- Email: [email protected]
Micromonas (Peptostreptococcus) micros: unusual case of prosthetic joint infection associated with dental procedures
ARTICLE IN PRESS
International Journal of Medical Microbiology 294 (2005) 465–470 www.elsevier.de/ijmm
CASE REPORT
Micromonas (Peptostreptococcus) micros: unusual case of prosthetic joint infection associated with dental procedures Holger Bartza,1, Claudia Nonnenmachera,b,1, Christine Bollmannc, Matthias Kuhlc, Stefan Zimmermanna, Klaus Heega, Reinier Muttersa, a
Institute of Medical Microbiology and Hygiene, Pilgrimstein 2, D-35037 Marburg, Germany Department of Periodontology, Philipps University Marburg, Marburg, Germany c Department of Orthopedic Surgery, Philipps University Marburg, Marburg, Germany b
Received 11 March 2004; received in revised form 8 October 2004; accepted 8 October 2004
Abstract Micromonas (Peptostreptococcus) micros is frequently associated with periodontal disease as well as respiratory, gastrointestinal and female genitourinary tract infections, but only rarely has been reported as a pathogenic agent of prosthetic joint infections. Here we describe a case of a 63-year-old woman with prosthetic joint infection of total hip arthroplasty caused by the anaerobic species Micromonas micros, associated with tooth extraction. Samples obtained intraoperatively and from the oral cavity were positive for the presence of M. micros by culture and by real-time PCR. This case report indicates that infections of prosthetic joints can be associated with dental procedures and that sensitive molecular techniques are necessary for their routine diagnostic. r 2004 Elsevier GmbH. All rights reserved. Keywords: Micromonas micros; Prosthetic joint infection; Tooth extraction
Introduction Prosthetic joint infections of primary arthroplasties occur with an incidence of 1.5–2.5% (Hanssen and Rand, 1999). In accordance with data obtained at our institute, Staphylococcus species are the most important microorganisms involved in these infections, accounting for approximately 50% of these infections overall. They are followed by streptococci, enterococci, Enterobacteriaceae, Pseudomonas aeruginosa, and anaerobes (Fitzgerald, 1989; Spangehl et al., 1998). Prosthetic joint infections caused by Micromonas (Peptostreptococcus) micros are rare and there have been only very few Corresponding author. 1
E-mail address: [email protected] (R. Mutters). These authors contributed equally.
1438-4221/$ - see front matter r 2004 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2004.10.001
reports of such cases in the literature (Stoll et al., 1996). In this report, an association between the loss of hip arthroplasty by Micromonas (M.) micros with a previous dental procedure is reported. M. micros is a Gram-positive anaerobic bacterium associated with periodontal disease (Haffajee and Socransky, 1994), endodontic infections (Siqueira et al., 2003) and abscesses (de Sousa et al, 2003; Araki et al, 2004). Although considered a natural commensal of the oral cavity, it is also commonly isolated from oral infections as well as from respiratory, gastrointestinal, and female genitourinary tract infections (Civen et al., 1995; Murdoch et al., 1988; Murdoch et al., 1994). Several virulence factors have been described for M. micros including production of hydrogen sulfide from glutathione (Carlsson et al., 1993) and production of hyaluronidase (Tam and Chan, 1985) as well as
ARTICLE IN PRESS 466
H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
adherence to gingival epithelial cells (Dzink et al., 1989) and expression of immunoglobulin G Fc-binding proteins (Grenier and Michaud, 1994). A possible route to the circulatory system for periodontal bacteria exists, as studies have shown transient bacteremia after dental procedures (Coulter et al., 1990; Otten et al. 1987). Access of bacteria to the blood stream may then lead to spread to distant sites, as well as attachment to and growth on the surface of an orthopedic implant. The diagnosis of prosthetic joint infection is often difficult, and treatment is prolonged, complicated, expensive and with no guarantee of successful therapy. Especially, when unusual microorganisms such as anaerobes are involved, microbiological techniques depending on the isolation of a pathogen by microbial culture techniques are often misleading. Thus, molecular techniques should be used in clinical microbiology laboratories to establish the cause of infectious diseases. This report illustrates the recovery of M. micros from a prosthetic joint infection site associated with dental procedure diagnosed by culture and real-time PCR.
1 250 mg i.v./d. This was changed to 4 0.5 g/d clindamycin after detection of M. micros. After that, clinical and laboratory signs of inflammation returned to normal. The patient’s dental history included several visits to a dentist due to acute dental pain. The patient presented extensive accumulation of calculus, generalized bone loss as well as pulpal/periapical infection. The diagnosis and treatment information was abstracted retrospectively from the original patient record by her dentist. Four days before the beginning of the hip pain, due to periradicular disease, three infected molars were extracted at the same visit. Following the usual recommendations the patient did not receive prophylactic antibiotics. Six months after the multiple tooth extraction and 6 days after the hip operation our intraoral examination revealed generalized gingival recession, extensive clinical attachment loss and shallow probing pocket depths (with exception of one site with 6 mm). There were no signs of acute inflammation. Subgingival samples were collected from all teeth for a microbiological examination.
Case report A 63-year-old woman who had undergone a hybrid total hip arthroplasty after a Lyme arthritis 9 years ago was referred to the orthopedic department for the replacement of the hip arthroplasty due to aseptic loosening of joint prosthesis. The first visit to a doctor because of hip pain was about 6 months before her stay in our hospital and 4 days after out-patient dental treatment. Because of the hip pain and anamnesis an out-patient computer-tomography and two-phase bone szintigraphy were done, revealing the diagnosis of shaft loosening vs. chronic osteomyelitis. After that, the patient was referred to our out-patient orthopedic department. Due to her increased C-reactive protein (89 mg/l, n ¼ 5 mg/l), an attempt was made to exclude infection by puncture of the hip joint. Conventional microbiological aerobic and anaerobic cultures from this sample were sterile. Molecular diagnostic methods to detect microorganisms were not used at this time. X-ray showed a loosening of the shaft. From that, a replacement of the hip arthroplasty was planned. During the operation an infection was diagnosed macroscopically and four microbiological samples were taken. An immediate Gram staining at our institute showed no microorganisms. Pathological examinations of the surrounding tissue showed a granulomatous synovialitis with pus, but neither bacteria nor yeasts were detected. After 48 h of aerobic and anaerobic culture, M. micros was found exclusively in all samples. After surgery, antibiotical treatment was started with 3 1.5 g cefuroxim i.v./d and gentamicin
Materials and methods Sample collection, culture methods, biochemical identification and bacterial resistance The first microbiological sample from the patient’s hip was taken during an examination in our out-patient orthopedic department. The hip was punctured under sterile conditions and the obtained fluid was transported in syringe to our laboratory immediately. Intraoperative samples were collected during the surgical procedure: either bacterial swabs transported in a Port-A-Cul-Tube (Becton Dickinson, Heidelberg, Germany) or parts of macroscopically infected tissue (transported in sterile tube containing physiological sodium chloride solution). All culture samples were processed at the Institute of Medical Microbiology, Philipps University Marburg, within 2 h following institutional guidelines. In brief, Columbia blood (5% sheep blood), chocolate, McConkey agars and Brain-Heart-Infusion broth for aerobic and Schaedler (with Vit. K1 and 5% sheep blood), Schaedler-KV (kanamycin and vancomycin) agars and thioglycolate broth for anaerobic culture were used (all from Becton Dickinson, Heidelberg, Germany). Identification of anaerobic microorganisms based on enzymatic activities was performed using the BD Crystal ANR ID Kit (Becton Dickinson). Subgingival plaque samples were collected from the mesial site in each tooth of the patient during her stay at our orthopedic department 6 days after the operation by
ARTICLE IN PRESS H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
C. Nonnenmacher. Two sterile paper points (Antaeos, Munich, Germany) were inserted to the bottom of the subgingival sulcus for a 20-s period. The samples were stored in a labeled sterile Eppendorf tube containing reduced transport fluid (RTF) medium with 25% glucose (Syed and Loesche, 1972 ). One sample of each site was analyzed by culture and one by real-time PCR. The subgingival samples were processed at the Institute of Medical Microbiology, Philipps University Marburg, within 2 h after collection as described above. No subgingival microbiological samples were collected at the time when multiple extractions were performed. Antibiotic susceptibility tests were performed by Epsilometer test (AB Biodisk, Solna, Sweden) according to NCCLS (National Committee for Clinical Laboratory Standards) guidelines using 2 E-Test-stripes on Schaedler agar (pre-reduced overnight; bacteria concentration: McFarland 0.5).
Molecular techniques All samples obtained during the hip surgical procedure as well as the oral samples were additionally evaluated and quantified by real-time PCR. DNA from the original clinical samples was isolated using DNeasy tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Real-time PCR was performed as described previously (Nonnenmacher et al., 2004) using the TaqMan system. The PCR primers and TaqMan probe were based on species-specific highly conserved regions from the 16S rRNA gene. The primers used for identification and quantification of M. micros were as follows: forward primer (AAACGACGATTAATACCACATGAGAC), reverse primer (ACTGCTGCCTCCCGTAGGA), and TaqMan probe (TCAAAGATTTATCGGTGTAAGAA GGGCTCGC). For quantification of M. micros, 10-fold dilutions of plasmids containing the amplified region of the target bacteria were used. To generate a standard curve, the threshold cycle (Ct) of these standard dilutions was plotted against the number of plasmid copies used as input. For this standard curve, M. micros was amplified with Ct values in the range of 14–35 which correspond to 108–102 plasmid copies, respectively.
Statistical analysis of the microbial etiology of joint infections Statistical analysis of the microbial etiology of joint infections was performed at our institute using a combination of swisslab II microbiology laboratory software (Frey computer systems, Berlin, Germany) and the hygiene software Hybase 5.0 (Cymed AG, Bochum, Germany).
467
Results Microbiological findings No microorganisms were found in the first samples taken during the examination in our out-patient orthopedic department. In contrast, M. micros was cultured from the four samples taken from the purulent lesion, which were collected during the surgical procedure. The only growth of bacteria in these samples was detected on Schaedler agar. The BD Crystal ANR ID Kit (Becton Dickinson, Heidelberg, Germany) (Organism ID after 24 h: 1231450110) revealed M. micros. Subgingival plaque samples evaluated by culture were positive for the presence of M. micros. In the case of growth of different anaerobes, different microorganisms were isolated and identified by BD Crystal ANR ID Kit. M. micros found in the plaque samples showed the same organism ID after 24 h in the crystal system. Other anaerobes found were revealed to be Prevotella sp. and Fusobacterium sp. Every isolated M. micros was susceptible to cefoxitin (MIC ¼ 0.016 mg/ml), metronidazol (MIC ¼ 0.064 mg/ ml), ampicillin/sulbactam (MIC ¼ 0.016 mg/ml), penicillin G (MIC ¼ 0.016 mg/ml), clindamycin (MIC ¼ 0.38 mg/ml), and meropenem (MIC ¼ 0.006 mg/ml).
Molecular identification and quantification of M. micros A total of four clinical samples collected intraoperatively (hip samples), which were culture positive, were quantified by TaqMan-PCR for the presence of M. micros. The results showed a range varying from 1.7 103 to 3.6 104 plasmid copies present in the samples. Samples collected from the oral sites were also positive for the presence of M. micros and ranged from 102 to 104, however, in some teeth M. micros was not detected (Fig. 1). Prevotella intermedia and Fusobacterium nucleatum were detected in low numbers in the oral samples (data not shown).
Bacteria spectrum found in joints (Marburg 2001–2003) In our institute, 1267 samples from joints (2001–2003) were evaluated by culture as described above in the last 2.5 years and 1103 samples were sterile. Coagulasenegative Staphylococcus species were observed in 78 samples, while S. aureus was recovered from 35 samples. Other bacteria commonly found in the oral cavity were recovered in 11 samples, i.e. in 6.7% of the joint infections.
ARTICLE IN PRESS 468
H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
Threshold cycle (Ct)
35 30 25 20 15 10 1.E+02
1.E+03
1.E+04 1.E+05 1.E+06 1.E+07 1.E+08 Plasmid copies (M. micros) M. micros alone intraoperative samples oral cavity samples
Fig. 1. Real-time PCR assay of M. micros (intraoperative and oral samples). M. micros alone represents serially diluted plasmid with insert from 16S RNA of this bacterium.
Discussion In the present study, we describe M. micros, the former Peptostreptococcus micros as the etiological agent of a prosthetic hip infection associated with tooth extraction. The time point of the first clinical signs of the hip infection correlated impressively with dental procedures. Although it is known that other processes due to oral hygiene (e.g. tooth brushing) lead to a transient bacteremia and we thus do not have direct evidence linking dental procedures to infection of the hip prosthesis, we do have some convincing hints that both events are not only of coincidental nature: the correlation of time points regarding hip pain and dental procedure and the same biochemical identification and same antibiotic resistance of the isolated bacteria. Accordingly, it is already established that transient bacteremia may occur after a dental procedure (Bartzokas et al., 1994; Waldman et al., 1997). These and other reports have also addressed joint infections which were correlated with organisms typically isolated from the oral flora (Bartzokas et al., 1994; LaPorte et al., 1999; Riesbeck and Sanzen, 1999) suggesting a close association between both conditions. M. micros has been isolated from the oral cavity and has been commonly described in mixed, anaerobic infections of different tissues (Civen et al., 1995; Murdoch et al., 1988; Murdoch et al., 1994). However, the mechanisms involved in the bacterial attachment and multiplication in the prosthetic devices are not fully understood. The pathogenesis of prosthetic joint infection is related to bacteria in biofilms, in which they are protected from antimicrobial killing and host responses rendering these infections difficult to eradicate. Classical microbiological methods failed to reveal the invading pathogen in our patient: the original sample from the first visit of the patient in our out-patient orthopedic department showed no microorganisms (this sample was
not available for re-examination with molecular diagnostic methods). Thus, in contrast to the anamnesis, the clinical signs, the laboratory parameters (pain, CRP) and the results of radiological examinations (CT, szintigraphy), the microbiological assays revealed a wrong etiology of the hip pain. This could have been due to the ‘‘hiding’’ of bacteria in biofilms. An attempt to identify bacterial DNA rather than cultivate entire microorganisms could bring advantages, i.e. improving patient care in terms of rapid, sensitive and accurate diagnosis, reducing unnecessary additional tests and treatments, and lowering medical expenses. So far, limits for these methods exist: first, the need for testing the antimicrobial sensitivity of a pathogen; second, if the pathogen is not known and bacterial DNA has to be amplified by random primers to identify it by DNA sequencing, only one microorganism should be in the sample. Since joint implants may predispose for microbial colonization and infection, the American Dental Association and the American Academy of Orthopedic Surgeons (2003) updated the 1997 statement on antibiotic prophylaxis for dental patients with orthopedic joints. The new protocol stated that antibiotic prophylaxis is not routinely indicated for most dental patients with total joint replacements but pre-medication should be considered in a small number of patients showing increased risk of experiencing hematogenous total joint infection. This includes patients with coexisting immunocompromised status such as diabetes, patients with joint inflammatory disease, patients undergoing chemotherapy or irradiation, and for the first 2 years after joint replacement. In addition, antibiotic prophylaxis is not indicated for dental patients with pins, plates and screws. These positions agree with the ADA Council on Dental Therapeutics (Council on Dental Therapeutics, 1990), the Academy of Oral Medicine (Eskinazi and Rathbun, 1988) and are similar to those of the British Society for Antimicrobial Therapy (Cawson, 1992). However, the incidence stratification of bacteremic dental procedures should also be taken into consideration in determining whether or not antibiotic prophylaxis is appropriate. Dental procedures including dental extractions, as in the case described above, where multiple extraction of infected teeth was performed, present a high incidence of bacteremia. This is also observed for those patients where dental treatment is prolonged (e.g., lasting 445 min). Future studies concerning the connection of oral microorganisms and joint infections should take into consideration new molecular microbiological techniques to improve the data basis on which therapy decisions are built. These studies should also pay attention to the fact that not only typical oral microorganisms can originate from the mouth, but also common bacteria such as S. aureus.
ARTICLE IN PRESS H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
Taken together, our case report and our statistical data indicate that infections of joints, especially those artificially replaced, can be associated with dental procedures. Microorganisms isolated from the joints can originate from the oral cavity and are sometimes hard to culture. Thus, hints from the anamnesis and laboratory parameters indicating an infection with these types of microorganisms (after dental procedures) should lead to an antibiotic treatment. Based on previously published studies from our group (Mutters and Nonnenmacher, 2003), we would suggest the use of modern quinolones (e.g. moxifloxacin) or carbapenems. Moxifloxacin showed to be very effective against Grampositive and Gram-negative anaerobic and microaerophilic microorganisms and is known to penetrate well into tissue (Krasemann et al., 2001). The microbiologist should be informed accordingly to use more appropriate and optimal methods for the analysis of this type of samples; e.g. more sensitive techniques like 16S PCR with random primers.
Acknowledgements The authors thank Detlef Schulz for leaving the outpatient dental data to us and Alexander Dalpke for helping to establish the TaqMan technique.
References American Dental Association, American Academy of Orthopedic Surgeons, 2003. Antibiotic prophylaxis for dental patients with total joint replacements. J. Am. Dent. Assoc. 134, 895–899. Araki, H., Kuriyama, T., Nakagawa, K., Karasawa, T., 2004. The microbial synergy of Peptostreptococcus micros and Prevotella intermedia in a murine abscess model. Oral Microbiol. Immunol. 19, 177–181. Bartzokas, C.A., Johnson, R., Jane, M., Martin, M.V., Pearce, P.K., Saw, Y., 1994. Relation between mouth and haematogenous infection in total joint replacements. BMJ 309, 506–508. Carlsson, J., Larsen, J.T., Edlund, M.B., 1993. Peptostreptococcus micros has a uniquely high capacity to form hydrogen sulfide from glutathione. Oral Microbiol. Immunol. 8, 42–45. Cawson, R.A., 1992. Antibiotic prophylaxis for dental treatment. BMJ 304, 933–934. Civen, R., Jousimies-Somer, H., Marina, M., Borenstein, L., Shah, H., Finegold, S.M., 1995. A retrospective review of cases of anaerobic empyema and update of bacteriology. Clin. Infect. Dis. 20 (Suppl. 2), S224–S229. Coulter, W.A., Coffey, A., Saunders, I.D., Emmerson, A.M., 1990. Bacteremia in children following dental extraction. J. Dent. Res. 69, 1691–1695.
469
Council on Dental Therapeutics, 1990. Management of dental patients with prosthetic joints. J. Am. Dent. Assoc. 121, 537–538. de Sousa, E.L., Ferraz, C.C., Gomes, B.P., Pinheiro, E.T., Teixeira, F.B., de Souza-Filho, F.J., 2003. Bacteriological study of root canals associated with periapical abscesses. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 96, 332–339. Dzink, J.L., Gibbons, R.J., Childs III, W.C., Socransky, S.S., 1989. The predominant cultivable microbiota of crevicular epithelial cells. Oral Microbiol. Immunol. 4, 1–5. Eskinazi, D., Rathbun, W., 1988. Is systematic antimicrobial prophylaxis justified in dental patients with prosthetic joints? Oral Surg. Oral Med. Oral Pathol. 66, 430–431. Fitzgerald Jr., R.H., 1989. Infections of hip prostheses and artificial joints. Infect. Dis. Clin. North. Am. 3, 329–338. Grenier, D., Michaud, J., 1994. Demonstration of human immunoglobulin G Fc-binding activity in oral bacteria. Clin. Diagn. Lab. Immunol. 1, 247–249. Haffajee, A.D., Socransky, S.S., 1994. Microbial etiological agents of destructive periodontal diseases. Periodontology 2000 (5), 78–111. Hanssen, A.D., Rand, J.A., 1999. Evaluation and treatment of infection at the site of a total hip or knee arthroplasty. Instr. Course Lect. 48, 111–122. Krasemann, C., Meyer, J., Tillotson, G., 2001. Evaluation of the clinical microbiology profile of moxifloxacin. Clin. Infect. Dis. 32 (Suppl. 1), 51–63. LaPorte, D.M., Waldman, B.J., Mont, M.A., Hungerford, D.S., 1999. Infections associated with dental procedures in total hip arthroplasty. J. Bone Joint Surg. Br. 81, 56–59. Murdoch, D.A., Mitchelmore, I.J., Tabaqchali, S., 1988. Peptostreptococcus micros in polymicrobial abscesses. Lancet 1 (8585), 594. Murdoch, D.A., Mitchelmore, I.J., Tabaqchali, S., 1994. The clinical importance of gram-positive anaerobic cocci isolated at St Bartholomew’s Hospital, London, in 1987. J. Med. Microbiol. 41, 36–44. Mutters, R., Nonnenmacher, C., 2003. Susceptibility of Grampositive and Gram-negative anaerobic and microaerophilic microorganisms for moxifloxacin and selected antibiotics appropriate for anaerobics. Dtsch. Zahna¨rztl. Z. 58, 302–303. Nonnenmacher, C., Dalpke, A., Mutters, R., Heeg, K., 2004. Quantitative detection of periodontopathogens by real-time PCR. J. Microbiol. Methods 59, 117–125. Otten, J.E., Pelz, K., Christmann, G., 1987. Anaerobic bacteremia following tooth extraction and removal of osteosynthesis plates. J. Oral Maxillofac. Surg. 45, 477–480. Riesbeck, K., Sanzen, L., 1999. Destructive knee joint infection caused by Peptostreptococcus micros: importance of early microbiological diagnosis. J. Clin. Microbiol. 37, 2737–2739. Siqueira Jr., J.F., Rocas, I.N., Andrade, A.F., de Uzeda, M., 2003. Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction. J. Endodont. 29, 111–113.
ARTICLE IN PRESS 470
H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
Spangehl, M.J., Younger, A.S., Masri, B.A., Duncan, C.P., 1998. Diagnosis of infection following total hip arthroplasty. Instr. Course Lect. 47, 285–295. Stoll, T., Stucki, G., Bruhlmann, P., Vogt, M., Gschwend, N., Michel, B.A., 1996. Infection of a total knee joint prosthesis by Peptostreptococcus micros and Propionibacterium acnes in an elderly RA patient: implant salvage with longterm antibiotics and needle aspiration/irrigation. Clin. Rheumatol. 15, 399–402.
Syed, S.A., Loesche, W.J., 1972. Survival of human dental plaque flora in various transport media. Appl. Microbiol. 24, 638–644. Tam, Y.C., Chan, E.C., 1985. Purification and characterization of hyaluronidase from oral Peptostreptococcus species. Infect. Immun. 47, 508–513. Waldman, B.J., Mont, M.A., Hungerford, D.S., 1997. Total knee arthroplasty infections associated with dental procedures. Clin. Orthop. 343, 164–172.
International Journal of Medical Microbiology 294 (2005) 465–470 www.elsevier.de/ijmm
CASE REPORT
Micromonas (Peptostreptococcus) micros: unusual case of prosthetic joint infection associated with dental procedures Holger Bartza,1, Claudia Nonnenmachera,b,1, Christine Bollmannc, Matthias Kuhlc, Stefan Zimmermanna, Klaus Heega, Reinier Muttersa, a
Institute of Medical Microbiology and Hygiene, Pilgrimstein 2, D-35037 Marburg, Germany Department of Periodontology, Philipps University Marburg, Marburg, Germany c Department of Orthopedic Surgery, Philipps University Marburg, Marburg, Germany b
Received 11 March 2004; received in revised form 8 October 2004; accepted 8 October 2004
Abstract Micromonas (Peptostreptococcus) micros is frequently associated with periodontal disease as well as respiratory, gastrointestinal and female genitourinary tract infections, but only rarely has been reported as a pathogenic agent of prosthetic joint infections. Here we describe a case of a 63-year-old woman with prosthetic joint infection of total hip arthroplasty caused by the anaerobic species Micromonas micros, associated with tooth extraction. Samples obtained intraoperatively and from the oral cavity were positive for the presence of M. micros by culture and by real-time PCR. This case report indicates that infections of prosthetic joints can be associated with dental procedures and that sensitive molecular techniques are necessary for their routine diagnostic. r 2004 Elsevier GmbH. All rights reserved. Keywords: Micromonas micros; Prosthetic joint infection; Tooth extraction
Introduction Prosthetic joint infections of primary arthroplasties occur with an incidence of 1.5–2.5% (Hanssen and Rand, 1999). In accordance with data obtained at our institute, Staphylococcus species are the most important microorganisms involved in these infections, accounting for approximately 50% of these infections overall. They are followed by streptococci, enterococci, Enterobacteriaceae, Pseudomonas aeruginosa, and anaerobes (Fitzgerald, 1989; Spangehl et al., 1998). Prosthetic joint infections caused by Micromonas (Peptostreptococcus) micros are rare and there have been only very few Corresponding author. 1
E-mail address: [email protected] (R. Mutters). These authors contributed equally.
1438-4221/$ - see front matter r 2004 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2004.10.001
reports of such cases in the literature (Stoll et al., 1996). In this report, an association between the loss of hip arthroplasty by Micromonas (M.) micros with a previous dental procedure is reported. M. micros is a Gram-positive anaerobic bacterium associated with periodontal disease (Haffajee and Socransky, 1994), endodontic infections (Siqueira et al., 2003) and abscesses (de Sousa et al, 2003; Araki et al, 2004). Although considered a natural commensal of the oral cavity, it is also commonly isolated from oral infections as well as from respiratory, gastrointestinal, and female genitourinary tract infections (Civen et al., 1995; Murdoch et al., 1988; Murdoch et al., 1994). Several virulence factors have been described for M. micros including production of hydrogen sulfide from glutathione (Carlsson et al., 1993) and production of hyaluronidase (Tam and Chan, 1985) as well as
ARTICLE IN PRESS 466
H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
adherence to gingival epithelial cells (Dzink et al., 1989) and expression of immunoglobulin G Fc-binding proteins (Grenier and Michaud, 1994). A possible route to the circulatory system for periodontal bacteria exists, as studies have shown transient bacteremia after dental procedures (Coulter et al., 1990; Otten et al. 1987). Access of bacteria to the blood stream may then lead to spread to distant sites, as well as attachment to and growth on the surface of an orthopedic implant. The diagnosis of prosthetic joint infection is often difficult, and treatment is prolonged, complicated, expensive and with no guarantee of successful therapy. Especially, when unusual microorganisms such as anaerobes are involved, microbiological techniques depending on the isolation of a pathogen by microbial culture techniques are often misleading. Thus, molecular techniques should be used in clinical microbiology laboratories to establish the cause of infectious diseases. This report illustrates the recovery of M. micros from a prosthetic joint infection site associated with dental procedure diagnosed by culture and real-time PCR.
1 250 mg i.v./d. This was changed to 4 0.5 g/d clindamycin after detection of M. micros. After that, clinical and laboratory signs of inflammation returned to normal. The patient’s dental history included several visits to a dentist due to acute dental pain. The patient presented extensive accumulation of calculus, generalized bone loss as well as pulpal/periapical infection. The diagnosis and treatment information was abstracted retrospectively from the original patient record by her dentist. Four days before the beginning of the hip pain, due to periradicular disease, three infected molars were extracted at the same visit. Following the usual recommendations the patient did not receive prophylactic antibiotics. Six months after the multiple tooth extraction and 6 days after the hip operation our intraoral examination revealed generalized gingival recession, extensive clinical attachment loss and shallow probing pocket depths (with exception of one site with 6 mm). There were no signs of acute inflammation. Subgingival samples were collected from all teeth for a microbiological examination.
Case report A 63-year-old woman who had undergone a hybrid total hip arthroplasty after a Lyme arthritis 9 years ago was referred to the orthopedic department for the replacement of the hip arthroplasty due to aseptic loosening of joint prosthesis. The first visit to a doctor because of hip pain was about 6 months before her stay in our hospital and 4 days after out-patient dental treatment. Because of the hip pain and anamnesis an out-patient computer-tomography and two-phase bone szintigraphy were done, revealing the diagnosis of shaft loosening vs. chronic osteomyelitis. After that, the patient was referred to our out-patient orthopedic department. Due to her increased C-reactive protein (89 mg/l, n ¼ 5 mg/l), an attempt was made to exclude infection by puncture of the hip joint. Conventional microbiological aerobic and anaerobic cultures from this sample were sterile. Molecular diagnostic methods to detect microorganisms were not used at this time. X-ray showed a loosening of the shaft. From that, a replacement of the hip arthroplasty was planned. During the operation an infection was diagnosed macroscopically and four microbiological samples were taken. An immediate Gram staining at our institute showed no microorganisms. Pathological examinations of the surrounding tissue showed a granulomatous synovialitis with pus, but neither bacteria nor yeasts were detected. After 48 h of aerobic and anaerobic culture, M. micros was found exclusively in all samples. After surgery, antibiotical treatment was started with 3 1.5 g cefuroxim i.v./d and gentamicin
Materials and methods Sample collection, culture methods, biochemical identification and bacterial resistance The first microbiological sample from the patient’s hip was taken during an examination in our out-patient orthopedic department. The hip was punctured under sterile conditions and the obtained fluid was transported in syringe to our laboratory immediately. Intraoperative samples were collected during the surgical procedure: either bacterial swabs transported in a Port-A-Cul-Tube (Becton Dickinson, Heidelberg, Germany) or parts of macroscopically infected tissue (transported in sterile tube containing physiological sodium chloride solution). All culture samples were processed at the Institute of Medical Microbiology, Philipps University Marburg, within 2 h following institutional guidelines. In brief, Columbia blood (5% sheep blood), chocolate, McConkey agars and Brain-Heart-Infusion broth for aerobic and Schaedler (with Vit. K1 and 5% sheep blood), Schaedler-KV (kanamycin and vancomycin) agars and thioglycolate broth for anaerobic culture were used (all from Becton Dickinson, Heidelberg, Germany). Identification of anaerobic microorganisms based on enzymatic activities was performed using the BD Crystal ANR ID Kit (Becton Dickinson). Subgingival plaque samples were collected from the mesial site in each tooth of the patient during her stay at our orthopedic department 6 days after the operation by
ARTICLE IN PRESS H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
C. Nonnenmacher. Two sterile paper points (Antaeos, Munich, Germany) were inserted to the bottom of the subgingival sulcus for a 20-s period. The samples were stored in a labeled sterile Eppendorf tube containing reduced transport fluid (RTF) medium with 25% glucose (Syed and Loesche, 1972 ). One sample of each site was analyzed by culture and one by real-time PCR. The subgingival samples were processed at the Institute of Medical Microbiology, Philipps University Marburg, within 2 h after collection as described above. No subgingival microbiological samples were collected at the time when multiple extractions were performed. Antibiotic susceptibility tests were performed by Epsilometer test (AB Biodisk, Solna, Sweden) according to NCCLS (National Committee for Clinical Laboratory Standards) guidelines using 2 E-Test-stripes on Schaedler agar (pre-reduced overnight; bacteria concentration: McFarland 0.5).
Molecular techniques All samples obtained during the hip surgical procedure as well as the oral samples were additionally evaluated and quantified by real-time PCR. DNA from the original clinical samples was isolated using DNeasy tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Real-time PCR was performed as described previously (Nonnenmacher et al., 2004) using the TaqMan system. The PCR primers and TaqMan probe were based on species-specific highly conserved regions from the 16S rRNA gene. The primers used for identification and quantification of M. micros were as follows: forward primer (AAACGACGATTAATACCACATGAGAC), reverse primer (ACTGCTGCCTCCCGTAGGA), and TaqMan probe (TCAAAGATTTATCGGTGTAAGAA GGGCTCGC). For quantification of M. micros, 10-fold dilutions of plasmids containing the amplified region of the target bacteria were used. To generate a standard curve, the threshold cycle (Ct) of these standard dilutions was plotted against the number of plasmid copies used as input. For this standard curve, M. micros was amplified with Ct values in the range of 14–35 which correspond to 108–102 plasmid copies, respectively.
Statistical analysis of the microbial etiology of joint infections Statistical analysis of the microbial etiology of joint infections was performed at our institute using a combination of swisslab II microbiology laboratory software (Frey computer systems, Berlin, Germany) and the hygiene software Hybase 5.0 (Cymed AG, Bochum, Germany).
467
Results Microbiological findings No microorganisms were found in the first samples taken during the examination in our out-patient orthopedic department. In contrast, M. micros was cultured from the four samples taken from the purulent lesion, which were collected during the surgical procedure. The only growth of bacteria in these samples was detected on Schaedler agar. The BD Crystal ANR ID Kit (Becton Dickinson, Heidelberg, Germany) (Organism ID after 24 h: 1231450110) revealed M. micros. Subgingival plaque samples evaluated by culture were positive for the presence of M. micros. In the case of growth of different anaerobes, different microorganisms were isolated and identified by BD Crystal ANR ID Kit. M. micros found in the plaque samples showed the same organism ID after 24 h in the crystal system. Other anaerobes found were revealed to be Prevotella sp. and Fusobacterium sp. Every isolated M. micros was susceptible to cefoxitin (MIC ¼ 0.016 mg/ml), metronidazol (MIC ¼ 0.064 mg/ ml), ampicillin/sulbactam (MIC ¼ 0.016 mg/ml), penicillin G (MIC ¼ 0.016 mg/ml), clindamycin (MIC ¼ 0.38 mg/ml), and meropenem (MIC ¼ 0.006 mg/ml).
Molecular identification and quantification of M. micros A total of four clinical samples collected intraoperatively (hip samples), which were culture positive, were quantified by TaqMan-PCR for the presence of M. micros. The results showed a range varying from 1.7 103 to 3.6 104 plasmid copies present in the samples. Samples collected from the oral sites were also positive for the presence of M. micros and ranged from 102 to 104, however, in some teeth M. micros was not detected (Fig. 1). Prevotella intermedia and Fusobacterium nucleatum were detected in low numbers in the oral samples (data not shown).
Bacteria spectrum found in joints (Marburg 2001–2003) In our institute, 1267 samples from joints (2001–2003) were evaluated by culture as described above in the last 2.5 years and 1103 samples were sterile. Coagulasenegative Staphylococcus species were observed in 78 samples, while S. aureus was recovered from 35 samples. Other bacteria commonly found in the oral cavity were recovered in 11 samples, i.e. in 6.7% of the joint infections.
ARTICLE IN PRESS 468
H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
Threshold cycle (Ct)
35 30 25 20 15 10 1.E+02
1.E+03
1.E+04 1.E+05 1.E+06 1.E+07 1.E+08 Plasmid copies (M. micros) M. micros alone intraoperative samples oral cavity samples
Fig. 1. Real-time PCR assay of M. micros (intraoperative and oral samples). M. micros alone represents serially diluted plasmid with insert from 16S RNA of this bacterium.
Discussion In the present study, we describe M. micros, the former Peptostreptococcus micros as the etiological agent of a prosthetic hip infection associated with tooth extraction. The time point of the first clinical signs of the hip infection correlated impressively with dental procedures. Although it is known that other processes due to oral hygiene (e.g. tooth brushing) lead to a transient bacteremia and we thus do not have direct evidence linking dental procedures to infection of the hip prosthesis, we do have some convincing hints that both events are not only of coincidental nature: the correlation of time points regarding hip pain and dental procedure and the same biochemical identification and same antibiotic resistance of the isolated bacteria. Accordingly, it is already established that transient bacteremia may occur after a dental procedure (Bartzokas et al., 1994; Waldman et al., 1997). These and other reports have also addressed joint infections which were correlated with organisms typically isolated from the oral flora (Bartzokas et al., 1994; LaPorte et al., 1999; Riesbeck and Sanzen, 1999) suggesting a close association between both conditions. M. micros has been isolated from the oral cavity and has been commonly described in mixed, anaerobic infections of different tissues (Civen et al., 1995; Murdoch et al., 1988; Murdoch et al., 1994). However, the mechanisms involved in the bacterial attachment and multiplication in the prosthetic devices are not fully understood. The pathogenesis of prosthetic joint infection is related to bacteria in biofilms, in which they are protected from antimicrobial killing and host responses rendering these infections difficult to eradicate. Classical microbiological methods failed to reveal the invading pathogen in our patient: the original sample from the first visit of the patient in our out-patient orthopedic department showed no microorganisms (this sample was
not available for re-examination with molecular diagnostic methods). Thus, in contrast to the anamnesis, the clinical signs, the laboratory parameters (pain, CRP) and the results of radiological examinations (CT, szintigraphy), the microbiological assays revealed a wrong etiology of the hip pain. This could have been due to the ‘‘hiding’’ of bacteria in biofilms. An attempt to identify bacterial DNA rather than cultivate entire microorganisms could bring advantages, i.e. improving patient care in terms of rapid, sensitive and accurate diagnosis, reducing unnecessary additional tests and treatments, and lowering medical expenses. So far, limits for these methods exist: first, the need for testing the antimicrobial sensitivity of a pathogen; second, if the pathogen is not known and bacterial DNA has to be amplified by random primers to identify it by DNA sequencing, only one microorganism should be in the sample. Since joint implants may predispose for microbial colonization and infection, the American Dental Association and the American Academy of Orthopedic Surgeons (2003) updated the 1997 statement on antibiotic prophylaxis for dental patients with orthopedic joints. The new protocol stated that antibiotic prophylaxis is not routinely indicated for most dental patients with total joint replacements but pre-medication should be considered in a small number of patients showing increased risk of experiencing hematogenous total joint infection. This includes patients with coexisting immunocompromised status such as diabetes, patients with joint inflammatory disease, patients undergoing chemotherapy or irradiation, and for the first 2 years after joint replacement. In addition, antibiotic prophylaxis is not indicated for dental patients with pins, plates and screws. These positions agree with the ADA Council on Dental Therapeutics (Council on Dental Therapeutics, 1990), the Academy of Oral Medicine (Eskinazi and Rathbun, 1988) and are similar to those of the British Society for Antimicrobial Therapy (Cawson, 1992). However, the incidence stratification of bacteremic dental procedures should also be taken into consideration in determining whether or not antibiotic prophylaxis is appropriate. Dental procedures including dental extractions, as in the case described above, where multiple extraction of infected teeth was performed, present a high incidence of bacteremia. This is also observed for those patients where dental treatment is prolonged (e.g., lasting 445 min). Future studies concerning the connection of oral microorganisms and joint infections should take into consideration new molecular microbiological techniques to improve the data basis on which therapy decisions are built. These studies should also pay attention to the fact that not only typical oral microorganisms can originate from the mouth, but also common bacteria such as S. aureus.
ARTICLE IN PRESS H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
Taken together, our case report and our statistical data indicate that infections of joints, especially those artificially replaced, can be associated with dental procedures. Microorganisms isolated from the joints can originate from the oral cavity and are sometimes hard to culture. Thus, hints from the anamnesis and laboratory parameters indicating an infection with these types of microorganisms (after dental procedures) should lead to an antibiotic treatment. Based on previously published studies from our group (Mutters and Nonnenmacher, 2003), we would suggest the use of modern quinolones (e.g. moxifloxacin) or carbapenems. Moxifloxacin showed to be very effective against Grampositive and Gram-negative anaerobic and microaerophilic microorganisms and is known to penetrate well into tissue (Krasemann et al., 2001). The microbiologist should be informed accordingly to use more appropriate and optimal methods for the analysis of this type of samples; e.g. more sensitive techniques like 16S PCR with random primers.
Acknowledgements The authors thank Detlef Schulz for leaving the outpatient dental data to us and Alexander Dalpke for helping to establish the TaqMan technique.
References American Dental Association, American Academy of Orthopedic Surgeons, 2003. Antibiotic prophylaxis for dental patients with total joint replacements. J. Am. Dent. Assoc. 134, 895–899. Araki, H., Kuriyama, T., Nakagawa, K., Karasawa, T., 2004. The microbial synergy of Peptostreptococcus micros and Prevotella intermedia in a murine abscess model. Oral Microbiol. Immunol. 19, 177–181. Bartzokas, C.A., Johnson, R., Jane, M., Martin, M.V., Pearce, P.K., Saw, Y., 1994. Relation between mouth and haematogenous infection in total joint replacements. BMJ 309, 506–508. Carlsson, J., Larsen, J.T., Edlund, M.B., 1993. Peptostreptococcus micros has a uniquely high capacity to form hydrogen sulfide from glutathione. Oral Microbiol. Immunol. 8, 42–45. Cawson, R.A., 1992. Antibiotic prophylaxis for dental treatment. BMJ 304, 933–934. Civen, R., Jousimies-Somer, H., Marina, M., Borenstein, L., Shah, H., Finegold, S.M., 1995. A retrospective review of cases of anaerobic empyema and update of bacteriology. Clin. Infect. Dis. 20 (Suppl. 2), S224–S229. Coulter, W.A., Coffey, A., Saunders, I.D., Emmerson, A.M., 1990. Bacteremia in children following dental extraction. J. Dent. Res. 69, 1691–1695.
469
Council on Dental Therapeutics, 1990. Management of dental patients with prosthetic joints. J. Am. Dent. Assoc. 121, 537–538. de Sousa, E.L., Ferraz, C.C., Gomes, B.P., Pinheiro, E.T., Teixeira, F.B., de Souza-Filho, F.J., 2003. Bacteriological study of root canals associated with periapical abscesses. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 96, 332–339. Dzink, J.L., Gibbons, R.J., Childs III, W.C., Socransky, S.S., 1989. The predominant cultivable microbiota of crevicular epithelial cells. Oral Microbiol. Immunol. 4, 1–5. Eskinazi, D., Rathbun, W., 1988. Is systematic antimicrobial prophylaxis justified in dental patients with prosthetic joints? Oral Surg. Oral Med. Oral Pathol. 66, 430–431. Fitzgerald Jr., R.H., 1989. Infections of hip prostheses and artificial joints. Infect. Dis. Clin. North. Am. 3, 329–338. Grenier, D., Michaud, J., 1994. Demonstration of human immunoglobulin G Fc-binding activity in oral bacteria. Clin. Diagn. Lab. Immunol. 1, 247–249. Haffajee, A.D., Socransky, S.S., 1994. Microbial etiological agents of destructive periodontal diseases. Periodontology 2000 (5), 78–111. Hanssen, A.D., Rand, J.A., 1999. Evaluation and treatment of infection at the site of a total hip or knee arthroplasty. Instr. Course Lect. 48, 111–122. Krasemann, C., Meyer, J., Tillotson, G., 2001. Evaluation of the clinical microbiology profile of moxifloxacin. Clin. Infect. Dis. 32 (Suppl. 1), 51–63. LaPorte, D.M., Waldman, B.J., Mont, M.A., Hungerford, D.S., 1999. Infections associated with dental procedures in total hip arthroplasty. J. Bone Joint Surg. Br. 81, 56–59. Murdoch, D.A., Mitchelmore, I.J., Tabaqchali, S., 1988. Peptostreptococcus micros in polymicrobial abscesses. Lancet 1 (8585), 594. Murdoch, D.A., Mitchelmore, I.J., Tabaqchali, S., 1994. The clinical importance of gram-positive anaerobic cocci isolated at St Bartholomew’s Hospital, London, in 1987. J. Med. Microbiol. 41, 36–44. Mutters, R., Nonnenmacher, C., 2003. Susceptibility of Grampositive and Gram-negative anaerobic and microaerophilic microorganisms for moxifloxacin and selected antibiotics appropriate for anaerobics. Dtsch. Zahna¨rztl. Z. 58, 302–303. Nonnenmacher, C., Dalpke, A., Mutters, R., Heeg, K., 2004. Quantitative detection of periodontopathogens by real-time PCR. J. Microbiol. Methods 59, 117–125. Otten, J.E., Pelz, K., Christmann, G., 1987. Anaerobic bacteremia following tooth extraction and removal of osteosynthesis plates. J. Oral Maxillofac. Surg. 45, 477–480. Riesbeck, K., Sanzen, L., 1999. Destructive knee joint infection caused by Peptostreptococcus micros: importance of early microbiological diagnosis. J. Clin. Microbiol. 37, 2737–2739. Siqueira Jr., J.F., Rocas, I.N., Andrade, A.F., de Uzeda, M., 2003. Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction. J. Endodont. 29, 111–113.
ARTICLE IN PRESS 470
H. Bartz et al. / International Journal of Medical Microbiology 294 (2005) 465–470
Spangehl, M.J., Younger, A.S., Masri, B.A., Duncan, C.P., 1998. Diagnosis of infection following total hip arthroplasty. Instr. Course Lect. 47, 285–295. Stoll, T., Stucki, G., Bruhlmann, P., Vogt, M., Gschwend, N., Michel, B.A., 1996. Infection of a total knee joint prosthesis by Peptostreptococcus micros and Propionibacterium acnes in an elderly RA patient: implant salvage with longterm antibiotics and needle aspiration/irrigation. Clin. Rheumatol. 15, 399–402.
Syed, S.A., Loesche, W.J., 1972. Survival of human dental plaque flora in various transport media. Appl. Microbiol. 24, 638–644. Tam, Y.C., Chan, E.C., 1985. Purification and characterization of hyaluronidase from oral Peptostreptococcus species. Infect. Immun. 47, 508–513. Waldman, B.J., Mont, M.A., Hungerford, D.S., 1997. Total knee arthroplasty infections associated with dental procedures. Clin. Orthop. 343, 164–172.