Microarray detection of fungal infection in pulmonary tuberculosis

Egyptian Journal of Chest Diseases and Tuberculosis (2013) 62, 151–157

The Egyptian Society of Chest Diseases and Tuberculosis

Egyptian Journal of Chest Diseases and Tuberculosis www.elsevier.com/locate/ejcdt www.sciencedirect.com

ORIGINAL ARTICLE

Microarray detection of fungal infection in pulmonary tuberculosis Nehad M. Osman a,*, Ashraf A. Gomaa a, Nehad M. Sayed b, Ashraf A. Abd el aziz c a b c

Pulmonary Medicine Department, Faculty of Medicine, Ain Shams University, Egypt Medical Microbiology and Immunology Department, Faculty of Medicine, Ain Shams University, Egypt Tropical Department, Faculty of Medicine, Ain Shams University, Egypt

Received 3 November 2012; accepted 13 February 2013 Available online 11 March 2013

KEYWORDS Mycotic infection; Pulmonary tuberculosis; MDR-TB; DNA microarray

Abstract Background: Fungal pulmonary infection can be acquired in tuberculosis, immunodeficiency patients, and other chronic diseases. Many physicians missed fungal pulmonary infection because it does not show specific clinical manifestations. The aim was to identify the presence of overlapping fungal infections in tuberculosis patients, using high multiplexing capacity of DNA microarray. Methods: The present study was conducted on 50 tuberculosis patients who were subdivided into: Group I consisted of 30 cases of multidrug resistance tuberculosis, Group II consisted of 10 fresh cases and Group III consisted of 10 relapse cases. Morning sputum samples were examined by DNA microarray. Results: Aspergillus spp., was the only fungus detected in 24% of cases, Group I showed the highest percentage (26.6%) with statistically significant difference compared to Group II and III (20%) for each. Aspergillus fumigatus was the predominant spp. identified followed by Aspergillus niger and Aspergillus flavus. Mixed infection was identified in 4 cases in Group I. A statistical significant association between fungal detection and MDR-TB, diabetic patients, smoker, being male, presence of haemoptysis and toxic manifestations, presence of cavitary lesion or abscess and severity of X-ray finding.

* Corresponding author. E-mail address: [email protected] (N.M. Osman). Peer review under responsibility of The Egyptian Society of Chest Diseases and Tuberculosis.

Production and hosting by Elsevier 0422-7638 ª 2013 The Egyptian Society of Chest Diseases and Tuberculosis. Production and hosting by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ejcdt.2013.02.002

152

N.M. Osman et al. Conclusion: Microarray detection of mycotic infection represents a rapid diagnostic tool helping early diagnosis of fungal co-infection and pulmonary TB. MDR-TB patients carry the risk of higher percentage of fungal infections and more liable for acquiring mixed fungal pathogens. Presence of male sex, smoking, DM and far extent of lesion must attract physicians’ attention for fungal coinfection with pulmonary TB. ª 2013 The Egyptian Society of Chest Diseases and Tuberculosis. Production and hosting by Elsevier B.V. All rights reserved.

Introduction Fungal pulmonary infection has been emerging recently due to widely used broad spectrum antibiotics and steroids [1]. It can be acquired primarily or secondarily in tuberculosis (TB), immunodeficiency patients, other chronic diseases such as diabetes mellitus or malignancy, and may worsen the primary disease [2–6]. TB is principally a disease of poverty, with 95% of cases and 98% of deaths occurring in developing countries [7]. Globally, about 3% of all newly diagnosed patients have multidrug resistance tuberculosis (MDR-TB) [8]. Egypt is ranked among the mid level incidence countries in tuberculosis. In 2007 the annual risk of infection was calculated mathematically by WHO it was (24/1,00,000) [9]. In (2010), Egypt is estimated to have 15,000 TB cases and a rate of 18 cases per 1,00,000 of population [10]. The percentage of mycotic infections increase in pulmonary tuberculosis patients. Mainly four types of fungi, i.e. Aspergillus niger, A. fumigatus, Histoplasma capsulatum and Cryptococcus neoformans were recorded, which causes severe infection in lungs in patients suffering from pulmonary tuberculosis [11]. Many physicians missed fungal pulmonary infection because it does not show specific clinical manifestations and usually hindered by other diseases and cause high rates of morbidity and mortality [12]. There is an increasing awareness amongst clinicians and microbiologists pertaining to importance of infection caused by opportunistic fungi [13–15]. Therefore there is an acute need for proper diagnosis of the opportunistic fungal pathogen especially in tuberculosis patients. The conventional identification of pathogenic fungi based on phenotypic features and physiological tests is time-consuming and, therefore, often imperfect for the early initiation of an antifungal therapy [16]. DNA microarrays were introduced for the rapid and simultaneous identification of different fungal species at the same time. Based on pan fungal internal transcribed spacer (ITS) primers directed at the conserved regions between the 18S and 28S rRNA, which were shown to correlate well with culture results [17]. Aim of the work: Is to identify the presence of overlapping fungal infections in tuberculosis patients, using high multiplexing capacity of DNA microarray which may help in correct diagnosis of these diseases that may increase the cure rate. Patients and method Subjects The present study was conducted on 50 tuberculosis patients, randomly selected amongst the diagnosed pulmonary tuberculosis cases admitted in El Abbasia Chest Hospital, They were divided into the following groups:  Group I consisted of 30 cases diagnosed as MDR-TB.

 Group II consisted of 10 cases diagnosed as new cases (fresh cases).  Group III consisted of 10 cases diagnosed as relapse cases. Case definition by previous anti TB treatment [9]. New case A patient who has never had treatment for TB or who has taken anti-TB drugs for less than 4 weeks. Relapse A patient who has been declared cured of any form of TB in the past by a physician after one full course of chemotherapy, and has become sputum smear-positive. MDR-TB It is defined as resistance to any combination of anti-TB drugs that include INH and rifampicin. Cases were radiologically classified based on chest X-ray (CXR) findings according to National Tuberculosis Association of USA (196)1 [18] into: minimal, moderately advanced, and far advanced cases. Samples collection Informed consent was obtained from each participant prior to specimen collection. Early morning sputum was collected in a sterile dry wide-necked, leak-proof container from each case and transported to the laboratory. Then sample was homogenized and liquefied using NALC––Na OH method that involves use of N-acetyl-L-cysteine (NALC) according to Colle et al. [19]. DNA extraction was done using Qiamp DNA Mini Kit (Qiagen, Izasa, Madrid, Spain), the yield of total DNA obtained was determined spectrophotometrically. Universal fungal primers were used for amplification of the ITS1 and ITS2 regions. The sequence of primers is ITS1: 50 -TCCGTAGGTGAACCTGCGG-30 (position 36–54) and ITS 4: 50 -TCCTCCGCTTATTGATATG-30 (position 601–620), as described by White et al. [20]. The sequence of the forward primer ITS1 is complementary to a conserved region at the end of the 18S rRNA gene, and the sequence of the reverse primer ITS 4 binds to a conserved region at the beginning of the 28S rRNA gene [21]. DNA amplification was performed in parallel with positive and negative controls. The positive control strain was isolated from clinical sample. The clinical isolate was identified by standard methods according to Colle et al. [19]. The negative control consisted of an equal volume of water replacing the DNA template. A total

Microarray detection of fungal infection in pulmonary tuberculosis reaction volume of 50 ll was prepared for PCR. The mixture contained 5 ll of 10· reaction buffer (100 mM Tris, 500 mM kcl; pH 8.3), 3 ll of 25 mM MgCl2, 1 ll of 10 mM PCR Nucleotide mix, 2.5 ll of each primer (20 lM), 0.2 ll of Taq DNA Polymerase (5 unit/ll) Biogenet – Korea, 500 ng of template DNA and DEPC treated water. The amplification was performed in a Master cycler gradient (Eppendorf, Hamburg, Germany). An initial denaturation step (94 C for 5 min) was followed by 35 cycles (with each cycle consisting of DNA denaturation at 94 C for 30 s, primer annealing at 57 C for 30 s, and elongation at 72 C for 1 min) and a final extension step at 72 C for 7 min [21]. Amplified DNA products were separated by electrophoresis in a 1% agarose gel containing ethidium bromide (0.5 mg/ml); the running buffer was TAE (40 mM Tris acetate [pH 8.0], 1 mM EDTA). A 100-bp DNA ladder was used as a molecular size marker (Promega – USA). DNA bands were visualized by UV transillumination. Then, DNA was denaturated for 5 min at 95 C and stored at 20 C. Conserved regions served as targets for probes which are able to discriminate between C. neoformans, H. capsulatum and Aspergillus (genus-specific probes) [21]. The probes were purchased from TIB Molbiol, Germany in Table 1. Five microlitres of each sample (PCR product) were spotted on microarray slide at room temperature. Five slides were prepared for each sample and tested by one of the five probes. Positive and negative controls were included. Probes were left at room temperature to thaw, and then 100 ll of deionized H2O were added to each probe. Hybridization was performed under standardized conditions as described by Spiess et al. [22]. Slides were incubated for 30 min at room temperature. After hybridization, the slides were washed with 2· SSC (1· is 0.15 M NaCl plus 0.015 M sodium citrate) with 0.1% sodium dodecyl sulfate, then 2· SSC, and finally, 0.2· SSC for 10 min each time. The washing procedure was performed at room temperature with shaking in a glass container [21]. Staining of microarray slides was done using ParagonT DNA Microarray QC Stain Kit with SYBR R 555 Stain and Control Slide (Cat P32930) – Invetrogen, USA, according to manufacturer‘s instructions. Microarray slides were placed into a staining tube containing the prepared staining solution (27 ml of stain buffer was added to 30 ll SYBR Green nucleic acid stain concentrate). The slides were incubated in the staining solution for 5 min at room temperature. After the incubation, the staining solution was poured off. Tubes (with slides inside) were centrifuged at 3000 rpm for 1 min with the tube lid off. Any remaining stain solution was decanted. Twenty-seven milliliter of fresh wash buffer were added and the slides were washed for 5 min with mild shaking. The working wash buffer was poured off and the slides were centrifuged at 3000 rpm for 1 min with the tube lid off. Then the remaining wash buffer was poured off, and centrifuged again for an additional 5 min with the tube lid

Table 1

153

off. Microarray slides were then read to be scanned. Each microarray slide was imaged by Carl Zeis camera. Image analysis was performed by the Fluorescent image analyzer, Image Pro-Plus to determine the optical density of each spot in addition to the positive and negative controls. Data analysis Analysis was performed using statistical software (SPSS version 17; SPSS, Inc., Chicago, IL). Percentages, Chi square test (v2) and correlation coefficient test were used, with significant alpha level less than (0.05). Results The present study was conducted on 50 tuberculosis patients admitted to El Abbasia Chest Hospital. Their age was ranging from (25 to 65) years. The patients were divided into three groups: Group I consisted of 30 cases diagnosed as MDRTB (60%) (20 males and 10 females). Group II consisted of 10 cases fresh diagnosed TB (20%) (8 males and 2 females). Group III consisted of 10 cases with relapse of TB (20%) (8 males and 2 females).The presence of fungal infection in pulmonary tuberculosis patients was detected by DNA microarray which allowed rapid and simultaneous identification of many fungal species at the same time. Aspergillus spp., was the only type detected in this study, while other fungal species as H. capsulatum or C. neoformans were not identified. Twelve out of 50 cases (24%) were positive for Aspergillus spp., 8 cases from Group I (26.6%), 2 cases from Group II (20%) and 2 cases from Group III (20%). Comparison between the studied groups shows statistically significant difference between Group I and both Groups II and III, while no statistically significant difference was found between Group II and III as shown in Table 2. A. fumigatus was the predominant Aspergillus spp. identified in all the patients followed by A. niger and A. flavus. Distribution of the isolated fungal spp. among the studied groups was as follows: A. fumigatus was identified in 2 cases of Group I, 2 cases of Group II and another 2 cases of Group III. While A. niger was identified in 2 cases of Group I only. Mixed infection was identified in 4 cases in Group I only (two of them were A. fumigatus with A. niger and the other two were A. fumigates with A. flavus) as shown in Table 3. In the present study 22 patients were smokers, fungal infection was detected in 10 of them (45.5%). Out of 50 cases 6 were suffering from DM, fungal infection was detected in 5 of them (83.3%). Twenty-two patients were presented with haemoptysis and toxic manifestation, fungal infection was detected in 10

Oligonucleotide probes sequence for identification of selected fungal species.

Probes sequences

Name

Position

ACA AGA GAC GAC GGT AGC TTC ACG GAACCCACCGCCCTCTTC GGAGACACCACGAACTCTGT CCAACACGAACACTGTCTGA CCGACACCCAACTTTATTT

H. capsulatum C. neoformans A. flavus A. niger A. fumigatus

663–686 540–565 175–194 114–133 502–520

154 Table 2

N.M. Osman et al. Prevalence of fungal infection among the studied groups.

Patients group

Number of positive cases

%

Chi-square test value

Significance

Group I (MDRTB)

8

26.6

v2(1) 2

P < 0.05 (S)

Group II fresh TB

2

20

v2(2) 2

P < 0.05 (S)

Group III relapse TB

2

20

v2(3) 0

P > 0.05 (NS)

a b c

v2(1) Comparison between patients of group I and group II. v2(2) Comparison between patients of group I and group III. v2(3) Comparison between patients of group II and group III.

Table 3

Prevalence of fungal species among the studied groups.

GroupI MDR-TB

A. fumigatus

A. niger

A. fumigatus and A. niger

A. fumigatus and A. flavus

2

2

2

2

Group II fresh TB

2

–

Group III relapsed TB

2

–

Table 4 Variable

Prevalence of fungal infection among the studied groups in relation to risk factors and clinical manifestations. Group I (MDR-TB) (30)

Group II fresh TB (10)

Group III relapsed TB (10)

No. No. of (+)ve fungal cases No. No. of (+)ve fungal cases No. No. of (+)ve fungal cases Smoking 12 (DM) 4 Haemoptysis and toxic manifestations 12

6 3 6

of them (45.5%), their distribution among the studied groups is shown in Table 4. Based on chest X-ray findings cases were radiologically classified into: Minimal extent cases (6/50), moderately advanced cases (20/50), fungal infection was detected in 4 of them (20%), far advanced cases (24/50); fungal infection was detected in 8 of them (33.3%). Ten patients presented with cavitary lesions or abscess, fungal infection was detected in 6 of them (60%) as shown in Tables 5 and 6. Table 7 showed that there was a statistically significant correlation between presence of fungal infection and male sex, smoking, DM, presence of haemoptysis and toxic manifestations, presence of cavitary lesion or abscess and severity of X-ray finding. While no statistically significant correlation was found between presence of fungal infection and age and female sex.

Discussion Fungal infections remain a leading cause of infectious morbidity and mortality in heavily immunosuppressed patients [23– 28]. For diagnosis of fungal infection, establishing cultures from blood and bronchoalveolar lavage (BAL) samples is often unsuccessful due to the low yields of CFU, and in the case

4 0 6

2 0 2

6 2 4

2 2 2

of immuno-compromised high-risk patients who are febrile, pulmonary tuberculosis, neutropenic, thrombocytopenic, and often seriously ill, tissue biopsy specimens, in general, are not available [29]. Early initiation of effective antifungal therapy and reversal of underlying host defects remain the cornerstones of treatment for pulmonary fungal infections [30]. More sensitive and rapid detection assays of mycotic infections in pulmonary tuberculosis patients have been established by use of the PCR method. However, traditional methods in molecular biology generally work on a ‘‘one gene in one experiment’’ basis. Recently, DNA microarray has attracted tremendous interests among biologists as it promises to monitor the whole genome on a single chip. An experiment with a single DNA chip can provide researchers information on thousands of genes simultaneously [21]. The current study was carried upon 50 pulmonary tuberculosis patients; the presence of fungal infection in pulmonary tuberculosis patients was detected by DNA microarray. Aspergillus spp., was the only type detected in this study in (24%) of cases, while other fungal species as H. capsulatum or C. neoformans were not identified. Njunda et al. [31] found that the prevalence of Aspergillus spp. in the sputum of patients suspected of pulmonary tuberculosis was 15%, also, Kurhade et al. [32] reported that the prevalence of Aspergillus spp. was (16.26%). However Ekkena et al. [33] noticed that the most common fungal isolates were Aspergillus spp. (42.9%).

Microarray detection of fungal infection in pulmonary tuberculosis Table 5

Prevalence of fungal infection among the studied groups in relation to radiological classification.

Radiological extent

Minimal Moderate Far

Table 6

155

Group I (MDR-TB) (30)

Group II fresh TB (10)

Group III elapsed TB (10)

No.

No. of (+)ve fungal cases

No.

No. of (+)ve fungal cases

No.

No. of (+)ve fungal cases

0 12 18

0 4 4

6 0 4

0 0 2

0 8 2

0 0 2

Fungal detection in relation to cavitary status of the lesion.

Number of cases

Patient with cavitary lesion or abscess (10)

Patient without cavitary lesion or abscess (40)

No. of (+)ve fungal cases No. of ()ve fungal cases

6 4

6 34

60% 40%

Table 7 Correlation coefficient test correlating fungal detection in the studied cases and their variables. Variable

Correlation coefficient test r

Significance

Age

0.2

P > 0.05 (NS)

0.89 0.01 0.99 0.93 0.87

P < 0.05 P > 0.05 P < 0.05 P < 0.05 P < 0.05

0.95

P < 0.05 (S)

0.94

P < 0.05 (S)

Sex Males Females Smoking DM Haemoptysis and toxic manifestations Presence of cavitary lesion or abscess Radiologically far extent

(S) (NS) (S) (S) (S)

The observed discrepancy between these results might be attributed to the limited number of patients enrolled in the present study and different geographical distribution. Patients were positive for both pulmonary Mycobacterium tuberculosis and Aspergillus sp. mainly, this established relationship was also observed by Sahoo et al. [34] and a possible justification for this is the fact that tuberculosis remains the most important cause of sub-acute and chronic respiratory morbidity which most often leaves behind a scarred pulmonary parenchyma vulnerable to fungal colonization. In the present study the detected fungal species were in higher percentage in MDR Group I (26.6%), than Group II (20%) and Group III (20%). Comparison between the studied groups shows statistically significant difference between Group I and both Groups II and III, while no statistically significant difference was found between Group II and III. Meawed et al. [35] found that the prevalence of co-association between retreatment of pulmonary TB and pulmonary fungal infection was 30.8%. Study by Jain et al. [36] and Kurhde et al. [32] also reported that in treated group, the fungal infection was found in higher percentage than in the fresh group. They explained that patients at the greatest risk for fungal infection are those with prolonged periods of pulmonary tuberculosis. As common use of broad spectrum antibiotics in the pulmonary disease for long duration, for example in pulmonary

15% 85%

tuberculosis stimulate the growth and virulence of infecting fungus by destruction of competing bacterial flora. Another explanation for high susceptibility of MDR-TB patients to fungal infection could be clarified by understanding the immunological changes associated with multi-drug resistant tuberculosis. It was confirmed that the most important host defenses against fungi are neutrophils and alveolar macrophages. IFN-c produced by the T lymphocytes increases the production of nitric oxide and other nitrogen and oxygen-reactive radicals of macrophages [37]. It was observed that patients with MDR-TB show low IFN-c production when compared with patients with non-resistant tuberculosis before and after treatment [38]. A recent study evaluating the immune response of MDR-TB patients revealed that the T CD4+ cells of these patients have a weaker response to stimulation with higher IL4 production and lower IFN-c response than fresh cases and normal individuals. This observation suggesting that the T CD4+ cells of MDRT patients polarize to Th2 response. Furthermore, those patients had increased IL-10 and TGF-c cytokine production that promote an environment, in which the recently recruited cells of the immune system become refractory to stimulation by the immunological activation signals [39]. The predominant Aspergillus species detected from sputum in the present study was A. fumigatus detected in 10 cases, followed by and A. niger detected in 4 patients, while A. flavus was detected from 2 patients. Among the collected samples 2 had mixed infection with A. fumigatus and A. niger and 2 had mixed A. fumigatus and A. flavus. These results were in accordance with Kurhade et al. [32] who reported that A. fumigatus was the commonest species isolated; followed by A. niger and A. flavus. Also Njunda et al. [31] reported that A. fumigatus (5%) was the predominant Aspergillus species isolated from sputum in their study followed by A. flavus (3%). However Razmpa et al. [40], reported higher prevalence for A. flavus (30%). This wide variation in the incidence and frequency of isolation of various Aspergillus species may be due to geographical differences [41], different technologies used for identification or number of patients enrolled in the different studies. It was noticed that the MDR group (Group I) carry the risk of higher percentage of fungal infections and it was the only group which was harboring mixed species. As treatment of MDR group necessitate the use of different antibiotics and anti-metabolites for long duration which may influence the incidence of fungal infection.

156 The present study showed that, there was a statistically significant correlation between presence of fungal infection and male sex, smoking, DM, presence of haemoptysis and toxic manifestations, presence of cavitary lesion or abscess and severity of X-ray finding. While no statistically significant correlation was found between presence of fungal infection and age and female sex. Men are more vulnerable to infection than females due to their greater exposure to the surrounding. These results were in agreement with that of Bansod and Rai [11], who observed that fungal infection was higher in male (62.50%) as compared to female (37.5%). They also reported positive correlation between fungal infection and severe toxemia and haemoptysis. This study showed that there was a statistically significant correlation between presence of fungal infection, smoking and DM. Smoking and DM act as a co-factor in accelerating and amplifying the immumo-suppression state [42,43]. The predominance of fungal infection in diabetic patients has been reported by Jain et al. [36]. Khanna et al. [33] reported that factors mainly responsible for prevalence of fungal super infection in pulmonary tuberculosis are presence of resistant strain, chronicity of diseases, and associated disease such as diabetes mellitus. The present study showed that, there was a statistically significant correlation between presence of fungal infection and presence of cavitary lesion or abscess and severity of X-ray finding. In the present study fungal infection was higher (60%) in cavitary group than in the non cavitary group (15%). This was in agreement with Jain et al. [36] who reported that, fungus positivity was higher (59%) in cavitary group than in the non cavitary group. Higher positivity was found according to the extent of lesion but this difference was not statistically significant (P > 0.05).

N.M. Osman et al.

[7]

[8] [9] [10]

[11]

[12]

[13] [14]

[15]

[16]

[17]

[18]

Conclusion [19]

Microarray detection of mycotic infection represents a rapid diagnostic tool helping early diagnosis of fungal co-infection and pulmonary TB. MDR-TB patients carry the risk of higher percentage of fungal infections and more liable for acquiring mixed fungal pathogens. Presence of male sex, smoking, DM and far extent of lesion must attract physicians’ attention for fungal co-infection with pulmonary tuberculosis.

[20]

[21]

References [22] [1] M. Nucci, K.A. Marr, Emerging fungal diseases, Clin. Infect. Dis. 41 (2005) 521–526 (ucci and Marr, 2005). [2] S. Basu, D. Chakraborty, S. Das, Susceptibility of Candida species from HIV infected and newborn candidaemia patients to amphotericin B, J. Biol. Sci. 10 (2010) 109–113. [3] V.P. Baradkar, M. Mathur, K. Wanjari, S. Kumar, Candida in Pulmonary Tuberculosis, Bombay Hosp. J. (2009) 52–53 (Special issue). [4] D. Satana, G.E. Genc, Z. Erturan, The antifungal susceptibility of oral Candida spp. isolates from HIV-infected patients, Afr. J. Microbiol. Res. 4 (2010) 466–470. [5] B. Ozcelik, S. Citak, S. Cesur, F. Icli, U. Abbasoglu, In vitro susceptibility of Candida species isolated from cancer patient to some antifungal agents, Drug Metabol. Drug Interact. 20 (2004) 101–108. [6] G. Kovacicova, Y. Krupova, M. Lovaszova, A. Roidova, J. Trupl, A. Liskova, Antifungal susceptibility of 262 bloodstream test isolates from a mixed cancer and non cancer patient

[23]

[24]

[25]

[26]

population: is there a correlation between in vitro resistance to fluconazole and the outcome of fungemia?, J Infect. Chemother. 6 (2000) 216–221. C. Dye, S. Scheele, P. Dolin, V. Pathania, M.C. Raviglione, Consensus statement. Global burden of tuberculosis: estimated incidence, prevalence, and mortality by country. WHO global surveillance and monitoring project, JAMA 282 (1999) 677–686. S.K. Sharma, A. Mohan, Multi-drug resistant tuberculosis, Indian J. Med. Res. 120 (2004) 354–376 (Review article). MOHP Report, Ministry of health and population report, National tuberculosis 2, (2008). WHO Report, WHO estimates of TB incidence by country, (2010). Available from: http://www.who.int/tb/country/data/ download/en/index.html. S. Bansod, M. Rai, Emerging of mycotic infection in patients infected with Mycobacterium tuberculosis, World J. Med. Sci. 3 (2) (2008) 74–80. M.A. Pfaller, D.J. Diekema, Epidemiology of invasive candidiasis: a persistent public health problem, Microbiol. Rev. 20 (2007) 133–163. A.G. Ghoshal, P.P. Roy, Diagnosis of tuberculosis, J. Indian Med. Assoc. 98 (2000) 115–118. S.K. Gupta, R. Chhabra, B.S. Sharma, A. Das, V.K. Khosla, Vertebral Cryptococcus stimulating tuberculosis, J. Indian Med. Assoc. 17 (6) (2003) 556–559. Y. Yamakami, A. Hashimoto, I. Tokimatsu, M. Nasu, Detection of DNA specific for Aspergillus species in serum of patients with invasive aspergillosis, J. Clin. Microbiol. 34 (1996) 2464–2468. J. Loeffler, H. Hebart, U. Brauchle, et al, Comparison between plasma and whole blood specimens for detection of Aspergillus DNA by PCR, J. Clin. Microbiol. 38 (10) (2000) 3830–3833. M. Klouche, U. Schroder, Rapid methods for diagnosis of bloodstream infections, Clin. Chem. Lab. Med. 46 (7) (2008) 888– 908. National Tuberculosis Association of the USA, Diagnostic Standard and Classification of Tuberculosis, National Tuberculosis Association, New York, 1961. J.G. Collee et al, Mackie and McCartney’s practical medical microbiology, 14th ed., Churchill Livingstone, Edinburgh, 1996. T.J. White, B.S. Lee, J. Taylor, Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in: M.A. Innes, D.H. Gelfand, J.J. Sninsky, T.J. White (Eds.), PCR protocols: a guide to methods and application, Academic Press, San Diego, 1990, pp. 315–322. D.M. Leinberger, U. Schumacher, I.B. Autenrieth, T.T. Bachmann, Development of a DNA microarray for detection and identification of fungal pathogens involved in invasive mycoses, J. Clin. Microbiol. 43 (10) (2005) 4943–4953. B. Spiess, W. Seifarth, M. Hummel, et al, DNA microarraybased detection and identification of fungal pathogens in clinical samples from neutropenic patients, J. Clin. Microbiol. 45 (11) (2007) 3743–3753. K. Bettina, S. Steffen, N. Michael, American society for microbiology; proteins in the cell wall of Mycobacterium tuberculosis, J. Bacteriol. 180 (20) (1999) 6543–6546. K. Greenberg, J. Knapp, N. Rom, D.J. Addrizzo Harris, Clinical presentation of pulmonary mycetoma in HIV infected Patients, Chest 122 (2002) 886–892. A. Mahale, A. Venugopal, K.A. Vishak, M.S. Kishore, A. Shanmuganathan, K. Dhungel, Inflammatory myofibroblastic tumor of lungs (psudotumor of the lung), Indian J. Radiol. Image 2 (2006) 207–210. K. Marr, A. Rachel, R. Carter, F. Crippa, A. Wald, L. Corey, Epidemiology and outcome of mould infections in hematopoietic stem cell transplant recipients, Clin. Infect. Dis. 34 (7) (2002) 909–917.

Microarray detection of fungal infection in pulmonary tuberculosis [27] R.C. Sahoo, K.A. Vishak, P.K. Dinesh, F. Lobo, H. Kini, Second primary lung cancer with tuberculosis. A case report, IJCD 48 (2006) 63–66. [28] R.C. Sahoo, Antileukotrienes in asthma and allergy, Curr. Med. J. India 2 (4) (2006) 48–52 (review article). [29] S. Bansod, I. Gupta, M. Rai, Specific detection of Aspergillus fumigatus in sputum sample of pulmonary tuberculosis patients by two-step PCR, Afr. J. Biotechnol. 7 (1) (2008) 016–021. [30] M. Richardson, C. Lass Florl, Changing epidemiology of systemic fungal infections, Clin. Microbiol. Infect. 14 (Suppl. 4) (2008) 5–24. [31] L. Njunda Anna, A. Ewang Anselm, F. Kamga Lucien-Henri, S. Nsagha Dickson, N. Assob Jules-Clement, A. Ndah David, E. Kwenti Tebit, Respiratory tract aspergillosis in the sputum of patients suspected of tuberculosis in fako division-cameroon, J. Microbiol. Res. 2 (4) (2012) 68–72. [32] A.M. Kurhade, J.M. Deshmukh, R.P. Fule, C. Chande, S. Akulwar, Mycological and serological study of pulmonary aspergillosis in central India, Indian J. Med. Microbiol. 20 (2002) 141–144. [33] O. Ekenna, A. Uba, J.O. Chikwem, S. Mambula, M.B. Aliyu, I. Mohammed, Relevance of moldy fungi as agents of chronic lower respiratory tract infection in patients seen in Maiduguri, Nigeria, West Afr. J. Med. 26 (2) (2007) 117–120. [34] R.C. Sahoo, P.V.P. Rao, P.O. Shivananda, A. Kumar, L.K. Mohanti, A Profile of Aspergillus lung disease, J. Assoc. Physicians India. 36 (1988) 711. [35] E. Meawed Takwa, M. Amany Fawzy, M. El Gamry Reda, Shaker Amany, El Gazzar Alaa, Ahmad S. Ragheb, Frequency of pulmonary fungal infection in Egyptian patients with re-

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

157 treatment pulmonary tuberculosis and its clinical and radiological significance, J. Am. Sci. 8 (5) (2012) 683–691. S.K. Jain, R.L. Agawal, D.E.V. Sharma, A. Shish, M. Agrawal, Fugal superinfection in pulmonary tuberculosis, Ind. J. Tub. XXIX (1982) 3173–3178. W. Meersseman, S.J. Vandecasteele, A. Wilmer, et al, Invasive aspergillosis in critically ill patients without malignancy, Am. J. Respir. Crit. Care Med. 170 (6) (2004) 621–625. A. Fortes, K. Pereira, P.R.Z. Antas, C.L. Franken, M. Dalcolmo, Detection of in vitro interferon-gamma and serum tumour necrosis factor-alpha in multidrug-resistant tuberculosis patients, Clin. Exp. Immunol. 141 (2005) 541–548. R.O. Pinheiro, M.P. Dalcolmo, E.P. Sampaio, Tuberculosis and multi-drug resistant tuberculosis: immunologic mechanisms and tools for controlling the disease, RECIIS – Elect. J. Commun. Inf. Innov. Health. Rio de Janeiro 2 (1) (2008) 95–101. E. Razmpa, M. Khajavi, M. Hadipour-Jahromi, P. Kordbacheh, The prevalence of fungal infections in nasal polyposis, Acta Medica Iranica 45 (1) (2007) 46–50. M. Luis, C. Manuela, Q. Santiago, F.C. Jose´, P. Adalberto, S. Aurora, E. He´ctor, Serologic IgE immune responses against Aspergillus fumigatus and Candida albicans in patients with cystic fibrosis, Chest 121 (3) (2002) 782–788. C. Jeon, M. Murray, Diabetes mellitus increases the risk of active tuberculosis: a systematic review of 13 observational studies, PLoS Med. 5 (7) (2008) e152. M.A. Baker, A.D. Harries, C.Y. Jeon, J.E. Hart, A. Kapur, K. Lo¨nnroth, S.E. Ottmani, S.D. Goonesekera, M.B. Murray, The impact of diabetes on tuberculosis treatment outcomes: a systematic review, BMC Med. 9 (2011) 81.