- Email: [email protected]
Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application
Ecotoxicology and Environmental Safety 151 (2018) 220–227
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application
T
⁎
Chongxin Xua,b, Ying Yanga, Liwen Liua, Jianhong Lia, , Xiaoqin Liuc, Xiao Zhangb, Yuan Liub, ⁎⁎ Cunzheng Zhangb, Xianjin Liub, a
College of Life Sciences, Nanjing Normal University, Nanjing 210023, China Key Laboratory of Food Quality and Safety of Jiangsu/Province-State Key Laboratory Breeding Base, Institute of Food Safety and Nutrition, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China c Huaihua Vocational and Technical College, Huaihua 418007, China b
A R T I C L E I N F O
A B S T R A C T
Keywords: Microcystin-LR Phage display antibody library Nanobody Protein expression ELISA
Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15 kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC50) were 0.87, 1.17 and 1.47 μg/L, their detection limits (IC10) were 0.06, 0.08 and 0.12 μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7–116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0–106.5%, coefficient of variations (CVs) were 3.4–10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple MCs.
1. Introduction Microcystins (MCs) belong to a type of short cyclic peptides of biotoxins which produced by multiple genera of cyanobacteria, such as Microcystis aeruginosa, Anabaena flosaquae, Oscillatoria agardhii and Aphanizomenon flosaquae etc. (Rastogi et al., 2014). The hazards of MCs are injury to liver, kidney, adrenal gland and stomach, disturbing nervous systems and inducing cancer (Chen et al., 2016; Svirčev et al., 2017). Algal blooms erupt more and more frequently, they cause MCs accumulation, and threaten water resources, soil environment, agricultural products and food safety in world-wide (Brooks et al., 2016; Chen et al., 2013; Hou et al., 2017; Wells et al., 2015). So far, more than
⁎
90 MC isoforms have been isolated and identified, and the most common isoforms were MC-LR, MC-RR, MC-YR, MC-WR, MC-LW, MCLY, MC-LF, MC-WF, MC-LA and MC-YF (Pearson et al., 2010). Among them, MC-LR was the most common isoform in waterbodies with algal blooms, also it had the strongest toxicity to human and animals, and its minimum residue limit (MRL) was 1.0 μg/L in water destined for human drinking water by World Health Organization (WHO) (Esterhuizen-Londt et al., 2017; McElhiney and Lawton, 2005). Until now, the reported methods of MC-LR determination include liquid chromatography-mass spectrometry (LC-MS), gas chromatography-mass spectrometry (GC-MS), enzyme-linked immunosorbent assay (ELISA), phosphatase inhibition and animal experiment (Moreira
Corresponding author. Correspondence to: Institute of Food Safety and Nutrition, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China. E-mail addresses: [email protected] (J. Li), [email protected] (X. Liu).
⁎⁎
https://doi.org/10.1016/j.ecoenv.2018.01.003 Received 3 December 2017; Received in revised form 28 December 2017; Accepted 3 January 2018 0147-6513/ © 2018 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
purchased from ComWin Biotech Co.,Ltd (Beijing, China). NcoI and NotI restriction endonucleases and T4 DNA ligase were obtained from New England Biolabs, Inc. (Beijing, China). N,N-dimethylformamide (DMF), N-hydroxysuccinimide (NHS), 1-ethyl-3-[3-dimethylaminopropyl]-carbodimide (EDC), keyhole limpet haemocyanin (KLH), bovine serum albumin (BSA), Difco™ skim milk, Tween 20, trypsin and 3,3,5,5-tetramethylbenzidine (TMB) were purchased from Sigma-Aldrich (Beijing, China). Cell culture flask and 96-well plates were purchased from Corning (Beijing, China). Other reagents and materials were all purchased from GE Healthcare (Beijing, China).
et al., 2014). The ELISA based on antibody for MC-LR was the most popular detecting method, because of its high sensitivity, simple operation, quick reaction and low cost (Heussner et al., 2014; Liu et al., 2014). In this detecting method, how to rapidly obtain the high activity of anti-MC-LR antibody was a critical step. Although the technologies were very mature to obtain the traditional polyclonal antibody and monoclonal antibody, they could not avoid the defects of laborious antigen and adjuvant emulsifying, time-consuming immune cycles and limited antibody products from immune animals (Wang et al., 2012). Therefore, it is necessary to explore a new technology for obtaining the antigen specific antibody more simply and quickly. In recent years, phage display antibody library has become a popular technology to rapidly obtain antigen specific antibody with high activity by high throughput biopanning (Zhao et al., 2016a). This technology randomly clones a lot of artificial antibody genes into a phagemid vector, then infects it to Escherichia coli (E.coli), and the antibodies are expressed on the surface of phage capsid proteins by coexpression (Qi et al., 2012; Smith, 1985). The antigen specific antibodies and their genes could be obtained by multiple rounds of library enrichment and screening, thus the antibody genes could be cloned into different expression vectors conveniently, even further for affinity maturation (Jiao et al., 2017; Pande et al., 2010; Vodnik et al., 2011; Xu et al., 2016). The reported types of antibody from the phage display antibody library were single chain variable fragment (scFv), domain antibody (DAb) and short chain peptides antibody (such as dodecapeptide and heptapeptide) (Pande et al., 2010; Vodnik et al., 2011). Zhang et al. (2012) obtained an anti-Cry1B toxin scFv from a human synthetic phage display library (Tomlinson J), and its IC50 was 0.84 μg/ mL and the linear range of detection (IC20-IC80) were 0.19–1.1 μg/mL. Zhao et al. (2016b) obtained five broad-specificity phage domain antibodies for pyrethroid, and they were all capable of detecting cypermethrin, β-cypermethrin, fenvalerate and phenoxybenzoic acid simultaneously. In natural world, some antibodies from camel, alpacas, llamas and shark are lack light chain naturally and only contain one heavy chain variable region (VHH) called nanobody (Muyldermans, 2013). Nanobody has a characteristic of low immunogenicity, strong stability, good solubility, strong penetrability and easy expression, it has been widely used in biomedicine and immunoassay field (Chakravarty et al., 2014; Liu et al., 2017; Muyldermans, 2013; Qiu et al., 2015). In this study, based on the superiorities of nanobody, we employed a large diversity and capacity of naive alpaca phage display nanobody library for screening high activity MC-LR nanobodies by biopanning, then the positive MC-LR nanobody proteins were expressed in E.coli BL21 by gene clone, later they were used to establish the IC-ELISA for MC-LR. Finally, we have made an assessment for the IC-ELISAs with accuracy, stability and repeatability based on nanobodies for detecting MC-LR by spiked tap water samples.
Conjugating of MC-LR to KLH and BSA were performed as described by Yu et al. (2002) with some optimization. Briefly, 1 mg MC-LR toxin standards dissolved in 0.2 mL DMF, drop by drop added to 0.6 mL DMF (containing 1.5 mg EDC and 1.5 mg NHS) with gently shaking (25 rpm) for 40 min at room temperature (RT), then for overnight at 4 °C. The next day, added the mixture into the KLH or BSA solution [6 mg KLH or BSA dissolved in 6 mL 0.1 M sodium carbonate buffer (CBS, pH=9.6)] with gently shaking (25 rpm) at RT for 4 h in dark. After that, centrifuged for 25 min at 8000 rpm and 4 °C by Amicon Ultra-4-Ultracel-3K (Millipore, USA), the supernatant pellet were resuspended by 6 mL 0.1 M sodium phosphate buffer (PBS, pH = 7.4) and centrifuged for 30 min at 8000 rpm and 4 °C, the ultrafiltration steps were repeated three times. Finally, the ultrafiltrates quantified to 6 mL by 0.1 M PBS buffer and the concentration of conjugates MC-LR-KLH or MC-LR-BSA will be determined for 1 mg/mL. The effect of conjugates MC-LR-KLH and MC-LR-BSA were analyzed by ultraviolet full wavelength scanner (Agilent, USA) and ELISA based on MC-LR monoclonal antibody (Sheng et al., 2007). For ELISA test, MC-LR-KLH and MC-LR-BSA were diluted with PBS buffer for 0.01, 0.05, 0.1, 0.2, 0.5, 1.0, 2.0 and 4.0 μg/mL respectively, and coated with them 100 μL/well in 96-well plate to stand overnight at 4 °C. The negative controls were KLH and BSA, respectively. The next day, after being washed for three times with 300 μL/well of PBST solution (PBS with 0.1% Tween 20) and blocked by 300 μL/well of MPBS solution (PBS with 5% Difco™ skim milk) at 37 °C for 2 h. After being washed with PBST solution, and then MC-LR monoclonal antibody (1: 2000 diluted with CBS buffer) were added into the wells at 100 μL/well of for incubating 2 h at 37 °C. After being washed with PBST solution, 100 μL/ well of goat anti-mouse IgG monoclonal antibody [HRP] (1:3000 dilution) were added for incubating 2 h at 37 °C. After being washed with PBST solution, added 100 μL/well of TMB solution, the color development were performed at RT for 20 min and stopped by 50 μL/well of 2 M sulfuric acid, the OD450 values were measured by an automatic microplate reader (Berthold, Germany). All tests were repeated three times and the given data were the mean value.
2. Materials and methods
2.3. Amplification of alpaca phage display antibody library
2.1. Phage antibody library, bacterial strains, reagents and materials
Amplification of alpaca phage display antibody library were performed as described by Pírez-Schirmer et al. (2017). Total 100 μL library phage particles (1012 CFU/mL) were added into 10 mL E.coli TG1 (logarithmic phase) in 2×TY medium [16 g tryptone, 10 g yeast extract and 5 g NaCl in 1 L double distilled water (ddH2O)], culturing for 1 h at 37 °C and 250 rpm, then 3300g centrifuging for 15 min at 37 °C. The cell pellets were resuspended by 10 mL 2×TY-AG liquid medium (with 100 μg/mL Amp and 1% glucose) and cultured with shaking 250 rpm at 37 °C for 2 h until cells density reached 0.6 at OD600, then KM13K07 helper phages (1012 CFU) were added and rescued for 1 h at 30 °C and 250 rpm. The cultures were centrifuged for 30 min at 1800g and 30 °C, and the cell pellets were resuspended by 500 mL 2×TY-AK medium (with 100 μg/mL Amp and 50 μg/mL Kana) for culturing overnight at 30 °C and 250 rpm. The next day, after the culture centrifuged for 15 min at 10,800g and 4 °C, a 500 mL supernatant was obtained, and
2.2. Preparation and analyzation of MC-LR-KLH and MC-LR-BSA
Alpaca phage display nanobody library [constructed in pComb3XSS phagemid vector (ampicillin resistance, Ampr), the capacity of the library is 2 × 109], E.coli TG1, KM13K07 helper phage (kanamycin resistance, Kanar) were obtained from Uppark Biotechnology Co. Ltd (Chengdu, China). pET26b vector (Kanar) and E.coli BL21 were purchased from Novagen (Germany). Microcystins (MC-LR, MC-RR, MCYR, MC-WR, MC-LW, MC-LY and MC-LF) were purchased from ApexBio Company (USA). Anti-M13 monoclonal antibody [HRP], goat antimouse IgG monoclonal antibody [HRP] and anti-HIS tag monoclonal antibody [HRP] were purchased from GenScript Bio. Co.Ltd (Nanjing, China). MC-LR monoclonal antibody [immunogen was MC-LR-ovalbumin (MC-LR-OVA)] was obtained from Enzo Biochem, Inc. (USA). 2×Tap PCR Master Mix, DNA maker and protein maker were 221
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
then 125 mL PEG/NaCl [containing 20% polyethylene-glycol (PEG) and 2.5 M NaCl] were mixed with the supernatant. The mixtures were kept on ice for 3 h and centrifuged for 30 min at 3300g and 4 °C. Precipitates were resuspend in 5 mL PBS buffer and centrifuged for 10 min at 11,600g and 4 °C to remove the residual cell debris. Final supernatant was the amplification of the library and the concentration of phage particles were adjusted to 1012 CFU/mL which used in next experiment.
solution, adding 100 μL/well of anti-M13 monoclonal antibody [HRP] (1:3000 dilution) incubating for 2 h at 37 °C, and adding TMB solution when after being washed, then measuring the OD450 values. The monoclonal phage nanobody with OD450 ratio of P/N > 3.0, was considered as a positive one which bound with MC-LR (Wang et al., 2012). P/N=positive (coated MC-LR-BSA)/negative (coated BSA). All tests were repeated three times and the given data were the mean value.
2.4. Enrichment and evaluation of library phage particles binding to MC-LR
2.6. Colony PCR, DNA sequencing and analysis
Enriching of MC-LR-specific phage particles was performed as described by Xu et al. (2016), and the enrichment was performed four rounds in this study. In brief, 3 mL MC-LR-KLH solution (the first round was 100 μg/mL, and the remaining three rounds were 80, 60, 20 μg/mL in PBS buffer respectively) were coated in a sterile cell culture flask (25 cm2) for standing overnight at 4 °C. The next day, after being washed four times with 5 mL sterile PBST solution and blocked by 6 mL MPBS solution for 2 h at 37 °C, after being washed with sterile PBST solution, then added 1.5 mL phage particles of the library amplification were mixed with 3.5 mL MPBS solution. The flask was shaken for 1 h at 125 rpm and RT, then standing at RT for 1 h. After being washed ten times with 3 mL sterile PBST solution, the binding phage particles (nanobodies) were eluted by 1.5 mL trypsin solution (PBS with 1 mg/ mL trypsin). The phage particles in the solution were the first round enrichment of phage particles binding to MC-LR, and collected for the next round of enrichment. Effect of each enrichment round of MC-LR-specific phage particles were evaluated by calculate the output/input and polyclonal phages ELISA (Zhang et al., 2012). In brief, each round of input library phage particles were quantified to 1012 CFU/mL, and taking 50 μL eluents from each round to infect 450 μL E.coli TG1, respectively, then spread on 2×TY-AG agar plates (with 1.5% agar) for calculating single colonies, which was the output of each round of enrichment. Polyclonal phage ELISA test was performed as follow, 100 μL/well of 1.0 μg/mL MC-LR-BSA(BSA, negative control) were coated in 96-well plate to stand overnight at 4 °C, after “washed-blocked-washed” process as described above, 100 μL/well eluents of each round were added in the 96well plate for incubating 2 h at 37 °C. After being washed with PBST solution, adding 100 μL/well of anti-M13 monoclonal antibody [HRP] (1:3000 dilution) for incubating 2 h at 37 °C, and added TMB solution after being washed with PBST solution, then measuring the OD450 values of each round enrichment MC-LR-specific phage particles. All tests were repeated three times and the given data were the mean value.
The obtained positive monoclonal phage nanobodies genes were identified by colony PCR and DNA sequencing. In brief, total 20 μL PCR reaction system, containing 10 μL 2×Tap PCR Master Mix, 1 μL positive monoclonal phage particles cultures in E. coli TG1, 1 μL upstream primers (OmpA-F: AAGACAGCTATCGCGATTGCAG) and downstream primers (OmpA-B: TCAGAGCCACCACCCTCCTAA) were all dissolved in ddH2O with a concentration in a micromolar range, and 7 μL ddH2O. The reaction conditions of PCR were 95 °C for 10 min, then 95 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min for total 35 cycles, and final extension for 10 min at 72 °C. The PCR products were analyzed by 1% agarose gel electrophoresis (180 V, 20 min), and sequenced by Sangon Bio Co. Ltd. (Shanghai, China). Gene Construction Kit (GCK) and Vector NTI Advance softwares were used for translating the nucleotide sequences of anti-MC-LR nanobodies into amino acid sequences and alignment of its protein sequence, respectively. 2.7. Gene cloning, soluble expression and purification of nanobodies In order to obtain the purified soluble proteins of MC-LR nanobodies for determination of MC-LR, the genes of nanobodies were cloned between NotI and NcoI sites of pET26b vector, respectively, then the proteins were expressed in E.coli BL21 and purified by His-Trap (HP) affinity chromatography. In brief, the PCR products (primers were OmpA-F-Not I: ATAAGAATGCGGCCGCAAGACAGCTATCGCGATTG CAG and OmpA-B-NcoI: CATGCCATGTCAGAGCCACCACCCTCCTAA, and the reaction conditions were as described above) of MC-LR nanobody genes were purified by GenElute™ PCR Clean-Up Kit as the operation manual, then digested with Not I and NcoI for overnight at 37 °C, and ligated into pET26b vectors by T4 DNA ligases for overnight at 16 °C, which the vectors had been digested with the same restriction endonucleases and reaction conditions. The next day, the ligated products were used to transform the E. coli BL21 competent cells for thermal shocking for 90 s at 42 °C, then culturing for 40 min at 37 °C and 250 rpm. The bacteria liquids will be spread on agar plates of LB-K medium (10 g tryptone, 5 g yeast extract and 10 g NaCl in 1 L ddH2O, and containing 1.5% agar powder and 50 μg/mL Kana) for culturing overnight at 37 °C. Randomly picking individual colonies cultured in LB-K liquid medium until to logarithmic phase at 37 °C and 250 rpm, then identified by colony PCR and DNA sequencing (primers were T7-F: TAATACGACTCACTATAGGG and T7-B: GCTAGTTATTGCTCAGCGG) as described above. To express the nanobodies, 50 μL positive individual colony bacteria liquid incubated into 250 mL LB-K liquid medium culturing for 2–3 h at 30 °C and 250 rpm until the OD600 was 0.6, then 0.8 mM isopropyl β-Dthiogalactoside (IPTG) was added into the bacteria liquid and grown overnight at 28 °C and 250 rpm. After centrifuged for 30 min at 3300g and 4 °C, the cell pellets were resuspended with 25 mL PBS buffer and lysed by sonication on ice at 300 W, working 3 s and intermittent 2.5 s for 40 min. The purified MC-LR nanobody proteins were obtained from the supernatant after being centrifuged for 30 min at 10,000g and 4 °C by using His-Trap (HP) affinity chromatography performed as described in the operation manual. The effect of purified nanobodies were analyzed by 12% SDS-PAGE with rapid silver staining. In brief, 15 μL/well of protein mixture (containing 12 μL eluent from His-Trap (HP) affinity chromatography and 3 μL of 4×protein denaturing loading buffer) were boiled for 5 min and loaded into the 12% SDS-PAGE
2.5. Screening and identification of MC-LR phage display nanobodies According to the results of polyclonal phages ELISA, the fourth round enrichment of phage particles were employed for randomly picking MC-LR phage nanobodies. The E.coli TG1 infected with the phage was spread on 2×TY-AG agar plates cultured at 37 °C overnight, individual colonies appearing on the plate were inoculated into wells of 96-well with 100 μL/well of 2×TY-AG liquid medium for growing overnight at 37 °C. The next day, the culture was transferred at 2 μL/ well to another 96-well plate with 200 μL/well of 2×TY-AG liquid medium, which was cultured at 37°C and 250 rpm for 3 h, then KM13K07 helper phages were added into them and rescued for 1 h at 30 °C and 250 rpm. The plates were centrifuged for 30 min at 3300g and 30 °C, and added 200 μL/well of 2×TY-AK liquid medium to resuspend the pellets for culturing overnight at 30 °C and 250 rpm. After being centrifuged for 30 min at 3300g and 30 °C, the activity of phage particles (nanobodies) binding with MC-LR in supernatant was identified by monoclonal phage ELISA. In brief, taking 100 μL/well of supernatants added in 96-well plates which coated with MC-LR-BSA and following “washed-blocked-washed” process as described above, the remaining 100 μL liquid in each well were added in 96-well plates that coated with BSA as negative control. After being washed with PBST 222
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
Fig. 1. (A): The absorption spectra conjugation of MC-LR to KLH (A1) and BSA (A2). MC-LR-KLH and MC-LR-BSA displayed an absorption peak near 260 nm and 265 nm between 240 nm of MC-LR and 280 nm of KLH/BSA. B: The ELISA values of preparation of MC-LR-KLH (B1) and MC-LR-BSA (B2) analyzed by MC-LR monoclonal antibody and the OD450 values were the means ± SDs from triplicate measurements.
MC-LR-BSA solution were coated in 96-well plate to stand overnight at 4 °C. After “washed-blocked-washed” process as described above, the wells were added with a 100 μL mixture per well of different MC-LR and purified MC-LR nanobodies incubating for 2 h at 37 °C, and the concentrations of MC-LR were 0.01, 0.05, 0.1, 0.5, 1.0, 2.0, 5.0, 10 and 100 μg/L. After being washed, adding 100 μL/well of anti-His monoclonal antibody [HRP] (1:3000 dilution) incubating for 2 h at 37 °C, then adding TMB solution after being washed, and measuring the OD450 values. The inhibition ratio of purified MC-LR nanobodies were calculated by the formula of [(P-S-N)]/(P-N)]×100%, and containing the IC10, IC20, IC50 and IC80 key indicator data of antibody activity. “P” was the OD450 value of the positive (50 μL purified MC-LR nanobodies + 50 μL CBS buffer), “S” was the OD450 value of the standard (50 μL purified MC-LR nanobodies + 50 μL serial concentration of MC-LR), “N” was the OD450 value of the negative (100 μL CBS buffer). The CRs of MC-LR analogues, MC-RR, MC-YR, MC-WR, MC-LW, MC-LY and MC-LF, were calculated as the formula of [CR (%)=IC50 (MC-LR)/IC50 (analogues)] × 100%, according to the IC-ELISA performed as described above, respectively. All tests were repeated three times and the given data were the mean value.
electrophoresis running for 110 min at 120 V. The gel was soaked in 50 mL of 40% methanol fixing solution (containing 30 μL of 37% formaldehyde) shaking for 10 min at RT and 25 rpm, and then washed two times with 50 mL ddH2O shaking for 5 min at RT and 25 rpm. Taking out the gel and soaking in 50 mL 0.2 g/L of sodium thiosulfate solution shaking for 1 min at RT and 25 rpm, then rapidly washed two times with 50 mL ddH2O shaking for 20 s at RT and 25 rpm. After being soaked in 50 mL 0.1% of silver nitrate solution shaking for 10 min at RT and 25 rpm, the gel was rapidly washed by 50 mL 3% sodium carbonate developing solution (containing 1 mL 0.2 g/L of sodium thiosulfate solution). The gel was soaked in 50 mL 3% sodium carbonate developing solution (containing 1 mL 0.2 g/L of sodium thiosulfate solution and 30 μL 37% formaldehyde) until the protein band displayed clearly, adding 5 mL 2.5 M of sodium citrate stop solution shaking for 10 min at RT and 25 rpm. Final, taking a photograph by gel imaging system (BioRad, USA).
2.8. IC-ELISA for MC-LR and its analogues based on nanobodies The method of IC-ELISA development was performed as described by Xu et al. (2017b) and Zhang et al. (2016). 100 μL/well of 1.5 μg/mL 223
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
2.9. Assessment of IC-ELISA for MC-LR by spiked water sample Tap water samples from the key laboratory of food quality and safety of Jiangsu/province-state key laboratory breeding base in Jiangsu Academy of Agricultural Sciences (Nanjing, China) were filtered through with a 0.45 µm of nitrocellulose membrane, and spiked serial concentration of MC-LR for assessment of the IC-ELISA. In brief, integration of the working ranges of detection (IC20-IC80) for MC-LR from the three IC-ELISA standard curves based on ANAb7, ANAb9 and ANAb12 MC-LR nanobodies respectively, 1 mL tap water samples were spiked with MC-LR standard at 0, 0.5, 1.0 and 4.0 μg/L concentration levels and detected directly. In the present study, the values of mean recoveries, SDs and CVs were calculated according to the corresponding IC-ELISA standard curve. Intra-assay variations were detected in triplicate for each of spiked level on the same day, and the inter-assay variations were detected in triplicate for each of spiked level in three days. All tests were repeated three times and the given data were the mean value.
Fig. 2. Polyclonal phage ELISA of MC-LR phage nanobodies from each round of biopanning, the coated antigen was MC-LR-BSA and the negative controls was BSA. The OD450 values were the means ± SDs from triplicate measurements.
nanobodies. In this study, we got available products by four rounds of library enrichment for high throughput screening MC-LR phage nanobodies.
3. Results and discussion 3.1. Conjugation of MC-LR-KLH and MC-LR-BSA
3.3. Screening and identification of MC-LR phage display nanobodies
MC-LR is a hapten, and its molecular weight (M.W.) is 994 Da. It has to be coupled with a macromolecular carrier protein to form a “haptencarrier” conjugate for immunogenicity (Mercader et al., 2008). KLH, BSA and OVA were the most common carrier proteins for preparation of “hapten-carrier” conjugates in small molecule immunological detection (Song et al., 2010). In this study, we used KLH and BSA to conjugate MC-LR, respectively. Fig. 1(A) showed the absorption spectra of the conjugates of MC-LR-KLH and MC-LR-BSA. The two hapten-carriers had an obvious offset in maximum absorption wavelength, compared with MC-LR, KLH or BSA, respectively. The maximum absorption of MC-LRKLH was at 260 nm which was between the absorption of MC-LR (238 nm) and KLH (280 nm) (Fig. 1(A1)), and the absorption of MC-LRBSA was at 265 nm, also between MC-LR (238 nm) and BSA (280 nm) (Fig. 1(A2)). The spectra indicated that the MC-LR was successfully coupled with KLH and BSA, respectively. Fig. 1(B) showed the ELISA tests of MC-LR-KLH (Fig. 1(B1)) and MC-LR-BSA (Fig. 1(B2)) with a MCLR monoclonal antibody descended from MC-LR-OVA antigen that could be specific combined to MC-LR without the carrier proteins KLH and BSA. Concentration gradients of MC-LR-KLH and MC-LR-BSA were recognized and the limited concentration were 0.05 and 0.01 μg/mL (P/N criteria > 3.0), respectively. Therefore, according to the spectra and ELISA test results, the MC-LR was successfully conjugated with KLH or BSA, and both of the hapten-carriers were qualified for the subsequent experiments.
As showed in Fig. 3(A), 20 positive monoclonal phage nanobodies (ANAb1 to ANAb20) were selected from the fourth enrichment round from the library, their monoclonal phage ELISA tests displayed the ratios of P/N were all > 3.0. The most positive monoclonal (ANAb12) had a P(1.472)/N(0.136) ratio of higher than 10.0 and the lowest positive (ANAb19) had a P(0.496)/N(0.122) ration of 4.07. All positive nanobodies displayed a 430 bp DNA fragment by colony PCR (Fig. 3(B)). The nine most positives, ANAb1, ANAb5, ANAb7, ANAb9, ANAb11, ANAb12, ANAb14, ANAb16 and ANAb17 were checked by DNA sequencing to confirm their bearing the nobody genes from alpaca. The results of sequencing showed the amino acid sequences of the nanobodies had the same immunoglobulin frameworks from FR1 to FR4, but more or less different in the complementarity determining regions from CDR1 to CDR3 (Fig. 3(C)). Associating the differences of activity with the nanobodies binding to MC-LR with monoclonal phage ELISA, we supposed the CDRs were the key parts of nanobodies binding to MC-LR. However, the activity rules and mechanisms of those nanobodies binging to MC-LR remained to be further researched and confirmed. The reported methods could be used for analyzing the activity rules and mechanisms of antibody to antigen were protein structural analysis, molecular docking and hot amino acid prediction (Barderas et al., 2008; Bonsor et al., 2011; Lai et al., 2013). 3.4. Gene cloning, expression and purification of nanobodies
3.2. Enrichment of library phage particles binding to MC-LR In order to analyze the activity characteristics and their further application of the obtained MC-LR nanobodies, we cloned the nanobody genes of the three most positive nanobodies, ANAb12, ANAb9 and ANAb7 into pET26b(+) vector respectively and then expressed them in E.coli BL21. The expressed proteins were recovered by affinity chromatography. Fig. 4(A) showed that all recombinant plasmids of pET26b-ANAb12, ANAb9 and ANAb7 nanobody genes released an approximate 400 bp fragment after digested by NcoI and NotI restriction endonucleases. The results of colony PCR (Fig. 3(B), lane 12, 9 and 7) and DNA sequencing (Fig. 3(C), ANAb12, ANAb9 and ANAb7) confirmed the three MC-LR nanobody genes had been exactly inserted into pET26b(+) vector and could be used for antibodies expression. The purified MC-LR nanobodies of ANAb12, ANAb9 and ANAb7 were showed in Fig. 4(B), and they were eluted from His-Trap (HP) affinity chromatography with 400 mM imidazole solution with the concentration of 98.56, 126.63 and 107.46 μg/mL, respectively. Being switched to the original culture systems (250 mL), the concentration of ANAb12,
It was an effective means to rapidly obtain antigen-specific phage particles from the library by enrichment of biopanning with gradient decrease of the coated antigen concentration. The antigen-specific phage particles were captured, while those uncombined or weakly combined were washed out progressively (Xu et al., 2017a). As showed in Fig. 2, after four rounds of biopanning, the phage particles binding to MC-LR were effectively enriched, and at the fourth round, the binding phage particles increased approximately 4500-fold (input and output data not shown) and the ELISA values increased approximately 3.5-fold than the first round. It should be mentioned that the coated antigen for biopanning was MC-LR-KLH, and the coated antigen for polyclonal phage ELISA was MC-LR-BSA and the negative control was BSA, the alternation of antigens could effectively avoid the artifact caused by the phage particles binding KLH and BSA carrier protein. Sufficient enrichment of MC-LR-specific phage particles from the library was a key to rapidly and successfully obtain high activity MC-LR phage 224
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
Fig. 3. (A): Monoclonal phage ELISA of obtained positive MC-LR phage nanobody culture supernatants, which the phage particles were quantified to 1012 CFU/mL and the coated antigen was MC-LR-BSA and the negative controls was BSA. The given OD450 values were the means from triplicate measurements. (B): PCR amplified products of obtained positive MC-LR phage nanobody genes from colony PCR of ANAb1-20. Lane M: DNA marker. Lane CK: Without template. Lanes 1–20: Correspond to the ANAb1-20, respectively. (C): Amino acid sequences of obtained positive MC-LR phage nanobody genes, the immunoglobulin frameworks (FR1-4) and the complementarity determining regions (CDR1-3) were determined according to NCBI database.
expressed MC-LR nanobodies, IC-ELISAs were established based on the purified antibody proteins for measuring MC-LR and analogues. ICELISA standard curves of ANAb12, ANAb9 and ANAb7 nanobodies for MC-LR were showed in Fig. 5, the IC50 were 0.87, 1.17 and 1.47 μg/L, the IC10 were 0.06, 0.08 and 0.12 μg/L, and IC20-IC80 were 0.17–4.8, 0.25–7.5 and 0.48–9.39 μg/L, respectively. Their IC50 and IC10 values for MC-LR were not compared with the report by Pirez-Schirmer et al. (2017), its IC50 was 0.28 μg/L and the IC10 was 0.05 μg/L, which the nanobody obtained from a MC-LR-OVA immunized llama phage display nanobody library. However, their IC10 values were better than the MCLR scFvs reported by Zhang et al. (2016) and Murphy et al. (2015), and they were 0.13 and 0.19 μg/L respectively. The sensitivities of all the purified MC-LR nanobodies (ANAb12, ANAb9 and ANAb7) met the detection requirements that the MRL was 1.0 μg/L in drink water by WHO. The CRs of MC-LR nanobodies against MC-LR analogues were
ANAb9 and ANAb7 nanobody proteins were 0.99, 1.27 and 1.07 mg/L respectively. The expression levels of antibody proteins in E.coli BL21 had a big gap compared with Qiu et al. (2015) who reported the deoxynivalenol-mimic nanobodies expressed in E.coli Rosetta by pET25b(+) vector and the concentrations were ranged from 30 to 40 mg/L. Therefore, in order to effectively produce lots of MC-LR nanobody proteins for subsequent application, it is necessary to further optimize the expression conditions, for example, culturing temperature and time, adding IPTG concentration and shaking speed of incubator, even changing the expression vectors, host bacteria, and more efficient affinity chromatography (Papaneophytou and Kontopidis, 2014).
3.5. IC-ELISA for MC-LR and its analogues based on nanobodies In order to evaluate activities and antigen-specificities of the 225
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
Table 1 The CRs of MC-LR nanobodies in IC-ELISA with MC-LR analogues (the given values were the means from triplicate measurements). Names of nanobodies
ANAb12
ANAb9
Fig. 4. (A): Double digestions for recombinant plasmid of pET26b-ANAb12, ANAb9 and ANAb7 nanobody genes by NcoI and NotI restriction endonucleases. Lane M: DNA marker. Lane CK: pET26b (+) vector. Lane 1–3: pET26b-ANAb12, pET26b-ANAb9 and pET26bANAb7 recombinant plasmids. (B): SDS-PAGE of MC-LR nanobody proteins were expressed in E.coli BL21. Lane M: Protein marker. Lane 1–3: The purification of MC-LR nanobody proteins of ANAb12, ANAb9 and ANAb7, respectively, which purified by HisTrap (HP) affinity chromatography and eluted with 400 mM imidazole solution.
ANAb7
MC-LR analogues Competitors
M.W. (Da)
MC-LR MC-RR MC-YR MC-WR MC-LW MC-LY MC-LF MC-LR MC-RR MC-YR MC-WR MC-LW MC-LY MC-LF MC-LR MC-RR MC-YR MC-WR MC-LW MC-LY MC-LF
994 1037 1044 1068 1024 1001 985 994 1037 1044 1068 1024 1001 985 994 1037 1044 1068 1024 1001 985
IC50 (μg/L)
CRs (%)
0.87 0.74 0.94 0.99 19.1 969.5 – 1.17 1.09 1.39 1.29 539.2 1223.6 2048.5 1.47 1.29 1.53 1.78 1602.6 – –
100 116.9 92.5 88.1 4.56 < 0.1 – 100 107.3 84.2 90.6 2.17 < 0.1 < 0.1 100 113.6 95.9 82.7 < 0.1 – –
nanobodies (ANAb12, ANAb9 and ANAb7), respectively. The results were listed in Table 2. The recoveries of MC-LR concentration were 84.0–101.5% and the CVs were 3.8–9.0% in intra and inter-assays for ANAb12, the recoveries were 84.1–97.6% and the CVs were 3.4–10.6% for ANAb9, and the recoveries were 88.0–106.5% and the CVs were 6.5–9.3% for ANAb7, respectively. On the whole, the three nanobodies, ANAb12, ANAb9 and ANAb7 had recoveries of 84.0–106.5% and the CVs of 3.4–10.6% for the spiked samples. All the results indicated that the IC-ELISAs established on the purified nanobodies from the alpaca phage display antibody library had a good accuracy, stability and practicality for detection of MC-LR. In the follow-up study, we will expand detection of MC-LR analogues (MC-RR, MC-YR and MC-WR) and different spiked samples such as soil and agricultural product samples to full evaluate and excavate the application value of the obtained MC-LR nanobodies for further development of the MCs rapid detection kits.
Fig. 5. The standard curves of IC-ELISA for MC-LR based on purified nanobodies (ANAb12, ANAb9 and ANAb7) and the inhibition ratio values (%) were the means ± SDs from triplicate measurements.
4. Conclusions showed in Table 1, all three MC-LR nanobodies showed strong CRs of 82.7–116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. These data indicated the nanobodies were broad specific for simultaneous detection of four MC isoforms, MC-LR, MC-RR, MC-YR and MC-WR. Generally, it was considered difficult to obtain an ultrasensitive antigen specific phage antibody from the naive phage display library without immunization (Sheedy et al., 2007). In order to improve the sensitivity and affinity of phage antibody to antigen, it was a practicable method to label fluorophore (such as Eu3+) or affinity mature to the obtained antibody (Steidl et al., 2008; Xu et al., 2017a). These methods could be used to promote the value of MC-LR nanobodies application for detecting MCs.
In the present study, we found that it was an effective method to rapidly obtained the high activity MC-LR phage nanobody from the naive alpaca phage display antibody library by rounds of biopanning, and the MC-LR coupled to KLH and BSA were used for coated antigen of enrichment and screening, respectively. The three most positive of MCLR nanobodies (ANAb12, ANAb9 and ANAb7) could be used for determination of MC-LR spiked in tap water sample by the corresponding of established IC-ELISA successfully, which expressed in E.coli BL21 with pET26b vector. At the same time, the three MC-LR nanobodies had a strong ability of broad-specificity for simultaneous detection of MCRR, MC-YR and MC-WR that hopefully provided a high activity antibody material for analyzing the MCs residues in environment and agricultural product samples.
3.6. Assessment of IC-ELISA for MC-LR by spiked water sample Acknowledgments The spiked sample test was an effective method to evaluate the accuracy, stability and practicality of a new detection method. In this study, the MC-LR was spiked in tap water samples at concentrations of 0.5, 1.0 and 4.0 μg/L according to the IC20-IC80 showed in Fig. 5, and the samples were measured by IC-ELISAs based on the purified
This study was supported by the National Natural Science Foundation of China (31370217, 31701724 and 31630061), and the Social Development Projects of Jiangsu Province in China (BE2017706). 226
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
Table 2 The IC-ELISAs based on MC-LR nanobodies for MC-LR in spiked tap water samples (the given values were the means ± SDs from triplicate measurements). Name of nanobodies
ANAb12
ANAb9
ANAb7
Spiked concentrations (μg/L)
0 0.5 1.0 4.0 0 0.5 1.0 4.0 0 0.5 1.0 4.0
Intra-assay
Inter-assay
Measured values ± SDs (μg/L)
Recoveries ± SDs (%)
CVs (%)
Measured values ± SDs (μg/L)
Recoveries ± SDs (%)
CVs (%)
– 0.462 ± 0.028 0.854 ± 0.077 3.963 ± 0.152 – 0.429 ± 0.036 0.976 ± 0.108 3.565 ± 0.222 – 0.512 ± 0.036 0.922 ± 0.086 4.261 ± 0.356
– 92.4 ± 5.6 85.4 ± 7.7 99.1 ± 3.8 – 85.8 ± 7.2 97.6 ± 10.3 89.1 ± 5.6 – 102.4 ± 7.2 92.2 ± 8.6 106.5 ± 8.9
– 6.1 9.0 3.8 – 8.4 10.6 6.3 – 7.0 9.3 8.4
– 0.420 ± 0.033 0.919 ± 0.051 4.060 ± 0.330 – 0.465 ± 0.044 0.934 ± 0.676 3.362 ± 0.117 – 0.493 ± 0.042 0.880 ± 0.057 4.090 ± 0.279
– 84.0 ± 6.6 91.9 ± 5.1 101.5 ± 8.3 – 93.0 ± 8.8 93.4 ± 6.8 84.1 ± 2.9 – 98.6 ± 8.4 88.0 ± 5.7 102.3 ± 7.0
– 7.9 5.5 8.2 – 9.5 7.3 3.4 – 8.5 6.5 6.8
Conflict of interest
Pearson, L., Mihali, T., Moffitt, M., Kellmann, R., Neilan, B., 2010. On the chemistry, toxicology and genetics of the cyanobacterial toxins, microcystin, nodularin, saxitoxin and cylindrospermopsin. Mar. Drugs 8, 1650–1680. Pirez-Schirmer, M., Rossotti, M., Badagian, N., Leizagoyen, C., Brena, B.M., GonzalezSapienza, G., 2017. Comparison of three antihapten VHH selection strategies for the development of highly sensitive immunoassays for microcystins. Anal. Chem. 89, 6800–6806. Qi, H., Lu, H., Qiu, H.J., Petrenko, V., Liu, A., 2012. Phagemid vectors for phage display: properties, characteristics and construction. J. Mol. Biol. 417, 129–143. Qiu, Y.L., He, Q.H., Xu, Y., Bhunia, A.K., Tu, Z., Chen, B., Liu, Y.Y., 2015. Deoxynivalenolmimic nanobody isolated from a naive phage display nanobody library and its application in immunoassay. Anal. Chim. Acta 887, 201–208. Rastogi, R.P., Sinha, R.P., Incharoensakdi, A., 2014. The cyanotoxin-microcystins: current overview. Rev. Environ. Sci. Bio 13, 215–249. Sheedy, C., MacKenzie, C.R., Hall, J.C., 2007. Isolation and affinity maturation of haptenspecific antibodies. Biotechnol. Adv. 25, 333–352. Sheng, J.W., He, M., Shi, H.C., 2007. A highly specific immunoassay for microcystin-LR detection based on a monoclonal antibody. Anal. Chim. Acta 603, 111–118. Smith, G.P., 1985. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228, 1315–1317. Song, J., Wang, R.M., Wang, Y.Q., Tang, Y.R., Deng, A.P., 2010. Hapten design, modification and preparation of artificial antigens. Chin. J. Anal. Chem. 38, 1211–1218. Steidl, S., Ratsch, O., Brocks, B., Durr, M., Thomassen-Wolf, E., 2008. In vitro affinity maturation of human GM-CSF antibodies by targeted CDR-diversification. Mol. Immunol. 46, 135–144. Svirčev, Z., Drobac, D., Tokodi, N., Mijović, B., Codd, G.A., Meriluoto, J., 2017. Toxicology of microcystins with reference to cases of human intoxications and epidemiological investigations of exposures to cyanobacteria and cyanotoxins. Arch. Toxicol. 91, 621–650. Vodnik, M., Zager, U., Strukelj, B., Lunder, M., 2011. Phage display: selecting straws instead of a needle from a haystack. Molecules 16, 790–817. Wang, Y., Zhang, X., Zhang, C., Liu, Y., Liu, X., 2012. Isolation of single chain variable fragment (scFv) specific for Cry1C toxin from human single fold scFv libraries. Toxicon 60, 1290–1297. Wells, M.L., Trainer, V.L., Smayda, T.J., Karlson, B.S.O., Trick, C.G., Kudela, R.M., Ishikawa, A., Bernard, S., Wulff, A., Anderson, D.M., Cochlan, W.P., 2015. Harmful algal blooms and climate change: learning from the past and present to forecast the future. Harmful Algae 49, 68–93. Xu, C., Liu, X., Zhang, C., Zhang, X., Zhong, J., Liu, Y., Hu, X., Lin, M., Liu, X., 2017a. Establishment of a sensitive time-resolved fluoroimmunoassay for detection of Bacillus thuringiensis Cry1Ie toxin based nanobody from a phage display library. Anal. Biochem. 518, 53–59. Xu, C., Zhang, C., Zhong, J., Hu, H., Luo, S., Liu, X., Zhang, X., Liu, Y., Liu, X., 2017b. Construction of an immunized rabbit phage display library for selecting high activity against Bacillus thuringiensis Cry1F toxin single-chain antibodies. J. Agric. Food Chem. 65, 6016–6022. Xu, C., Zhang, X., Liu, X., Liu, Y., Hu, X., Zhong, J., Zhang, C., Liu, X., 2016. Selection and application of broad-specificity human domain antibody for simultaneous detection of Bt Cry toxins. Anal. Biochem. 512, 70–77. Yu, F.Y., Liu, B.H., Chou, H.N., Chu, F.S., 2002. Development of a sensitive ELISA for the determination of microcystins in algae. J. Agric. Food Chem. 50, 4176–4182. Zhang, X., He, K., Zhao, R., Wang, L., Jin, Y., 2016. Cloning of scFv from hybridomas using a rational strategy: application as a receptor to sensitive detection microcystinLR in water. Chemosphere 160, 230–236. Zhang, X., Liu, Y., Zhang, C., Wang, Y., Xu, C., Liu, X., 2012. Rapid isolation of singlechain antibodies from a human synthetic phage display library for detection of Bacillus thuringiensis (Bt) Cry1B toxin. Ecotoxicol. Environ. Saf. 81, 84–90. Zhao, A., Tohidkia, M.R., Siegel, D.L., Coukos, G., Omidi, Y., 2016a. Phage antibody display libraries: a powerful antibody discovery platform for immunotherapy. Crit. Rev. Biotechnol. 36, 276–289. Zhao, Y.Y., Liang, Y., Liu, Y., Zhang, X., Hu, X.D., Tu, S.C., Wu, A.H., Zhang, C.Z., Zhong, J.F., Zhao, S.M., Liu, X.J., Tu, K., 2016b. Isolation of broad-specificity domain antibody from phage library for development of pyrethroid immunoassay. Anal. Biochem. 502, 1–7.
The authors declare no conflict of interest. References Barderas, R., Desmet, J., Timmerman, P., Meloen, R., Casal, J.I., 2008. Affinity maturation of antibodies assisted by in silico modeling. Proc. Natl. Acad. Sci. USA 105, 9029–9034. Bonsor, D.A., Postel, S., Pierce, B.G., Wang, N., Zhu, P., Buonpane, R.A., Weng, Z., Kranz, D.M., Sundberg, E.J., 2011. Molecular basis of a million-fold affinity maturation process in a protein-protein interaction. J. Mol. Biol. 411, 321–328. Brooks, B.W., Lazorchak, J.M., Howard, M.D., Johnson, M.V.V., Morton, S.L., Perkins, D.A., Reavie, E.D., Scott, G.I., Smith, S.A., Steevens, J.A., 2016. Are harmful algal blooms becoming the greatest inland water quality threat to public health and aquatic ecosystems? Environ. Toxicol. Chem. 35, 6–13. Chakravarty, R., Goel, S., Cai, W., 2014. Nanobody: the "magic bullet" for molecular imaging? Theranostics 4, 386–398. Chen, J., Zhang, H.Q., Hu, L.B., Shi, Z.Q., 2013. Microcystin-LR-induced phytotoxicity in rice crown root is associated with the cross-talk between auxin and nitric oxide. Chemosphere 93, 283–293. Chen, L., Chen, J., Zhang, X., Xie, P., 2016. A review of reproductive toxicity of microcystins. J. Hazard. Mater. 301, 381–399. Esterhuizen-Londt, M., Hertel, S., Pflugmacher, S., 2017. Uptake and biotransformation of pure commercial microcystin-LR versus microcystin-LR from a natural cyanobacterial bloom extract in the aquatic fungus Mucor hiemalis. Biotechnol. Lett. 39, 1537–1545. Heussner, A.H., Winter, I., Altaner, S., Kamp, L., Rubio, F., Dietrich, D.R., 2014. Comparison of two ELISA-based methods for the detection of microcystins in blood serum. Chem. Biol. Interact. 223, 10–17. Hou, J., Wang, X., Hayat, T., Wang, X., 2017. Ecotoxicological effects and mechanism of CuO nanoparticles to individual organisms. Environ. Pollut. 221, 209–217. Jiao, L., Liu, Y., Zhang, X., Liu, B., Zhang, C., Liu, X., 2017. Site-saturation mutagenesis library construction and screening for specific broad-spectrum single-domain antibodies against multiple Cry1 toxins. Appl. Microbiol. Biotechnol. 101, 6071–6082. Lai, C.L., Srivastava, A., Pilling, C., Chase, A.R., Falke, J.J., Voth, G.A., 2013. Molecular mechanism of membrane binding of the GRP1 PH domain. J. Mol. Biol. 425, 3073–3090. Liu, L., Xing, C., Yan, H., Kuang, H., Xu, C., 2014. Development of an ELISA and immunochromatographic strip for highly sensitive detection of microcystin-LR. Sensors 14, 14672–14685. Liu, X., Tang, Z., Duan, Z., He, Z., Shu, M., Wang, X., Gee, S.J., Hammock, B.D., Xu, Y., 2017. Nanobody-based enzyme immunoassay for ochratoxin A in cereal with high resistance to matrix interference. Talanta 164, 154–158. McElhiney, J., Lawton, L.A., 2005. Detection of the cyanobacterial hepatotoxins microcystins. Toxicol. Appl. Pharmacol. 203, 219–230. Mercader, J.V., Celia, S.P., Agulló, C., Antonio, A.S., Antonio, A.F., 2008. Hapten synthesis and monoclonal antibody-based immunoassay development for detection of the fungicide trifloxystrobin. J. Agric. Food Chem. 56, 2581–2588. Moreira, C., Ramos, V., Azevedo, J., Vasconcelos, V., 2014. Methods to detect cyanobacteria and their toxins in the environment. Appl. Microbiol. Biotechnol. 98, 8073–8082. Murphy, C., Stack, E., Krivelo, S., McPartlin, D.A., Byrne, B., Greef, C., Lochhead, M.J., Husar, G., Devlin, S., Elliott, C.T., O'Kennedy, R.J., 2015. Detection of the cyanobacterial toxin, microcystin-LR, using a novel recombinant antibody-based opticalplanar waveguide platform. Biosens. Bioelectron. 67, 708–714. Muyldermans, S., 2013. Nanobodies: natural single-domain antibodies. Annu. Rev. Biochem. 82, 775–797. Pande, J., Szewczyk, M.M., Grover, A.K., 2010. Phage display: concept, innovations, applications and future. Biotechnol. Adv. 28, 849–858. Papaneophytou, C.P., Kontopidis, G., 2014. Statistical approaches to maximize recombinant protein expression in Escherichia coli: a general review. Protein Expr. Purif. 94, 22–32.
227
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application
T
⁎
Chongxin Xua,b, Ying Yanga, Liwen Liua, Jianhong Lia, , Xiaoqin Liuc, Xiao Zhangb, Yuan Liub, ⁎⁎ Cunzheng Zhangb, Xianjin Liub, a
College of Life Sciences, Nanjing Normal University, Nanjing 210023, China Key Laboratory of Food Quality and Safety of Jiangsu/Province-State Key Laboratory Breeding Base, Institute of Food Safety and Nutrition, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China c Huaihua Vocational and Technical College, Huaihua 418007, China b
A R T I C L E I N F O
A B S T R A C T
Keywords: Microcystin-LR Phage display antibody library Nanobody Protein expression ELISA
Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15 kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC50) were 0.87, 1.17 and 1.47 μg/L, their detection limits (IC10) were 0.06, 0.08 and 0.12 μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7–116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0–106.5%, coefficient of variations (CVs) were 3.4–10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple MCs.
1. Introduction Microcystins (MCs) belong to a type of short cyclic peptides of biotoxins which produced by multiple genera of cyanobacteria, such as Microcystis aeruginosa, Anabaena flosaquae, Oscillatoria agardhii and Aphanizomenon flosaquae etc. (Rastogi et al., 2014). The hazards of MCs are injury to liver, kidney, adrenal gland and stomach, disturbing nervous systems and inducing cancer (Chen et al., 2016; Svirčev et al., 2017). Algal blooms erupt more and more frequently, they cause MCs accumulation, and threaten water resources, soil environment, agricultural products and food safety in world-wide (Brooks et al., 2016; Chen et al., 2013; Hou et al., 2017; Wells et al., 2015). So far, more than
⁎
90 MC isoforms have been isolated and identified, and the most common isoforms were MC-LR, MC-RR, MC-YR, MC-WR, MC-LW, MCLY, MC-LF, MC-WF, MC-LA and MC-YF (Pearson et al., 2010). Among them, MC-LR was the most common isoform in waterbodies with algal blooms, also it had the strongest toxicity to human and animals, and its minimum residue limit (MRL) was 1.0 μg/L in water destined for human drinking water by World Health Organization (WHO) (Esterhuizen-Londt et al., 2017; McElhiney and Lawton, 2005). Until now, the reported methods of MC-LR determination include liquid chromatography-mass spectrometry (LC-MS), gas chromatography-mass spectrometry (GC-MS), enzyme-linked immunosorbent assay (ELISA), phosphatase inhibition and animal experiment (Moreira
Corresponding author. Correspondence to: Institute of Food Safety and Nutrition, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China. E-mail addresses: [email protected] (J. Li), [email protected] (X. Liu).
⁎⁎
https://doi.org/10.1016/j.ecoenv.2018.01.003 Received 3 December 2017; Received in revised form 28 December 2017; Accepted 3 January 2018 0147-6513/ © 2018 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
purchased from ComWin Biotech Co.,Ltd (Beijing, China). NcoI and NotI restriction endonucleases and T4 DNA ligase were obtained from New England Biolabs, Inc. (Beijing, China). N,N-dimethylformamide (DMF), N-hydroxysuccinimide (NHS), 1-ethyl-3-[3-dimethylaminopropyl]-carbodimide (EDC), keyhole limpet haemocyanin (KLH), bovine serum albumin (BSA), Difco™ skim milk, Tween 20, trypsin and 3,3,5,5-tetramethylbenzidine (TMB) were purchased from Sigma-Aldrich (Beijing, China). Cell culture flask and 96-well plates were purchased from Corning (Beijing, China). Other reagents and materials were all purchased from GE Healthcare (Beijing, China).
et al., 2014). The ELISA based on antibody for MC-LR was the most popular detecting method, because of its high sensitivity, simple operation, quick reaction and low cost (Heussner et al., 2014; Liu et al., 2014). In this detecting method, how to rapidly obtain the high activity of anti-MC-LR antibody was a critical step. Although the technologies were very mature to obtain the traditional polyclonal antibody and monoclonal antibody, they could not avoid the defects of laborious antigen and adjuvant emulsifying, time-consuming immune cycles and limited antibody products from immune animals (Wang et al., 2012). Therefore, it is necessary to explore a new technology for obtaining the antigen specific antibody more simply and quickly. In recent years, phage display antibody library has become a popular technology to rapidly obtain antigen specific antibody with high activity by high throughput biopanning (Zhao et al., 2016a). This technology randomly clones a lot of artificial antibody genes into a phagemid vector, then infects it to Escherichia coli (E.coli), and the antibodies are expressed on the surface of phage capsid proteins by coexpression (Qi et al., 2012; Smith, 1985). The antigen specific antibodies and their genes could be obtained by multiple rounds of library enrichment and screening, thus the antibody genes could be cloned into different expression vectors conveniently, even further for affinity maturation (Jiao et al., 2017; Pande et al., 2010; Vodnik et al., 2011; Xu et al., 2016). The reported types of antibody from the phage display antibody library were single chain variable fragment (scFv), domain antibody (DAb) and short chain peptides antibody (such as dodecapeptide and heptapeptide) (Pande et al., 2010; Vodnik et al., 2011). Zhang et al. (2012) obtained an anti-Cry1B toxin scFv from a human synthetic phage display library (Tomlinson J), and its IC50 was 0.84 μg/ mL and the linear range of detection (IC20-IC80) were 0.19–1.1 μg/mL. Zhao et al. (2016b) obtained five broad-specificity phage domain antibodies for pyrethroid, and they were all capable of detecting cypermethrin, β-cypermethrin, fenvalerate and phenoxybenzoic acid simultaneously. In natural world, some antibodies from camel, alpacas, llamas and shark are lack light chain naturally and only contain one heavy chain variable region (VHH) called nanobody (Muyldermans, 2013). Nanobody has a characteristic of low immunogenicity, strong stability, good solubility, strong penetrability and easy expression, it has been widely used in biomedicine and immunoassay field (Chakravarty et al., 2014; Liu et al., 2017; Muyldermans, 2013; Qiu et al., 2015). In this study, based on the superiorities of nanobody, we employed a large diversity and capacity of naive alpaca phage display nanobody library for screening high activity MC-LR nanobodies by biopanning, then the positive MC-LR nanobody proteins were expressed in E.coli BL21 by gene clone, later they were used to establish the IC-ELISA for MC-LR. Finally, we have made an assessment for the IC-ELISAs with accuracy, stability and repeatability based on nanobodies for detecting MC-LR by spiked tap water samples.
Conjugating of MC-LR to KLH and BSA were performed as described by Yu et al. (2002) with some optimization. Briefly, 1 mg MC-LR toxin standards dissolved in 0.2 mL DMF, drop by drop added to 0.6 mL DMF (containing 1.5 mg EDC and 1.5 mg NHS) with gently shaking (25 rpm) for 40 min at room temperature (RT), then for overnight at 4 °C. The next day, added the mixture into the KLH or BSA solution [6 mg KLH or BSA dissolved in 6 mL 0.1 M sodium carbonate buffer (CBS, pH=9.6)] with gently shaking (25 rpm) at RT for 4 h in dark. After that, centrifuged for 25 min at 8000 rpm and 4 °C by Amicon Ultra-4-Ultracel-3K (Millipore, USA), the supernatant pellet were resuspended by 6 mL 0.1 M sodium phosphate buffer (PBS, pH = 7.4) and centrifuged for 30 min at 8000 rpm and 4 °C, the ultrafiltration steps were repeated three times. Finally, the ultrafiltrates quantified to 6 mL by 0.1 M PBS buffer and the concentration of conjugates MC-LR-KLH or MC-LR-BSA will be determined for 1 mg/mL. The effect of conjugates MC-LR-KLH and MC-LR-BSA were analyzed by ultraviolet full wavelength scanner (Agilent, USA) and ELISA based on MC-LR monoclonal antibody (Sheng et al., 2007). For ELISA test, MC-LR-KLH and MC-LR-BSA were diluted with PBS buffer for 0.01, 0.05, 0.1, 0.2, 0.5, 1.0, 2.0 and 4.0 μg/mL respectively, and coated with them 100 μL/well in 96-well plate to stand overnight at 4 °C. The negative controls were KLH and BSA, respectively. The next day, after being washed for three times with 300 μL/well of PBST solution (PBS with 0.1% Tween 20) and blocked by 300 μL/well of MPBS solution (PBS with 5% Difco™ skim milk) at 37 °C for 2 h. After being washed with PBST solution, and then MC-LR monoclonal antibody (1: 2000 diluted with CBS buffer) were added into the wells at 100 μL/well of for incubating 2 h at 37 °C. After being washed with PBST solution, 100 μL/ well of goat anti-mouse IgG monoclonal antibody [HRP] (1:3000 dilution) were added for incubating 2 h at 37 °C. After being washed with PBST solution, added 100 μL/well of TMB solution, the color development were performed at RT for 20 min and stopped by 50 μL/well of 2 M sulfuric acid, the OD450 values were measured by an automatic microplate reader (Berthold, Germany). All tests were repeated three times and the given data were the mean value.
2. Materials and methods
2.3. Amplification of alpaca phage display antibody library
2.1. Phage antibody library, bacterial strains, reagents and materials
Amplification of alpaca phage display antibody library were performed as described by Pírez-Schirmer et al. (2017). Total 100 μL library phage particles (1012 CFU/mL) were added into 10 mL E.coli TG1 (logarithmic phase) in 2×TY medium [16 g tryptone, 10 g yeast extract and 5 g NaCl in 1 L double distilled water (ddH2O)], culturing for 1 h at 37 °C and 250 rpm, then 3300g centrifuging for 15 min at 37 °C. The cell pellets were resuspended by 10 mL 2×TY-AG liquid medium (with 100 μg/mL Amp and 1% glucose) and cultured with shaking 250 rpm at 37 °C for 2 h until cells density reached 0.6 at OD600, then KM13K07 helper phages (1012 CFU) were added and rescued for 1 h at 30 °C and 250 rpm. The cultures were centrifuged for 30 min at 1800g and 30 °C, and the cell pellets were resuspended by 500 mL 2×TY-AK medium (with 100 μg/mL Amp and 50 μg/mL Kana) for culturing overnight at 30 °C and 250 rpm. The next day, after the culture centrifuged for 15 min at 10,800g and 4 °C, a 500 mL supernatant was obtained, and
2.2. Preparation and analyzation of MC-LR-KLH and MC-LR-BSA
Alpaca phage display nanobody library [constructed in pComb3XSS phagemid vector (ampicillin resistance, Ampr), the capacity of the library is 2 × 109], E.coli TG1, KM13K07 helper phage (kanamycin resistance, Kanar) were obtained from Uppark Biotechnology Co. Ltd (Chengdu, China). pET26b vector (Kanar) and E.coli BL21 were purchased from Novagen (Germany). Microcystins (MC-LR, MC-RR, MCYR, MC-WR, MC-LW, MC-LY and MC-LF) were purchased from ApexBio Company (USA). Anti-M13 monoclonal antibody [HRP], goat antimouse IgG monoclonal antibody [HRP] and anti-HIS tag monoclonal antibody [HRP] were purchased from GenScript Bio. Co.Ltd (Nanjing, China). MC-LR monoclonal antibody [immunogen was MC-LR-ovalbumin (MC-LR-OVA)] was obtained from Enzo Biochem, Inc. (USA). 2×Tap PCR Master Mix, DNA maker and protein maker were 221
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
then 125 mL PEG/NaCl [containing 20% polyethylene-glycol (PEG) and 2.5 M NaCl] were mixed with the supernatant. The mixtures were kept on ice for 3 h and centrifuged for 30 min at 3300g and 4 °C. Precipitates were resuspend in 5 mL PBS buffer and centrifuged for 10 min at 11,600g and 4 °C to remove the residual cell debris. Final supernatant was the amplification of the library and the concentration of phage particles were adjusted to 1012 CFU/mL which used in next experiment.
solution, adding 100 μL/well of anti-M13 monoclonal antibody [HRP] (1:3000 dilution) incubating for 2 h at 37 °C, and adding TMB solution when after being washed, then measuring the OD450 values. The monoclonal phage nanobody with OD450 ratio of P/N > 3.0, was considered as a positive one which bound with MC-LR (Wang et al., 2012). P/N=positive (coated MC-LR-BSA)/negative (coated BSA). All tests were repeated three times and the given data were the mean value.
2.4. Enrichment and evaluation of library phage particles binding to MC-LR
2.6. Colony PCR, DNA sequencing and analysis
Enriching of MC-LR-specific phage particles was performed as described by Xu et al. (2016), and the enrichment was performed four rounds in this study. In brief, 3 mL MC-LR-KLH solution (the first round was 100 μg/mL, and the remaining three rounds were 80, 60, 20 μg/mL in PBS buffer respectively) were coated in a sterile cell culture flask (25 cm2) for standing overnight at 4 °C. The next day, after being washed four times with 5 mL sterile PBST solution and blocked by 6 mL MPBS solution for 2 h at 37 °C, after being washed with sterile PBST solution, then added 1.5 mL phage particles of the library amplification were mixed with 3.5 mL MPBS solution. The flask was shaken for 1 h at 125 rpm and RT, then standing at RT for 1 h. After being washed ten times with 3 mL sterile PBST solution, the binding phage particles (nanobodies) were eluted by 1.5 mL trypsin solution (PBS with 1 mg/ mL trypsin). The phage particles in the solution were the first round enrichment of phage particles binding to MC-LR, and collected for the next round of enrichment. Effect of each enrichment round of MC-LR-specific phage particles were evaluated by calculate the output/input and polyclonal phages ELISA (Zhang et al., 2012). In brief, each round of input library phage particles were quantified to 1012 CFU/mL, and taking 50 μL eluents from each round to infect 450 μL E.coli TG1, respectively, then spread on 2×TY-AG agar plates (with 1.5% agar) for calculating single colonies, which was the output of each round of enrichment. Polyclonal phage ELISA test was performed as follow, 100 μL/well of 1.0 μg/mL MC-LR-BSA(BSA, negative control) were coated in 96-well plate to stand overnight at 4 °C, after “washed-blocked-washed” process as described above, 100 μL/well eluents of each round were added in the 96well plate for incubating 2 h at 37 °C. After being washed with PBST solution, adding 100 μL/well of anti-M13 monoclonal antibody [HRP] (1:3000 dilution) for incubating 2 h at 37 °C, and added TMB solution after being washed with PBST solution, then measuring the OD450 values of each round enrichment MC-LR-specific phage particles. All tests were repeated three times and the given data were the mean value.
The obtained positive monoclonal phage nanobodies genes were identified by colony PCR and DNA sequencing. In brief, total 20 μL PCR reaction system, containing 10 μL 2×Tap PCR Master Mix, 1 μL positive monoclonal phage particles cultures in E. coli TG1, 1 μL upstream primers (OmpA-F: AAGACAGCTATCGCGATTGCAG) and downstream primers (OmpA-B: TCAGAGCCACCACCCTCCTAA) were all dissolved in ddH2O with a concentration in a micromolar range, and 7 μL ddH2O. The reaction conditions of PCR were 95 °C for 10 min, then 95 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min for total 35 cycles, and final extension for 10 min at 72 °C. The PCR products were analyzed by 1% agarose gel electrophoresis (180 V, 20 min), and sequenced by Sangon Bio Co. Ltd. (Shanghai, China). Gene Construction Kit (GCK) and Vector NTI Advance softwares were used for translating the nucleotide sequences of anti-MC-LR nanobodies into amino acid sequences and alignment of its protein sequence, respectively. 2.7. Gene cloning, soluble expression and purification of nanobodies In order to obtain the purified soluble proteins of MC-LR nanobodies for determination of MC-LR, the genes of nanobodies were cloned between NotI and NcoI sites of pET26b vector, respectively, then the proteins were expressed in E.coli BL21 and purified by His-Trap (HP) affinity chromatography. In brief, the PCR products (primers were OmpA-F-Not I: ATAAGAATGCGGCCGCAAGACAGCTATCGCGATTG CAG and OmpA-B-NcoI: CATGCCATGTCAGAGCCACCACCCTCCTAA, and the reaction conditions were as described above) of MC-LR nanobody genes were purified by GenElute™ PCR Clean-Up Kit as the operation manual, then digested with Not I and NcoI for overnight at 37 °C, and ligated into pET26b vectors by T4 DNA ligases for overnight at 16 °C, which the vectors had been digested with the same restriction endonucleases and reaction conditions. The next day, the ligated products were used to transform the E. coli BL21 competent cells for thermal shocking for 90 s at 42 °C, then culturing for 40 min at 37 °C and 250 rpm. The bacteria liquids will be spread on agar plates of LB-K medium (10 g tryptone, 5 g yeast extract and 10 g NaCl in 1 L ddH2O, and containing 1.5% agar powder and 50 μg/mL Kana) for culturing overnight at 37 °C. Randomly picking individual colonies cultured in LB-K liquid medium until to logarithmic phase at 37 °C and 250 rpm, then identified by colony PCR and DNA sequencing (primers were T7-F: TAATACGACTCACTATAGGG and T7-B: GCTAGTTATTGCTCAGCGG) as described above. To express the nanobodies, 50 μL positive individual colony bacteria liquid incubated into 250 mL LB-K liquid medium culturing for 2–3 h at 30 °C and 250 rpm until the OD600 was 0.6, then 0.8 mM isopropyl β-Dthiogalactoside (IPTG) was added into the bacteria liquid and grown overnight at 28 °C and 250 rpm. After centrifuged for 30 min at 3300g and 4 °C, the cell pellets were resuspended with 25 mL PBS buffer and lysed by sonication on ice at 300 W, working 3 s and intermittent 2.5 s for 40 min. The purified MC-LR nanobody proteins were obtained from the supernatant after being centrifuged for 30 min at 10,000g and 4 °C by using His-Trap (HP) affinity chromatography performed as described in the operation manual. The effect of purified nanobodies were analyzed by 12% SDS-PAGE with rapid silver staining. In brief, 15 μL/well of protein mixture (containing 12 μL eluent from His-Trap (HP) affinity chromatography and 3 μL of 4×protein denaturing loading buffer) were boiled for 5 min and loaded into the 12% SDS-PAGE
2.5. Screening and identification of MC-LR phage display nanobodies According to the results of polyclonal phages ELISA, the fourth round enrichment of phage particles were employed for randomly picking MC-LR phage nanobodies. The E.coli TG1 infected with the phage was spread on 2×TY-AG agar plates cultured at 37 °C overnight, individual colonies appearing on the plate were inoculated into wells of 96-well with 100 μL/well of 2×TY-AG liquid medium for growing overnight at 37 °C. The next day, the culture was transferred at 2 μL/ well to another 96-well plate with 200 μL/well of 2×TY-AG liquid medium, which was cultured at 37°C and 250 rpm for 3 h, then KM13K07 helper phages were added into them and rescued for 1 h at 30 °C and 250 rpm. The plates were centrifuged for 30 min at 3300g and 30 °C, and added 200 μL/well of 2×TY-AK liquid medium to resuspend the pellets for culturing overnight at 30 °C and 250 rpm. After being centrifuged for 30 min at 3300g and 30 °C, the activity of phage particles (nanobodies) binding with MC-LR in supernatant was identified by monoclonal phage ELISA. In brief, taking 100 μL/well of supernatants added in 96-well plates which coated with MC-LR-BSA and following “washed-blocked-washed” process as described above, the remaining 100 μL liquid in each well were added in 96-well plates that coated with BSA as negative control. After being washed with PBST 222
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
Fig. 1. (A): The absorption spectra conjugation of MC-LR to KLH (A1) and BSA (A2). MC-LR-KLH and MC-LR-BSA displayed an absorption peak near 260 nm and 265 nm between 240 nm of MC-LR and 280 nm of KLH/BSA. B: The ELISA values of preparation of MC-LR-KLH (B1) and MC-LR-BSA (B2) analyzed by MC-LR monoclonal antibody and the OD450 values were the means ± SDs from triplicate measurements.
MC-LR-BSA solution were coated in 96-well plate to stand overnight at 4 °C. After “washed-blocked-washed” process as described above, the wells were added with a 100 μL mixture per well of different MC-LR and purified MC-LR nanobodies incubating for 2 h at 37 °C, and the concentrations of MC-LR were 0.01, 0.05, 0.1, 0.5, 1.0, 2.0, 5.0, 10 and 100 μg/L. After being washed, adding 100 μL/well of anti-His monoclonal antibody [HRP] (1:3000 dilution) incubating for 2 h at 37 °C, then adding TMB solution after being washed, and measuring the OD450 values. The inhibition ratio of purified MC-LR nanobodies were calculated by the formula of [(P-S-N)]/(P-N)]×100%, and containing the IC10, IC20, IC50 and IC80 key indicator data of antibody activity. “P” was the OD450 value of the positive (50 μL purified MC-LR nanobodies + 50 μL CBS buffer), “S” was the OD450 value of the standard (50 μL purified MC-LR nanobodies + 50 μL serial concentration of MC-LR), “N” was the OD450 value of the negative (100 μL CBS buffer). The CRs of MC-LR analogues, MC-RR, MC-YR, MC-WR, MC-LW, MC-LY and MC-LF, were calculated as the formula of [CR (%)=IC50 (MC-LR)/IC50 (analogues)] × 100%, according to the IC-ELISA performed as described above, respectively. All tests were repeated three times and the given data were the mean value.
electrophoresis running for 110 min at 120 V. The gel was soaked in 50 mL of 40% methanol fixing solution (containing 30 μL of 37% formaldehyde) shaking for 10 min at RT and 25 rpm, and then washed two times with 50 mL ddH2O shaking for 5 min at RT and 25 rpm. Taking out the gel and soaking in 50 mL 0.2 g/L of sodium thiosulfate solution shaking for 1 min at RT and 25 rpm, then rapidly washed two times with 50 mL ddH2O shaking for 20 s at RT and 25 rpm. After being soaked in 50 mL 0.1% of silver nitrate solution shaking for 10 min at RT and 25 rpm, the gel was rapidly washed by 50 mL 3% sodium carbonate developing solution (containing 1 mL 0.2 g/L of sodium thiosulfate solution). The gel was soaked in 50 mL 3% sodium carbonate developing solution (containing 1 mL 0.2 g/L of sodium thiosulfate solution and 30 μL 37% formaldehyde) until the protein band displayed clearly, adding 5 mL 2.5 M of sodium citrate stop solution shaking for 10 min at RT and 25 rpm. Final, taking a photograph by gel imaging system (BioRad, USA).
2.8. IC-ELISA for MC-LR and its analogues based on nanobodies The method of IC-ELISA development was performed as described by Xu et al. (2017b) and Zhang et al. (2016). 100 μL/well of 1.5 μg/mL 223
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
2.9. Assessment of IC-ELISA for MC-LR by spiked water sample Tap water samples from the key laboratory of food quality and safety of Jiangsu/province-state key laboratory breeding base in Jiangsu Academy of Agricultural Sciences (Nanjing, China) were filtered through with a 0.45 µm of nitrocellulose membrane, and spiked serial concentration of MC-LR for assessment of the IC-ELISA. In brief, integration of the working ranges of detection (IC20-IC80) for MC-LR from the three IC-ELISA standard curves based on ANAb7, ANAb9 and ANAb12 MC-LR nanobodies respectively, 1 mL tap water samples were spiked with MC-LR standard at 0, 0.5, 1.0 and 4.0 μg/L concentration levels and detected directly. In the present study, the values of mean recoveries, SDs and CVs were calculated according to the corresponding IC-ELISA standard curve. Intra-assay variations were detected in triplicate for each of spiked level on the same day, and the inter-assay variations were detected in triplicate for each of spiked level in three days. All tests were repeated three times and the given data were the mean value.
Fig. 2. Polyclonal phage ELISA of MC-LR phage nanobodies from each round of biopanning, the coated antigen was MC-LR-BSA and the negative controls was BSA. The OD450 values were the means ± SDs from triplicate measurements.
nanobodies. In this study, we got available products by four rounds of library enrichment for high throughput screening MC-LR phage nanobodies.
3. Results and discussion 3.1. Conjugation of MC-LR-KLH and MC-LR-BSA
3.3. Screening and identification of MC-LR phage display nanobodies
MC-LR is a hapten, and its molecular weight (M.W.) is 994 Da. It has to be coupled with a macromolecular carrier protein to form a “haptencarrier” conjugate for immunogenicity (Mercader et al., 2008). KLH, BSA and OVA were the most common carrier proteins for preparation of “hapten-carrier” conjugates in small molecule immunological detection (Song et al., 2010). In this study, we used KLH and BSA to conjugate MC-LR, respectively. Fig. 1(A) showed the absorption spectra of the conjugates of MC-LR-KLH and MC-LR-BSA. The two hapten-carriers had an obvious offset in maximum absorption wavelength, compared with MC-LR, KLH or BSA, respectively. The maximum absorption of MC-LRKLH was at 260 nm which was between the absorption of MC-LR (238 nm) and KLH (280 nm) (Fig. 1(A1)), and the absorption of MC-LRBSA was at 265 nm, also between MC-LR (238 nm) and BSA (280 nm) (Fig. 1(A2)). The spectra indicated that the MC-LR was successfully coupled with KLH and BSA, respectively. Fig. 1(B) showed the ELISA tests of MC-LR-KLH (Fig. 1(B1)) and MC-LR-BSA (Fig. 1(B2)) with a MCLR monoclonal antibody descended from MC-LR-OVA antigen that could be specific combined to MC-LR without the carrier proteins KLH and BSA. Concentration gradients of MC-LR-KLH and MC-LR-BSA were recognized and the limited concentration were 0.05 and 0.01 μg/mL (P/N criteria > 3.0), respectively. Therefore, according to the spectra and ELISA test results, the MC-LR was successfully conjugated with KLH or BSA, and both of the hapten-carriers were qualified for the subsequent experiments.
As showed in Fig. 3(A), 20 positive monoclonal phage nanobodies (ANAb1 to ANAb20) were selected from the fourth enrichment round from the library, their monoclonal phage ELISA tests displayed the ratios of P/N were all > 3.0. The most positive monoclonal (ANAb12) had a P(1.472)/N(0.136) ratio of higher than 10.0 and the lowest positive (ANAb19) had a P(0.496)/N(0.122) ration of 4.07. All positive nanobodies displayed a 430 bp DNA fragment by colony PCR (Fig. 3(B)). The nine most positives, ANAb1, ANAb5, ANAb7, ANAb9, ANAb11, ANAb12, ANAb14, ANAb16 and ANAb17 were checked by DNA sequencing to confirm their bearing the nobody genes from alpaca. The results of sequencing showed the amino acid sequences of the nanobodies had the same immunoglobulin frameworks from FR1 to FR4, but more or less different in the complementarity determining regions from CDR1 to CDR3 (Fig. 3(C)). Associating the differences of activity with the nanobodies binding to MC-LR with monoclonal phage ELISA, we supposed the CDRs were the key parts of nanobodies binding to MC-LR. However, the activity rules and mechanisms of those nanobodies binging to MC-LR remained to be further researched and confirmed. The reported methods could be used for analyzing the activity rules and mechanisms of antibody to antigen were protein structural analysis, molecular docking and hot amino acid prediction (Barderas et al., 2008; Bonsor et al., 2011; Lai et al., 2013). 3.4. Gene cloning, expression and purification of nanobodies
3.2. Enrichment of library phage particles binding to MC-LR In order to analyze the activity characteristics and their further application of the obtained MC-LR nanobodies, we cloned the nanobody genes of the three most positive nanobodies, ANAb12, ANAb9 and ANAb7 into pET26b(+) vector respectively and then expressed them in E.coli BL21. The expressed proteins were recovered by affinity chromatography. Fig. 4(A) showed that all recombinant plasmids of pET26b-ANAb12, ANAb9 and ANAb7 nanobody genes released an approximate 400 bp fragment after digested by NcoI and NotI restriction endonucleases. The results of colony PCR (Fig. 3(B), lane 12, 9 and 7) and DNA sequencing (Fig. 3(C), ANAb12, ANAb9 and ANAb7) confirmed the three MC-LR nanobody genes had been exactly inserted into pET26b(+) vector and could be used for antibodies expression. The purified MC-LR nanobodies of ANAb12, ANAb9 and ANAb7 were showed in Fig. 4(B), and they were eluted from His-Trap (HP) affinity chromatography with 400 mM imidazole solution with the concentration of 98.56, 126.63 and 107.46 μg/mL, respectively. Being switched to the original culture systems (250 mL), the concentration of ANAb12,
It was an effective means to rapidly obtain antigen-specific phage particles from the library by enrichment of biopanning with gradient decrease of the coated antigen concentration. The antigen-specific phage particles were captured, while those uncombined or weakly combined were washed out progressively (Xu et al., 2017a). As showed in Fig. 2, after four rounds of biopanning, the phage particles binding to MC-LR were effectively enriched, and at the fourth round, the binding phage particles increased approximately 4500-fold (input and output data not shown) and the ELISA values increased approximately 3.5-fold than the first round. It should be mentioned that the coated antigen for biopanning was MC-LR-KLH, and the coated antigen for polyclonal phage ELISA was MC-LR-BSA and the negative control was BSA, the alternation of antigens could effectively avoid the artifact caused by the phage particles binding KLH and BSA carrier protein. Sufficient enrichment of MC-LR-specific phage particles from the library was a key to rapidly and successfully obtain high activity MC-LR phage 224
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
Fig. 3. (A): Monoclonal phage ELISA of obtained positive MC-LR phage nanobody culture supernatants, which the phage particles were quantified to 1012 CFU/mL and the coated antigen was MC-LR-BSA and the negative controls was BSA. The given OD450 values were the means from triplicate measurements. (B): PCR amplified products of obtained positive MC-LR phage nanobody genes from colony PCR of ANAb1-20. Lane M: DNA marker. Lane CK: Without template. Lanes 1–20: Correspond to the ANAb1-20, respectively. (C): Amino acid sequences of obtained positive MC-LR phage nanobody genes, the immunoglobulin frameworks (FR1-4) and the complementarity determining regions (CDR1-3) were determined according to NCBI database.
expressed MC-LR nanobodies, IC-ELISAs were established based on the purified antibody proteins for measuring MC-LR and analogues. ICELISA standard curves of ANAb12, ANAb9 and ANAb7 nanobodies for MC-LR were showed in Fig. 5, the IC50 were 0.87, 1.17 and 1.47 μg/L, the IC10 were 0.06, 0.08 and 0.12 μg/L, and IC20-IC80 were 0.17–4.8, 0.25–7.5 and 0.48–9.39 μg/L, respectively. Their IC50 and IC10 values for MC-LR were not compared with the report by Pirez-Schirmer et al. (2017), its IC50 was 0.28 μg/L and the IC10 was 0.05 μg/L, which the nanobody obtained from a MC-LR-OVA immunized llama phage display nanobody library. However, their IC10 values were better than the MCLR scFvs reported by Zhang et al. (2016) and Murphy et al. (2015), and they were 0.13 and 0.19 μg/L respectively. The sensitivities of all the purified MC-LR nanobodies (ANAb12, ANAb9 and ANAb7) met the detection requirements that the MRL was 1.0 μg/L in drink water by WHO. The CRs of MC-LR nanobodies against MC-LR analogues were
ANAb9 and ANAb7 nanobody proteins were 0.99, 1.27 and 1.07 mg/L respectively. The expression levels of antibody proteins in E.coli BL21 had a big gap compared with Qiu et al. (2015) who reported the deoxynivalenol-mimic nanobodies expressed in E.coli Rosetta by pET25b(+) vector and the concentrations were ranged from 30 to 40 mg/L. Therefore, in order to effectively produce lots of MC-LR nanobody proteins for subsequent application, it is necessary to further optimize the expression conditions, for example, culturing temperature and time, adding IPTG concentration and shaking speed of incubator, even changing the expression vectors, host bacteria, and more efficient affinity chromatography (Papaneophytou and Kontopidis, 2014).
3.5. IC-ELISA for MC-LR and its analogues based on nanobodies In order to evaluate activities and antigen-specificities of the 225
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
Table 1 The CRs of MC-LR nanobodies in IC-ELISA with MC-LR analogues (the given values were the means from triplicate measurements). Names of nanobodies
ANAb12
ANAb9
Fig. 4. (A): Double digestions for recombinant plasmid of pET26b-ANAb12, ANAb9 and ANAb7 nanobody genes by NcoI and NotI restriction endonucleases. Lane M: DNA marker. Lane CK: pET26b (+) vector. Lane 1–3: pET26b-ANAb12, pET26b-ANAb9 and pET26bANAb7 recombinant plasmids. (B): SDS-PAGE of MC-LR nanobody proteins were expressed in E.coli BL21. Lane M: Protein marker. Lane 1–3: The purification of MC-LR nanobody proteins of ANAb12, ANAb9 and ANAb7, respectively, which purified by HisTrap (HP) affinity chromatography and eluted with 400 mM imidazole solution.
ANAb7
MC-LR analogues Competitors
M.W. (Da)
MC-LR MC-RR MC-YR MC-WR MC-LW MC-LY MC-LF MC-LR MC-RR MC-YR MC-WR MC-LW MC-LY MC-LF MC-LR MC-RR MC-YR MC-WR MC-LW MC-LY MC-LF
994 1037 1044 1068 1024 1001 985 994 1037 1044 1068 1024 1001 985 994 1037 1044 1068 1024 1001 985
IC50 (μg/L)
CRs (%)
0.87 0.74 0.94 0.99 19.1 969.5 – 1.17 1.09 1.39 1.29 539.2 1223.6 2048.5 1.47 1.29 1.53 1.78 1602.6 – –
100 116.9 92.5 88.1 4.56 < 0.1 – 100 107.3 84.2 90.6 2.17 < 0.1 < 0.1 100 113.6 95.9 82.7 < 0.1 – –
nanobodies (ANAb12, ANAb9 and ANAb7), respectively. The results were listed in Table 2. The recoveries of MC-LR concentration were 84.0–101.5% and the CVs were 3.8–9.0% in intra and inter-assays for ANAb12, the recoveries were 84.1–97.6% and the CVs were 3.4–10.6% for ANAb9, and the recoveries were 88.0–106.5% and the CVs were 6.5–9.3% for ANAb7, respectively. On the whole, the three nanobodies, ANAb12, ANAb9 and ANAb7 had recoveries of 84.0–106.5% and the CVs of 3.4–10.6% for the spiked samples. All the results indicated that the IC-ELISAs established on the purified nanobodies from the alpaca phage display antibody library had a good accuracy, stability and practicality for detection of MC-LR. In the follow-up study, we will expand detection of MC-LR analogues (MC-RR, MC-YR and MC-WR) and different spiked samples such as soil and agricultural product samples to full evaluate and excavate the application value of the obtained MC-LR nanobodies for further development of the MCs rapid detection kits.
Fig. 5. The standard curves of IC-ELISA for MC-LR based on purified nanobodies (ANAb12, ANAb9 and ANAb7) and the inhibition ratio values (%) were the means ± SDs from triplicate measurements.
4. Conclusions showed in Table 1, all three MC-LR nanobodies showed strong CRs of 82.7–116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. These data indicated the nanobodies were broad specific for simultaneous detection of four MC isoforms, MC-LR, MC-RR, MC-YR and MC-WR. Generally, it was considered difficult to obtain an ultrasensitive antigen specific phage antibody from the naive phage display library without immunization (Sheedy et al., 2007). In order to improve the sensitivity and affinity of phage antibody to antigen, it was a practicable method to label fluorophore (such as Eu3+) or affinity mature to the obtained antibody (Steidl et al., 2008; Xu et al., 2017a). These methods could be used to promote the value of MC-LR nanobodies application for detecting MCs.
In the present study, we found that it was an effective method to rapidly obtained the high activity MC-LR phage nanobody from the naive alpaca phage display antibody library by rounds of biopanning, and the MC-LR coupled to KLH and BSA were used for coated antigen of enrichment and screening, respectively. The three most positive of MCLR nanobodies (ANAb12, ANAb9 and ANAb7) could be used for determination of MC-LR spiked in tap water sample by the corresponding of established IC-ELISA successfully, which expressed in E.coli BL21 with pET26b vector. At the same time, the three MC-LR nanobodies had a strong ability of broad-specificity for simultaneous detection of MCRR, MC-YR and MC-WR that hopefully provided a high activity antibody material for analyzing the MCs residues in environment and agricultural product samples.
3.6. Assessment of IC-ELISA for MC-LR by spiked water sample Acknowledgments The spiked sample test was an effective method to evaluate the accuracy, stability and practicality of a new detection method. In this study, the MC-LR was spiked in tap water samples at concentrations of 0.5, 1.0 and 4.0 μg/L according to the IC20-IC80 showed in Fig. 5, and the samples were measured by IC-ELISAs based on the purified
This study was supported by the National Natural Science Foundation of China (31370217, 31701724 and 31630061), and the Social Development Projects of Jiangsu Province in China (BE2017706). 226
Ecotoxicology and Environmental Safety 151 (2018) 220–227
C. Xu et al.
Table 2 The IC-ELISAs based on MC-LR nanobodies for MC-LR in spiked tap water samples (the given values were the means ± SDs from triplicate measurements). Name of nanobodies
ANAb12
ANAb9
ANAb7
Spiked concentrations (μg/L)
0 0.5 1.0 4.0 0 0.5 1.0 4.0 0 0.5 1.0 4.0
Intra-assay
Inter-assay
Measured values ± SDs (μg/L)
Recoveries ± SDs (%)
CVs (%)
Measured values ± SDs (μg/L)
Recoveries ± SDs (%)
CVs (%)
– 0.462 ± 0.028 0.854 ± 0.077 3.963 ± 0.152 – 0.429 ± 0.036 0.976 ± 0.108 3.565 ± 0.222 – 0.512 ± 0.036 0.922 ± 0.086 4.261 ± 0.356
– 92.4 ± 5.6 85.4 ± 7.7 99.1 ± 3.8 – 85.8 ± 7.2 97.6 ± 10.3 89.1 ± 5.6 – 102.4 ± 7.2 92.2 ± 8.6 106.5 ± 8.9
– 6.1 9.0 3.8 – 8.4 10.6 6.3 – 7.0 9.3 8.4
– 0.420 ± 0.033 0.919 ± 0.051 4.060 ± 0.330 – 0.465 ± 0.044 0.934 ± 0.676 3.362 ± 0.117 – 0.493 ± 0.042 0.880 ± 0.057 4.090 ± 0.279
– 84.0 ± 6.6 91.9 ± 5.1 101.5 ± 8.3 – 93.0 ± 8.8 93.4 ± 6.8 84.1 ± 2.9 – 98.6 ± 8.4 88.0 ± 5.7 102.3 ± 7.0
– 7.9 5.5 8.2 – 9.5 7.3 3.4 – 8.5 6.5 6.8
Conflict of interest
Pearson, L., Mihali, T., Moffitt, M., Kellmann, R., Neilan, B., 2010. On the chemistry, toxicology and genetics of the cyanobacterial toxins, microcystin, nodularin, saxitoxin and cylindrospermopsin. Mar. Drugs 8, 1650–1680. Pirez-Schirmer, M., Rossotti, M., Badagian, N., Leizagoyen, C., Brena, B.M., GonzalezSapienza, G., 2017. Comparison of three antihapten VHH selection strategies for the development of highly sensitive immunoassays for microcystins. Anal. Chem. 89, 6800–6806. Qi, H., Lu, H., Qiu, H.J., Petrenko, V., Liu, A., 2012. Phagemid vectors for phage display: properties, characteristics and construction. J. Mol. Biol. 417, 129–143. Qiu, Y.L., He, Q.H., Xu, Y., Bhunia, A.K., Tu, Z., Chen, B., Liu, Y.Y., 2015. Deoxynivalenolmimic nanobody isolated from a naive phage display nanobody library and its application in immunoassay. Anal. Chim. Acta 887, 201–208. Rastogi, R.P., Sinha, R.P., Incharoensakdi, A., 2014. The cyanotoxin-microcystins: current overview. Rev. Environ. Sci. Bio 13, 215–249. Sheedy, C., MacKenzie, C.R., Hall, J.C., 2007. Isolation and affinity maturation of haptenspecific antibodies. Biotechnol. Adv. 25, 333–352. Sheng, J.W., He, M., Shi, H.C., 2007. A highly specific immunoassay for microcystin-LR detection based on a monoclonal antibody. Anal. Chim. Acta 603, 111–118. Smith, G.P., 1985. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228, 1315–1317. Song, J., Wang, R.M., Wang, Y.Q., Tang, Y.R., Deng, A.P., 2010. Hapten design, modification and preparation of artificial antigens. Chin. J. Anal. Chem. 38, 1211–1218. Steidl, S., Ratsch, O., Brocks, B., Durr, M., Thomassen-Wolf, E., 2008. In vitro affinity maturation of human GM-CSF antibodies by targeted CDR-diversification. Mol. Immunol. 46, 135–144. Svirčev, Z., Drobac, D., Tokodi, N., Mijović, B., Codd, G.A., Meriluoto, J., 2017. Toxicology of microcystins with reference to cases of human intoxications and epidemiological investigations of exposures to cyanobacteria and cyanotoxins. Arch. Toxicol. 91, 621–650. Vodnik, M., Zager, U., Strukelj, B., Lunder, M., 2011. Phage display: selecting straws instead of a needle from a haystack. Molecules 16, 790–817. Wang, Y., Zhang, X., Zhang, C., Liu, Y., Liu, X., 2012. Isolation of single chain variable fragment (scFv) specific for Cry1C toxin from human single fold scFv libraries. Toxicon 60, 1290–1297. Wells, M.L., Trainer, V.L., Smayda, T.J., Karlson, B.S.O., Trick, C.G., Kudela, R.M., Ishikawa, A., Bernard, S., Wulff, A., Anderson, D.M., Cochlan, W.P., 2015. Harmful algal blooms and climate change: learning from the past and present to forecast the future. Harmful Algae 49, 68–93. Xu, C., Liu, X., Zhang, C., Zhang, X., Zhong, J., Liu, Y., Hu, X., Lin, M., Liu, X., 2017a. Establishment of a sensitive time-resolved fluoroimmunoassay for detection of Bacillus thuringiensis Cry1Ie toxin based nanobody from a phage display library. Anal. Biochem. 518, 53–59. Xu, C., Zhang, C., Zhong, J., Hu, H., Luo, S., Liu, X., Zhang, X., Liu, Y., Liu, X., 2017b. Construction of an immunized rabbit phage display library for selecting high activity against Bacillus thuringiensis Cry1F toxin single-chain antibodies. J. Agric. Food Chem. 65, 6016–6022. Xu, C., Zhang, X., Liu, X., Liu, Y., Hu, X., Zhong, J., Zhang, C., Liu, X., 2016. Selection and application of broad-specificity human domain antibody for simultaneous detection of Bt Cry toxins. Anal. Biochem. 512, 70–77. Yu, F.Y., Liu, B.H., Chou, H.N., Chu, F.S., 2002. Development of a sensitive ELISA for the determination of microcystins in algae. J. Agric. Food Chem. 50, 4176–4182. Zhang, X., He, K., Zhao, R., Wang, L., Jin, Y., 2016. Cloning of scFv from hybridomas using a rational strategy: application as a receptor to sensitive detection microcystinLR in water. Chemosphere 160, 230–236. Zhang, X., Liu, Y., Zhang, C., Wang, Y., Xu, C., Liu, X., 2012. Rapid isolation of singlechain antibodies from a human synthetic phage display library for detection of Bacillus thuringiensis (Bt) Cry1B toxin. Ecotoxicol. Environ. Saf. 81, 84–90. Zhao, A., Tohidkia, M.R., Siegel, D.L., Coukos, G., Omidi, Y., 2016a. Phage antibody display libraries: a powerful antibody discovery platform for immunotherapy. Crit. Rev. Biotechnol. 36, 276–289. Zhao, Y.Y., Liang, Y., Liu, Y., Zhang, X., Hu, X.D., Tu, S.C., Wu, A.H., Zhang, C.Z., Zhong, J.F., Zhao, S.M., Liu, X.J., Tu, K., 2016b. Isolation of broad-specificity domain antibody from phage library for development of pyrethroid immunoassay. Anal. Biochem. 502, 1–7.
The authors declare no conflict of interest. References Barderas, R., Desmet, J., Timmerman, P., Meloen, R., Casal, J.I., 2008. Affinity maturation of antibodies assisted by in silico modeling. Proc. Natl. Acad. Sci. USA 105, 9029–9034. Bonsor, D.A., Postel, S., Pierce, B.G., Wang, N., Zhu, P., Buonpane, R.A., Weng, Z., Kranz, D.M., Sundberg, E.J., 2011. Molecular basis of a million-fold affinity maturation process in a protein-protein interaction. J. Mol. Biol. 411, 321–328. Brooks, B.W., Lazorchak, J.M., Howard, M.D., Johnson, M.V.V., Morton, S.L., Perkins, D.A., Reavie, E.D., Scott, G.I., Smith, S.A., Steevens, J.A., 2016. Are harmful algal blooms becoming the greatest inland water quality threat to public health and aquatic ecosystems? Environ. Toxicol. Chem. 35, 6–13. Chakravarty, R., Goel, S., Cai, W., 2014. Nanobody: the "magic bullet" for molecular imaging? Theranostics 4, 386–398. Chen, J., Zhang, H.Q., Hu, L.B., Shi, Z.Q., 2013. Microcystin-LR-induced phytotoxicity in rice crown root is associated with the cross-talk between auxin and nitric oxide. Chemosphere 93, 283–293. Chen, L., Chen, J., Zhang, X., Xie, P., 2016. A review of reproductive toxicity of microcystins. J. Hazard. Mater. 301, 381–399. Esterhuizen-Londt, M., Hertel, S., Pflugmacher, S., 2017. Uptake and biotransformation of pure commercial microcystin-LR versus microcystin-LR from a natural cyanobacterial bloom extract in the aquatic fungus Mucor hiemalis. Biotechnol. Lett. 39, 1537–1545. Heussner, A.H., Winter, I., Altaner, S., Kamp, L., Rubio, F., Dietrich, D.R., 2014. Comparison of two ELISA-based methods for the detection of microcystins in blood serum. Chem. Biol. Interact. 223, 10–17. Hou, J., Wang, X., Hayat, T., Wang, X., 2017. Ecotoxicological effects and mechanism of CuO nanoparticles to individual organisms. Environ. Pollut. 221, 209–217. Jiao, L., Liu, Y., Zhang, X., Liu, B., Zhang, C., Liu, X., 2017. Site-saturation mutagenesis library construction and screening for specific broad-spectrum single-domain antibodies against multiple Cry1 toxins. Appl. Microbiol. Biotechnol. 101, 6071–6082. Lai, C.L., Srivastava, A., Pilling, C., Chase, A.R., Falke, J.J., Voth, G.A., 2013. Molecular mechanism of membrane binding of the GRP1 PH domain. J. Mol. Biol. 425, 3073–3090. Liu, L., Xing, C., Yan, H., Kuang, H., Xu, C., 2014. Development of an ELISA and immunochromatographic strip for highly sensitive detection of microcystin-LR. Sensors 14, 14672–14685. Liu, X., Tang, Z., Duan, Z., He, Z., Shu, M., Wang, X., Gee, S.J., Hammock, B.D., Xu, Y., 2017. Nanobody-based enzyme immunoassay for ochratoxin A in cereal with high resistance to matrix interference. Talanta 164, 154–158. McElhiney, J., Lawton, L.A., 2005. Detection of the cyanobacterial hepatotoxins microcystins. Toxicol. Appl. Pharmacol. 203, 219–230. Mercader, J.V., Celia, S.P., Agulló, C., Antonio, A.S., Antonio, A.F., 2008. Hapten synthesis and monoclonal antibody-based immunoassay development for detection of the fungicide trifloxystrobin. J. Agric. Food Chem. 56, 2581–2588. Moreira, C., Ramos, V., Azevedo, J., Vasconcelos, V., 2014. Methods to detect cyanobacteria and their toxins in the environment. Appl. Microbiol. Biotechnol. 98, 8073–8082. Murphy, C., Stack, E., Krivelo, S., McPartlin, D.A., Byrne, B., Greef, C., Lochhead, M.J., Husar, G., Devlin, S., Elliott, C.T., O'Kennedy, R.J., 2015. Detection of the cyanobacterial toxin, microcystin-LR, using a novel recombinant antibody-based opticalplanar waveguide platform. Biosens. Bioelectron. 67, 708–714. Muyldermans, S., 2013. Nanobodies: natural single-domain antibodies. Annu. Rev. Biochem. 82, 775–797. Pande, J., Szewczyk, M.M., Grover, A.K., 2010. Phage display: concept, innovations, applications and future. Biotechnol. Adv. 28, 849–858. Papaneophytou, C.P., Kontopidis, G., 2014. Statistical approaches to maximize recombinant protein expression in Escherichia coli: a general review. Protein Expr. Purif. 94, 22–32.
227