- Email: [email protected]
Microbial changes in vacuum-packed chilled pork during storage
Meat Science 100 (2015) 145–149
Contents lists available at ScienceDirect
Meat Science journal homepage: www.elsevier.com/locate/meatsci
Microbial changes in vacuum-packed chilled pork during storage Fan Zhao, Guanghong Zhou, Keping Ye, Shuaiwu Wang, Xinglian Xu, Chunbao Li ⁎ Key Laboratory of Animal Products Processing, MOA, Key Laboratory of Meat Processing and Quality Control, MOE, Synergetic Innovation Center of Food Safety and Nutrition, PR China College of Food Science and Technology, Nanjing Agricultural University, PR China
a r t i c l e
i n f o
Article history: Received 11 June 2014 Received in revised form 6 August 2014 Accepted 5 October 2014 Available online 12 October 2014 Keywords: Pyrosequencing Fresh meat Bacteria
a b s t r a c t Microbial composition in vacuum-packed chilled pork was investigated. The number of microbial counts increased during the period of 21 day storage with the deterioration of meat. A total of 28,216 bacterial sequences were obtained for the assessment of microbial diversity from vacuum packed pork during chilled storage. More than 200 bacterial genera belonging to eighteen phyla were observed, and most of them are likely to be associated with contamination via fecal, air and/or water during slaughtering and subsequent meat handling. Microbial populations changed greatly during storage, of which the seventh day was a critical time point for microbial diversity. Micrococcaceae, Flavobacteriaceae, Enterobacteriaceae, Lactobacillaceae and Carnobacteriaceae were the major components that may be associated with the spoilage of meat. Although the potential impact of detected microbes on meat hygiene and/or safety is unknown, effective decontamination of the whole chain is always important for meat industry to guarantee meat safety and to improve shelf-life of fresh meat. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Meat hygiene is determined by numerous environmental factors, which could result in meat spoilage and food safety problems. For chilled meat, the growth of bacteria is the main cause of the reduction of freshness and the progress of spoilage (Belák et al., 2011; Ercolini, Russo, Nasi, Ferranti, & Villani, 2009; Horvath, Andrassy, Korbasz, & Farkas, 2007). The microbial diversity and main flora in fresh meat have been widely investigated using traditional cultivation methods. In recent years, cloning and sequencing techniques such as polymerase chain reaction and denaturing gradient gel electrophoresis (PCR–DGGE) have been applied to explore microbial populations in meats (Ercolini et al., 2010; Jiang, Gao, Xu, Ye, & Zhou, 2011; Li, Zhou, Xu, Li, & Zhu, 2006; Osés et al., 2013). The PCR–DGGE overcomes the limitations of traditional cultivation methods. For example, some microorganisms cannot be cultivated by traditional methods; and it takes a long time to identify the composition from a pool of microorganisms. Li et al. (2006) found that the bacterial diversity of chilled pork decreased with storage time and Arthrobacter sp., Enterococcus sp., Staphylococcus sp., Moraxella sp., Pseudomonas sp., Lactobacillus sp., Aeromonas sp., Acinetobacter sp. and Brochothrix thermosphacta were the main flora during a 7-day storage period. However, PCR–DGGE is still time-consuming and can be only used to detect predominant members of the microbial communities. More recently, the bacterial diversity in beef steaks and a Chinese meat product (Zhenjiang Yao Meat) was examined with high-throughput barcoded ⁎ Corresponding author at: College of Food Science and Technology, Nanjing Agricultural University, Weigang 1#, 210095 Nanjing, PR China. Tel./fax: +86 25 84395679. E-mail address: [email protected] (C. Li).
http://dx.doi.org/10.1016/j.meatsci.2014.10.004 0309-1740/© 2014 Elsevier Ltd. All rights reserved.
parallel 454 pyrosequencing and their data showed that the bacterial phylotypes were more complex than previous studies have suggested (De Filippis, La Storia, Villani, & Ercolini, 2013; Xiao, Dong, Zhu, & Cui, 2013). In these two studies, high-throughput sequencing was shown to be a powerful means of giving insight and understanding of the changes in the microbial populations in meat and meat products during production or storage. In the present study, parallel pyrosequencing with 16S rDNA and 18S rDNA was applied to characterize bacterial and fungal changes in vacuum-packed chilled pork. The results were expected to provide insights into the understanding of microbial changes in fresh pork during production and during subsequent chill storage in terms of any precautions for meat safety and for the improvement of meat hygiene. 2. Material and methods 2.1. Sampling A total of 20 pig carcasses from the same herd were selected from a single slaughtering line in a commercial slaughterhouse (Henan, a capacity of 3000 carcasses per day). After 20 h chilling in a 0 °C chiller, carcasses were commercially fabricated. The cut “hind leg” was vacuum-packed in heat-shrink bags (oxygen transmission rates: 18.54 × 10 − 6 cm 3/m 3·d·Pa). Vacuum packed cuts were stored at 0 °C for up to 21 days and were sampled after 1 h (day 0), 7 days, 14 days, and 21 days after vacuum packaging (5 bags per time point). On each sampling occasion, 100 g of muscle on the exposed surface was cut to a thickness of up to 2 cm and was removed for color and pH measurement, total volatile basic nitrogen (TVB-N) determination, microbial enumeration and DNA extraction.
146
F. Zhao et al. / Meat Science 100 (2015) 145–149
2.2. Color measurement Color parameters were determined as previously described (Li et al., 2012) using a Minolta colorimeter (CR-300; Minolta Camera Co., Osaka, Japan) with illuminant D65, a 0° viewing angle and an 8 mm port/viewing area. Before measurement, the colorimeter was calibrated with a white tile (mod CR-A43). Color coordinates (L*, a*, b*) were recorded. Three measurements were performed on each of five samples at each time point. 2.3. pH measurement Meat pH was measured as previously described (Li et al., 2012). Briefly, 1 g of sample was homogenized (Ultra Turrax T25, IKA, Germany) at 6000 rpm for 2 × 15 s with a 5 s break in 10 mL of ice-cold buffer containing sodium iodoacetate (5 mM) and potassium chloride (150 mM), pH 7.0. The pH of the homogenate was recorded with a Hanna 211 pH meter (Hanna, Italy). Three measurements were performed on each of five samples at each time point. 2.4. TVBN determination TVBN concentration (milligrams per 100 g of meat) was determined according to the method of Malle and Poumeyrol (1989). Briefly, 100 g sample was homogenized in 6% trichloroacetic acid at 5000 rpm for 30 s with two bursts. The homogenate was filtered through Whatman filter paper and TVBN in the filtrate was released by adding 1% K2CO3 and diffusing with 1% boric acid and then titrated with 0.02 N HCl. Results of TVBN contents were expressed as mg/100 g meat. Three measurements were performed on each of five samples at each time point. 2.5. Enumeration and isolation of microorganisms Twenty five grams of each meat sample was homogenized in 225 mL of peptone saline (0.85% NaCl and 0.1% peptone in distilled water) for 30 s in a blender. After that, triplicate serial dilutions were prepared and plated onto Plate Count Agar (PCA, Land Bridge Company, China) plates. The plates were incubated for 48 h at 37 °C. The number of microbes was expressed as log10 (counts). Three measurements were performed on each of five samples at each time point. 2.6. Total bacterial genomic DNA extraction Meat subsamples (25 g) were homogenized in 225 mL of peptone saline (0.85% NaCl and 0.1% peptone in distilled water) for 30 s in a blender. Twenty milliliters of the homogenate was centrifuged at a speed of 10,000 ×g for 10 min (Avanti J-HC, Berkman, USA). The pellets were resuspended in 200 μL of lysis buffer and broken with 100 mg of zirconium beads (0.1 mm) in Mini-beadbeater (FastPrep, Thermo Electron Corporation, USA) for 2 min. Microbial DNA was extracted with DNeasy tissue kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions and resuspended in 100 μL of TE buffer (containing 10 mmol/L Tris–HCl, pH = 8.0 and 1 mmol/L EDTA, pH = 8.0). The DNA concentration was measured using a Nano-drop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). 2.7. Pyrosequencing for 16S rDNA The bacterial diversity was analyzed by pyrosequencing of the amplified 16S rDNA V4–V5 variable region (Richard et al., 2013). The forward primers included adaptor A (CCATCTCATCCCTGCGTGTCTCCG ACGACT), barcodes, and gene specific primer F (16S 515F: GTGCCAGC MGCCGCGGTAA). The reverse primers included adaptor B (CCTATCCC CTGTGTGCCTTGGCAGTCTCAG), barcodes, and gene specific primer R (16S 926R: CCGTCAATTYYTTTRAGTTT). Four barcodes, i.e., ATGCACGT,
ATGTGACT, CAGAGTCT and CAGATAGT were used for 0 day, 7 day, 14 day and 21 day samples, respectively. The reaction mixture (20 μL) included 0.25 μL of TaKaRa Ex Taq®(5 U/μL), 2 μL of 10× Ex Taq buffer (25 mM Mg2+ Plus), 1.6 μL of dNTP, 0.4 μL of primer F, 0.4 μL of primer R, 1.0 μL of DNA template, and 14.35 μL of ddH2O. The amplification was performed using GeneAmp® 9700 PCR system (ABI, USA) as follows: initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s and extension at 72 °C for 30 s, and a final extension at 72 °C for 10 min. The PCR products were separated by 2% agarose gel electrophoresis under 100 V for 40 min (Tanon EPS-100 system), purified using AxyPrep DNA gel extraction kit (Axygen, USA) and fluorescently quantified by Quant-iT™ PicoGreen® dsDNA assay kit (Invitrogen, USA) and an equimolar pool was obtained prior to further analysis. Amplicon pyrosequencing was performed using a 454/Roche GS-FLX sequencer (Roche, Germany). The purified pool was amplified using GS FLX Titanium LV emPCR Kit (Lib-L, Qiagen, USA) using GeneAmp® 9700 PCR system (ABI, USA) under the following conditions: initial denaturation at 94 °C for 4 min, followed by 50 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 4.5 min and extension at 68 °C for 30 s, and finally being held at 10 °C. The resulting solution was treated with GS FLX Titanium emPCR Breaking Kit and the final DNA was sequenced using 454 GS FLX platform (Roche, Germany). 2.8. Data analysis After pyrosequencing, all readings were screened and filtered using QIIME 1.6.0 software (Caporaso et al., 2010). The readings were excluded if their quality scores were lower than 25 and/or their length was shorter than 200 base pairs. Operational taxonomic units (OTUs) were picked only if they had similarity values of 97% or higher. Alpha diversity was evaluated by community richness (rarefaction curves, Chao1 and ACE) and diversity (Shannon indices) using MOTHUR (version 1.32.1) (http://www.mothur.org/) (Schloss et al., 2009). The representative sequences were compared to the RDP classification (Ribosomal Database Project, http://rdp.cme.msu.edu/wiki/index. php/Main_Page) to obtain the taxonomy assignment (Wang, Garrity, Tiedje, & Cole, 2007). Beta diversity was evaluated by phylogenetic tree analysis and similarity analysis. The Fast UniFrac test in the MOTHUR program was performed to compare the phylogenetic structure and to generate Venn diagrams. The differences in meat quality data with storage time were evaluated by one-way analysis of variance. Least squares means of 4 time points were compared by Duncan's multiple comparison method at the significance level of 0.05 with the program SAS 9.12 (SAS Institute Inc., Cary, NC, USA, 2003). 3. Results 3.1. Bacterial enumeration and meat quality Total bacterial counts increased during the storage (P b 0.05, Table 1). Although there was a large increase by day 14, the bacterial counts were still at an acceptable level (smaller than 106 CFU g−1). At day 21, the natural logarithm of the bacterial count was over 6 and the meat appeared slightly sticky, indicating that meat had began to be deteriorated and would not be suitable for consumption. Meat pH and TVBN values showed a similar trend whereby they both increased with storage time (P b 0.05, Table 1). Meat color measurements (L*, a*, b*) did not show significant changes with storage time (P N 0.05, Table 1). 3.2. Sequencing data For 16S rDNA analysis, a total of 28,216 pyrosequencing tags with the length of 173 to 557 base pairs were obtained, of which the majority
F. Zhao et al. / Meat Science 100 (2015) 145–149
147
Table 1 Microbial growth and meat quality of the vacuum-packaged pork during chilled storage. Time (days)
Bacterial counts Log10 (CFUg−1)
0 7 14 21
4.13 4.32 5.41 6.50
± ± ± ±
pH
0.39a 0.59a 0.24b 0.34c
5.72 5.79 5.90 5.99
TVBN (mgN/100 g) ± ± ± ±
0.01a 0.13a 0.22ab 0.22b
5.67 6.79 7.80 8.81
± ± ± ±
1.03a 0.86ab 1.69bc 1.47c
L* 45.23 43.45 46.14 44.31
a* ± ± ± ±
1.35 2.79 3.14 4.35
12.01 12.70 13.40 13.55
b* ± ± ± ±
3.09 2.73 2.90 3.09
3.11 3.11 6.19 5.58
± ± ± ±
1.35a 1.97a 1.82b 1.79b
Figures in the table are means and standard deviations. a,b,c Figures with different subscripts in a column are significantly different (P b 0.05).
ranged from 265 to 272 base pairs, and also from 390 to 395 base pairs (Fig. 1). With the unique sequences analyzed, samples at day 0 and day 14 had similar levels of diversity (Shannon rarefaction, Fig. 2). The 7 day samples showed the highest bacterial diversity and the 21 day samples had the lowest bacterial diversity (Fig. 2).
Clostridiaceae, Micrococcaceae, Nocardiaceae, Corynebacteriaceae, Propionibacteriaceae, Porphyromonadaceae, Listeriaceae, Bacillaceae, Flavobacteriaceae, Chlamydomonadaceae, Mamiellaceae, Brucellaceae, Staphylococcaceae, Enterococcaceae, Streptococcaceae, Fusobacteriaceae, Vibrionaceae, Hyphomicrobiaceae, Methylobacteriaceae, Sphingomonadaceae, Alcaligenaceae, Aeromonadaceae, Shewanellaceae, Moraxellaceae, and Xanthomonadaceae (data not shown).
3.3. Changes in microbiota composition during storage 3.4. Microbial diversity varying with storage time Eighteen phyla were found in the microbiota in vacuum packed pork across all the time points (Fig. 3a). The vast majority of sequences belong to one of the four major phyla: Actinobacteria, Bacteroidetes, Firmicutes or Proteobacteria. Of the four major phyla, Actinobacteria and Bacteroidetes were the most predominant microbiota at day 0 (28.17% and 33.75% of total sequences, respectively), but they were substantially decreased after that time. Firmicutes increased greatly at day 14 and day 21 (45.77% and 77.04% of total sequences, respectively). The abundance of Proteobacteria increased from 8.57% at day 0 to 52.32% at day 7, but it then decreased to 7.69% at day 21. Verrucomicrobia showed a similar tendency to increase from 0.03% at day 0 to 10.40% at day 7, but it was not detectable at day 14. The remaining phyla were very low in abundance, including Crenarchaeota, Acidobacteria, Chloroflexi, Cyanobacteria, Deferribacteres, Fusobacteria, Gemmatimonadetes, Lentisphaerae, Planctomycetes, Spirochaetes, Tenericutes and Thermi (less than 1.5% of total sequences). Although bacterial counts continued to increase through the 21 day storage as shown above, the number of bacterial families increased significantly from day 0 to day 7, and then decreased greatly after day 7. At day 0, Micrococcaceae and Flavobacteriaceae accounted for 26.59% and 32.99% of total sequences, respectively (Fig. 3b). At day 7, the percentages of main flora were 12.34% for Flavobacteriaceae, 25.94% for Rhodobacteraceae, 5.69% for Aeromonadaceae, 4.70% for Enterobacteriaceae, 4.33% for Puniceicoccaceae, 5.84% for Verrucomicrobiaceae, and 2.28% for Lactobacillaceae. At day 14, the predominant populations were Carnobacteriaceae (14.54%), Lactobacillaceae (21.15%), and Enterobacteriaceae (21.63%). At day 21, the prevalent populations were still Lactobacillaceae (70.18%), Carnobacteriaceae (3.40%) and Enterobacteriaceae (6.50%). In addition, at least 26 low-abundance families were found to exist in vacuum-packed pork, including Pseudomonadaceae,
The Venn plot indicated that 24 sequences were common across all time points (Fig. 4), corresponding to 20 families of bacteria existing on the surface of vacuum packed pork throughout 21 day storage period. Of these 20 families of bacteria, Flavobacteriaceae, Staphylococcaceae, Aeromonadaceae and Enterobacteriaceae were dominant in abundance during the first 7 or 14 days of storage. Lactobacillaceae dominated and played a critical role in the spoilage of meat at day 21. 4. Discussion In the present study, microbial enumeration and TVBN measurement indicated a continuous deterioration of pork during storage. The number of microbial counts did not show a significant increase from day 0 to day 7 probably because of the lack of oxygen in the package and the low storage temperature. However the microbial Shannon rarefaction for pyrosequencing increased, indicating that microbial community of vacuum-packed pork became more diverse during the first 7-day storage. However, during the subsequent two-week storage, the Shannon rarefaction decreased while the number of microbial counts continued to increase. This could be due to the competitive growth or inhibition between the microorganisms. This meant that the predominance of some bacteria resulted in the deterioration of pork. Although it is impossible in the present study to associate the bacterial counts with the OTUs abundance throughout the period of storage, the major components of microflora in the first 7 days were more diverse and different from those at day 14 and day 21. Micrococcaceae
Number of sequences
3000 2500 2000 1500 1000 500 0 150
250
350
450
550
Sequence length Fig. 1. Distribution of sequence reads of microbial communities by 16S rDNA sequencing.
Fig. 2. Shannon rarefaction curves applied to estimate richness at different storage time points.
148
F. Zhao et al. / Meat Science 100 (2015) 145–149
a
abundance
b
100%
other
90%
Aeromonadaceae
80%
Carnobacteriaceae
70%
Enterobacteriaceae
60%
Flavobacteriaceae
50%
Lactobacillaceae
40%
Micrococcaceae
30%
Moraxellaceae
20%
Puniceicoccaceae
10%
Rhodobacteraceae
0%
0d
7d
14d
21d
Verrucomicrobiaceae
storage time (day) Fig. 3. Changes in abundance of bacterial and fungal phyla based on 16S rDNA sequencing. (a) phyla-based; (b) family-based. In the legend, “k” stands for kingdom and “p” for phyla.
and Flavobacteriaceae were the prevalent OTUs in the 0 day samples. Micrococcaceae is an aerobic bacterium that exists widely in the environment and can readily contaminate meat during animal slaughtering and postmortem handling by equipment and workers (De Filippis et al., 2013). After vacuum packaging, the abundance of Micrococcaceae on the surface of pork decreased greatly, which is likely to the result of death or the growth inhibition of the bacteria. Flavobacteriaceae is an amphi-microbe that also exists widely in the environment and may contaminate meat (De Filippis et al., 2013). Under vacuum packaging
Fig. 4. Venn plot for microbial diversity across storage time. The figures in different compartments mean the numbers of sequences specific for or common to storage time. The sum of the figures in an ellipse was the total number of sequences at a certain time.
conditions, the OTUs abundance of Flavobacteriaceae on pork surface remained high in the 7 day samples, but its abundance continuously decreased with longer storage times. Possible reasons for this are as follows: 1) Flavobacteriaceae may grow more slowly than other bacteria (for example, Lactobacillaceae) under vacuum conditions; and 2) the growth of Flavobacteriaceae may be inhibited by other bacteria. Our colleagues have observed that Lactobacillus, Pseudomonas sp. and Carnobacterium sp. were the major components of the microflora in vacuum-packed chilled pork (Jiang et al., 2010; Li et al., 2006). The present study confirmed the prevalence of Lactobacillaceae and Carnobacteriaceae at day 14 and day 21. It has been shown that Lactobacillus may produce lactic acid which inhibits the growth of other families of bacteria in vacuum packed meat (Blixt & Borch, 2002). Pseudomonadaceae was very low in abundance throughout the period of storage, but its abundance showed a large increase from day 14 to day 21, indicating a potential contribution to the spoilage of meat if the storage period was to be further extended. Although Enterobacteriaceae has been shown one of the major bacteria in vacuum-packed chilled meat (Pennacchia, Ercolini, & Villani, 2011), the present study showed that it accounted for a decreasing proportion of OTUs from day 7 to day 21. It meant that Enterobacteriaceae may not be the main contributor to the spoilage of meat. In addition, several low-abundance, animal-sourcing bacteria observed in the present study could be associated with contamination via fecal, air and/or water during slaughtering and subsequent handling. For example, Rhodobacteraceae, Puniceicoccaceae, and Verrucomicrobiaceae
F. Zhao et al. / Meat Science 100 (2015) 145–149
were reported to be intestinal microorganisms in livestock animals (Choo, Lee, Song, & Cho, 2007; De Jesús-Laboy et al., 2012; Gill et al., 2006). 5. Conclusions Pyrosequencing was applied to explore the microbial community of vacuum-packed chilled pork and to establish the range and diversity of this community. Hundreds of different microbes were found to exist on the surface of vacuum-packed chilled pork and the microbial components changed through the 21 day storage. Micrococcaceae, Flavobacteriaceae, Enterobacteriaceae, Lactobacillaceae and Carnobacteriaceae were the major components that may be associated with the spoilage of meat. Although the potential impact of such microbes on meat hygiene and/or safety is unknown, effective decontamination of the whole chain is always important for the meat industry to guarantee meat safety and improve the shelf-life of fresh meat. Conflict of interest The authors have no conflict of interest. Acknowledgments The present study was supported by projects NCET-11-0668 (MOE), 2012BAD28B02-03 (MOST), 2014BAD19B01 (MOST) and CARS-36-11 (MOA). References Belák, Á., Kovács, M., Hermann, Z., Holczman, A.N., Márta, D., Stojakovič, S.C., Bajcsi, N., & Maráz, A. (2011). Molecular analysis of poultry meat spoiling microbiota and heterogeneity of their proteolytic and lipolytic enzyme activities. Acta Aliment Hung, 40, 3–22. Blixt, Y., & Borch, E. (2002). Comparison of shelf life of vacuum-packed pork and beef. Meat Science, 60, 371–378. Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello, E.K., Fierer, N., Gonzalez Peña, A., Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley, S.T., Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A., McDonald, D., Muegge, B.D., Pirrung, M., Reeder, J., Secinsky, J.R., Turnbaugh, P.J., Walters, W.A., Widmann, J., Yatsunenko, T., Zaneveld, J., & Knight, R. (2010). QIIME allows analysis of highthroughput community sequencing data. Nature Methods, 7, 335–336. Choo, Y. -J., Lee, K., Song, J., & Cho, J. -C. (2007). Puniceicoccus vermicola gen. nov., sp. nov., a novel marine bacterium, and description of Puniceicoccaceae fam. nov., Puniceicoccales ord. nov., Opitutaceae fam. nov., Opitutales ord. nov. and Opitutae classis nov. in the phylum ‘Verrucomicrobia’. International Journal of Systematic and Evolutionary Microbiology, 57, 532–537.
149
De Filippis, F., La Storia, A., Villani, F., & Ercolini, D. (2013). Exploring the sources of bacterial spoilers in beefsteaks by culture-independent high-throughput sequencing. PLoS ONE, 8, e70222. De Jesús-Laboy, K.M., Godoy-Vitorino, F., Piceno, Y.M., Tom, L.M., Pantoja-Feliciano, I.G., Rivera-Rivera, M.J., Andersen, G.L., & Domínguez-Bello, M. G. (2012). Comparison of the fecal microbiota in feral and domestic goats. Genes, 3, 1–18. Ercolini, D., Ferrocino, I., La Storia, A., Mauriello, G., Gigli, S., Masi, P., & Villani, F. (2010). Development of spoilage microbiota in beef stored in nisin activated packaging. Food Microbiology, 27, 137–143. Ercolini, D., Russo, F., Nasi, A., Ferranti, P., & Villani, F. (2009). Mesophilic and psychrotrophic bacteria from meat and their spoiling potential in vitro and in beef. Applied and Environmental Microbiology, 75, 1990–2001. Gill, J.J., Sabour, P.M., Gong, J., Yu, H., Leslie, K.E., & Griffiths, M.W. (2006). Characterization of bacterial populations recovered from the teat canals of lactating dairy and beef cattle by 16S rRNA gene sequence analysis. FEMS Microbiology Ecology, 56, 471–481. Horvath, K., Andrassy, E., Korbasz, M., & Farkas, J. (2007). Using automatic conductometry for monitoring spoilage bacteria on chilled pork cutlets. Acta Aliment Hung, 36, 283–291. Jiang, Y., Gao, F., Xu, X.L., Su, Y., Ye, K.P., & Zhou, G.H. (2010). Changes in the bacterial communities of vacuum-packaged pork during chilled storage analyzed by PCR–DGGE. Meat Science, 86, 889–895. Jiang, Y., Gao, F., Xu, X.L., Ye, K.P., & Zhou, G.H. (2011). Changes in the composition of the bacterial flora on tray-packaged pork during chilled storage analyzed by PCR–DGGE and real-time PCR. Journal of Food Science, 76, M27–M33. Li, C.B., Liu, D.Y., Zhou, G.H., Xu, X.L., Qi, J., Shi, P.L., & Xia, T.L. (2012). Meat quality and cooking attributes of thawed pork with different low field NMR T21. Meat Science, 92, 79–83. Li, M.Y., Zhou, G.H., Xu, X.L., Li, C.B., & Zhu, W.Y. (2006). Changes of bacterial diversity and main flora in chilled pork during storage using PCR–DGGE. Food Microbiology, 23, 607–611. Malle, P., & Poumeyrol, M. (1989). A new chemical criterion for the quality control of fish: trimethylamine/total volatile basic nitrogen (%). Journal of Food Protection, 50, 419–423. Osés, S.M., Diez, A.M., Melero, B., Luning, P.A., Jaime, I., & Rovira, J. (2013). Characterization by culture-dependent and culture-independent methods of the bacterial population of suckling-lamb packaged in different atmospheres. Food Microbiology, 36, 216–222. Pennacchia, C., Ercolini, D., & Villani, F. (2011). Spoilage-related microbiota associated with chilled beef stored in air or vacuum pack. Food Microbiology, 28, 84–93. Richard, J.E., Kenneth, D.B., Claire, J.J., Russell, S., Lilly, A., Lawrence, M., & Mark, E.V. (2013). Comparison of the distal gut microbiota from people and animals in Africa. PLoS ONE, 8, e54783. Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B., Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres, B., Thallinger, G.G., Van Horn, D.J., & Weber, C.F. (2009). Introducing mothur: Open-source, platformindependent, community supported software for describing and comparing microbial communities. Applied and Environmental Microbiology, 75, 7537–7541. Wang, Q., Garrity, G.M., Tiedje, J.M., & Cole, J.R. (2007). Naïve Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and Environmental Microbiology, 73, 5261–5267. Xiao, X., Dong, Y., Zhu, Y., & Cui, H.L. (2013). Bacterial diversity analysis of Zhenjiang Yao meat during refrigerated and vacuum-packed storage by 454 pyrosequencing. Current Microbiology, 66, 398–405.
Contents lists available at ScienceDirect
Meat Science journal homepage: www.elsevier.com/locate/meatsci
Microbial changes in vacuum-packed chilled pork during storage Fan Zhao, Guanghong Zhou, Keping Ye, Shuaiwu Wang, Xinglian Xu, Chunbao Li ⁎ Key Laboratory of Animal Products Processing, MOA, Key Laboratory of Meat Processing and Quality Control, MOE, Synergetic Innovation Center of Food Safety and Nutrition, PR China College of Food Science and Technology, Nanjing Agricultural University, PR China
a r t i c l e
i n f o
Article history: Received 11 June 2014 Received in revised form 6 August 2014 Accepted 5 October 2014 Available online 12 October 2014 Keywords: Pyrosequencing Fresh meat Bacteria
a b s t r a c t Microbial composition in vacuum-packed chilled pork was investigated. The number of microbial counts increased during the period of 21 day storage with the deterioration of meat. A total of 28,216 bacterial sequences were obtained for the assessment of microbial diversity from vacuum packed pork during chilled storage. More than 200 bacterial genera belonging to eighteen phyla were observed, and most of them are likely to be associated with contamination via fecal, air and/or water during slaughtering and subsequent meat handling. Microbial populations changed greatly during storage, of which the seventh day was a critical time point for microbial diversity. Micrococcaceae, Flavobacteriaceae, Enterobacteriaceae, Lactobacillaceae and Carnobacteriaceae were the major components that may be associated with the spoilage of meat. Although the potential impact of detected microbes on meat hygiene and/or safety is unknown, effective decontamination of the whole chain is always important for meat industry to guarantee meat safety and to improve shelf-life of fresh meat. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Meat hygiene is determined by numerous environmental factors, which could result in meat spoilage and food safety problems. For chilled meat, the growth of bacteria is the main cause of the reduction of freshness and the progress of spoilage (Belák et al., 2011; Ercolini, Russo, Nasi, Ferranti, & Villani, 2009; Horvath, Andrassy, Korbasz, & Farkas, 2007). The microbial diversity and main flora in fresh meat have been widely investigated using traditional cultivation methods. In recent years, cloning and sequencing techniques such as polymerase chain reaction and denaturing gradient gel electrophoresis (PCR–DGGE) have been applied to explore microbial populations in meats (Ercolini et al., 2010; Jiang, Gao, Xu, Ye, & Zhou, 2011; Li, Zhou, Xu, Li, & Zhu, 2006; Osés et al., 2013). The PCR–DGGE overcomes the limitations of traditional cultivation methods. For example, some microorganisms cannot be cultivated by traditional methods; and it takes a long time to identify the composition from a pool of microorganisms. Li et al. (2006) found that the bacterial diversity of chilled pork decreased with storage time and Arthrobacter sp., Enterococcus sp., Staphylococcus sp., Moraxella sp., Pseudomonas sp., Lactobacillus sp., Aeromonas sp., Acinetobacter sp. and Brochothrix thermosphacta were the main flora during a 7-day storage period. However, PCR–DGGE is still time-consuming and can be only used to detect predominant members of the microbial communities. More recently, the bacterial diversity in beef steaks and a Chinese meat product (Zhenjiang Yao Meat) was examined with high-throughput barcoded ⁎ Corresponding author at: College of Food Science and Technology, Nanjing Agricultural University, Weigang 1#, 210095 Nanjing, PR China. Tel./fax: +86 25 84395679. E-mail address: [email protected] (C. Li).
http://dx.doi.org/10.1016/j.meatsci.2014.10.004 0309-1740/© 2014 Elsevier Ltd. All rights reserved.
parallel 454 pyrosequencing and their data showed that the bacterial phylotypes were more complex than previous studies have suggested (De Filippis, La Storia, Villani, & Ercolini, 2013; Xiao, Dong, Zhu, & Cui, 2013). In these two studies, high-throughput sequencing was shown to be a powerful means of giving insight and understanding of the changes in the microbial populations in meat and meat products during production or storage. In the present study, parallel pyrosequencing with 16S rDNA and 18S rDNA was applied to characterize bacterial and fungal changes in vacuum-packed chilled pork. The results were expected to provide insights into the understanding of microbial changes in fresh pork during production and during subsequent chill storage in terms of any precautions for meat safety and for the improvement of meat hygiene. 2. Material and methods 2.1. Sampling A total of 20 pig carcasses from the same herd were selected from a single slaughtering line in a commercial slaughterhouse (Henan, a capacity of 3000 carcasses per day). After 20 h chilling in a 0 °C chiller, carcasses were commercially fabricated. The cut “hind leg” was vacuum-packed in heat-shrink bags (oxygen transmission rates: 18.54 × 10 − 6 cm 3/m 3·d·Pa). Vacuum packed cuts were stored at 0 °C for up to 21 days and were sampled after 1 h (day 0), 7 days, 14 days, and 21 days after vacuum packaging (5 bags per time point). On each sampling occasion, 100 g of muscle on the exposed surface was cut to a thickness of up to 2 cm and was removed for color and pH measurement, total volatile basic nitrogen (TVB-N) determination, microbial enumeration and DNA extraction.
146
F. Zhao et al. / Meat Science 100 (2015) 145–149
2.2. Color measurement Color parameters were determined as previously described (Li et al., 2012) using a Minolta colorimeter (CR-300; Minolta Camera Co., Osaka, Japan) with illuminant D65, a 0° viewing angle and an 8 mm port/viewing area. Before measurement, the colorimeter was calibrated with a white tile (mod CR-A43). Color coordinates (L*, a*, b*) were recorded. Three measurements were performed on each of five samples at each time point. 2.3. pH measurement Meat pH was measured as previously described (Li et al., 2012). Briefly, 1 g of sample was homogenized (Ultra Turrax T25, IKA, Germany) at 6000 rpm for 2 × 15 s with a 5 s break in 10 mL of ice-cold buffer containing sodium iodoacetate (5 mM) and potassium chloride (150 mM), pH 7.0. The pH of the homogenate was recorded with a Hanna 211 pH meter (Hanna, Italy). Three measurements were performed on each of five samples at each time point. 2.4. TVBN determination TVBN concentration (milligrams per 100 g of meat) was determined according to the method of Malle and Poumeyrol (1989). Briefly, 100 g sample was homogenized in 6% trichloroacetic acid at 5000 rpm for 30 s with two bursts. The homogenate was filtered through Whatman filter paper and TVBN in the filtrate was released by adding 1% K2CO3 and diffusing with 1% boric acid and then titrated with 0.02 N HCl. Results of TVBN contents were expressed as mg/100 g meat. Three measurements were performed on each of five samples at each time point. 2.5. Enumeration and isolation of microorganisms Twenty five grams of each meat sample was homogenized in 225 mL of peptone saline (0.85% NaCl and 0.1% peptone in distilled water) for 30 s in a blender. After that, triplicate serial dilutions were prepared and plated onto Plate Count Agar (PCA, Land Bridge Company, China) plates. The plates were incubated for 48 h at 37 °C. The number of microbes was expressed as log10 (counts). Three measurements were performed on each of five samples at each time point. 2.6. Total bacterial genomic DNA extraction Meat subsamples (25 g) were homogenized in 225 mL of peptone saline (0.85% NaCl and 0.1% peptone in distilled water) for 30 s in a blender. Twenty milliliters of the homogenate was centrifuged at a speed of 10,000 ×g for 10 min (Avanti J-HC, Berkman, USA). The pellets were resuspended in 200 μL of lysis buffer and broken with 100 mg of zirconium beads (0.1 mm) in Mini-beadbeater (FastPrep, Thermo Electron Corporation, USA) for 2 min. Microbial DNA was extracted with DNeasy tissue kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions and resuspended in 100 μL of TE buffer (containing 10 mmol/L Tris–HCl, pH = 8.0 and 1 mmol/L EDTA, pH = 8.0). The DNA concentration was measured using a Nano-drop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). 2.7. Pyrosequencing for 16S rDNA The bacterial diversity was analyzed by pyrosequencing of the amplified 16S rDNA V4–V5 variable region (Richard et al., 2013). The forward primers included adaptor A (CCATCTCATCCCTGCGTGTCTCCG ACGACT), barcodes, and gene specific primer F (16S 515F: GTGCCAGC MGCCGCGGTAA). The reverse primers included adaptor B (CCTATCCC CTGTGTGCCTTGGCAGTCTCAG), barcodes, and gene specific primer R (16S 926R: CCGTCAATTYYTTTRAGTTT). Four barcodes, i.e., ATGCACGT,
ATGTGACT, CAGAGTCT and CAGATAGT were used for 0 day, 7 day, 14 day and 21 day samples, respectively. The reaction mixture (20 μL) included 0.25 μL of TaKaRa Ex Taq®(5 U/μL), 2 μL of 10× Ex Taq buffer (25 mM Mg2+ Plus), 1.6 μL of dNTP, 0.4 μL of primer F, 0.4 μL of primer R, 1.0 μL of DNA template, and 14.35 μL of ddH2O. The amplification was performed using GeneAmp® 9700 PCR system (ABI, USA) as follows: initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s and extension at 72 °C for 30 s, and a final extension at 72 °C for 10 min. The PCR products were separated by 2% agarose gel electrophoresis under 100 V for 40 min (Tanon EPS-100 system), purified using AxyPrep DNA gel extraction kit (Axygen, USA) and fluorescently quantified by Quant-iT™ PicoGreen® dsDNA assay kit (Invitrogen, USA) and an equimolar pool was obtained prior to further analysis. Amplicon pyrosequencing was performed using a 454/Roche GS-FLX sequencer (Roche, Germany). The purified pool was amplified using GS FLX Titanium LV emPCR Kit (Lib-L, Qiagen, USA) using GeneAmp® 9700 PCR system (ABI, USA) under the following conditions: initial denaturation at 94 °C for 4 min, followed by 50 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 4.5 min and extension at 68 °C for 30 s, and finally being held at 10 °C. The resulting solution was treated with GS FLX Titanium emPCR Breaking Kit and the final DNA was sequenced using 454 GS FLX platform (Roche, Germany). 2.8. Data analysis After pyrosequencing, all readings were screened and filtered using QIIME 1.6.0 software (Caporaso et al., 2010). The readings were excluded if their quality scores were lower than 25 and/or their length was shorter than 200 base pairs. Operational taxonomic units (OTUs) were picked only if they had similarity values of 97% or higher. Alpha diversity was evaluated by community richness (rarefaction curves, Chao1 and ACE) and diversity (Shannon indices) using MOTHUR (version 1.32.1) (http://www.mothur.org/) (Schloss et al., 2009). The representative sequences were compared to the RDP classification (Ribosomal Database Project, http://rdp.cme.msu.edu/wiki/index. php/Main_Page) to obtain the taxonomy assignment (Wang, Garrity, Tiedje, & Cole, 2007). Beta diversity was evaluated by phylogenetic tree analysis and similarity analysis. The Fast UniFrac test in the MOTHUR program was performed to compare the phylogenetic structure and to generate Venn diagrams. The differences in meat quality data with storage time were evaluated by one-way analysis of variance. Least squares means of 4 time points were compared by Duncan's multiple comparison method at the significance level of 0.05 with the program SAS 9.12 (SAS Institute Inc., Cary, NC, USA, 2003). 3. Results 3.1. Bacterial enumeration and meat quality Total bacterial counts increased during the storage (P b 0.05, Table 1). Although there was a large increase by day 14, the bacterial counts were still at an acceptable level (smaller than 106 CFU g−1). At day 21, the natural logarithm of the bacterial count was over 6 and the meat appeared slightly sticky, indicating that meat had began to be deteriorated and would not be suitable for consumption. Meat pH and TVBN values showed a similar trend whereby they both increased with storage time (P b 0.05, Table 1). Meat color measurements (L*, a*, b*) did not show significant changes with storage time (P N 0.05, Table 1). 3.2. Sequencing data For 16S rDNA analysis, a total of 28,216 pyrosequencing tags with the length of 173 to 557 base pairs were obtained, of which the majority
F. Zhao et al. / Meat Science 100 (2015) 145–149
147
Table 1 Microbial growth and meat quality of the vacuum-packaged pork during chilled storage. Time (days)
Bacterial counts Log10 (CFUg−1)
0 7 14 21
4.13 4.32 5.41 6.50
± ± ± ±
pH
0.39a 0.59a 0.24b 0.34c
5.72 5.79 5.90 5.99
TVBN (mgN/100 g) ± ± ± ±
0.01a 0.13a 0.22ab 0.22b
5.67 6.79 7.80 8.81
± ± ± ±
1.03a 0.86ab 1.69bc 1.47c
L* 45.23 43.45 46.14 44.31
a* ± ± ± ±
1.35 2.79 3.14 4.35
12.01 12.70 13.40 13.55
b* ± ± ± ±
3.09 2.73 2.90 3.09
3.11 3.11 6.19 5.58
± ± ± ±
1.35a 1.97a 1.82b 1.79b
Figures in the table are means and standard deviations. a,b,c Figures with different subscripts in a column are significantly different (P b 0.05).
ranged from 265 to 272 base pairs, and also from 390 to 395 base pairs (Fig. 1). With the unique sequences analyzed, samples at day 0 and day 14 had similar levels of diversity (Shannon rarefaction, Fig. 2). The 7 day samples showed the highest bacterial diversity and the 21 day samples had the lowest bacterial diversity (Fig. 2).
Clostridiaceae, Micrococcaceae, Nocardiaceae, Corynebacteriaceae, Propionibacteriaceae, Porphyromonadaceae, Listeriaceae, Bacillaceae, Flavobacteriaceae, Chlamydomonadaceae, Mamiellaceae, Brucellaceae, Staphylococcaceae, Enterococcaceae, Streptococcaceae, Fusobacteriaceae, Vibrionaceae, Hyphomicrobiaceae, Methylobacteriaceae, Sphingomonadaceae, Alcaligenaceae, Aeromonadaceae, Shewanellaceae, Moraxellaceae, and Xanthomonadaceae (data not shown).
3.3. Changes in microbiota composition during storage 3.4. Microbial diversity varying with storage time Eighteen phyla were found in the microbiota in vacuum packed pork across all the time points (Fig. 3a). The vast majority of sequences belong to one of the four major phyla: Actinobacteria, Bacteroidetes, Firmicutes or Proteobacteria. Of the four major phyla, Actinobacteria and Bacteroidetes were the most predominant microbiota at day 0 (28.17% and 33.75% of total sequences, respectively), but they were substantially decreased after that time. Firmicutes increased greatly at day 14 and day 21 (45.77% and 77.04% of total sequences, respectively). The abundance of Proteobacteria increased from 8.57% at day 0 to 52.32% at day 7, but it then decreased to 7.69% at day 21. Verrucomicrobia showed a similar tendency to increase from 0.03% at day 0 to 10.40% at day 7, but it was not detectable at day 14. The remaining phyla were very low in abundance, including Crenarchaeota, Acidobacteria, Chloroflexi, Cyanobacteria, Deferribacteres, Fusobacteria, Gemmatimonadetes, Lentisphaerae, Planctomycetes, Spirochaetes, Tenericutes and Thermi (less than 1.5% of total sequences). Although bacterial counts continued to increase through the 21 day storage as shown above, the number of bacterial families increased significantly from day 0 to day 7, and then decreased greatly after day 7. At day 0, Micrococcaceae and Flavobacteriaceae accounted for 26.59% and 32.99% of total sequences, respectively (Fig. 3b). At day 7, the percentages of main flora were 12.34% for Flavobacteriaceae, 25.94% for Rhodobacteraceae, 5.69% for Aeromonadaceae, 4.70% for Enterobacteriaceae, 4.33% for Puniceicoccaceae, 5.84% for Verrucomicrobiaceae, and 2.28% for Lactobacillaceae. At day 14, the predominant populations were Carnobacteriaceae (14.54%), Lactobacillaceae (21.15%), and Enterobacteriaceae (21.63%). At day 21, the prevalent populations were still Lactobacillaceae (70.18%), Carnobacteriaceae (3.40%) and Enterobacteriaceae (6.50%). In addition, at least 26 low-abundance families were found to exist in vacuum-packed pork, including Pseudomonadaceae,
The Venn plot indicated that 24 sequences were common across all time points (Fig. 4), corresponding to 20 families of bacteria existing on the surface of vacuum packed pork throughout 21 day storage period. Of these 20 families of bacteria, Flavobacteriaceae, Staphylococcaceae, Aeromonadaceae and Enterobacteriaceae were dominant in abundance during the first 7 or 14 days of storage. Lactobacillaceae dominated and played a critical role in the spoilage of meat at day 21. 4. Discussion In the present study, microbial enumeration and TVBN measurement indicated a continuous deterioration of pork during storage. The number of microbial counts did not show a significant increase from day 0 to day 7 probably because of the lack of oxygen in the package and the low storage temperature. However the microbial Shannon rarefaction for pyrosequencing increased, indicating that microbial community of vacuum-packed pork became more diverse during the first 7-day storage. However, during the subsequent two-week storage, the Shannon rarefaction decreased while the number of microbial counts continued to increase. This could be due to the competitive growth or inhibition between the microorganisms. This meant that the predominance of some bacteria resulted in the deterioration of pork. Although it is impossible in the present study to associate the bacterial counts with the OTUs abundance throughout the period of storage, the major components of microflora in the first 7 days were more diverse and different from those at day 14 and day 21. Micrococcaceae
Number of sequences
3000 2500 2000 1500 1000 500 0 150
250
350
450
550
Sequence length Fig. 1. Distribution of sequence reads of microbial communities by 16S rDNA sequencing.
Fig. 2. Shannon rarefaction curves applied to estimate richness at different storage time points.
148
F. Zhao et al. / Meat Science 100 (2015) 145–149
a
abundance
b
100%
other
90%
Aeromonadaceae
80%
Carnobacteriaceae
70%
Enterobacteriaceae
60%
Flavobacteriaceae
50%
Lactobacillaceae
40%
Micrococcaceae
30%
Moraxellaceae
20%
Puniceicoccaceae
10%
Rhodobacteraceae
0%
0d
7d
14d
21d
Verrucomicrobiaceae
storage time (day) Fig. 3. Changes in abundance of bacterial and fungal phyla based on 16S rDNA sequencing. (a) phyla-based; (b) family-based. In the legend, “k” stands for kingdom and “p” for phyla.
and Flavobacteriaceae were the prevalent OTUs in the 0 day samples. Micrococcaceae is an aerobic bacterium that exists widely in the environment and can readily contaminate meat during animal slaughtering and postmortem handling by equipment and workers (De Filippis et al., 2013). After vacuum packaging, the abundance of Micrococcaceae on the surface of pork decreased greatly, which is likely to the result of death or the growth inhibition of the bacteria. Flavobacteriaceae is an amphi-microbe that also exists widely in the environment and may contaminate meat (De Filippis et al., 2013). Under vacuum packaging
Fig. 4. Venn plot for microbial diversity across storage time. The figures in different compartments mean the numbers of sequences specific for or common to storage time. The sum of the figures in an ellipse was the total number of sequences at a certain time.
conditions, the OTUs abundance of Flavobacteriaceae on pork surface remained high in the 7 day samples, but its abundance continuously decreased with longer storage times. Possible reasons for this are as follows: 1) Flavobacteriaceae may grow more slowly than other bacteria (for example, Lactobacillaceae) under vacuum conditions; and 2) the growth of Flavobacteriaceae may be inhibited by other bacteria. Our colleagues have observed that Lactobacillus, Pseudomonas sp. and Carnobacterium sp. were the major components of the microflora in vacuum-packed chilled pork (Jiang et al., 2010; Li et al., 2006). The present study confirmed the prevalence of Lactobacillaceae and Carnobacteriaceae at day 14 and day 21. It has been shown that Lactobacillus may produce lactic acid which inhibits the growth of other families of bacteria in vacuum packed meat (Blixt & Borch, 2002). Pseudomonadaceae was very low in abundance throughout the period of storage, but its abundance showed a large increase from day 14 to day 21, indicating a potential contribution to the spoilage of meat if the storage period was to be further extended. Although Enterobacteriaceae has been shown one of the major bacteria in vacuum-packed chilled meat (Pennacchia, Ercolini, & Villani, 2011), the present study showed that it accounted for a decreasing proportion of OTUs from day 7 to day 21. It meant that Enterobacteriaceae may not be the main contributor to the spoilage of meat. In addition, several low-abundance, animal-sourcing bacteria observed in the present study could be associated with contamination via fecal, air and/or water during slaughtering and subsequent handling. For example, Rhodobacteraceae, Puniceicoccaceae, and Verrucomicrobiaceae
F. Zhao et al. / Meat Science 100 (2015) 145–149
were reported to be intestinal microorganisms in livestock animals (Choo, Lee, Song, & Cho, 2007; De Jesús-Laboy et al., 2012; Gill et al., 2006). 5. Conclusions Pyrosequencing was applied to explore the microbial community of vacuum-packed chilled pork and to establish the range and diversity of this community. Hundreds of different microbes were found to exist on the surface of vacuum-packed chilled pork and the microbial components changed through the 21 day storage. Micrococcaceae, Flavobacteriaceae, Enterobacteriaceae, Lactobacillaceae and Carnobacteriaceae were the major components that may be associated with the spoilage of meat. Although the potential impact of such microbes on meat hygiene and/or safety is unknown, effective decontamination of the whole chain is always important for the meat industry to guarantee meat safety and improve the shelf-life of fresh meat. Conflict of interest The authors have no conflict of interest. Acknowledgments The present study was supported by projects NCET-11-0668 (MOE), 2012BAD28B02-03 (MOST), 2014BAD19B01 (MOST) and CARS-36-11 (MOA). References Belák, Á., Kovács, M., Hermann, Z., Holczman, A.N., Márta, D., Stojakovič, S.C., Bajcsi, N., & Maráz, A. (2011). Molecular analysis of poultry meat spoiling microbiota and heterogeneity of their proteolytic and lipolytic enzyme activities. Acta Aliment Hung, 40, 3–22. Blixt, Y., & Borch, E. (2002). Comparison of shelf life of vacuum-packed pork and beef. Meat Science, 60, 371–378. Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello, E.K., Fierer, N., Gonzalez Peña, A., Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley, S.T., Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A., McDonald, D., Muegge, B.D., Pirrung, M., Reeder, J., Secinsky, J.R., Turnbaugh, P.J., Walters, W.A., Widmann, J., Yatsunenko, T., Zaneveld, J., & Knight, R. (2010). QIIME allows analysis of highthroughput community sequencing data. Nature Methods, 7, 335–336. Choo, Y. -J., Lee, K., Song, J., & Cho, J. -C. (2007). Puniceicoccus vermicola gen. nov., sp. nov., a novel marine bacterium, and description of Puniceicoccaceae fam. nov., Puniceicoccales ord. nov., Opitutaceae fam. nov., Opitutales ord. nov. and Opitutae classis nov. in the phylum ‘Verrucomicrobia’. International Journal of Systematic and Evolutionary Microbiology, 57, 532–537.
149
De Filippis, F., La Storia, A., Villani, F., & Ercolini, D. (2013). Exploring the sources of bacterial spoilers in beefsteaks by culture-independent high-throughput sequencing. PLoS ONE, 8, e70222. De Jesús-Laboy, K.M., Godoy-Vitorino, F., Piceno, Y.M., Tom, L.M., Pantoja-Feliciano, I.G., Rivera-Rivera, M.J., Andersen, G.L., & Domínguez-Bello, M. G. (2012). Comparison of the fecal microbiota in feral and domestic goats. Genes, 3, 1–18. Ercolini, D., Ferrocino, I., La Storia, A., Mauriello, G., Gigli, S., Masi, P., & Villani, F. (2010). Development of spoilage microbiota in beef stored in nisin activated packaging. Food Microbiology, 27, 137–143. Ercolini, D., Russo, F., Nasi, A., Ferranti, P., & Villani, F. (2009). Mesophilic and psychrotrophic bacteria from meat and their spoiling potential in vitro and in beef. Applied and Environmental Microbiology, 75, 1990–2001. Gill, J.J., Sabour, P.M., Gong, J., Yu, H., Leslie, K.E., & Griffiths, M.W. (2006). Characterization of bacterial populations recovered from the teat canals of lactating dairy and beef cattle by 16S rRNA gene sequence analysis. FEMS Microbiology Ecology, 56, 471–481. Horvath, K., Andrassy, E., Korbasz, M., & Farkas, J. (2007). Using automatic conductometry for monitoring spoilage bacteria on chilled pork cutlets. Acta Aliment Hung, 36, 283–291. Jiang, Y., Gao, F., Xu, X.L., Su, Y., Ye, K.P., & Zhou, G.H. (2010). Changes in the bacterial communities of vacuum-packaged pork during chilled storage analyzed by PCR–DGGE. Meat Science, 86, 889–895. Jiang, Y., Gao, F., Xu, X.L., Ye, K.P., & Zhou, G.H. (2011). Changes in the composition of the bacterial flora on tray-packaged pork during chilled storage analyzed by PCR–DGGE and real-time PCR. Journal of Food Science, 76, M27–M33. Li, C.B., Liu, D.Y., Zhou, G.H., Xu, X.L., Qi, J., Shi, P.L., & Xia, T.L. (2012). Meat quality and cooking attributes of thawed pork with different low field NMR T21. Meat Science, 92, 79–83. Li, M.Y., Zhou, G.H., Xu, X.L., Li, C.B., & Zhu, W.Y. (2006). Changes of bacterial diversity and main flora in chilled pork during storage using PCR–DGGE. Food Microbiology, 23, 607–611. Malle, P., & Poumeyrol, M. (1989). A new chemical criterion for the quality control of fish: trimethylamine/total volatile basic nitrogen (%). Journal of Food Protection, 50, 419–423. Osés, S.M., Diez, A.M., Melero, B., Luning, P.A., Jaime, I., & Rovira, J. (2013). Characterization by culture-dependent and culture-independent methods of the bacterial population of suckling-lamb packaged in different atmospheres. Food Microbiology, 36, 216–222. Pennacchia, C., Ercolini, D., & Villani, F. (2011). Spoilage-related microbiota associated with chilled beef stored in air or vacuum pack. Food Microbiology, 28, 84–93. Richard, J.E., Kenneth, D.B., Claire, J.J., Russell, S., Lilly, A., Lawrence, M., & Mark, E.V. (2013). Comparison of the distal gut microbiota from people and animals in Africa. PLoS ONE, 8, e54783. Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B., Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres, B., Thallinger, G.G., Van Horn, D.J., & Weber, C.F. (2009). Introducing mothur: Open-source, platformindependent, community supported software for describing and comparing microbial communities. Applied and Environmental Microbiology, 75, 7537–7541. Wang, Q., Garrity, G.M., Tiedje, J.M., & Cole, J.R. (2007). Naïve Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and Environmental Microbiology, 73, 5261–5267. Xiao, X., Dong, Y., Zhu, Y., & Cui, H.L. (2013). Bacterial diversity analysis of Zhenjiang Yao meat during refrigerated and vacuum-packed storage by 454 pyrosequencing. Current Microbiology, 66, 398–405.