- Email: [email protected]
Micropatterned coculture of hepatocytes on electrospun fibers as a potential in vitro model for predictive drug metabolism
Materials Science and Engineering C 63 (2016) 475–484
Contents lists available at ScienceDirect
Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec
Micropatterned coculture of hepatocytes on electrospun fibers as a potential in vitro model for predictive drug metabolism Yaowen Liu a,b, Jiaojun Wei a, Jinfu Lu a, Dongmei Lei a, Shili Yan a, Xiaohong Li a,⁎ a b
Key Laboratory of Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu 610031, PR China College of Food Science, Sichuan Agricultural University, Yaan 625014, PR China
a r t i c l e
i n f o
Article history: Received 19 January 2016 Received in revised form 14 February 2016 Accepted 7 March 2016 Available online 10 March 2016 Keywords: Micropatterned fibrous mats Hepatocyte coculture Hepatocyte spheroid Drug metabolism Drug-drug interaction
a b s t r a c t The liver is the major organ of importance to determine drug dispositions in the body, thus the development of hepatocyte culture systems is of great scientific and practical interests to provide reliable and predictable models for in vitro drug screening. In the current study, to address the challenges of a rapid function loss of primary hepatocytes, the coculture of hepatocytes with fibroblasts and endothelial cells (Hep-Fib-EC) was established on micropatterned fibrous scaffolds. Liver-specific functions, such as the albumin secretion and urea synthesis, were well maintained in the coculture system, accompanied by a rapid formation of multicellular hepatocyte spheroids. The activities of phase I (CYP3A11 and CYP2C9) and phase II enzymes indicated a gradual increase for cocultured hepatocytes, and a maximum level was achieved after 5 days and maintained throughout 15 days of culture. The metabolism testing on model drugs indicated that the scaled clearance rates for hepatocytes in the Hep-Fib-EC coculture system were significantly higher than those of other culture methods, and a linear regression analysis indicated good correlations between the observed data of rats and in vitro predicted values during 15 days of culture. In addition, the enzyme activities and drug clearance rates of hepatocytes in the Hep-Fib-EC coculture model experienced sensitive responsiveness to the inducers and inhibitors of metabolizing enzymes. These results demonstrated the feasibility of micropatterned coculture of hepatocytes as a potential in vitro testing model for the prediction of in vivo drug metabolism. © 2016 Elsevier B.V. All rights reserved.
1. Introduction The modern drug discovery and development has long been interested in identifying high-throughput screening systems to predict the in vivo disposition of new chemical entities. A stable and effective in vitro model would allow investigators to reduce the use of animals in drug testing, to eliminate false lead candidates, and to reduce the incidence of costly late-stage failures during clinical trials. The liver performs many complex functions within the body including the biotransformation of drugs and xenobiotics through high levels of metabolizing enzymes. Thus, the development of an in vitro hepatocyte culture system is of great scientific and practical interests to evaluate the preclinical metabolism and toxicity and to identify potential complications for drug candidates [1]. Hepatoma cell lines, such as HepG2 cells indicate an entire lack or a very low level of many important drug metabolizing enzymes and transporters [2], and thus freshly isolated primary hepatocytes constitute a common model for in vitro drug metabolism testing [3]. Primary hepatocytes are one kind of polarized cells and undergo a rapid loss of their cuboidal morphology within 2–3 days in a monolayer ⁎ Corresponding author. E-mail address: [email protected] (X. Li).
http://dx.doi.org/10.1016/j.msec.2016.03.025 0928-4931/© 2016 Elsevier B.V. All rights reserved.
culture, accompanied by a reduction in the expression of metabolizing enzymes [4]. Attempts have been made to explore a reliable culture of primary hepatocytes for studying drug metabolism and responsiveness to inducers or inhibitors of metabolizing enzymes. One of the strategies is the establishment of three-dimensional (3D) hepatocyte culture by loading cells between two layers of Matrigel or entrapping cells in hydrogels, to reflect more closely the in vivo structure of cells surrounding by extracellular matrices (ECMs) [5]. But the barriers of Matrigel or hydrogel would affect the availability of test compounds to hepatocytes and the mass exchange in the drug screening process [6]. Alternatively, hepatocyte spheroids were established in hanging drop and microfluidic culture system to maintain the hepatocyte morphology and functions [7]. Schutte et al. cultured primary rat hepatocytes on a microspace plate for use in drug metabolism tests over 72 h. Hepatocytes retained their natural cuboidal morphology and showed stable expression of metabolizing enzymes and high sensitivity to an model drug acetaminophen [4]. It should be noted that the neighboring cells and surrounding ECMs determine the morphology and differentiation functions of hepatocytes [8], but an optimal physical, chemical and biological microenvironment has not been identified to maintain high-level cellular functions. Hepatic lobule is the basic unit of liver and consists primarily of hepatocytes, endothelial cells (ECs), fibroblasts, hepatic stellate cells,
476
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
and Kupffer cells. Thus, significant enhancement in hepatocyte phenotype and function has been achieved after coculture of hepatocytes with nonparenchymal cells [9]. Yamada et al. cocultured primary rat hepatocytes with fibroblasts on a hydrogel fiber-based scaffold, and a significant increase in the albumin secretion and urea synthesis was observed because of heterotypic and homotypic cell-cell interactions, compared with conventional monolayer culture and single cultivation in hydrogel fibers [10]. In addition, fibroblasts are not in physical contact with hepatocytes in native liver, and the space of disse resides between fibroblasts and hepatocytes [11]. It was indicated that the random coculture of hepatocytes and fibroblasts restricted hepatocytes move and hampered the formation of spheroids [12]. Thus, micropatterned scaffolds were developed for hepatocyte coculture to confine the cell growth and ECM deposition in patterned regions [13]. Khetani et al. cocultured hepatocytes with non-parenchymal cells on micropatterned areas of a tissue culture plate (TCP), where hepatocytes grew on defined areas as islands, surrounded by fibroblasts which served as feeder cells. It revealed a noticeably improved performance in detecting hepatotoxic drugs when compared with standard sandwich hepatocyte culture [14,15]. However, the two-dimensional (2D) patterned coculture is not sufficient to achieve efficient cell − cell interactions and the formation of 3D hepatic lobule-like microtissues in vitro. Electrospinning is currently the only technique that allows the fabrication of continuous fibers with diameters ranging from several micrometers down to a few nanometers, which have found wide applications in biomedical field [16]. In our previous study, patterned fibrous mats were constructed with distinct ridges and grooves after collection on a glass substrate patterned with an electrically conductive circuit [17]. To reassemble into an in vivo-like structure, micropatterned coculture of hepatocytes was established by precise assembly of cell-loaded patterned fibrous mats, in which hepatocytes were located in patterned regions separately from other types of cells [18,19]. In the current study, the micropatterned coculture of hepatocytes with fibroblasts and ECs was investigated to resemble heterotypic micro-organoids of hepatic lobules. The activities of phase I enzymes CYP3A11 and CYP2C9 and phase II enzymes were determined on the cocultured hepatocytes, along with the mRNA levels of these enzymes. Five drugs with hepatic metabolism covering above enzymes were chosen to predict the clearance rates by the in vitro cocultured hepatocytes, and the correlations with the observed data in vivo were evaluated. Additionally, the inhibition and induction of enzyme activities are the key mechanisms in drug-drug interactions. Thus, the metabolic activities of cocultured hepatocytes were examined by using specific inducers and inhibitors to above enzymes. 2. Materials and methods 2.1. Materials Poly(ethylene glycol)-poly(DL -lactide) (PELA, Mw = 42.3 kDa, Mw/Mn = 1.23) was prepared by bulk ring-opening polymerization of lactide/poly(ethylene glycol using stannous chloride as the initiator [20]. Lactosylated poly(DL-lactide) (lac-PLA, Mw = 7.6 kDa, Mw/Mn = 1.32) was prepared by bulk ring-opening polymerization of lactide using pentaerythritol as the core and stannous octoate as the initiator, followed by conjugation with lactobionic acid [18]. Dimethyl sulfoxide (DMSO), 4,6-diamidino-2-phenylindole dihydrochloride (DAPI), tetramethylrhodamine isothiocyanate (TRITC)-phalloidin, and glutathione were procured from Sigma-Aldrich (St. Louis, MO), and fluorescein diacetate was from Molecular Probes (Carlsbad, CA). Goat antirat albumin antibody was received from Abcam (Cambridge, UK), and goat antirabbit IgG-aminomethylcoumarin acetate (AMCA) was from Innova Biosciences Ltd. (Innova, UK). Rabbit antimouse collagen I antibody, mouse antihuman collagen IV antibody, mouse antigoat IgG-FITC, and goat antimouse IgGTRITC were obtained from Biosynthesis Biotechnology Co., Ltd.
(Wuhan, China). 7-Benzyloxy-4-trifluoromethylcoumarin (BFC), 7hydroxycoumarin (7-HC), and 7-methoxy-4-trifluoromethylcoumarin (MFC) were acquired from Tianjin Heowns Medicine Co. Ltd. (Tianjin, China). Tolbutamide, S-warfarin, midazolam, testosterone, acetaminophen, rifampicin, ketoconazole, and probenecid were purchased from Dalian Meilun Medicine Group Co. Ltd. (Dalian, China). All other chemicals and solvents were of reagent grade or better, and received from Chengdu Kelong Reagent Co. (Chengdu, China), unless otherwise indicated. 2.2. Construction of patterned fibrous scaffolds The patterned scaffolds for loading hepatocytes, fibroblasts and ECs were constructed as described previously [19]. Briefly, a photomask containing parallel strips of 100 and 200 μm wide and gaps between the strips of 300 and 400 μm wide was fabricated by E-beam mask lithography system (Mark 40, CHA Industries, Fremont, CA). Micropatterned collectors were constructed on a glass template patterned with silver circuit by a photolithography process (Suss Mircotec MA6, Germany). PELA and Lac-PLA blends at the weight ratio of 1/1 were dissolved in chloroform and fed into an electrospinning system at 0.6 mL/h by a syringe pump (Zhejiang University Medical Instrument Company, Hangzhou, China). The electrospinning was performed at a voltage of 20 kV using a high voltage statitron (Tianjing High Voltage Power Supply Company, Tianjing, China), and fibers deposited on the patterned collector with a thickness of 400 μm and a strip/gap width of 200/300 μm were used for hepatocyte loading. Additionally, PELA fibers were obtained on patterned collectors with the strip/gap widths of 200/300 μm and 100/400 μm for loading fibroblasts and ECs, respectively. Patterned mats were punched into disks of 15 mm in diameter to fit the well size of a 24-well TCP. 2.3. Establishment of patterned hepatocyte coculture Primary hepatocytes were isolated from livers of adult rats using collagenase perfusion procedure as described previously [21]. Male Sprague-Dawley rats weighing 120–150 g were from Sichuan Dashuo Biotech Inc. (Chengdu, China), and all animal protocols were approved by the University Animal Care and Use Committee. Swiss mouse embryo fibroblasts NIH3T3 and human umbilical vein ECs were from American Type Culture Collection (Rockville, MD). The patterned coculture of hepatocyte with fibroblasts and ECs (Hep-Fib-EC) was established in 24-well TCPs as described previously [19]. Briefly, hepatocytes, fibroblasts, and ECs were seeded on patterned mats at a cell density of 2 × 105, 3.0 × 105 and 1.5 × 105 cells/cm2, respectively. The patterned fibrous mats with cells loaded were rightly stacked by fitting the bulges of one patterned mat nearly into the dents of another mat, ensuring a close contact with each other. The patterned coculture system was incubated in Dulbecco's modified Eagle's medium (DMEM, Gibco BRL, Rockville, MD), supplemented with 10% of fetal bovine serum (FBS), 100 units/mL of penicillin and 100 μg/mL of streptomycin (Gibco BRL, Grand Island, NY), and the culture medium was refreshed every 2–3 days. Patterned coculture of hepatocyte with fibroblasts (Hep-Fib) was established as described above, and hepatocyte culture on the patterned mats was set as the control. 2.4. Characterization of patterned scaffolds and coculture The patterning features of electrospun fibrous mats were observed by an optical microscope (Nikon Eclipse TS100, Japan). Fiber morphologies in the patterned areas were investigated by a scanning electron microscope (SEM, FEI Quanta 200, The Netherlands) equipped with a field-emission gun (20 kV) and a Robinson detector after 2 min of gold coating to minimize the charging effect. The fiber diameter was measured from SEM images as described previously [17]. The distribution
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
of hepatocytes, fibroblasts and ECs on patterned scaffolds was determined after immunohistochemical (IHC) staining on the intracellular albumin, collagen I and collagen IV syntheses, respectively [19]. Briefly, cell-loaded fibrous mats were incubated with goat antirat albumin antibody at 4 °C for 24 h. After washing with PBS, cells were incubated with mouse antigoat IgG-FITC at 37 °C for 30 min. The collage I produced by cocultured fibroblasts was stained using rabbit antirat antibody of collagen I as the primary antibody and goat antirabbit IgG-AMCA as the secondary antibody. IHC staining of collagen IV from cocultured ECs was performed by mouse antihuman collagen IV antibody and goat antimouse IgG-TRITC. The staining images were observed by a confocal laser scanning microscope (CLSM, Leica TCS-SP2, Germany) and merged by ImageJ software to confirm the micropatterned coculture. 2.5. Characterization of cocultured hepatocytes The morphologies of hepatocytes after coculture on patterned scaffolds were observed by SEM as described above, after dehydration of the cell-loaded fibrous mats in a series of graded ethanol solutions and freeze-drying. The organization of actin filaments (F-actin) in hepatocytes was staining with TRITC-phalloidin, followed by counterstaining with DAPI. The biliary excretion of hepatocytes was detected after incubation of cell-loaded mats in culture medium containing 3 mg/mL of fluorescein diacetate at 37 °C for 45 min. The staining images were observed under CLSM as described previously [19]. After hepatocyte coculture for 1, 3, 5, 7, 10, and 15 days, the culture media were retrieved for analysis of the albumin secretion and urea synthesis as described previously [18]. Briefly, the albumin production was determined by an enzyme-linked immunosorbent assay (ELISA) with a quantitation kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The urea production was measured using a commercially available kit from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) based on its specific reaction with diacetyl monoxime. Absorbance was measured with a microplate reader (Elx-800, Bio-Tek Instrument Inc., Winooski, VT), and standard curves were generated using purified rat albumin or urea dissolved in culture media. The urea and albumin secretions were normalized to the cell numbers and per day (μg/106 cells/day).
477
probenecid as specific inhibitors of CYP 3A11 and phase II enzymes, respectively [25].
2.7. Gene expression of enzymes from cocultured hepatocytes Gene expressions profiles for CYP3A11, CYP2C9 and phase II enzymes were determined by a quantitative reverse-transcription polymerase chain reaction (RT-PCR) as described previously [23], and compared to that of β-actin. Due to the complicated phase II detoxification pathways, only UGT1A1, a major phase II metabolism enzyme, was determined [23]. All the premiers for CYP3A11, CYP2C9, UGT1A1, and β-actin were synthesized by Beijing AuGCT DNA-SYN Biotechnology Co., Ltd. (Beijing, China) and their sequences are designed as follows [26]. CYP3A11 forward: TCTGTGCAGAAGCATCGAGTG and reverse: TGGGAGGTGCCTTATTGGG; CYP2C9 forward: AAAAGCACAATCCGCAGT CT and reverse: GCATCTGGCTCCTGTCTTTC; UGT1A1 forward: GGGATT CTCAGAATCTAGACATT and reverse: GTGTGTGGTATAAATGCTGTAGG; and β-actin forward: CTGGCACCCAGCACAATG and reverse: GCCGAT CCACACGGAGTACT. Briefly, hepatocytes cocultured on patterned fibrous scaffolds were washed with PBS and treated with trypsin (Invitrogen, Carlsbad, CA), followed by a mild shaking to remove fibroblasts and/or ECs [23]. The supernatant was aspirated and the attached hepatocytes were washed with culture medium. Total RNA was extracted using an RNeasy Plus Mini Kit (Qiagen Inc., Valencia, CA), and the total RNA concentration was determined by optical densities at 260 nm using a spectrophotometer. cDNA was prepared from the total RNA using a High Capacity RNA-to-cDNA Kit (Applied Biosystem Asia, Singapore) according to manufacturer's instructions. 10 ng of cDNA sample and 1 μL of 10 μM primer were added to 10 μL of reaction mixture containing SYBR Green I master mixture in a 96-well reaction plate. The thermocycling conditions were 95 °C for 10 s, 40 cycles of 95 °C for 5 s and 60 °C for 20 s, followed by a dissociation curve step. The reaction was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems Asia, Singapore), and the gene transcription was evaluated using the △△Ct method and normalized to β-actin [27]. The mRNA levels of cocultured hepatocytes were also determined after incubation with enzyme inductors or inhibitors as described previously.
2.6. Characterization of enzyme activities of cocultured hepatocytes 2.8. Drug metabolism testing on cocultured hepatocytes The activities of CYP3A11, CYP2C9, and phase II enzymes were determined using fluorescent substrates BFC, MFC, and 7-HC, respectively [22]. Briefly, BFC, MFC and 7-HC were dissolved in DMSO, and diluted with culture media to working concentrations at 150 μM of MFC, 100 μM of BFC, and 50 μM of 7-HC. After hepatocyte culture on fibrous meshes for 1, 3, 5, 7, 10, and 15 days, 50 μM of the enzyme substrate was added into the culture medium. Then, 20 μL of culture medium was retrieved from each well every 15 min during 2 h of incubation and added to a 96-well TCP, followed by the addition of 200 μL of acetonitrile to stop the reaction. All samples were sonicated for 3 min and centrifuged at 4000 rpm for 20 min. The fluorescent intensities of the supernatant were measured by a fluorescence spectrophotometer (Hitachi F-7000, Japan), at the exciting/emission wavelengths of 410/538, 333/416, and 370/450 nm for BFC, MFC, and 7-HC, respectively [23]. Standard curves were established with different concentrations of BFC, MFC, and 7-HC, and the enzyme activities were normalized by the cell numbers (pmol/min/106 cells). The enzyme activities of hepatocytes on fibrous meshes were also measured on days 7 and 15 under an induction or inhibition treatment. For the induction tests, hepatocyte cocultures were pretreated for 24 h with 25 μM rifampicin or glutathione as inducers of CYP 3A11 and phase II enzymes, respectively, before incubation with the enzyme substrates [24]. For the inhibition studies, hepatocytes were incubated with the substrate in the presence of 25 μM ketoconazole or 2 mM
Hepatocytes cocultured on patterned fibrous scaffolds were subjected to drug metabolism tests. Midazolam and testosterone were usually used for studying hepatic clearance rates by CYP3A11, while tolbutamide and S-warfarin were metabolized by CYP2C9 [28]. The hepatic clearance rates of phase II enzymes were evaluated after treatment with 25 μM of acetaminophen [29]. Briefly, all the drugs were dissolved in DMSO and diluted in culture medium to ensure a final DMSO concentration of less than 0.2% (v/v). After incubation with cocultured hepatocyte with drugs at a dose of 25 μM for 10, 20, 40, 60, and 120 min, 1.5 mL of the incubation medium was collected, followed by a rapid addition of the same amount of acetonitrile to stop the reaction. The amount of drugs was determined by high-performance liquid chromatography (HPLC, Agligent 1260 infinity, Santa Clara, CA) using a C18 column and an ultraviolet detector. The mobile phase was a gradient mixture of water and acetonitrile with a flow rate of 0.8 mL/min. A mixture of acetonitrile and water (85:15, v/v) was initially maintained for 1 min after sample injection, followed by a linear increase in the percentage of acetonitrile from 85% to 100% in the next 15 min. The column was reequilibrated with the initial mobile phase for 5 min before the next injection. The drug metabolism tests were repeated after coculture of hepatocytes on patterned scaffolds for 7 and 15 days, and also performed in the presence of specific inducers or inhibitors of the enzymes as described previously.
478
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
2.9. Statistical analysis The results are reported as mean ± standard deviation. Whenever appropriate, comparisons among multiple groups were performed by analysis of variance (ANOVA), while a two-tailed Student's t-test was used to discern the statistical difference between two groups. A probability value (p) of less than 0.05 was considered to be statistically significant. 3. Results 3.1. Characterization of hepatocyte coculture on patterned fibrous scaffolds In the current study, patterned fibrous mats were obtained after fiber deposition on patterned collectors with silver strips. Due to Coulombic interactions with the collector, fibers were preferentially deposited on the silver circuit and formed patterns similar to those of the collector. Fig. 1a shows the morphologies of patterned fibrous mats, indicating distinct ridges and grooves. As shown in Fig. 1b,
electrospun fibers deposited on the ridges indicated an apparent alignment along the direction of silver strips. The diameter and pore size of fibrous mats were determined from SEM images using ImageJ software, indicating an average diameter of 1.02 ± 0.21 μm and pore size of 25.6 ± 8.7 μm. Fig. 1c depicts the establishment of patterned coculture by stacking patterned fibrous mats with loaded hepatocytes, fibroblasts, and ECs together. IHC staining of albumin, collagen I, and collagen IV was used to visualize the cocultures of hepatocytes, fibroblasts, and ECs in the patterned regions, respectively. Fig. 1d shows the merged fluorescence signals, indicating that three types of cells selectively resided in the patterned regions without apparent boundary crossing, and the patterned coculture profile remained stable during the experimental period. 3.2. Characterization of cocultured hepatocytes on patterned fibrous scaffolds Fig. 2a shows SEM images of hepatocyte spheroids formed in the Hep-Fib-EC coculture system, consisting of indistinct individual cells
Fig. 1. (a) SEM morphologies of patterned fibrous mats with ridge/groove widths of 200/300 and 100/400 μm. (b) Typical SEM morphologies of fibers in the ridges. (c) Schematic illustration of the micropatterned coculture of hepatocytes with fibroblasts and ECs. (d) Merged CLSM image of immunofluorescent staining of collagen I secretion (blue) by fibroblasts, collagen IV (red) by ECs, and albumin (green) by hepatocytes after micropatterned coculture for 5 days.
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
479
Fig. 2. (a) Typical SEM morphologies, (b) CLSM images of F-actin stained with TRITC-phalloidin and counterstained with DAPI, and (c) CLSM images of fluorescein diacetate-stained excretory function of hepatocyte spheroids after Hep-Fib-EC coculture for 5 days. (d) Albumin secretion and (e) urea synthesis of hepatocytes after Hep-Fib-EC coculture for 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone. n = 5; *: p b 0.05.
with tight cell-cell contacts. Cocultured hepatocytes formed aggregates to maintain their 3D morphologies like in vivo, exhibiting compact polyhedral spheroidal morphology with a rough surface. Fig. 2b shows fluorescent images of F-actin staining, indicating that the cytoskeleton underwent a significant rearrangement and the formation of dense actin fibers. It was suggested that hepatocyte aggregates were effectively formed on fibrous substrates and had strong cell-cell contacts. Bile canaliculi are important for native liver to excrete metabolites and toxins from the body [30]. In the current study, the biliary excretory function of hepatocyte spheroids was investigated by incubating with fluorescein diacetate, which entered cells via a passive diffusion and was hydrolyzed by intracellular esterases into fluorescein before excretion by bile canaliculi. As shown in Fig. 2c, strong fluorescence signals were detected along the border of hepatocytes, indicating that these hepatocytes maintained their ability to uptake chemicals and efflux bile acid. To quantitatively assess the liver-specific functions of hepatocytes, the albumin secretion and urea synthesis were determined after micropatterned cocultures with fibroblasts and ECs, compared with hepatocytes cultured alone. As shown in Fig. 2d and e, hepatocytes cultured alone rapidly lost their functions, and the levels of albumin and urea syntheses were significantly lower at each time point compared to those of cocultured hepatocytes. Although there was a slight decrease throughout 15 days of incubation, the albumin production of hepatocytes in the Hep-Fib-EC coculture system sustained a significantly higher level at 55.6 ± 5.4 μg/106 cells/day than that from Hep-Fib at 35.6 ± 5.2 μg/106 cells/day after 15 days (p b 0.05). As shown in Fig. 2e, similar results were detected for the urea synthesis, at 29.8 ± 4.4 and 22.5 ± 4.2 μg/106 cells/day for hepatocytes in Hep-Fib-EC and Hep-Fib coculture systems, respectively. Particularly, the albumin secretion and urea synthesis in Hep-Fib-EC was about 20
and 15-fold higher than those of hepatocytes cultured alone after 15 days of incubation, respectively. 3.3. Metabolizing enzyme activities of cocultured hepatocyte Drug metabolism in the liver can be divided into two phases. Phase I is characterized by oxidative, reductive, and hydrolytic pathways to add functional groups to the drug substrate. CYP3A11 and CYP2C9 are the most abundant metabolizing enzymes in adult liver and are responsible for 70–80% of all phase I dependent metabolism of clinically used drugs [31]. Phase II metabolism involves the addition of chemical groups (e.g. glycine or acetate), which usually makes the compound less toxic to body tissues and easier to excrete [32]. As shown in Fig. 3, there was a slight increase in the enzyme activities of hepatocyte cultured alone, and the highest activity was observed on day 3, followed by an over 50% reduction after 15 days. However, there was a continuous increase in the activities of CYP3A11, CYP2C9 and phase II enzymes for cocultured hepatocytes during 5 days of incubation. The CYP3A11 activities of hepatocytes in the Hep-Fib-EC coculture system reached 6.39 ± 0.44 pmol/min/106 cells after 5 days, and remained at this level until 15 days (Fig. 3a). However, a continuous decrease in the CYP3A11 activities was detected in the Hep-Fib coculture system from 4.81 ± 0.37 pmol/min/106 cells on day 5 to 4.03 ± 0.31 pmol/min/106 cells on day 15. As shown in Fig. 3, the activity changes of CYP2C9 and phase II enzymes showed a similar trend to that of CYP3A11 during the incubation period. After coculture for 15 days, the CYP2C9 activities of hepatocytes after Hep-Fib-EC coculture were around 1.5 and 7.6-fold higher than those after Hep-Fib coculture and hepatocytes cultured alone, respectively (Fig. 3b). After incubation for 5 days, the phase II enzyme activities in Hep-Fib-EC coculture system reached a high level and remained throughout 15 days at 16.2 ± 1.0 pmol/min/106 cells, which
480
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
Fig. 4. The mRNA levels of CYP 3A11, CYP2C9, and UGT1A1 of phase II enzymes, normalized to that of β-actin, of hepatocytes after Hep-Fib-EC coculture for 7 and 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone.
respectively, compared with those on day 7. As shown in Fig. 4, there was only around 7.4%, 17.1%, and 18.4% decreases in the mRNA levels of CYP3A11, CYP2C9, and phase II enzymes, respectively, for hepatocytes after Hep-Fib-EC coculture. The mRNA levels of CYP3A11, CYP2C9, and phase II enzymes for hepatocytes in Hep-Fib-EC coculture after 15 days were 1.5, 1.8 and 2.9-fold higher than those in Hep-Fib, respectively. It was indicated that hepatocytes in the Hep-Fib-EC coculture system could remain significant higher expression levels of liver-specific genes relevant for the enzymes activity and drug metabolism, which paralleled the trend in the fluorometric activity analysis throughout the culture period (Fig. 3). 3.5. Drug metabolism tests on cocultured hepatocytes The drug metabolism tests were performed on hepatocytes after coculture for 7 and 15 days, by measuring the clearance rates of five compounds with hepatic metabolism covering above enzymes. Fig. 5 shows typical concentration changes of the five drugs during 2 h of metabolizing by hepatocytes after Hep-Fib-EC coculture for 15 days. The intrinsic clearance of each model drug was calculated from the substrate disappearance rate in the culture medium according to the following equation [33]: CLin vitro ¼ ðC 0 − C t Þ V SF=AUC 0‐t N
Fig. 3. The activities of (a) CYP 3A11, (b) CYP2C9, and (c) phase II enzymes, measured using the specific substrates BFC, MFC, and 7-HC, respectively, of hepatocytes after Hep-Fib-EC coculture for 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone. n = 5; *: p b 0.05.
where C0 and Ct are the concentrations (μM) of compound at time 0 and t (min), respectively, and AUC 0-t is the area under the concentration-time curve from 0 to t with a unit of min ⋅ μM. V is the volume of incubation solution (μL), and N is the number of hepatocytes. The intrinsic clearance is further normalized by 10 6 hepatocytes to have a unit of μL/min/106 hepatocytes [33]. A scaling
was around 1.5 and 10-fold higher than those of Hep-Fib coculture and hepatocytes cultured alone, respectively (Fig. 3c). 3.4. Gene expression of metabolic enzymes for cocultured hepatocytes The activities of metabolic enzymes were supported by mRNA expressions in hepatocytes. As shown in Fig. 4, the mRNA levels of CYP 3A11, CYP 2C9, and phase II enzymes, normalized to that of β-actin, for cocultured hepatocytes were expressed at significantly higher levels than those of hepatocytes cultured alone. In addition, there were significant reductions by around 62.5%, 62.5%, and 87.5% in mRNA levels of CYP3A11, CYP2C9, and phase II enzymes, respectively, of hepatocytes cultured alone for 15 days, compared with those after 7 days. The decreases in the mRNA levels were less significant for hepatocytes after coculture with fibroblasts for 15 days, at around 24.1%, 42.3%, and 54.2% for CYP3A11, CYP2C9, and phase II enzymes,
Fig. 5. The concentration changes of midazolam, testosterone, tolbutamide, S-warfarin, and acetaminophen during 2 h of metabolizing by hepatocytes after Hep-Fib-EC coculture for 15 days (n = 5).
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
factor (SF) of 135 × 106 hepatocyte/g of liver and 50 g liver/kg body weight was used in the calculation of in vitro scaled clearance rate (CLin vitro, mL/min/kg) [34]. Fig. 6 summarizes the in vitro scaled clearance rates of the five drugs during 2 h of metabolizing by hepatocytes after coculture for 7 and 15 days. The clearance rate of all the five substrates appeared to be higher for cocultured hepatocytes than those of hepatocytes cultured alone. Midazolam and testosterone were used as the substrate of hepatocyte CYP3A11. As shown in Fig. 6a, the hepatic clearance rates of both midazolam and testosterone maintained significantly higher levels for hepatocytes after coculture in the Hep-Fib-EC system during 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone (p b 0.05). The clearance rates of testosterone by hepatocytes after coculture in the Hep-Fib-EC system were significantly higher than those of Hep-Fib coculture (p b 0.05), at around 55.4% and 107.2% higher after 7 and 15 days, respectively. Fig. 6b shows the metabolism results of tolbutamide and S-warfarin by CYP2C9, indicating a similar profile between them and a profile comparable to that of CYP3A11. The clearance rates of tolbutamide and S-warfarin were around 41.9% and 33.3% higher, respectively, for hepatocytes in the HepFib-EC system than those after Hep-Fib coculture for 7 days. Though there was a slight decrease in the drug clearance rate for hepatocytes after coculture for 15 days, the enhanced metabolism capabilities were remained for hepatocyte in the Hep-Fib-EC coculture system. The scaled clearance rates of tolbutamide and S-warfarin in the Hep-Fib-EC system were around 2.4 and 2.0-fold higher than those in Hep-Fib, respectively. Significant difference in the acetaminophen metabolism was also detected for hepatocytes between Hep-Fib-EC and Hep-Fib systems. As shown in Fig. 6c, hepatocytes after Hep-FibEC coculture for 15 days indicated around 1.8-fold higher clearance rates of acetaminophen than those in the Hep-Fib system. 3.6. In vitro-in vivo correlation analysis of drug metabolism In order to clarify the predication ability of cocultured hepatocytes in the drug metabolism screening, the in vitro predicted values of scaled clearance data of the five compounds were compared to the observed
481
data in vivo. The in vivo clearance rate (CLin vivo) of midazolam in rats is 2.46 mL/min/kg [35], while those of testosterone, tolbutamide, S-warfarin, and acetaminophen were 2.46, 45.1, 0.48, and 12.9 mL/min/kg, respectively [36]. Fig. 7 summarizes the plots of CLin vivo against CLin vitro of hepatocytes after coculture in Hep-FibEC and Hep-Fib for 7 and 15 days, compared with those of hepatocytes cultured alone. A linear regression analysis was performed to obtain the correlation values (R2), which were used to evaluate the correlations between the in vitro predicted clearance values and in vivo observed data [37]. The R2 values for hepatocytes cultured alone and cocultured in Hep-Fib and Hep-Fib-EC for 7 days were 0.341, 0.684, and 0.846, respectively. After incubation for 15 days, the R2 values were 0.182, 0.542, and 0.806 for hepatocytes cultured alone and cocultured in Hep-Fib and Hep-Fib-EC, respectively. 3.7. Induction effects on the cocultured hepatocyte The metabolizing enzymes of hepatocytes play a significant role in the drug metabolism, and the inhibition or induction of metabolic enzymes is an important factor that affects the pharmacokinetics of a drug molecule and cause potential therapeutic failures of coadministered drugs. Therefore, in the current study, drug interactions were investigated in the Hep-Fib-EC coculture system to clarify the inhibition or induction effects on the enzyme activities, gene expression profiles, and drug clearance rates. Rifampicin and glutathione were clinically used inducers for CYP 3A11 and phase II enzymes, respectively [24]. As shown in Fig. 8a, the CYP3A11 activities indicated around 3.5 and 3.2-fold increase after rifampicin treatment on hepatocytes cocultured for 7 and 15 days, respectively. In the meantime, the glutathione treatment on the Hep-Fib-EC culture system led to significantly higher phase II enzyme activities (p b 0.05), at around 2.1 and 1.8-fold increases compared to the control (Fig. 8d). In addition, the induction treatment with rifampicin and glutathione involved an increase in gene transcription of CYP3A11 and phase II enzymes. As shown in Fig. 8b and e, the mRNA levels, normalized to that of β-actin, of CYP3A11 and phase II enzymes showed a 2-fold increase after induction treatment on cocultured hepatocytes. Consistently, the drug clearance rates showed the same change trend of enzymes activities under
Fig. 6. (a) The in vitro scaled clearance rates of midazolam, (b) testosterone, (c) tolbutamide, (d) S-warfarin, and (e) acetaminophen during 2 h of metabolizing by hepatocytes after Hep-Fib-EC coculture for 7 and 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone. n = 5; *: p b 0.05.
482
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
(Fig. 7c). In the meantime, the hepatic clearance rates of acetaminophen indicated around 150% and 143% increase after glutathione treatment on hepatocytes cocultured for 7 and 15 days, respectively (Fig. 7f). 3.8. Inhibition effects on the cocultured hepatocyte Two clinical drugs, ketoconazole and probenecid, were used as inhibitors of CYP 3A11 and phase II enzymes, respectively [25]. As shown in Fig. 8, hepatocytes after coculture in the Hep-Fib-EC system experienced a significant decrease in the activities of CYP 3A11 and phase II enzymes after incubation with these inhibitors. The inhibition treatment led to around 39.5% reduction in the activity and 25.0% decrease in the mRNA levels of CYP 3A11 enzymes, normalized to that of β-actin, for hepatocytes after coculture for 15 days. The hepatic clearance rates of testosterone decreased by around 44.9% and 47.5% after ketoconazole treatment on hepatocytes cocultured for 7 and 15 days, respectively (Fig. 8c). In addition, a similar profile was detected after inhibition treatment of phase II enzymes. As shown in Fig. 8d and e, the phase II enzymes showed around 56.7% and 41.9% reductions in the activities and mRNA levels, respectively, after probenecid treatment on hepatocytes cocultured for 15 days. Obvious decreases in the clearance rates of acetaminophen were determined, at around 79.3% and 81.4% lower after the inhibition treatment with hepatocytes cocultured for 7 and 15 days, respectively (Fig. 8f). Thus, the induction and inhibition of CYP3A11 and phase II enzymes led to an increase or reduction of the testosterone and acetaminophen metabolic capabilities, indicating that the drug interactions can be examined in vitro using the Hep-Fib-EC coculture system. 4. Discussion
Fig. 7. The plots of in vitro scaled clearance rates against in vivo clearance data of midazolam, testosterone, tolbutamide, S-warfarin, and acetaminophen by hepatocytes after Hep-Fib-EC coculture for (a) 7 and (b) 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone.
induction. The rifampicin treatment induced significantly higher clearance rates of testosterone (p b 0.05), showing around 180% and 160% increases for hepatocytes after coculture for 7 and 15 days, respectively
In the current study, patterned collectors with the strip/gap widths of 200/300 μm were used to prepare patterned fibrous mats for loading of hepatocytes and fibroblasts, while ECs were supposed to be loaded on patterned mats from collectors with the strip/gap widths of 100/400 μm. Firstly, the expression of albumin, urea and metabolizing enzymes from hepatocytes indicated different changing profiles during the culture period. The levels of albumin secretion and urea synthesis were maintained during 3–5 days of culture, followed by
Fig. 8. (a) The CYP 3A11 activities, (b) mRNA levels of CYP3A11, and (c) in vitro scaled clearance rates of testosterone by hepatocytes after Hep-Fib-EC coculture for 7 and 15 days, as well as in the presence of rifampicin and ketoconazole as an inducer and inhibitor of CYP3A11, respectively. (d) The activities of phase II enzymes, (e) mRNA levels of UGT1A1 of phase II enzymes, and (f) in vitro scaled clearance rates of acetaminophen by hepatocytes, as well as in the presence of glutathione and probenecid as an inducer and inhibitor of phase II enzymes, respectively (n = 5).
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
a gradual decline during the following incubation (Fig. 2). Though it was quite low at the beginning, due to the diffusion of enzymes from the isolated hepatocytes [38], the enzyme activity increased along with the culture time, and a maximum level was achieved after 5 days and maintained throughout 15 days of culture (Fig. 3). The difference in the changing profiles of albumin and metabolizing enzymes may be resulted from their different sensitivities to the cell polarity and cell-cell interactions. The albumin and urea expressions are more dependent on the hepatocyte polarity, while the enzyme activity is more easily affected by the cell junctions within spheroids [39]. Secondly, the albumin secretion highly depends on hepatocytes from different species, the isolation and culture process of primary cells. The primary hepatocytes isolated from Lewis rats by a collagenase perfusion indicated albumin secretions varying from higher than 120 μg/106 cells/day to less than 10 μg/106 cells/day [23,40]. In the current study, hepatocytes were collected from Sprague-Dawley rats and the albumin secretion was maintained at over 50 μg/106 cells/day after 15 days, which was comparable to or better than the levels from the same hepatocyte source and after coculture with fibroblasts [41, 42]. In the Hep-Fib-EC coculture system, fibroblasts and ECs were not in physical contact with hepatocytes and separately grew within individual spaces. Thus, compared with other culture models, the hepatocyte coculture on the micropatterned fibrous scaffolds not only eliminates the mechanical inhibition on hepatocyte spheroid formation by other cell types, but also enrolls fibroblast and ECs to support the hepatic functions by continuously expressing regulation factors. Thirdly, the metabolism testing was performed with model drugs, and the scaled clearance rates for hepatocytes in the Hep-Fib-EC coculture system were significantly higher than those of other culture methods. A linear regression analysis showed R2 values of over 0.8 for the Hep-Fib-EC coculture system (Fig. 7), indicating good correlations between in vitro predicted values and in vivo observed data in rats. Riley et al. summarized the in vitro metabolism data of acidic, basic, and neutral drugs generated in hepatocytes and microsomes, and the calculated CLin vitro predicted well CLin vivo at R2 of 0.78 for hepatocytes and 0.77 for microsomes [33]. Novik et al. reported an in vitro platform that combined the patented microfluidic device with hepatocytes coculture for drug metabolism studies, indicating that the flow-based coculture system achieved high predictive values at R2 of 0.89 for over 6 days [43]. In the current study, hepatocytes after Hep-Fib-EC coculture indicated stable enzymes activities (Fig. 2) and mRNA expressions (Fig. 3) and high R2 values (Fig. 7) throughout 15 days of incubation. In addition, though some models of hepatocyte culture or cocultures have been previously shown to be functional for over 1 month in vitro [5], the micropatterned coculture of hepatocyte culture was maintained for 15 days in the current study, because this timeframe is enough for common drug examinations. So the complete functional lifetime when the culture model was no longer functional was not assessed. Lastly, the micropatterned coculture could be incorporated into a wide array of emerging drug development platforms, such as multiwell plates and diverse organ-on-a-chip devices, enabling a reusable, inexpensive and scalable technology. Due to the easy accessibility and manipulation, fibroblasts NIH3T3 and/or human umbilical vein ECs are generally used to coculture with hepatocytes to clarify the effect of cocultures on the cellular behaviors [23,44], enabling a reproducible screening model. It should be noted than the expression of drugmetabolizing enzymes by hepatocytes shows significant interspecies variations [45]. Thus, the current study starts with rats to show a proof-of-concept of micropatterned coculture of hepatocytes for drug metabolism testing. The Hep-Fib-EC coculture model demonstrates an easily manipulating strategy to maintain hepatocyte functions, and hepatocytes from other sources and other types of cells could be used in the micropatterned coculture platform to achieve a higher level of hepatocyte functions and a more accurate prediction of drug metabolism in vivo.
483
5. Conclusions The coculture of hepatocytes, fibroblast and ECs was established on micropatterned fibrous scaffolds to retain the liver-specific functions of hepatocytes. The activities of CYP3A11, CYP2C9 and phase II enzymes reached a maximum level after 5 days and maintained throughout 15 days of culture. Compared with other hepatocyte culture method, the Hep-Fib-EC coculture system could remain significantly higher enzyme activities for drug metabolism, higher expression levels of liver-specific genes, higher clearance rates of model drugs, and higher correlation values with in vivo observed data. In addition, the enzyme activities and drug clearance rates of hepatocytes after Hep-Fib-EC coculture experienced sensitive responsiveness to inducers and inhibitors of these enzymes. This result demonstrates the feasibility of the micropatterned coculture of hepatocytes as a potential in vitro testing model for drug metabolism. Acknowledgements This work was supported by National Natural Science Foundation of China (51073130, 21274117 and 31470922) and Fundamental Research Funds for the Central Universities (2062015YXZT06). References [1] J. Bowes, A.J. Brown, J. Hamon, W. Jarolimek, A. Sridhar, G. Waldron, S. Whitebread, Reducing safety-related drug attrition: the use of in vitro pharmacological profiling, Nat. Rev. Drug Discov. 11 (2012) 909–922. [2] A. Asthana, W.S. Kisaalita, Biophysical microenvironment and 3D culture physiological relevance, Drug Discov. Today 18 (2013) 533–540. [3] J. Kim, R.C. Hayward, Mimicking dynamic in vivo environments with stimuli responsive materials for cell culture, Trends Biotechnol. 30 (2012) 426–439. [4] M. Schutte, B. Fox, M.O. Baradez, A. Devonshire, J. Minguez, M. Bokhari, S. Przyborski, D. Marshall, Rat primary hepatocytes show enhanced performance and sensitivity to acetaminophen during three-dimensional culture on a polystyrene scaffold designed for routine use, Assay Drug Dev. Technol. 9 (2011) 475–486. [5] E.L. Lecluyse, R.P. Witek, M.E. Andersen, M.J. Powers, Organotypic liver culture models: meeting current challenges in toxicity testing, Crit. Rev. Toxicol. 42 (2012) 501–548. [6] B. Nugraha, X. Hong, X. Mo, L. Tan, W. Zhang, P.M. Chan, C.H. Kang, Y. Wang, L.T. Beng, W. Sun, D. Choudhury, J.M. Robens, M. McMillian, J. Silva, S. Dallas, C.H. Tan, Z. Yue, H. Yu, Galactosylated cellulosic sponge for multi-well drug safety testing, Biomaterials 32 (2011) 6982–6994. [7] Y.C. Toh, T.C. Lim, D. Tai, G. Xiao, D. van Noort, H. Yu, A microfluidic 3D hepatocyte chip for drug toxicity testing, Lab Chip 9 (2009) 2026–2035. [8] S. Ng, Y.N. Wu, Y. Zhou, Y.E. Toh, Z.Z. Ho, S.M. Chia, J.H. Zhu, H.Q. Mao, H. Yu, Optimization of 3-D hepatocyte culture by controlling the physical and chemical properties of the extra-cellular matrices, Biomaterials 26 (2005) 3153–3163. [9] R. Kostadinova, F. Boess, D. Applegate, L. Suter, T. Weiser, T. Singer, B. Naughton, A. Roth, A long-term three dimensional liver co-culture system for improved prediction of clinically relevant drug-induced hepatotoxicity, Toxicol. Appl. Pharmacol. 268 (2013) 1–16. [10] M. Yamada, R. Utoh, K. Ohashi, K. Tatsumi, M. Yamato, T. Okano, M. Seki, Controlled formation of heterotypic hepatic micro-organoids in anisotropic hydrogel microfibers for long-term preservation of liver-specific functions, Biomaterials 33 (2012) 8304–8315. [11] E.E. Hui, S.N. Bhatia, Micromechanical control of cell-cell interactions, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 5722–5726. [12] K. Nakazawa, Y. Shinmura, A. Higuchi, Y.J. Sakai, Effects of culture conditions on a micropatterned co-culture of rat hepatocytes with 3T3 cells, J. Bioprocess. Biotech. S3 (2011) 002. [13] O. Ukairo, M. McVay, S. Krzyzewski, S. Aoyama, K. Rose, M.E. Andersen, S.R. Khetani, E.L. Lecluyse, Bioactivation and toxicity of acetaminophen in a rat hepatocyte micropatterned coculture system, J. Biochem. Mol. Toxicol. 27 (2013) 471–478. [14] S.R. Khetani, C. Kanchagar, O. Ukairo, S. Krzyzewski, A. Moore, J. Shi, S. Aoyama, M. Aleo, Y. Will, Use of micropatterned cocultures to detect compounds that cause drug-induced liver injury in humans, Toxicol. Sci. 132 (2013) 107–117. [15] C. Lin, J. Shi, A. Moore, S.R. Khetani, Prediction of drug clearance and drug-drug interactions in microscale cultures of human hepatocytes, Drug Metab. Dispos. 44 (2016) 127–136. [16] M. Adabi, R. Saber, R. Faridi-Majidi, F. Faridbod, Performance of electrodes synthesized with polyacrylonitrile-based carbon nanofibers for application in electrochemical sensors and biosensors, Mater. Sci. Eng. C 48 (2015) 673–678. [17] Y.W. Liu, L. Zhang, H.N. Li, S.L. Yan, J.S. Yu, J. Weng, X.H. Li, Electrospun fibrous mats on lithographically micropatterned collectors to control cellular behaviors, Langmuir 28 (2012) 17134–17142. [18] Y.W. Liu, L. Zhang, J.J. Wei, S.L. Yan, J.S. Yu, X.H. Li, Promoting hepatocyte spheroid formation and functions by coculture with fibroblasts on micropatterned electrospun fibrous scaffolds, J. Mater. Chem. B 2 (2014) 3029–3040.
484
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
[19] Y.W. Liu, H.N. Li, S.L. Yan, J.J. Wei, X.H. Li, Hepatocyte cocultures with endothelial cells and fibroblasts on micropatterned fibrous mats to promote liver-specific functions and capillary formation capabilities, Biomacromolecules 15 (2014) 1044–1054. [20] X.H. Li, Y.H. Zhang, W.X. Jia, X.M. Deng, Z.T. Huang, Influence of process parameters on the protein stability encapsulated in poly-dl-lactide-poly(ethylene glycol) microspheres, J. Control. Release 68 (2000) 41–52. [21] P.O. Seglen, Preparation of isolated rat liver cells, Methods Cell Biol. 13 (1976) 29–83. [22] M.T. Donato, N. Jiménez, J.V. Castell, M.J. Gómez-Lechón, Fluorescence-based assays for screening nine cytochrome P450 (P450) activities in intact cells expressing individual human P450 enzymes, Drug Metab. Dispos. 32 (2004) 699–706. [23] S.R. Khetani, S.N. Bhatia, Microscale culture of human liver cells for drug development, Nat. Biotechnol. 26 (2008) 120–126. [24] K. Swales, N. Plant, A. Ayrton, S. Hood, G. Gibson, Relative receptor expression is a determinant in xenobiotic-mediated CYP3A induction in rat and human cells, Xenobiotica 33 (2003) 703–716. [25] Z.H. Liu, S. Zeng, Cytotoxicity of ginkgolic acid in HepG2 cells and primary rat hepatocytes, Toxicol. Lett. 187 (2009) 131–136. [26] Y. Huang, S.L. Zheng, H.Y. Zhu, Z.S. Xu, R.A. Xu, Effects of aescin on cytochrome P450 enzymes in rats, J. Ethnopharmacol. 151 (2014) 583–590. [27] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method, Methods 25 (2001) 402–408. [28] G.T. Tucker, J.B. Houston, S.M. Huang, Optimizing drug development: strategies to assess drug metabolism/transporter interaction potential towards a consensus, Pharm. Res. 18 (2001) 1071–1080. [29] S.E. Kostrubsky, J.F. Sinclair, S.C. Strom, S. Wood, E. Urda, D.B. Stolz, Y.H. Wen, S. Kulkarni, A. Mutlib, Phenobarbital and phenytoin increased acetaminophen hepatotoxicity due to inhibition of UDP-glucuronosyl transferase in cultured human hepatocytes, Toxicol. Sci. 87 (2005) 146–155. [30] X. Liu, J.P. Chism, E.L. LeCluyse, K.R. Brouwer, K.L. Brouwer, Correlation of biliary excretion in sandwich-cultured rat hepatocytes and in vivo in rats, Drug Metab. Dispos. 27 (1999) 637–644. [31] T. Elkayam, S. Amitay-Shaprut, M. Dvir-Ginzberg, T. Harel, S. Cohen, Enhancing the drug metabolism activities of C3A-a human hepatocyte cell line-by tissue engineering within alginate scaffolds, Tissue Eng. 12 (2006) 1357–1368. [32] S. Wilkening, F. Stahl, A. Bader, Comparison of primary human hepatocytes and hepatoma cell line Hepg2 with regard to their biotransformation properties, Drug Metab. Dispos. 31 (2003) 1035–1042.
[33] P. Chao, T. Maguire, E. Novik, K.C. Cheng, M.L. Yarmush, Evaluation of a microfluidic based cell culture platform with primary human hepatocytes for the prediction of hepatic clearance in human, Biochem. Pharmacol. 78 (2009) 625–632. [34] J.B. Houston, Utility of in vitro drug metabolism data in predicting in vivo metabolic clearance, Biochem. Pharmacol. 47 (1994) 1469–1479. [35] C. Lu, P. Li, R. Gallegos, V. Uttamsingh, C.Q. Xia, G.T. Miwa, S.K. Balani, L.S. Gan, Use of cryopreserved human hepatocytes in sandwich culture to measure hepatobiliary transport, Drug Metab. Dispos. 34 (2006) 1600–1605. [36] J. Yin, H. Qiu, J. Dai, Y. Lu, R. Zhao, L. Chen, Q. Meng, Prediction of hepatic plasma clearance in vivo from gel-entrapped rat and humanhepatocytes, Can. J. Physiol. Pharmacol. 91 (2013) 178–186. [37] R.J. Riley, D.F. McGinnity, R.P. Austin, A unified model for predicting human hepatic, metabolic clearance from in vitro intrinsic clearance data in hepatocytes and microsomes, Drug Metab. Dispos. 33 (2005) 1304–1311. [38] M. Rasouli, H. Asgari, Rat liver perfusion and hepatocytes isolation, J. Mazandaran Univ. Med. Sci. 18 (2008) 71–80. [39] M.V. Peshwa, F.J. Wu, B.D. Follstad, F.B. Cerra, W.S. Hu, Kinetics of hepatocyte spheroid formation, Biotechnol. Prog. 10 (1994) 460–466. [40] C.H. Cho, J. Park, D. Nagrath, A.W. Tilles, F. Berthiaume, M. Toner, M.L. Yarmush, Oxygen uptake rates and liver-specific functions of hepatocyte and 3T3 fibroblast co-cultures, Biotechnol. Bioeng. 97 (2007) 188–199. [41] Z.Q. Feng, X.H. Chu, N.P. Huang, M.K. Leach, G. Wang, Y.C. Wang, Y.T. Ding, Z.Z. Gu, Rat hepatocyte aggregate formation on discrete aligned nanofibers of type-I collagen-coated poly(L-lactic acid), Biomaterials 31 (2010) 3604–3612. [42] S. Kidambi, L. Sheng, M.L. Yarmush, M. Toner, I. Lee, C. Chan, Patterned co-culture of primary hepatocytes and fibroblasts using polyelectrolyte multilayer templates, Macromol. Biosci. 7 (2007) 344–353. [43] E. Novik, T.J. Maguire, P. Chao, K.C. Cheng, M.L. Yarmush, A microfluidic hepatic coculture platform for cell-based drug metabolism studies, Biochem. Pharmacol. 79 (2010) 1036–1044. [44] M.F. Leong, J.K.C. Toh, C. Du, K. Narayanan, H.F. Lu, T.C. Lim, A.C.A. Wan, J.Y. Ying, Patterned prevascularised tissue constructs by assembly of polyelectrolyte hydrogel fibres, Nat. Commun. 4 (2013) 2353. [45] M.J. Gómez-Lechón, J.V. Castell, M.T. Donato, Hepatocytes-the choice to investigate drug metabolism and toxicity in man: in vitro variability as a reflection of in vivo, Chem. Biol. Interact. 168 (2007) 30–50.
Contents lists available at ScienceDirect
Materials Science and Engineering C journal homepage: www.elsevier.com/locate/msec
Micropatterned coculture of hepatocytes on electrospun fibers as a potential in vitro model for predictive drug metabolism Yaowen Liu a,b, Jiaojun Wei a, Jinfu Lu a, Dongmei Lei a, Shili Yan a, Xiaohong Li a,⁎ a b
Key Laboratory of Advanced Technologies of Materials, Ministry of Education, School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu 610031, PR China College of Food Science, Sichuan Agricultural University, Yaan 625014, PR China
a r t i c l e
i n f o
Article history: Received 19 January 2016 Received in revised form 14 February 2016 Accepted 7 March 2016 Available online 10 March 2016 Keywords: Micropatterned fibrous mats Hepatocyte coculture Hepatocyte spheroid Drug metabolism Drug-drug interaction
a b s t r a c t The liver is the major organ of importance to determine drug dispositions in the body, thus the development of hepatocyte culture systems is of great scientific and practical interests to provide reliable and predictable models for in vitro drug screening. In the current study, to address the challenges of a rapid function loss of primary hepatocytes, the coculture of hepatocytes with fibroblasts and endothelial cells (Hep-Fib-EC) was established on micropatterned fibrous scaffolds. Liver-specific functions, such as the albumin secretion and urea synthesis, were well maintained in the coculture system, accompanied by a rapid formation of multicellular hepatocyte spheroids. The activities of phase I (CYP3A11 and CYP2C9) and phase II enzymes indicated a gradual increase for cocultured hepatocytes, and a maximum level was achieved after 5 days and maintained throughout 15 days of culture. The metabolism testing on model drugs indicated that the scaled clearance rates for hepatocytes in the Hep-Fib-EC coculture system were significantly higher than those of other culture methods, and a linear regression analysis indicated good correlations between the observed data of rats and in vitro predicted values during 15 days of culture. In addition, the enzyme activities and drug clearance rates of hepatocytes in the Hep-Fib-EC coculture model experienced sensitive responsiveness to the inducers and inhibitors of metabolizing enzymes. These results demonstrated the feasibility of micropatterned coculture of hepatocytes as a potential in vitro testing model for the prediction of in vivo drug metabolism. © 2016 Elsevier B.V. All rights reserved.
1. Introduction The modern drug discovery and development has long been interested in identifying high-throughput screening systems to predict the in vivo disposition of new chemical entities. A stable and effective in vitro model would allow investigators to reduce the use of animals in drug testing, to eliminate false lead candidates, and to reduce the incidence of costly late-stage failures during clinical trials. The liver performs many complex functions within the body including the biotransformation of drugs and xenobiotics through high levels of metabolizing enzymes. Thus, the development of an in vitro hepatocyte culture system is of great scientific and practical interests to evaluate the preclinical metabolism and toxicity and to identify potential complications for drug candidates [1]. Hepatoma cell lines, such as HepG2 cells indicate an entire lack or a very low level of many important drug metabolizing enzymes and transporters [2], and thus freshly isolated primary hepatocytes constitute a common model for in vitro drug metabolism testing [3]. Primary hepatocytes are one kind of polarized cells and undergo a rapid loss of their cuboidal morphology within 2–3 days in a monolayer ⁎ Corresponding author. E-mail address: [email protected] (X. Li).
http://dx.doi.org/10.1016/j.msec.2016.03.025 0928-4931/© 2016 Elsevier B.V. All rights reserved.
culture, accompanied by a reduction in the expression of metabolizing enzymes [4]. Attempts have been made to explore a reliable culture of primary hepatocytes for studying drug metabolism and responsiveness to inducers or inhibitors of metabolizing enzymes. One of the strategies is the establishment of three-dimensional (3D) hepatocyte culture by loading cells between two layers of Matrigel or entrapping cells in hydrogels, to reflect more closely the in vivo structure of cells surrounding by extracellular matrices (ECMs) [5]. But the barriers of Matrigel or hydrogel would affect the availability of test compounds to hepatocytes and the mass exchange in the drug screening process [6]. Alternatively, hepatocyte spheroids were established in hanging drop and microfluidic culture system to maintain the hepatocyte morphology and functions [7]. Schutte et al. cultured primary rat hepatocytes on a microspace plate for use in drug metabolism tests over 72 h. Hepatocytes retained their natural cuboidal morphology and showed stable expression of metabolizing enzymes and high sensitivity to an model drug acetaminophen [4]. It should be noted that the neighboring cells and surrounding ECMs determine the morphology and differentiation functions of hepatocytes [8], but an optimal physical, chemical and biological microenvironment has not been identified to maintain high-level cellular functions. Hepatic lobule is the basic unit of liver and consists primarily of hepatocytes, endothelial cells (ECs), fibroblasts, hepatic stellate cells,
476
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
and Kupffer cells. Thus, significant enhancement in hepatocyte phenotype and function has been achieved after coculture of hepatocytes with nonparenchymal cells [9]. Yamada et al. cocultured primary rat hepatocytes with fibroblasts on a hydrogel fiber-based scaffold, and a significant increase in the albumin secretion and urea synthesis was observed because of heterotypic and homotypic cell-cell interactions, compared with conventional monolayer culture and single cultivation in hydrogel fibers [10]. In addition, fibroblasts are not in physical contact with hepatocytes in native liver, and the space of disse resides between fibroblasts and hepatocytes [11]. It was indicated that the random coculture of hepatocytes and fibroblasts restricted hepatocytes move and hampered the formation of spheroids [12]. Thus, micropatterned scaffolds were developed for hepatocyte coculture to confine the cell growth and ECM deposition in patterned regions [13]. Khetani et al. cocultured hepatocytes with non-parenchymal cells on micropatterned areas of a tissue culture plate (TCP), where hepatocytes grew on defined areas as islands, surrounded by fibroblasts which served as feeder cells. It revealed a noticeably improved performance in detecting hepatotoxic drugs when compared with standard sandwich hepatocyte culture [14,15]. However, the two-dimensional (2D) patterned coculture is not sufficient to achieve efficient cell − cell interactions and the formation of 3D hepatic lobule-like microtissues in vitro. Electrospinning is currently the only technique that allows the fabrication of continuous fibers with diameters ranging from several micrometers down to a few nanometers, which have found wide applications in biomedical field [16]. In our previous study, patterned fibrous mats were constructed with distinct ridges and grooves after collection on a glass substrate patterned with an electrically conductive circuit [17]. To reassemble into an in vivo-like structure, micropatterned coculture of hepatocytes was established by precise assembly of cell-loaded patterned fibrous mats, in which hepatocytes were located in patterned regions separately from other types of cells [18,19]. In the current study, the micropatterned coculture of hepatocytes with fibroblasts and ECs was investigated to resemble heterotypic micro-organoids of hepatic lobules. The activities of phase I enzymes CYP3A11 and CYP2C9 and phase II enzymes were determined on the cocultured hepatocytes, along with the mRNA levels of these enzymes. Five drugs with hepatic metabolism covering above enzymes were chosen to predict the clearance rates by the in vitro cocultured hepatocytes, and the correlations with the observed data in vivo were evaluated. Additionally, the inhibition and induction of enzyme activities are the key mechanisms in drug-drug interactions. Thus, the metabolic activities of cocultured hepatocytes were examined by using specific inducers and inhibitors to above enzymes. 2. Materials and methods 2.1. Materials Poly(ethylene glycol)-poly(DL -lactide) (PELA, Mw = 42.3 kDa, Mw/Mn = 1.23) was prepared by bulk ring-opening polymerization of lactide/poly(ethylene glycol using stannous chloride as the initiator [20]. Lactosylated poly(DL-lactide) (lac-PLA, Mw = 7.6 kDa, Mw/Mn = 1.32) was prepared by bulk ring-opening polymerization of lactide using pentaerythritol as the core and stannous octoate as the initiator, followed by conjugation with lactobionic acid [18]. Dimethyl sulfoxide (DMSO), 4,6-diamidino-2-phenylindole dihydrochloride (DAPI), tetramethylrhodamine isothiocyanate (TRITC)-phalloidin, and glutathione were procured from Sigma-Aldrich (St. Louis, MO), and fluorescein diacetate was from Molecular Probes (Carlsbad, CA). Goat antirat albumin antibody was received from Abcam (Cambridge, UK), and goat antirabbit IgG-aminomethylcoumarin acetate (AMCA) was from Innova Biosciences Ltd. (Innova, UK). Rabbit antimouse collagen I antibody, mouse antihuman collagen IV antibody, mouse antigoat IgG-FITC, and goat antimouse IgGTRITC were obtained from Biosynthesis Biotechnology Co., Ltd.
(Wuhan, China). 7-Benzyloxy-4-trifluoromethylcoumarin (BFC), 7hydroxycoumarin (7-HC), and 7-methoxy-4-trifluoromethylcoumarin (MFC) were acquired from Tianjin Heowns Medicine Co. Ltd. (Tianjin, China). Tolbutamide, S-warfarin, midazolam, testosterone, acetaminophen, rifampicin, ketoconazole, and probenecid were purchased from Dalian Meilun Medicine Group Co. Ltd. (Dalian, China). All other chemicals and solvents were of reagent grade or better, and received from Chengdu Kelong Reagent Co. (Chengdu, China), unless otherwise indicated. 2.2. Construction of patterned fibrous scaffolds The patterned scaffolds for loading hepatocytes, fibroblasts and ECs were constructed as described previously [19]. Briefly, a photomask containing parallel strips of 100 and 200 μm wide and gaps between the strips of 300 and 400 μm wide was fabricated by E-beam mask lithography system (Mark 40, CHA Industries, Fremont, CA). Micropatterned collectors were constructed on a glass template patterned with silver circuit by a photolithography process (Suss Mircotec MA6, Germany). PELA and Lac-PLA blends at the weight ratio of 1/1 were dissolved in chloroform and fed into an electrospinning system at 0.6 mL/h by a syringe pump (Zhejiang University Medical Instrument Company, Hangzhou, China). The electrospinning was performed at a voltage of 20 kV using a high voltage statitron (Tianjing High Voltage Power Supply Company, Tianjing, China), and fibers deposited on the patterned collector with a thickness of 400 μm and a strip/gap width of 200/300 μm were used for hepatocyte loading. Additionally, PELA fibers were obtained on patterned collectors with the strip/gap widths of 200/300 μm and 100/400 μm for loading fibroblasts and ECs, respectively. Patterned mats were punched into disks of 15 mm in diameter to fit the well size of a 24-well TCP. 2.3. Establishment of patterned hepatocyte coculture Primary hepatocytes were isolated from livers of adult rats using collagenase perfusion procedure as described previously [21]. Male Sprague-Dawley rats weighing 120–150 g were from Sichuan Dashuo Biotech Inc. (Chengdu, China), and all animal protocols were approved by the University Animal Care and Use Committee. Swiss mouse embryo fibroblasts NIH3T3 and human umbilical vein ECs were from American Type Culture Collection (Rockville, MD). The patterned coculture of hepatocyte with fibroblasts and ECs (Hep-Fib-EC) was established in 24-well TCPs as described previously [19]. Briefly, hepatocytes, fibroblasts, and ECs were seeded on patterned mats at a cell density of 2 × 105, 3.0 × 105 and 1.5 × 105 cells/cm2, respectively. The patterned fibrous mats with cells loaded were rightly stacked by fitting the bulges of one patterned mat nearly into the dents of another mat, ensuring a close contact with each other. The patterned coculture system was incubated in Dulbecco's modified Eagle's medium (DMEM, Gibco BRL, Rockville, MD), supplemented with 10% of fetal bovine serum (FBS), 100 units/mL of penicillin and 100 μg/mL of streptomycin (Gibco BRL, Grand Island, NY), and the culture medium was refreshed every 2–3 days. Patterned coculture of hepatocyte with fibroblasts (Hep-Fib) was established as described above, and hepatocyte culture on the patterned mats was set as the control. 2.4. Characterization of patterned scaffolds and coculture The patterning features of electrospun fibrous mats were observed by an optical microscope (Nikon Eclipse TS100, Japan). Fiber morphologies in the patterned areas were investigated by a scanning electron microscope (SEM, FEI Quanta 200, The Netherlands) equipped with a field-emission gun (20 kV) and a Robinson detector after 2 min of gold coating to minimize the charging effect. The fiber diameter was measured from SEM images as described previously [17]. The distribution
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
of hepatocytes, fibroblasts and ECs on patterned scaffolds was determined after immunohistochemical (IHC) staining on the intracellular albumin, collagen I and collagen IV syntheses, respectively [19]. Briefly, cell-loaded fibrous mats were incubated with goat antirat albumin antibody at 4 °C for 24 h. After washing with PBS, cells were incubated with mouse antigoat IgG-FITC at 37 °C for 30 min. The collage I produced by cocultured fibroblasts was stained using rabbit antirat antibody of collagen I as the primary antibody and goat antirabbit IgG-AMCA as the secondary antibody. IHC staining of collagen IV from cocultured ECs was performed by mouse antihuman collagen IV antibody and goat antimouse IgG-TRITC. The staining images were observed by a confocal laser scanning microscope (CLSM, Leica TCS-SP2, Germany) and merged by ImageJ software to confirm the micropatterned coculture. 2.5. Characterization of cocultured hepatocytes The morphologies of hepatocytes after coculture on patterned scaffolds were observed by SEM as described above, after dehydration of the cell-loaded fibrous mats in a series of graded ethanol solutions and freeze-drying. The organization of actin filaments (F-actin) in hepatocytes was staining with TRITC-phalloidin, followed by counterstaining with DAPI. The biliary excretion of hepatocytes was detected after incubation of cell-loaded mats in culture medium containing 3 mg/mL of fluorescein diacetate at 37 °C for 45 min. The staining images were observed under CLSM as described previously [19]. After hepatocyte coculture for 1, 3, 5, 7, 10, and 15 days, the culture media were retrieved for analysis of the albumin secretion and urea synthesis as described previously [18]. Briefly, the albumin production was determined by an enzyme-linked immunosorbent assay (ELISA) with a quantitation kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The urea production was measured using a commercially available kit from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) based on its specific reaction with diacetyl monoxime. Absorbance was measured with a microplate reader (Elx-800, Bio-Tek Instrument Inc., Winooski, VT), and standard curves were generated using purified rat albumin or urea dissolved in culture media. The urea and albumin secretions were normalized to the cell numbers and per day (μg/106 cells/day).
477
probenecid as specific inhibitors of CYP 3A11 and phase II enzymes, respectively [25].
2.7. Gene expression of enzymes from cocultured hepatocytes Gene expressions profiles for CYP3A11, CYP2C9 and phase II enzymes were determined by a quantitative reverse-transcription polymerase chain reaction (RT-PCR) as described previously [23], and compared to that of β-actin. Due to the complicated phase II detoxification pathways, only UGT1A1, a major phase II metabolism enzyme, was determined [23]. All the premiers for CYP3A11, CYP2C9, UGT1A1, and β-actin were synthesized by Beijing AuGCT DNA-SYN Biotechnology Co., Ltd. (Beijing, China) and their sequences are designed as follows [26]. CYP3A11 forward: TCTGTGCAGAAGCATCGAGTG and reverse: TGGGAGGTGCCTTATTGGG; CYP2C9 forward: AAAAGCACAATCCGCAGT CT and reverse: GCATCTGGCTCCTGTCTTTC; UGT1A1 forward: GGGATT CTCAGAATCTAGACATT and reverse: GTGTGTGGTATAAATGCTGTAGG; and β-actin forward: CTGGCACCCAGCACAATG and reverse: GCCGAT CCACACGGAGTACT. Briefly, hepatocytes cocultured on patterned fibrous scaffolds were washed with PBS and treated with trypsin (Invitrogen, Carlsbad, CA), followed by a mild shaking to remove fibroblasts and/or ECs [23]. The supernatant was aspirated and the attached hepatocytes were washed with culture medium. Total RNA was extracted using an RNeasy Plus Mini Kit (Qiagen Inc., Valencia, CA), and the total RNA concentration was determined by optical densities at 260 nm using a spectrophotometer. cDNA was prepared from the total RNA using a High Capacity RNA-to-cDNA Kit (Applied Biosystem Asia, Singapore) according to manufacturer's instructions. 10 ng of cDNA sample and 1 μL of 10 μM primer were added to 10 μL of reaction mixture containing SYBR Green I master mixture in a 96-well reaction plate. The thermocycling conditions were 95 °C for 10 s, 40 cycles of 95 °C for 5 s and 60 °C for 20 s, followed by a dissociation curve step. The reaction was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems Asia, Singapore), and the gene transcription was evaluated using the △△Ct method and normalized to β-actin [27]. The mRNA levels of cocultured hepatocytes were also determined after incubation with enzyme inductors or inhibitors as described previously.
2.6. Characterization of enzyme activities of cocultured hepatocytes 2.8. Drug metabolism testing on cocultured hepatocytes The activities of CYP3A11, CYP2C9, and phase II enzymes were determined using fluorescent substrates BFC, MFC, and 7-HC, respectively [22]. Briefly, BFC, MFC and 7-HC were dissolved in DMSO, and diluted with culture media to working concentrations at 150 μM of MFC, 100 μM of BFC, and 50 μM of 7-HC. After hepatocyte culture on fibrous meshes for 1, 3, 5, 7, 10, and 15 days, 50 μM of the enzyme substrate was added into the culture medium. Then, 20 μL of culture medium was retrieved from each well every 15 min during 2 h of incubation and added to a 96-well TCP, followed by the addition of 200 μL of acetonitrile to stop the reaction. All samples were sonicated for 3 min and centrifuged at 4000 rpm for 20 min. The fluorescent intensities of the supernatant were measured by a fluorescence spectrophotometer (Hitachi F-7000, Japan), at the exciting/emission wavelengths of 410/538, 333/416, and 370/450 nm for BFC, MFC, and 7-HC, respectively [23]. Standard curves were established with different concentrations of BFC, MFC, and 7-HC, and the enzyme activities were normalized by the cell numbers (pmol/min/106 cells). The enzyme activities of hepatocytes on fibrous meshes were also measured on days 7 and 15 under an induction or inhibition treatment. For the induction tests, hepatocyte cocultures were pretreated for 24 h with 25 μM rifampicin or glutathione as inducers of CYP 3A11 and phase II enzymes, respectively, before incubation with the enzyme substrates [24]. For the inhibition studies, hepatocytes were incubated with the substrate in the presence of 25 μM ketoconazole or 2 mM
Hepatocytes cocultured on patterned fibrous scaffolds were subjected to drug metabolism tests. Midazolam and testosterone were usually used for studying hepatic clearance rates by CYP3A11, while tolbutamide and S-warfarin were metabolized by CYP2C9 [28]. The hepatic clearance rates of phase II enzymes were evaluated after treatment with 25 μM of acetaminophen [29]. Briefly, all the drugs were dissolved in DMSO and diluted in culture medium to ensure a final DMSO concentration of less than 0.2% (v/v). After incubation with cocultured hepatocyte with drugs at a dose of 25 μM for 10, 20, 40, 60, and 120 min, 1.5 mL of the incubation medium was collected, followed by a rapid addition of the same amount of acetonitrile to stop the reaction. The amount of drugs was determined by high-performance liquid chromatography (HPLC, Agligent 1260 infinity, Santa Clara, CA) using a C18 column and an ultraviolet detector. The mobile phase was a gradient mixture of water and acetonitrile with a flow rate of 0.8 mL/min. A mixture of acetonitrile and water (85:15, v/v) was initially maintained for 1 min after sample injection, followed by a linear increase in the percentage of acetonitrile from 85% to 100% in the next 15 min. The column was reequilibrated with the initial mobile phase for 5 min before the next injection. The drug metabolism tests were repeated after coculture of hepatocytes on patterned scaffolds for 7 and 15 days, and also performed in the presence of specific inducers or inhibitors of the enzymes as described previously.
478
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
2.9. Statistical analysis The results are reported as mean ± standard deviation. Whenever appropriate, comparisons among multiple groups were performed by analysis of variance (ANOVA), while a two-tailed Student's t-test was used to discern the statistical difference between two groups. A probability value (p) of less than 0.05 was considered to be statistically significant. 3. Results 3.1. Characterization of hepatocyte coculture on patterned fibrous scaffolds In the current study, patterned fibrous mats were obtained after fiber deposition on patterned collectors with silver strips. Due to Coulombic interactions with the collector, fibers were preferentially deposited on the silver circuit and formed patterns similar to those of the collector. Fig. 1a shows the morphologies of patterned fibrous mats, indicating distinct ridges and grooves. As shown in Fig. 1b,
electrospun fibers deposited on the ridges indicated an apparent alignment along the direction of silver strips. The diameter and pore size of fibrous mats were determined from SEM images using ImageJ software, indicating an average diameter of 1.02 ± 0.21 μm and pore size of 25.6 ± 8.7 μm. Fig. 1c depicts the establishment of patterned coculture by stacking patterned fibrous mats with loaded hepatocytes, fibroblasts, and ECs together. IHC staining of albumin, collagen I, and collagen IV was used to visualize the cocultures of hepatocytes, fibroblasts, and ECs in the patterned regions, respectively. Fig. 1d shows the merged fluorescence signals, indicating that three types of cells selectively resided in the patterned regions without apparent boundary crossing, and the patterned coculture profile remained stable during the experimental period. 3.2. Characterization of cocultured hepatocytes on patterned fibrous scaffolds Fig. 2a shows SEM images of hepatocyte spheroids formed in the Hep-Fib-EC coculture system, consisting of indistinct individual cells
Fig. 1. (a) SEM morphologies of patterned fibrous mats with ridge/groove widths of 200/300 and 100/400 μm. (b) Typical SEM morphologies of fibers in the ridges. (c) Schematic illustration of the micropatterned coculture of hepatocytes with fibroblasts and ECs. (d) Merged CLSM image of immunofluorescent staining of collagen I secretion (blue) by fibroblasts, collagen IV (red) by ECs, and albumin (green) by hepatocytes after micropatterned coculture for 5 days.
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
479
Fig. 2. (a) Typical SEM morphologies, (b) CLSM images of F-actin stained with TRITC-phalloidin and counterstained with DAPI, and (c) CLSM images of fluorescein diacetate-stained excretory function of hepatocyte spheroids after Hep-Fib-EC coculture for 5 days. (d) Albumin secretion and (e) urea synthesis of hepatocytes after Hep-Fib-EC coculture for 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone. n = 5; *: p b 0.05.
with tight cell-cell contacts. Cocultured hepatocytes formed aggregates to maintain their 3D morphologies like in vivo, exhibiting compact polyhedral spheroidal morphology with a rough surface. Fig. 2b shows fluorescent images of F-actin staining, indicating that the cytoskeleton underwent a significant rearrangement and the formation of dense actin fibers. It was suggested that hepatocyte aggregates were effectively formed on fibrous substrates and had strong cell-cell contacts. Bile canaliculi are important for native liver to excrete metabolites and toxins from the body [30]. In the current study, the biliary excretory function of hepatocyte spheroids was investigated by incubating with fluorescein diacetate, which entered cells via a passive diffusion and was hydrolyzed by intracellular esterases into fluorescein before excretion by bile canaliculi. As shown in Fig. 2c, strong fluorescence signals were detected along the border of hepatocytes, indicating that these hepatocytes maintained their ability to uptake chemicals and efflux bile acid. To quantitatively assess the liver-specific functions of hepatocytes, the albumin secretion and urea synthesis were determined after micropatterned cocultures with fibroblasts and ECs, compared with hepatocytes cultured alone. As shown in Fig. 2d and e, hepatocytes cultured alone rapidly lost their functions, and the levels of albumin and urea syntheses were significantly lower at each time point compared to those of cocultured hepatocytes. Although there was a slight decrease throughout 15 days of incubation, the albumin production of hepatocytes in the Hep-Fib-EC coculture system sustained a significantly higher level at 55.6 ± 5.4 μg/106 cells/day than that from Hep-Fib at 35.6 ± 5.2 μg/106 cells/day after 15 days (p b 0.05). As shown in Fig. 2e, similar results were detected for the urea synthesis, at 29.8 ± 4.4 and 22.5 ± 4.2 μg/106 cells/day for hepatocytes in Hep-Fib-EC and Hep-Fib coculture systems, respectively. Particularly, the albumin secretion and urea synthesis in Hep-Fib-EC was about 20
and 15-fold higher than those of hepatocytes cultured alone after 15 days of incubation, respectively. 3.3. Metabolizing enzyme activities of cocultured hepatocyte Drug metabolism in the liver can be divided into two phases. Phase I is characterized by oxidative, reductive, and hydrolytic pathways to add functional groups to the drug substrate. CYP3A11 and CYP2C9 are the most abundant metabolizing enzymes in adult liver and are responsible for 70–80% of all phase I dependent metabolism of clinically used drugs [31]. Phase II metabolism involves the addition of chemical groups (e.g. glycine or acetate), which usually makes the compound less toxic to body tissues and easier to excrete [32]. As shown in Fig. 3, there was a slight increase in the enzyme activities of hepatocyte cultured alone, and the highest activity was observed on day 3, followed by an over 50% reduction after 15 days. However, there was a continuous increase in the activities of CYP3A11, CYP2C9 and phase II enzymes for cocultured hepatocytes during 5 days of incubation. The CYP3A11 activities of hepatocytes in the Hep-Fib-EC coculture system reached 6.39 ± 0.44 pmol/min/106 cells after 5 days, and remained at this level until 15 days (Fig. 3a). However, a continuous decrease in the CYP3A11 activities was detected in the Hep-Fib coculture system from 4.81 ± 0.37 pmol/min/106 cells on day 5 to 4.03 ± 0.31 pmol/min/106 cells on day 15. As shown in Fig. 3, the activity changes of CYP2C9 and phase II enzymes showed a similar trend to that of CYP3A11 during the incubation period. After coculture for 15 days, the CYP2C9 activities of hepatocytes after Hep-Fib-EC coculture were around 1.5 and 7.6-fold higher than those after Hep-Fib coculture and hepatocytes cultured alone, respectively (Fig. 3b). After incubation for 5 days, the phase II enzyme activities in Hep-Fib-EC coculture system reached a high level and remained throughout 15 days at 16.2 ± 1.0 pmol/min/106 cells, which
480
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
Fig. 4. The mRNA levels of CYP 3A11, CYP2C9, and UGT1A1 of phase II enzymes, normalized to that of β-actin, of hepatocytes after Hep-Fib-EC coculture for 7 and 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone.
respectively, compared with those on day 7. As shown in Fig. 4, there was only around 7.4%, 17.1%, and 18.4% decreases in the mRNA levels of CYP3A11, CYP2C9, and phase II enzymes, respectively, for hepatocytes after Hep-Fib-EC coculture. The mRNA levels of CYP3A11, CYP2C9, and phase II enzymes for hepatocytes in Hep-Fib-EC coculture after 15 days were 1.5, 1.8 and 2.9-fold higher than those in Hep-Fib, respectively. It was indicated that hepatocytes in the Hep-Fib-EC coculture system could remain significant higher expression levels of liver-specific genes relevant for the enzymes activity and drug metabolism, which paralleled the trend in the fluorometric activity analysis throughout the culture period (Fig. 3). 3.5. Drug metabolism tests on cocultured hepatocytes The drug metabolism tests were performed on hepatocytes after coculture for 7 and 15 days, by measuring the clearance rates of five compounds with hepatic metabolism covering above enzymes. Fig. 5 shows typical concentration changes of the five drugs during 2 h of metabolizing by hepatocytes after Hep-Fib-EC coculture for 15 days. The intrinsic clearance of each model drug was calculated from the substrate disappearance rate in the culture medium according to the following equation [33]: CLin vitro ¼ ðC 0 − C t Þ V SF=AUC 0‐t N
Fig. 3. The activities of (a) CYP 3A11, (b) CYP2C9, and (c) phase II enzymes, measured using the specific substrates BFC, MFC, and 7-HC, respectively, of hepatocytes after Hep-Fib-EC coculture for 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone. n = 5; *: p b 0.05.
where C0 and Ct are the concentrations (μM) of compound at time 0 and t (min), respectively, and AUC 0-t is the area under the concentration-time curve from 0 to t with a unit of min ⋅ μM. V is the volume of incubation solution (μL), and N is the number of hepatocytes. The intrinsic clearance is further normalized by 10 6 hepatocytes to have a unit of μL/min/106 hepatocytes [33]. A scaling
was around 1.5 and 10-fold higher than those of Hep-Fib coculture and hepatocytes cultured alone, respectively (Fig. 3c). 3.4. Gene expression of metabolic enzymes for cocultured hepatocytes The activities of metabolic enzymes were supported by mRNA expressions in hepatocytes. As shown in Fig. 4, the mRNA levels of CYP 3A11, CYP 2C9, and phase II enzymes, normalized to that of β-actin, for cocultured hepatocytes were expressed at significantly higher levels than those of hepatocytes cultured alone. In addition, there were significant reductions by around 62.5%, 62.5%, and 87.5% in mRNA levels of CYP3A11, CYP2C9, and phase II enzymes, respectively, of hepatocytes cultured alone for 15 days, compared with those after 7 days. The decreases in the mRNA levels were less significant for hepatocytes after coculture with fibroblasts for 15 days, at around 24.1%, 42.3%, and 54.2% for CYP3A11, CYP2C9, and phase II enzymes,
Fig. 5. The concentration changes of midazolam, testosterone, tolbutamide, S-warfarin, and acetaminophen during 2 h of metabolizing by hepatocytes after Hep-Fib-EC coculture for 15 days (n = 5).
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
factor (SF) of 135 × 106 hepatocyte/g of liver and 50 g liver/kg body weight was used in the calculation of in vitro scaled clearance rate (CLin vitro, mL/min/kg) [34]. Fig. 6 summarizes the in vitro scaled clearance rates of the five drugs during 2 h of metabolizing by hepatocytes after coculture for 7 and 15 days. The clearance rate of all the five substrates appeared to be higher for cocultured hepatocytes than those of hepatocytes cultured alone. Midazolam and testosterone were used as the substrate of hepatocyte CYP3A11. As shown in Fig. 6a, the hepatic clearance rates of both midazolam and testosterone maintained significantly higher levels for hepatocytes after coculture in the Hep-Fib-EC system during 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone (p b 0.05). The clearance rates of testosterone by hepatocytes after coculture in the Hep-Fib-EC system were significantly higher than those of Hep-Fib coculture (p b 0.05), at around 55.4% and 107.2% higher after 7 and 15 days, respectively. Fig. 6b shows the metabolism results of tolbutamide and S-warfarin by CYP2C9, indicating a similar profile between them and a profile comparable to that of CYP3A11. The clearance rates of tolbutamide and S-warfarin were around 41.9% and 33.3% higher, respectively, for hepatocytes in the HepFib-EC system than those after Hep-Fib coculture for 7 days. Though there was a slight decrease in the drug clearance rate for hepatocytes after coculture for 15 days, the enhanced metabolism capabilities were remained for hepatocyte in the Hep-Fib-EC coculture system. The scaled clearance rates of tolbutamide and S-warfarin in the Hep-Fib-EC system were around 2.4 and 2.0-fold higher than those in Hep-Fib, respectively. Significant difference in the acetaminophen metabolism was also detected for hepatocytes between Hep-Fib-EC and Hep-Fib systems. As shown in Fig. 6c, hepatocytes after Hep-FibEC coculture for 15 days indicated around 1.8-fold higher clearance rates of acetaminophen than those in the Hep-Fib system. 3.6. In vitro-in vivo correlation analysis of drug metabolism In order to clarify the predication ability of cocultured hepatocytes in the drug metabolism screening, the in vitro predicted values of scaled clearance data of the five compounds were compared to the observed
481
data in vivo. The in vivo clearance rate (CLin vivo) of midazolam in rats is 2.46 mL/min/kg [35], while those of testosterone, tolbutamide, S-warfarin, and acetaminophen were 2.46, 45.1, 0.48, and 12.9 mL/min/kg, respectively [36]. Fig. 7 summarizes the plots of CLin vivo against CLin vitro of hepatocytes after coculture in Hep-FibEC and Hep-Fib for 7 and 15 days, compared with those of hepatocytes cultured alone. A linear regression analysis was performed to obtain the correlation values (R2), which were used to evaluate the correlations between the in vitro predicted clearance values and in vivo observed data [37]. The R2 values for hepatocytes cultured alone and cocultured in Hep-Fib and Hep-Fib-EC for 7 days were 0.341, 0.684, and 0.846, respectively. After incubation for 15 days, the R2 values were 0.182, 0.542, and 0.806 for hepatocytes cultured alone and cocultured in Hep-Fib and Hep-Fib-EC, respectively. 3.7. Induction effects on the cocultured hepatocyte The metabolizing enzymes of hepatocytes play a significant role in the drug metabolism, and the inhibition or induction of metabolic enzymes is an important factor that affects the pharmacokinetics of a drug molecule and cause potential therapeutic failures of coadministered drugs. Therefore, in the current study, drug interactions were investigated in the Hep-Fib-EC coculture system to clarify the inhibition or induction effects on the enzyme activities, gene expression profiles, and drug clearance rates. Rifampicin and glutathione were clinically used inducers for CYP 3A11 and phase II enzymes, respectively [24]. As shown in Fig. 8a, the CYP3A11 activities indicated around 3.5 and 3.2-fold increase after rifampicin treatment on hepatocytes cocultured for 7 and 15 days, respectively. In the meantime, the glutathione treatment on the Hep-Fib-EC culture system led to significantly higher phase II enzyme activities (p b 0.05), at around 2.1 and 1.8-fold increases compared to the control (Fig. 8d). In addition, the induction treatment with rifampicin and glutathione involved an increase in gene transcription of CYP3A11 and phase II enzymes. As shown in Fig. 8b and e, the mRNA levels, normalized to that of β-actin, of CYP3A11 and phase II enzymes showed a 2-fold increase after induction treatment on cocultured hepatocytes. Consistently, the drug clearance rates showed the same change trend of enzymes activities under
Fig. 6. (a) The in vitro scaled clearance rates of midazolam, (b) testosterone, (c) tolbutamide, (d) S-warfarin, and (e) acetaminophen during 2 h of metabolizing by hepatocytes after Hep-Fib-EC coculture for 7 and 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone. n = 5; *: p b 0.05.
482
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
(Fig. 7c). In the meantime, the hepatic clearance rates of acetaminophen indicated around 150% and 143% increase after glutathione treatment on hepatocytes cocultured for 7 and 15 days, respectively (Fig. 7f). 3.8. Inhibition effects on the cocultured hepatocyte Two clinical drugs, ketoconazole and probenecid, were used as inhibitors of CYP 3A11 and phase II enzymes, respectively [25]. As shown in Fig. 8, hepatocytes after coculture in the Hep-Fib-EC system experienced a significant decrease in the activities of CYP 3A11 and phase II enzymes after incubation with these inhibitors. The inhibition treatment led to around 39.5% reduction in the activity and 25.0% decrease in the mRNA levels of CYP 3A11 enzymes, normalized to that of β-actin, for hepatocytes after coculture for 15 days. The hepatic clearance rates of testosterone decreased by around 44.9% and 47.5% after ketoconazole treatment on hepatocytes cocultured for 7 and 15 days, respectively (Fig. 8c). In addition, a similar profile was detected after inhibition treatment of phase II enzymes. As shown in Fig. 8d and e, the phase II enzymes showed around 56.7% and 41.9% reductions in the activities and mRNA levels, respectively, after probenecid treatment on hepatocytes cocultured for 15 days. Obvious decreases in the clearance rates of acetaminophen were determined, at around 79.3% and 81.4% lower after the inhibition treatment with hepatocytes cocultured for 7 and 15 days, respectively (Fig. 8f). Thus, the induction and inhibition of CYP3A11 and phase II enzymes led to an increase or reduction of the testosterone and acetaminophen metabolic capabilities, indicating that the drug interactions can be examined in vitro using the Hep-Fib-EC coculture system. 4. Discussion
Fig. 7. The plots of in vitro scaled clearance rates against in vivo clearance data of midazolam, testosterone, tolbutamide, S-warfarin, and acetaminophen by hepatocytes after Hep-Fib-EC coculture for (a) 7 and (b) 15 days, compared with those of Hep-Fib coculture and hepatocytes cultured alone.
induction. The rifampicin treatment induced significantly higher clearance rates of testosterone (p b 0.05), showing around 180% and 160% increases for hepatocytes after coculture for 7 and 15 days, respectively
In the current study, patterned collectors with the strip/gap widths of 200/300 μm were used to prepare patterned fibrous mats for loading of hepatocytes and fibroblasts, while ECs were supposed to be loaded on patterned mats from collectors with the strip/gap widths of 100/400 μm. Firstly, the expression of albumin, urea and metabolizing enzymes from hepatocytes indicated different changing profiles during the culture period. The levels of albumin secretion and urea synthesis were maintained during 3–5 days of culture, followed by
Fig. 8. (a) The CYP 3A11 activities, (b) mRNA levels of CYP3A11, and (c) in vitro scaled clearance rates of testosterone by hepatocytes after Hep-Fib-EC coculture for 7 and 15 days, as well as in the presence of rifampicin and ketoconazole as an inducer and inhibitor of CYP3A11, respectively. (d) The activities of phase II enzymes, (e) mRNA levels of UGT1A1 of phase II enzymes, and (f) in vitro scaled clearance rates of acetaminophen by hepatocytes, as well as in the presence of glutathione and probenecid as an inducer and inhibitor of phase II enzymes, respectively (n = 5).
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
a gradual decline during the following incubation (Fig. 2). Though it was quite low at the beginning, due to the diffusion of enzymes from the isolated hepatocytes [38], the enzyme activity increased along with the culture time, and a maximum level was achieved after 5 days and maintained throughout 15 days of culture (Fig. 3). The difference in the changing profiles of albumin and metabolizing enzymes may be resulted from their different sensitivities to the cell polarity and cell-cell interactions. The albumin and urea expressions are more dependent on the hepatocyte polarity, while the enzyme activity is more easily affected by the cell junctions within spheroids [39]. Secondly, the albumin secretion highly depends on hepatocytes from different species, the isolation and culture process of primary cells. The primary hepatocytes isolated from Lewis rats by a collagenase perfusion indicated albumin secretions varying from higher than 120 μg/106 cells/day to less than 10 μg/106 cells/day [23,40]. In the current study, hepatocytes were collected from Sprague-Dawley rats and the albumin secretion was maintained at over 50 μg/106 cells/day after 15 days, which was comparable to or better than the levels from the same hepatocyte source and after coculture with fibroblasts [41, 42]. In the Hep-Fib-EC coculture system, fibroblasts and ECs were not in physical contact with hepatocytes and separately grew within individual spaces. Thus, compared with other culture models, the hepatocyte coculture on the micropatterned fibrous scaffolds not only eliminates the mechanical inhibition on hepatocyte spheroid formation by other cell types, but also enrolls fibroblast and ECs to support the hepatic functions by continuously expressing regulation factors. Thirdly, the metabolism testing was performed with model drugs, and the scaled clearance rates for hepatocytes in the Hep-Fib-EC coculture system were significantly higher than those of other culture methods. A linear regression analysis showed R2 values of over 0.8 for the Hep-Fib-EC coculture system (Fig. 7), indicating good correlations between in vitro predicted values and in vivo observed data in rats. Riley et al. summarized the in vitro metabolism data of acidic, basic, and neutral drugs generated in hepatocytes and microsomes, and the calculated CLin vitro predicted well CLin vivo at R2 of 0.78 for hepatocytes and 0.77 for microsomes [33]. Novik et al. reported an in vitro platform that combined the patented microfluidic device with hepatocytes coculture for drug metabolism studies, indicating that the flow-based coculture system achieved high predictive values at R2 of 0.89 for over 6 days [43]. In the current study, hepatocytes after Hep-Fib-EC coculture indicated stable enzymes activities (Fig. 2) and mRNA expressions (Fig. 3) and high R2 values (Fig. 7) throughout 15 days of incubation. In addition, though some models of hepatocyte culture or cocultures have been previously shown to be functional for over 1 month in vitro [5], the micropatterned coculture of hepatocyte culture was maintained for 15 days in the current study, because this timeframe is enough for common drug examinations. So the complete functional lifetime when the culture model was no longer functional was not assessed. Lastly, the micropatterned coculture could be incorporated into a wide array of emerging drug development platforms, such as multiwell plates and diverse organ-on-a-chip devices, enabling a reusable, inexpensive and scalable technology. Due to the easy accessibility and manipulation, fibroblasts NIH3T3 and/or human umbilical vein ECs are generally used to coculture with hepatocytes to clarify the effect of cocultures on the cellular behaviors [23,44], enabling a reproducible screening model. It should be noted than the expression of drugmetabolizing enzymes by hepatocytes shows significant interspecies variations [45]. Thus, the current study starts with rats to show a proof-of-concept of micropatterned coculture of hepatocytes for drug metabolism testing. The Hep-Fib-EC coculture model demonstrates an easily manipulating strategy to maintain hepatocyte functions, and hepatocytes from other sources and other types of cells could be used in the micropatterned coculture platform to achieve a higher level of hepatocyte functions and a more accurate prediction of drug metabolism in vivo.
483
5. Conclusions The coculture of hepatocytes, fibroblast and ECs was established on micropatterned fibrous scaffolds to retain the liver-specific functions of hepatocytes. The activities of CYP3A11, CYP2C9 and phase II enzymes reached a maximum level after 5 days and maintained throughout 15 days of culture. Compared with other hepatocyte culture method, the Hep-Fib-EC coculture system could remain significantly higher enzyme activities for drug metabolism, higher expression levels of liver-specific genes, higher clearance rates of model drugs, and higher correlation values with in vivo observed data. In addition, the enzyme activities and drug clearance rates of hepatocytes after Hep-Fib-EC coculture experienced sensitive responsiveness to inducers and inhibitors of these enzymes. This result demonstrates the feasibility of the micropatterned coculture of hepatocytes as a potential in vitro testing model for drug metabolism. Acknowledgements This work was supported by National Natural Science Foundation of China (51073130, 21274117 and 31470922) and Fundamental Research Funds for the Central Universities (2062015YXZT06). References [1] J. Bowes, A.J. Brown, J. Hamon, W. Jarolimek, A. Sridhar, G. Waldron, S. Whitebread, Reducing safety-related drug attrition: the use of in vitro pharmacological profiling, Nat. Rev. Drug Discov. 11 (2012) 909–922. [2] A. Asthana, W.S. Kisaalita, Biophysical microenvironment and 3D culture physiological relevance, Drug Discov. Today 18 (2013) 533–540. [3] J. Kim, R.C. Hayward, Mimicking dynamic in vivo environments with stimuli responsive materials for cell culture, Trends Biotechnol. 30 (2012) 426–439. [4] M. Schutte, B. Fox, M.O. Baradez, A. Devonshire, J. Minguez, M. Bokhari, S. Przyborski, D. Marshall, Rat primary hepatocytes show enhanced performance and sensitivity to acetaminophen during three-dimensional culture on a polystyrene scaffold designed for routine use, Assay Drug Dev. Technol. 9 (2011) 475–486. [5] E.L. Lecluyse, R.P. Witek, M.E. Andersen, M.J. Powers, Organotypic liver culture models: meeting current challenges in toxicity testing, Crit. Rev. Toxicol. 42 (2012) 501–548. [6] B. Nugraha, X. Hong, X. Mo, L. Tan, W. Zhang, P.M. Chan, C.H. Kang, Y. Wang, L.T. Beng, W. Sun, D. Choudhury, J.M. Robens, M. McMillian, J. Silva, S. Dallas, C.H. Tan, Z. Yue, H. Yu, Galactosylated cellulosic sponge for multi-well drug safety testing, Biomaterials 32 (2011) 6982–6994. [7] Y.C. Toh, T.C. Lim, D. Tai, G. Xiao, D. van Noort, H. Yu, A microfluidic 3D hepatocyte chip for drug toxicity testing, Lab Chip 9 (2009) 2026–2035. [8] S. Ng, Y.N. Wu, Y. Zhou, Y.E. Toh, Z.Z. Ho, S.M. Chia, J.H. Zhu, H.Q. Mao, H. Yu, Optimization of 3-D hepatocyte culture by controlling the physical and chemical properties of the extra-cellular matrices, Biomaterials 26 (2005) 3153–3163. [9] R. Kostadinova, F. Boess, D. Applegate, L. Suter, T. Weiser, T. Singer, B. Naughton, A. Roth, A long-term three dimensional liver co-culture system for improved prediction of clinically relevant drug-induced hepatotoxicity, Toxicol. Appl. Pharmacol. 268 (2013) 1–16. [10] M. Yamada, R. Utoh, K. Ohashi, K. Tatsumi, M. Yamato, T. Okano, M. Seki, Controlled formation of heterotypic hepatic micro-organoids in anisotropic hydrogel microfibers for long-term preservation of liver-specific functions, Biomaterials 33 (2012) 8304–8315. [11] E.E. Hui, S.N. Bhatia, Micromechanical control of cell-cell interactions, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 5722–5726. [12] K. Nakazawa, Y. Shinmura, A. Higuchi, Y.J. Sakai, Effects of culture conditions on a micropatterned co-culture of rat hepatocytes with 3T3 cells, J. Bioprocess. Biotech. S3 (2011) 002. [13] O. Ukairo, M. McVay, S. Krzyzewski, S. Aoyama, K. Rose, M.E. Andersen, S.R. Khetani, E.L. Lecluyse, Bioactivation and toxicity of acetaminophen in a rat hepatocyte micropatterned coculture system, J. Biochem. Mol. Toxicol. 27 (2013) 471–478. [14] S.R. Khetani, C. Kanchagar, O. Ukairo, S. Krzyzewski, A. Moore, J. Shi, S. Aoyama, M. Aleo, Y. Will, Use of micropatterned cocultures to detect compounds that cause drug-induced liver injury in humans, Toxicol. Sci. 132 (2013) 107–117. [15] C. Lin, J. Shi, A. Moore, S.R. Khetani, Prediction of drug clearance and drug-drug interactions in microscale cultures of human hepatocytes, Drug Metab. Dispos. 44 (2016) 127–136. [16] M. Adabi, R. Saber, R. Faridi-Majidi, F. Faridbod, Performance of electrodes synthesized with polyacrylonitrile-based carbon nanofibers for application in electrochemical sensors and biosensors, Mater. Sci. Eng. C 48 (2015) 673–678. [17] Y.W. Liu, L. Zhang, H.N. Li, S.L. Yan, J.S. Yu, J. Weng, X.H. Li, Electrospun fibrous mats on lithographically micropatterned collectors to control cellular behaviors, Langmuir 28 (2012) 17134–17142. [18] Y.W. Liu, L. Zhang, J.J. Wei, S.L. Yan, J.S. Yu, X.H. Li, Promoting hepatocyte spheroid formation and functions by coculture with fibroblasts on micropatterned electrospun fibrous scaffolds, J. Mater. Chem. B 2 (2014) 3029–3040.
484
Y. Liu et al. / Materials Science and Engineering C 63 (2016) 475–484
[19] Y.W. Liu, H.N. Li, S.L. Yan, J.J. Wei, X.H. Li, Hepatocyte cocultures with endothelial cells and fibroblasts on micropatterned fibrous mats to promote liver-specific functions and capillary formation capabilities, Biomacromolecules 15 (2014) 1044–1054. [20] X.H. Li, Y.H. Zhang, W.X. Jia, X.M. Deng, Z.T. Huang, Influence of process parameters on the protein stability encapsulated in poly-dl-lactide-poly(ethylene glycol) microspheres, J. Control. Release 68 (2000) 41–52. [21] P.O. Seglen, Preparation of isolated rat liver cells, Methods Cell Biol. 13 (1976) 29–83. [22] M.T. Donato, N. Jiménez, J.V. Castell, M.J. Gómez-Lechón, Fluorescence-based assays for screening nine cytochrome P450 (P450) activities in intact cells expressing individual human P450 enzymes, Drug Metab. Dispos. 32 (2004) 699–706. [23] S.R. Khetani, S.N. Bhatia, Microscale culture of human liver cells for drug development, Nat. Biotechnol. 26 (2008) 120–126. [24] K. Swales, N. Plant, A. Ayrton, S. Hood, G. Gibson, Relative receptor expression is a determinant in xenobiotic-mediated CYP3A induction in rat and human cells, Xenobiotica 33 (2003) 703–716. [25] Z.H. Liu, S. Zeng, Cytotoxicity of ginkgolic acid in HepG2 cells and primary rat hepatocytes, Toxicol. Lett. 187 (2009) 131–136. [26] Y. Huang, S.L. Zheng, H.Y. Zhu, Z.S. Xu, R.A. Xu, Effects of aescin on cytochrome P450 enzymes in rats, J. Ethnopharmacol. 151 (2014) 583–590. [27] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method, Methods 25 (2001) 402–408. [28] G.T. Tucker, J.B. Houston, S.M. Huang, Optimizing drug development: strategies to assess drug metabolism/transporter interaction potential towards a consensus, Pharm. Res. 18 (2001) 1071–1080. [29] S.E. Kostrubsky, J.F. Sinclair, S.C. Strom, S. Wood, E. Urda, D.B. Stolz, Y.H. Wen, S. Kulkarni, A. Mutlib, Phenobarbital and phenytoin increased acetaminophen hepatotoxicity due to inhibition of UDP-glucuronosyl transferase in cultured human hepatocytes, Toxicol. Sci. 87 (2005) 146–155. [30] X. Liu, J.P. Chism, E.L. LeCluyse, K.R. Brouwer, K.L. Brouwer, Correlation of biliary excretion in sandwich-cultured rat hepatocytes and in vivo in rats, Drug Metab. Dispos. 27 (1999) 637–644. [31] T. Elkayam, S. Amitay-Shaprut, M. Dvir-Ginzberg, T. Harel, S. Cohen, Enhancing the drug metabolism activities of C3A-a human hepatocyte cell line-by tissue engineering within alginate scaffolds, Tissue Eng. 12 (2006) 1357–1368. [32] S. Wilkening, F. Stahl, A. Bader, Comparison of primary human hepatocytes and hepatoma cell line Hepg2 with regard to their biotransformation properties, Drug Metab. Dispos. 31 (2003) 1035–1042.
[33] P. Chao, T. Maguire, E. Novik, K.C. Cheng, M.L. Yarmush, Evaluation of a microfluidic based cell culture platform with primary human hepatocytes for the prediction of hepatic clearance in human, Biochem. Pharmacol. 78 (2009) 625–632. [34] J.B. Houston, Utility of in vitro drug metabolism data in predicting in vivo metabolic clearance, Biochem. Pharmacol. 47 (1994) 1469–1479. [35] C. Lu, P. Li, R. Gallegos, V. Uttamsingh, C.Q. Xia, G.T. Miwa, S.K. Balani, L.S. Gan, Use of cryopreserved human hepatocytes in sandwich culture to measure hepatobiliary transport, Drug Metab. Dispos. 34 (2006) 1600–1605. [36] J. Yin, H. Qiu, J. Dai, Y. Lu, R. Zhao, L. Chen, Q. Meng, Prediction of hepatic plasma clearance in vivo from gel-entrapped rat and humanhepatocytes, Can. J. Physiol. Pharmacol. 91 (2013) 178–186. [37] R.J. Riley, D.F. McGinnity, R.P. Austin, A unified model for predicting human hepatic, metabolic clearance from in vitro intrinsic clearance data in hepatocytes and microsomes, Drug Metab. Dispos. 33 (2005) 1304–1311. [38] M. Rasouli, H. Asgari, Rat liver perfusion and hepatocytes isolation, J. Mazandaran Univ. Med. Sci. 18 (2008) 71–80. [39] M.V. Peshwa, F.J. Wu, B.D. Follstad, F.B. Cerra, W.S. Hu, Kinetics of hepatocyte spheroid formation, Biotechnol. Prog. 10 (1994) 460–466. [40] C.H. Cho, J. Park, D. Nagrath, A.W. Tilles, F. Berthiaume, M. Toner, M.L. Yarmush, Oxygen uptake rates and liver-specific functions of hepatocyte and 3T3 fibroblast co-cultures, Biotechnol. Bioeng. 97 (2007) 188–199. [41] Z.Q. Feng, X.H. Chu, N.P. Huang, M.K. Leach, G. Wang, Y.C. Wang, Y.T. Ding, Z.Z. Gu, Rat hepatocyte aggregate formation on discrete aligned nanofibers of type-I collagen-coated poly(L-lactic acid), Biomaterials 31 (2010) 3604–3612. [42] S. Kidambi, L. Sheng, M.L. Yarmush, M. Toner, I. Lee, C. Chan, Patterned co-culture of primary hepatocytes and fibroblasts using polyelectrolyte multilayer templates, Macromol. Biosci. 7 (2007) 344–353. [43] E. Novik, T.J. Maguire, P. Chao, K.C. Cheng, M.L. Yarmush, A microfluidic hepatic coculture platform for cell-based drug metabolism studies, Biochem. Pharmacol. 79 (2010) 1036–1044. [44] M.F. Leong, J.K.C. Toh, C. Du, K. Narayanan, H.F. Lu, T.C. Lim, A.C.A. Wan, J.Y. Ying, Patterned prevascularised tissue constructs by assembly of polyelectrolyte hydrogel fibres, Nat. Commun. 4 (2013) 2353. [45] M.J. Gómez-Lechón, J.V. Castell, M.T. Donato, Hepatocytes-the choice to investigate drug metabolism and toxicity in man: in vitro variability as a reflection of in vivo, Chem. Biol. Interact. 168 (2007) 30–50.