0.16

DOPAC/DA

DOPAC / DA

0.12 0.10 0.08 0.06 0.04 0.02 0

Saline

1

5

*

(C) 0.45

*

0.14

25

MPTP Dose (mg/kg)

Fig. 2. Dose response effect of sub-chronic MPTP administration on striatal DA (A); DOPAC (B); and the DOPAC/DA ratio (C). Wild-type (black) or a-synuclein knock-out (grey) mice were treated with various doses (1–25 mg/kg, i.p.) of MPTP in a subchronic regimen or its saline vehicle (1 ml/kg). DA and DOPAC columns represent percent change from saline control. (A) Actual DA control values: wild-type 200  5 ng/mg protein, knock-out 276  4 ng/mg protein. (B) Actual DOPAC control values: wildtype 17.4  1.6 ng/mg protein, knock-out 20.1  0.4 ng/mg protein. (C) DOPAC/DA ratio columns represent means. Vertical lines represent 1 S.E. of six to eight determinants; (*) indicate a significant difference from saline treatment group; (#) indicates a significant difference from MPTP-treated wild-type counterparts (P  0.05).

wild-type mice and an attenuated decrease in the knock-out mice (Fig. 3B). The DOPAC/DA ratio was only increased in wild-type mice (Fig. 3C).

0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0

* Saline

1

5

10

20

MPTP Dose (mg/kg)

Fig. 3. Dose response effect of prolonged, chronic MPTP on striatal DA (A); DOPAC (B); and the DOPAC/DA ratio (C). Wildtype (black) or a-synuclein knock-out (grey) mice were treated with various doses (1–20 mg/kg, i.p.) of MPTP in a prolonged, chronic regimen or its saline vehicle (1 ml/kg). DA and DOPAC columns represent percent change from saline control. (A) Actual DA control values: wild-type 190  18 ng/mg protein, knock-out 270  23 ng/mg protein. (B) Actual DOPAC control values: wildtype 22.2  1.8 ng/mg protein, knock-out 28  3.5 ng/mg protein. DOPAC/DA ratio columns represent means. Vertical lines represent 1 S.E. of six to eight determinants; (*) indicate a significant difference from saline treatment group; (#) indicates a significant difference from MPTP-treated wild-type counterparts (P  0.05).

immunoreactivity in wild-type mice (Fig. 4A and B), while knock-out mice were unaffected. Substantia Nigra Lactate Concentrations

Striatum VMAT-2 Protein Concentrations Prolonged, chronic administration of 20 mg/kg MPTP, produced a significant depletion of VMAT-2

Lactate concentrations in the substantia nigra were significantly elevated following prolonged, chronic administration of MPTP in a-synuclein knock-out

766

R.E. Drolet et al. / NeuroToxicology 25 (2004) 761–769

Fig. 4. Dose response effect of MPTP on striatum VMAT-2 immunoreactivity. Wild-type (black) or a-synuclein knock-out (grey) mice were administered MPTP (10 or 20 mg/kg, i.p.) in a prolonged, chronic regimen or their saline vehicle (1 ml/kg). (A) Two representative immunoblot samples of wild-type mice striatal VMAT-2 (80 kDa) and b-III-Tubulin (50 kDa) protein following prolonged, chronic MPTP or saline treatment. (B) Quantification of striatal VMAT-2 protein. Relative density units (RDU) were obtained by subtracting the b-IIITubulin signal from the VMAT-2 protein signal. Columns represent percent change from saline treated controls. Actual control values: wild-type 60  10 RDU, knock-out 45  9 RDU. Vertical lines represent 1 S.E. of four to six determinants; (*) indicate a significant difference from saline treated group (P  0.05).

Lactate (ug/mg)

60 50

WT

40

KO

*

*

30 20 10 0 Saline

10

20

MPTP Dose (mg/kg)

Fig. 5. Dose response effect of MPTP on substantia nigra lactate concentrations. Wild-type (black) and a-synuclein knock-out (grey) mice were treated with prolonged, chronic MPTP (10 or 20 mg/kg, i.p.) or their saline vehicle (1 ml/kg). Columns represent means and vertical lines represent 1 S.E. of six to eight determinants; (*) indicates a significant difference from salinetreated group (P  0.05).

mice. In contrast, substantia nigra lactate concentrations in wild-type mice remained unchanged following prolonged, chronic MPTP treatment (Fig. 5).

DISCUSSION The results of this study provide evidence that mice lacking a-synuclein have an attenuated response to sub-chronic and prolonged, chronic MPTP administration. Using DA concentrations in the striatum as an index of nerve terminal storage, it is clear that asynuclein knock-out mice have attenuated responses to both sub-chronic and prolonged, chronic systemic MPTP exposure when compared to wild-type mice. Despite using a MPTP administration protocol that more closely mimics the chronic time course of neu-

rodegeneration seen in PD, our findings are in agreement with previous studies suggesting that selective deletion of a-synuclein gene expression from either insertion of a stop codon prior to a start codon, or the deletion of the a-synuclein gene with targeting vectors confers resistance to acute, and sub-chronic MPTP administration (Dauer et al., 2002; Schlu¨ ter et al., 2003). Despite supporting the hypothesis that a-synuclein is involved in MPTP induced toxicity, the present study does not provide an explanation why mice with a spontaneous 2 cM genomic deletion in a region containing the a-synuclein gene have a similar response to MPTP as wild-type mice. The present study alone cannot exclude the possibility of an unknown variation in background strain between the wild-type a-synuclein knock-out mice as an alternative explanation for the differential response to MPTP described herein. However, an attenuated response to MPTP has now been replicated independently in three unique strains of mice with absent a-synuclein expression. Taken together, it is more plausible that the resistance to MPTP is directly related to the loss of a-synuclein and less likely due to an unaccounted variation in background strain coincidentally occurring in three independent strains of a-synuclein knock-out mice. Nevertheless, the fact that the spontaneous deletion of a segment of the genome containing the a-synuclein gene does not result in altered sensitivity to acute MPTP exposure is an important finding and might suggest the presence of an adjacent modifying gene that could also influence the response to MPTP or interact with a-synuclein. The activity of DA neurons was assessed indirectly using the ratio of DOPAC (DA metabolism) to DA

R.E. Drolet et al. / NeuroToxicology 25 (2004) 761–769

(vesicular storage). DOPAC is the major metabolite formed from intra-neuronal metabolism of DA by monoamine oxidase. Following treatment with doses of MPTP that sufficiently deplete striatal DA levels (i.e. 25 mg/kg, sub-chronic; 10 or 20 mg/kg, prolonged, chronic) wild-type mice have an increase in the DOPAC/DA ratio. The increase in DOPAC/DA ratio observed in wild-type mice following MPTP exposure suggests a compensatory increase in activity of the surviving neurons. Interestingly, a-synuclein knock-out mice do not have an increase in the DOPAC/DA ratio following a loss of up to 50% of striatal DA innervation. One explanation is that mice lacking a-synuclein are unable to increase DA release sufficient to produce an increase in the DOPAC/DA ratio. The attenuated response to MPTP in mice lacking a-synuclein may be due to an inability of the toxin to reach mitochondrial complex I (Dauer et al., 2002). The mitochondria hold the site of action for MPPþ as well as for the conversion of DA to DOPAC. No change in the DOPAC/DA ratio in a-synuclein knock-out mice could reflect a common neuronal dysfunction, which prevents recovered MPPþ and DA from reaching the mitochondria. In parallel with our neurochemical data, there is a dose-dependent decrease in striatal VMAT-2 protein in wild-type mice following prolonged, chronic MPTP treatment. However, mice lacking a-synuclein do not show a loss of VMAT-2 despite a significant loss of DA concentrations. Using VMAT-2 as an indicator of synaptic vesicle density there is a discrepancy between DA and VMAT-2 concentrations in a-synuclein knockout mice. Depletion of striatal DA stores in the absence of loss of vesicles could be due to sequestration of MPPþ into synaptic vesicles, thereby preventing the toxin from reaching the mitochondria (German et al., 2000). It is unlikely that mice lacking a-synuclein have decreased MPPþ uptake since these mice have unaltered DAT protein expression and function (Dauer et al., 2002). Administration of MPTP produces an increase in extracellular lactate concentrations (Kindt et al., 1987). It was previously reported that following MPTP administration, lactate concentrations were lower in a-synuclein knock-out mice than in wild-type mice (Dauer et al., 2002), suggesting an inability of the toxin to reach complex I in knock-out mice. In contrast, the present study demonstrated that, following MPTP administration, lactate concentrations in the substantia nigra were higher in mice lacking a-synuclein than in wild-type mice. The discrepancy in lactate results likely stems from a difference in the time as well as

767

the region of sample collection. Dauer et al. (2002) measured lactate concentrations in the striatum by microdialysis directly following MPTP administration. The present study measured lactate concentrations in the substantia nigra 3 weeks following the last injection of MPTP. Given the interval between MPTP exposure and sample collection it is unlikely that MPTP or MPPþ remains in situ to directly inhibit mitochondrial function (Dauer and Przedborski, 2003). There are a number of potential explanations for the persistent increase in lactate concentrations observed in this study. If mice lacking a-synuclein are resistant to MPTP because of increased vesicular sequestration of the neurotoxin, then it is possible that the sequestered MPPþ could be released from its vesicular compartment and able to continually inhibit mitochondrial complex I long after systemic MPPþ has been excreted. The increase in lactate concentration in a-synuclein knock-out mice may also be explained by a greater number of surviving substantia nigra neurons capable of producing lactate. However, wild-type mice receiving 10 mg/kg MPTP and a-synuclein knock-out mice receiving 20 mg/kg MPTP have similar depletions of striatal DA, but only mice lacking a-synuclein have increased lactate concentrations. Further studies using direct measurements of mitochondrial function and oxidative stress will be necessary to determine if a specific and ongoing mitochondrial deficit exists in a-synuclein knock-out mice following prolonged, chronic MPTP exposure. If a persistent mitochondrial deficit does exist, then it is possible that these mice may actually be more vulnerable to the effects of MPTP if the time course of the study were extended further. Consistent with this hypothesis, studies are currently underway assessing the toxicity of prolonged, chronic MPTP on wild-type and a-synuclein knock-out mice six months post MPTP treatment. Since this chronic MPTP model and time point was shown to produce intraneuronal protein inclusions in C57 mice (Meredith et al., 2002), it will be interesting to determine if inclusions can be formed in mice lacking a-synuclein. In summary, this study demonstrates that there is an attenuated response to prolonged, chronic MPTP exposure in a-synuclein knock-out mice. Although the mechanism by which the deletion of the a-synuclein gene promotes resistance to MPTP remains unclear, the results of this study suggest that mice lacking asynuclein could be resistant to MPTP due to an increased ability to sequester the toxin into synaptic vesicles. While there may be a number of alternative reasons a-synuclein knock-out mice have an attenuated

768

R.E. Drolet et al. / NeuroToxicology 25 (2004) 761–769

response to MPTP administration, it is clear that future studies using similar strategies have the potential to elucidate the role of a-synuclein as a mediator of the response to systemic neurotoxin exposure.

ACKNOWLEDGEMENTS This work was supported by grants from the Michigan State University Foundation, and the Michigan Parkinson’s Foundation. The authors thank Dr. Ryan Burri, Mr. Jeremy Smith, Ms. Melissa Quaka for their technical help.

REFERENCES Abeliovich A, Schmitz Y, Farinas I, Choi-Lundberg D, Ho WH, Castillo PE et al. Mice lacking alpha-synuclein display functional deficits in the nigrostriatal dopamine system. Neuron 2000;25:239–52. Ballard PA, Tetrud J, Langston JW. Permanent human parkinsonism due to 1-methyl-4-phenyl-1,2,3, 6-tetrahydropyridine (MPTP): seven cases. Neurology 1985;35:949–56. Chan P, DeLanney LE, Irwin I, Langston J, Di Monte D. Rapid ATP loss caused by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine in mouse brain. J Neurochem 1991;57:348–51. Dauer W, Przedborski S. Parkinson’s disease: mechanisms and models. Neuron 2003;39:889–909. Dauer W, Kholodilov N, Vila M, Trillat AC, Goodchild R, Larsen KE et al. Resistance of alpha-synuclein null mice to the parkinsonian neurotoxin MPTP. Proc Natl Acad Sci USA 2002;99:14524–9. DeMaria JE, Lerant AA, Freeman ME. Prolactin activates all three populations of hypothalamic neuroendocrine dopaminergic neurons in ovariectomized rats. Brain Res 1999;837:236–41. Eidelberg E, Brooks BA, Morgan WW, Walden JG, Kokemoor RH. Variability and functional recovery in the N-methyl-4phenyl-1,2,3,6-tetrahydropyridine model of parkinsonism in monkeys. Neuroscience 1986;18:817–22. Fabre E, Monserrat J, Herrero A, Barja G, Leret ML. Effect of MPTP on brain mitochondrial H2O2 and ATP production and on dopamine and DOPAC in the striatum. J Physiol Biochem 1999;55:325–31. German DC, Liang CL, Manaye KF, Lane K, Sonsalla PK. Pharmacological inactivation of the vesicular monoamine transporter can enhance 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced neurodegeneration of midbrain dopaminergic neurons, but not locus coeruleus noradrenergic neurons. Neuroscience 2000;101:1063–9. Hasegawa E, Takeshige K, Oishi T, Murai Y, Minakami S. 1Methyl-4-phenylpyridinium (MPPþ) induces NADH-dependent superoxide formation and enhances NADH-dependent lipid peroxidation in bovine heart submitochondrial particles. Biochem Biophys Res Commun 1990;170:1049–55. Hasegawa E, Kang D, Sakamoto K, Mitsumoto A, Nagano T, Minakami S et al. A dual effect of 1-methyl-4-phenylpyridinium (MPPþ)-analogs on the respiratory chain of bovine

heart mitochondria. Arch Biochem Biophys 1997;337: 69–74. Hogan KA, Staal RG, Sonsalla PK. Analysis of VMAT2 binding after methamphetamine or MPTP treatment: disparity between homogenates and vesicle preparations. J Neurochem 2000;74: 2217–20. Jackson-Lewis V, Jakowec M, Burke RE, Przedborski S. Time course and morphology of dopaminergic neuronal death caused by the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. Neurodegeneration 1995;4:257–69. Kilbourn MR, Kuszpit K, Sherman P. Rapid and differential losses of in vivo dopamine transporter (DAT) and vesicular monoamine transporter (VMAT2) radioligand binding in MPTPtreated mice. Synapse 2000;35:250–5. Kindt MV, Heikkila RE, Nicklas WJ. Mitochondrial and metabolic toxicity of methyl-4-(20 -methylphenyl)-1,2,3,6tetrahydropyridine. J Pharmacol Exp Ther 1987;242:858–63. Kruger R, Kuhn W, Muller T, Woitalla D, Graeber M, Kosel S et al. Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson’s disease. Nat Genet 1998;18:106–8. Langston JW, Ballard P, Tetrud JW, Irwin I. Chronic parkinsonism in humans due to a product of meperidine–analog synthesis. Science 1983;219:979–80. Lau YS, Trobough KL, Crampton JM, Wilson JA. Effects of probenecid on striatal dopamine depletion in acute and longterm 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)treated mice. Gen Pharmacol 1990;21:181–7. Lee FJ, Liu F, Pristupa ZB, Niznik HB. Direct binding and functional coupling of alpha-synuclein to the dopamine transporters accelerate dopamine-induced apoptosis. FASEB J 2001;15:916–26. Lindley SE, Gunnet JW, Lookingland KJ, Moore KE. 3,4Dihydroxyphenylacetic acid concentrations in the intermediate lobe and neural lobe of the posterior pituitary gland as an index of tuberohypophysial dopaminergic neuronal activity. Brain Res 1990;506:133–8. Lotharius J, Brundin P. Impaired dopamine storage resulting from alpha-synuclein mutations may contribute to the pathogenesis of Parkinson’s disease. Hum Mol Genet 2002;11:2395–407. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265–75. Meredith GE, Totterdell S, Petroske E, Santa Cruz K, Callison Jr, RC, Lau YS. Lysosomal malfunction accompanies alphasynuclein aggregation in a progressive mouse model of Parkinson’s disease. Brain Res 2002;956:156–65. Nicklas WJ, Vyas I, Heikkila RE. Inhibition of NADH-linked oxidation in brain mitochondria by 1-methyl-4-phenyl-pyridine, a metabolite of the neurotoxin, 1-methyl-4-phenyl-1,2,5,6tetrahydropyridine. Life Sci 1985;36:2503–8. Palkovits M. Isolated removal of hypothalamic or other brain nuclei of the rat. Brain Res 1973;59:449–50. Perez RG, Waymire JC, Lin E, Liu JJ, Guo F, Zigmond MJ. A role for alpha-synuclein in the regulation of dopamine biosynthesis. J Neurosci 2002;22:3090–9. Petroske E, Meredith GE, Callen S, Totterdell S, Lau YS. Mouse model of parkinsonism: a comparison between subacute MPTP and chronic MPTP/probenecid treatment. Neuroscience 2001;106:589–601. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A et al. Mutation in the alpha-synuclein gene identified

R.E. Drolet et al. / NeuroToxicology 25 (2004) 761–769 in families with Parkinson’s disease. Science 1997;276: 2045–7. Przedborski S, Jackson-Lewis V, Naini AB, Jakowec M, Petzinger G, Miller R et al. The parkinsonian toxin 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine (MPTP): a technical review of its utility and safety. J Neurochem 2001;76:1265–74. Reveron ME, Savelieva KV, Tillerson JL, McCormack AL, Di Monte DA, Miller GW. L-DOPA does not cause neurotoxicity in VMAT2 heterozygote knockout mice. NeuroToxicology 2002;23:611–9. Schlu¨ ter OM, Fornai F, Alessandri MG, Takamori S, Geppert M, Jahn R et al. Role of alpha-synuclein in 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine-induced parkinsonism in mice. Neuroscience 2003;118:985–1002. Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J et al. Alpha-synuclein locus triplication causes Parkinson’s disease. Science 2003;302:841. Smeyne M, Goloubeva O, Smeyne RJ. Strain-dependent susceptibility to MPTP and MPP(þ)-induced parkinsonism is determined by glia. Glia 2001;34:73–80.

769

Spillantini MG, Schmidt ML, Lee VM, Trojanowski JQ, Jakes R, Goedert M. Alpha-synuclein in Lewy bodies. Nature 1997;388:839–40. Tatton NA, Kish SJ. In situ detection of apoptotic nuclei in the substantia nigra compacta of 1-methyl-4-phenyl-1,2,3,6tetrahydropyridine-treated mice using terminal deoxynucleotidyl transferase labelling and acridine orange staining. Neuroscience 1997;77:1037–48. Westerink BH, Spaan SJ. Simultaneous determination of the formation rate of dopamine and its metabolite 3,4dihydroxyphenylacetic acid (DOPAC) in various rat brain areas. Brain Res 1982;252:239–45. Wilson JM, Kish SJ. The vesicular monoamine transporter, in contrast to the dopamine transporter, is not altered by chronic cocaine self-administration in the rat. J Neurosci 1996;16: 3507–10. Wilson JM, Levey AI, Rajput A, Ang L, Guttman M, Shannak K et al. Differential changes in neurochemical markers of striatal dopamine nerve terminals in idiopathic Parkinson’s disease. Neurology 1996;47:718–26.