Microplastics as a vector for the transport of the bacterial fish pathogen species Aeromonas salmonicida

Marine Pollution Bulletin 125 (2017) 301–309

Contents lists available at ScienceDirect

Marine Pollution Bulletin journal homepage: www.elsevier.com/locate/marpolbul

Microplastics as a vector for the transport of the bacterial fish pathogen species Aeromonas salmonicida

T

Manca Kovač Viršeka,⁎,1, Marija Nika Lovšinb,1,2, Špela Korena, Andrej Kržanc, Monika Peterlina a b c

Institute for Water of the Republic of Slovenia, Sector for Marine Waters, Dunajska c. 156, 1000 Ljubljana, Slovenia University of Nova Gorica, School of Environmental Sciences, Vipavska 13, 5000 Nova Gorica, Slovenia National Institute of Chemistry, Department for Polymer Chemistry and Technology, Hajdrihova 19, 1000 Ljubljana, Slovenia

A R T I C L E I N F O

A B S T R A C T

Keywords: Microplastic Sea surface Adriatic Sea Bacterial community Aeromonas salmonicida Hydrocarbon-degrading bacteria

Microplastics is widespread in the marine environment where it can cause numerous negative effects. It can provide space for the growth of organisms and serves as a vector for the long distance transfer of marine microorganisms. In this study, we examined the sea surface concentrations of microplastics in the North Adriatic and characterized bacterial communities living on the microplastics. DNA from microplastics particles was isolated by three different methods, followed by PCR amplification of 16S rDNA, clone libraries preparation and phylogenetic analysis. 28 bacterial species were identified on the microplastics particles including Aeromonas spp. and hydrocarbon-degrading bacterial species. Based on the 16S rDNA sequences the pathogenic fish bacteria Aeromonas salmonicida was identified for the first time on microplastics. Because A. salmonicida is responsible for illnesses in fish, it is crucial to get answers if and how microplastics pollution is responsible for spreading of diseases.

1. Introduction Marine litter is regularly observed everywhere in the oceans. According to estimations by Jambeck et al. (2015), 8 million metric tons of plastic waste makes its way into the world's oceans every year. Emissions of plastic come from point and diffuse land-based sources, as well as from fishing and from marine-based industry sources, and can travel long distances before being stranded (Galgani et al., 2015). Plastics constitute a large part, even close to 100%, of floating litter (Galgani et al., 2015). This is a cause of worry as plastics production keeps rising. Global production of plastics in 2015 reached 322 million metric tons, of which 58 million metric tons were produced in Europe alone, and this number does not even include the production of textile fibers (PET, PA, PP, polyacryl) made of effectively the same materials (PlasticsEurope, 2016). Assuming that 10% of all plastic waste ends up in the oceans (Thompson, 2006) and due its slow degradation, we can only conclude that the quantities of macrolitter and, consequently, microplastics (< 5 mm) in the marine environment will continue increasing in the future. Over the past few years, a significant effort has been made to quantify microplastics in the seas (Lusher, 2015). From the seafloor to the water column and seacoast, microplastics measurements dominate ⁎

the sea surface. Specifically, the sea surface microplastic concentrations found in the Pacific ocean are: Northern Pacific (NP) Subtropical gyre 20,000–450,000 particles/km2(Goldstein et al., 2013); NP central gyre 85,184 particles/km2 (Carson et al., 2013); NP central gyre 334,271 particles/km2 (Moore et al., 2001), and in the Atlantic ocean they are: North Atlantic gyre 20,328 particles/km2 (Law et al., 2010); Northwest Atlantic 490 particles/km2 (Wilber, 1987); Caribbean 1414 particles/km2 (Law et al., 2010). Microplastics can accumulate on shorelines, on the sea surface and on the seafloor. Accumulation rates vary significantly as they are influenced by diverse factors such as the presence of large cities, shore use, maritime activities (Galgani et al., 2015), and oceanographic features such as currents and waves (Galgani, 2014; Andrady, 2011; Browne et al., 2011). It appears that accumulation rates are lower in the southern than in the northern hemisphere (Galgani et al., 2015). In EU, the Marine Strategy Framework Directive (MSFD, 2008/56/ EC) has highlighted concerns for the environmental implications of marine litter (Zarfl et al., 2011). In the Mediterranean Sea, which is one of the most polluted seas (Costello et al., 2010), the presence of microplastics in waters has already been confirmed (Galgani et al., 1996). In surface waters of the northwest Mediterranean 1,330,000 particles/ km2 (Collignon et al., 2012) were found and in the bay of Calvi on

Corresponding author at: Institute for Water of the Republic of Slovenia, Dunajska c. 156, 1000 Ljubljana, Slovenia. E-mail address: [email protected] (M.K. Viršek). These authors equally contributed to the study. 2 University of Ljubljana, Faculty of Pharmacy, The Chair of Clinical Biochemistry, Aškerčeva cesta 7, 1000 Ljubljana, Slovenia. 1

http://dx.doi.org/10.1016/j.marpolbul.2017.08.024 Received 9 May 2017; Received in revised form 12 August 2017; Accepted 12 August 2017 Available online 07 September 2017 0025-326X/ © 2017 Elsevier Ltd. All rights reserved.

Marine Pollution Bulletin 125 (2017) 301–309

M.K. Viršek et al.

Corsica Island as 62,000 particles/km2 were found. The Adriatic Sea, a small, shallow and semi enclosed basin, represents a hotspot for pollution (Halpern et al., 2008). Gajšt et al. (2016) reported an average of 406.000 particles/km2 in the Slovenian part of the North Adriatic and indicated high locational and temporal variation attributed to currents and winds. The negative effects of plastic marine litter and microplastics on animals, such as benthic invertebrates, birds, fish, mammals and turtles as a result of entanglement or ingestion, are well documented (Kühn et al., 2015; Lusher, 2015). Furthermore, it is generally assumed that microplastics may act as a vector for the transport of chemicals adsorbed on or contained in plastic particles, such as persistent organic pollutants (POPs) or additives (Koelmans, 2015). Since plastics have a much longer half-life than most natural floating marine substrates and a hydrophobic surface that promotes microbial colonization and biofilm formation, it serves as pelagic habitat for microorganisms and invertebrates (Reisser et al., 2014). Zettler et al. (2013) referred to the diverse microbial community composed of heterotrophs, autotrophs, predators, and symbionts that inhibit and live on plastic particles as the “plastisphere”. The formation of biofilms on the plastic's surface strongly influences plastic degradation processes (Artham et al., 2009) in two ways. The organisms can indirectly increase longevity of plastic particles (Carson et al., 2013) by protecting them from ultraviolet radiation and photocatalysis either directly via decreased buoyancy resulting in sinking (Andrady, 2011), or organisms can actively accelerate the degradation process (Balasubramanian et al., 2010; Zettler et al., 2013). The transport of microorganisms attached to plastics is of a great concern, since communities present on plastic particles differ from those present in the surrounding marine environment (Zettler et al., 2013). The transport of species over long distances therefore presents a potential change in their natural ranges, possibly allowing them to become non-native or even invasive species (Reisser et al., 2014) or disease vectors (Goldstein et al., 2014; Maso et al., 2003). Bacteria such as human pathogen Vibrio spp. (Zettler et al., 2013; Kirstein et al., 2016; Foulon et al., 2016) and other Vibrionaceae (De Tender et al., 2015) have been found colonizing microplastics particles in the marine environment. Even though it is known that all surfaces of microplastics in the marine environment are rapidly colonized by bacteria (Harrison et al., 2014), the actual taxonomic composition of biofilms on marine microplastics remains largely unexplored (Kirstein et al., 2016). There are no known data on bacterial communities colonizing microplastic particles in the North Adriatic Sea, which is a known area of high microplastic pollution and a highly populated sea. The main goal of our research was therefore to: 1) determine the abundance and chemical composition of sea surface microplastics in the North Adriatic Sea, 2) isolate bacterial DNA from the biofilms on microplastics, and to 3) construct a clone library, perform phylogenetic analysis and identify the bacterial species in biofilms on microplastics from the sampled area.

protocol for microplastics sampling on the sea surface and sample analysis developed within the DeFishGear project (Kovač Viršek et al., 2016). The boat speed was approx. 2.5 knots and the time of sampling was 30 min. Transects were approx. 1.3 nm long. All collected samples were analyzed in the laboratory. First, samples were cleaned of organic material and artificial objects larger than 5 mm by visual observation. After that, samples were checked for the presence of microplastic particles using a stereomicroscope. No degradation of the organic material from field samples was carried out. Microplastic particles were placed into 6 categories (fragments, filaments, films, pellets, granules and foams). In order to avoid contamination from air transported fibers, microplastics separation was performed in a clean room. 2.2. Chemical characterization of microplastics Chemical identification of microplastic particles sampled in 2014 was carried out using ATR FT-IR microscopy (LUMOS, Bruker, Germany), while microplastic particles sampled in 2015 were analyzed using ATR FT-IR spectroscopy (Spectrum Two, Perkin Elmer, USA). When an ATR-FT-IR microscope was used, microplastic particles were placed on a glass filter and the ATR germanium crystal was cleaned using 80% alcohol and a lint free cloth. The filter with the microplastic was placed on the automatic scanning table and the joystick was used to locate the sample and to record an optical image. The measured area was 20 × 20 μm in size. The obtained spectra were compared with spectra in the BRUKER Polymer library and ATR-FTIR Polymer library (S.T. Japan) collections to identify the composition of particles. When the ATR FT-IR spectrometer was used, microplastic particles were placed on a diamond crystal ATR holder and spectra were collected and compared with a spectra database (Hummel spectra library). 2.3. DNA isolation from microplastics For the analysis of bacterial community one additional transect was sampled on 26th of August 2014 for 20 min on the route S2 (see Fig. 1) using a manta net. The measured sea temperature was 24.4 °C and salinity was 35.5 PSU. Material caught in the manta net was rinsed into a sterile bottle by sterile distilled water and was immediately stored in a cool box and transferred to the laboratory. On the same day, microplastic particles were separated with sterile tweezers into a sterile petri dish and frozen at − 20 °C. DNA from microplastics' samples was extracted using three different isolation methods. Two of them were direct methods, where DNA was directly isolated from microplastic particles using the PowerSoil DNA Isolation Kit (MOBIO Laboratories, Carlsbad, CA) (1# clone library) or PowerBiofilm DNA isolation kit (MOBIO Laboratories, Carlsbad, CA) (2# clone library) according to the manufacturer's instructions. In these methods, 30 to 50 mg of microplastics was used for DNA extraction. While we hypothesized that pre-culturing bacteria from a microplastic particle in a bacterial growth media (LB) could amplify the signal, also a pre-culturing method was tested. There microplastic (1 piece) was cultured in Lauria Bertani (LB) medium overnight at 37 °C and DNA was extracted from the bacteria grown overnight using a DNeasy Tissue DNA isolation kit (Qiagen) (3# clone library). The yield of bacterial DNA ranged from 450 to 4450 ng. To exclude the possibility of contamination, only sterile MiliQ water and other material were used. All procedure were done in PCR box with UV disinfection. In the polymerase chain reaction MiliQ water was used as a negative control. In the case, when microplastic fragment was precultured in LB media, as a negative control only growth media was incubated overnight.

2. Methods 2.1. Microplastics sampling Samples were collected along the Slovenian coast (from Piran Bay to Koper Bay) of the North Adriatic Sea during two periods of time. The first sampling was carried out in August 2014 (25th and 26th August 2014), when six transects were sampled in 2 days (Fig. 1, S1–S4 and R1–R2) and the second in May 2015 (11th May 2015), when 4 transects were sampled (S1–S4 on the same locations as in August 2014). The sampling transects were selected so that the majority of the Slovenian coastal sea area was included in the survey (from the south to the north border) and the areas influenced by all the main Slovenian coastal cities (Piran, Izola, Koper). Samples were collected using a manta net with 308 μm pore size, according to the methodology described in the

2.4. 16S RNA PCR amplification and clone library construction 16S RNA was amplified from genomic DNA samples using primers Bac27F (5′-AGAGTTTGATCMTGGCTCAG) and Univ1492R (5′302

Marine Pollution Bulletin 125 (2017) 301–309

M.K. Viršek et al.

Fig. 1. Map of the Slovenian coast at the North Adriatic Sea with sampling transects (S1–S4, R1–R2) (source: www.defishgear.izvrs.si/defishgearpublic).

2.6. Statistical analysis

CGGTTACCTTGTTACGACTT) (Jiang et al., 2006) and Kappa 2G Robust Mastermix (KAPABiosystems). The amplification reaction was performed in final volume of 20 μl and consisted of 0.5 μl of KAPA2G Robust DNA Polimerase (5 U/μl), 4 μl of KAPA2G Buffer A 5× with 1.5 mM MgCl2, 0.5 μl of dNTP Mix (10 mM each) and 13 μl of genomic DNA (8–80 ng/μl). The following PCR conditions were used: initial denaturation at 95 °C for 60 s, followed by 35 cycles at 95 °C for 5 s, 57 °C for 10 s, 72 °C for 5 s and final extension at 72 °C for 10 min. PCR products were analyzed on 1% agarose gel electrophoresis. 1450 bp PCR fragments were extracted from the gel using a Gel Extraction kit (QiaGEN) and ligated into pCR4 vector using the TOPO TA cloning kit (Invitrogen). To verify that bacterial colonies contain plasmid with the PCR insert, all the bacterial colonies were subjected to colony PCR using the same conditions as described for PCR. 90% of the colonies contained plasmid vectors with insert. Plasmid DNA was isolated (Plasmid DNA isolation kit, Qiagen) from the positive colonies and 78 plasmid clones were sequenced using the Sanger method (Sanger et al., 1977). 66 DNA plasmids were successfully sequenced (Macrogene). All DNA sequences were used for taxonomic classification using BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi) against 16S ribosomal RNA sequences (Bacteria and Archea) using default settings. 60 sequences were submitted into the GenBank under accession numbers MF615104-MF615163.

To compare microplastic abundance between the sampling periods in 2014 and 2015, the nonparametric Mann-Whitney U Test was used in IBM SPSS Statistics v.21 (IBM Corporation, New York, USA) because the data were not normally distributed and could not be transformed for normal distribution. 3. Results 3.1. Microplastic concentrations To examine the concentration of microplastics along the Slovenian coast (from Piran Bay to Koper Bay) of the North Adriatic Sea, we sampled the sea surface by manta net during two sampling periods, one in August 2014 and one in May 2015. On both sampling dates, microplastics were found in each sample. Surprisingly, the concentration of microplastic particles (No/km2) was on average five times higher in 2015 than in 2014 (Mann-Whitney U Test = 0; p-value = 0.011; Table 1). In 2014, a total of 2299 microplastic particles were collected from 6 transects, while in 2015, 6784 particles were collected from 4 transects. Mean microplastic concentrations were 259,310 ( ± 57,096) per km2 in 2014 and 1,304,811 ( ± 609,426) per km2 in 2015. Differences among microplastics categories between 2014 and 2015 were statistically significant for fragments and filaments (Mann-Whitney U Test = 0; p-value = 0.011; Table 1). Filaments were the most abundant in 2014, while fragments were the most abundant in 2015. The concentration of foamed particles was similar between both sampling periods (Mann-Whitney U Test = 11; p-value = 0.829; Table 1). Just a few pellets were found in samples in 2014, while none were found in 2015.

2.5. Phylogenetic analysis Sequence alignment and a phylogenetic tree were built with Mega7 software (Tamura et al., 2007). 16S rDNA sequences of above described clone libraries were aligned using the ClustalX progressive alignment method (Tuimala, 2004). Phylogenetic trees were built using the Neighbor-Joining algorithm (Saitou and Nei, 1987) based on the Kimura 2-parametric matrix (Kimura, 1980). Built phylogenetic trees were evaluated via bootstrapping analysis. Bacterial diversity for each group of clones was calculated using the Shannon diversity index (H-index).

3.2. Chemical composition of microplastics To analyze the chemical composition of microplastics, we performed FTIR analysis of 4.6% (from total 2299 particles) microplastic 303

Marine Pollution Bulletin 125 (2017) 301–309

M.K. Viršek et al.

Table 1 Mean microplastic concentrations in the North Adriatic Sea along the Slovenian coast at two sampling periods in years 2014 and 2015. Microplastic type

Year 2014 (No km− 2)

Year 2015 (No km− 2)

Mann-Whitney test (U-value)

p-Value

Total Fragments Filaments Films Pellets Granules Foams

259,310 ( ± 57,096) 24,084 ( ± 14,830) 229,598 ( ± 67,880) 1696 ( ± 1584) 103 ( ± 252) 478 ( ± 370) 3351 ( ± 2985)

1,304,811 ( ± 609,426) 755,063 ( ± 87,212) 509,924 ( ± 142,032) 31,806 ( ± 3428) 0 4116 ( ± 5231) 3902 ( ± 3415)

0 0 0 5.5 10 10 11

0.011 0.011 0.011 0.165 0.414 0.660 0.829

Fig. 2. Chemical composition of the microplastic particles sampled on the sea surface of the North Adriatic Sea along the Slovenian coast at two times (August 2014 and May 2015). The abundance of different polymers is represented as a percentage (%) of particles with a certain polymer composition. The circle shows the total number of chemically analyzed particles (N).

Fig. 3. The percentage of bacterial taxa identified from microplastic fragments using the 16S rDNA library (A – 1# clone library; B – 2# clone library).

bacterial species grow on the microplastics particles, we isolated genomic DNA from several microplastics particles and amplified part of the 16S rRNA gene by polymerase chain reaction (PCR). To exclude the possibility that the DNA extraction method would limit the variety of identified bacterial strains, we decided to use several previously published DNA isolation methods that were successfully used for the isolation of DNA from biofilms. From the resulting PCR fragments, a library of plasmid clones was prepared and sequenced. Sequences were then assigned to major groups based on BLAST similarities. All the cloned sequences belong to the six major Bacteria phyla: Proteobacteria, Planctomycetes, Chloroflexi, Bacteroidetes, Cyanobacteria and Firmicutes. The percentage of 16S rDNA sequences from each group of clones indicates that the community structure differs greatly among isolation methods. Specifically, clones corresponding to Gammaproteobacteria and Alphaproteobacteria were found in the 1# and 2# clone libraries, while clones corresponding to the remainder of the bacterial classes were identified just in one of the libraries (Fig. 3). Furthermore, the bacterial species within

particles collected in 2014 and 1.5% (from total 6784 particles) of the particles collected in 2015. Chemical analysis of the microplastics revealed that 75% of the analyzed microplastics particles was from polyethylene indicating that polyethylene was the most common type of plastic in both sampling periods, followed by polypropylene (> 9.3%). > 2.6% of the plastics were composed of polyamide, mainly filaments. Expanded polystyrene (“Styrofoam”) was also frequently found at all sites as a category of microplastic “foam”, comprising > 1.4% (Fig. 2).

3.3. Bacterial communities Our analysis was further extended by an analysis of bacterial communities growing on microplastics from the sea surface. All bacterial species were identified from the “fragments” category of microplastics collected in the North Adriatic Sea. We used only fragments, due to their higher abundance and good surface to volume ratio, which enables effective growth to bacterial biofilms. To determine which 304

Marine Pollution Bulletin 125 (2017) 301–309

M.K. Viršek et al.

Fig. 4. Phylogenetic trees generated based on the alignment of 16S rDNA sequences isolated from microplastics fragments by two different DNA isolation methods: A) DNA was isolated directly from microplastics using a PowerSoil DNA Isolation Kit (1# clone library); B) DNA was isolated directly from microplastics using a PowerBiofilm DNA isolation kit (2# clone library). Trees are based on the Kimura 2 parametric distance of partial sequences of 16S rDNA genes, and the tree was built based on the Neighbor-Joining algorithm. Numbers at nodes represent the bootstrap values.

bacteria from the genus Bacillus were identified (Bacillus pumilus with 15 OTUs and Bacillus safensis with 1 OTUs; operational taxonomic units). In total 45 sequences were used for phylogenetic analysis, 22 of which were from the first clone library, 23 from the second clone library. Bacteria belonged predominantly to the Gammaproteobacteria, where species affiliated with Aeromonadacae were the most common (Fig. 4A, B). In addition, Aeromonas salmonicida sequences were ≥96% homologous with sequences already present in the GenBank.

Gammaproteobacteria and Alphaproteobacteria differ in almost all identified bacterial species between the 1# and 2# clone libraries (except A. salmonicida and H. piscium were present on both clone libraries) (Fig. 4A, B). Evaluation of clone abundance within different phyla indicates that Gammaproteobacteria were dominant in the 1# and 2# clone libraries, with 50% and 64%, respectively (Fig. 3). Although Alphaproteobacteria were the second most dominant group in both libraries, it accounted for only 21% of the clones from the first group and 12% from the second group, respectively. In the 3# clone library, only 305

Marine Pollution Bulletin 125 (2017) 301–309

M.K. Viršek et al.

its diseases in the sea are not available. Microplastics can accumulate higher concentrations of some pathogenic microorganisms, although they may not be found in the surrounding water. It was found that bacterial communities grown on microplastics (plastisfera) are completely different from the communities in the surrounding water (Zettler et al., 2013; Harrison et al., 2014). When our bacterial species identified from microplastics were compared with a study of the sea water bacterial community in the North Adriatic Sea (Korlević, 2015), the bacterial genera Alteromonas and Prochlorococcus were found to be present in both seawater and microplastics ecological niches. The presence of Alteromonas on microplastics is understandable as they are known to be able to colonize smaller particulate organic matter (Ivars-Martinez et al., 2008) and they are able to degrade aromatic carbon compounds, specifically naphthalene, phenanthrene, anthracene, and pyrene (Jin et al., 2012). In the last five years, a few studies on microbial community composition and diversity on marine plastic particles have been reported (Zettler et al., 2013; Reisser et al., 2014; Carson et al., 2013; Oberbeckman et al., 2014). The majority of them based solely on morphological data that cannot provide exact information on bacterial species. Only Zettler et al. (2013) provided the first high-throughput sequencing study. When we compared the results of our bacterial community on microplastics with the results of Zettler et al. (2013) we found that six bacterial species/classes grown on polyethylene and polypropylene were the same: Erythrobacter, Parvularcula, Cyanobacteria (Prochloroccocus), Anaerolinaceae, Alteromonas and Flavobacteria. All of these bacterial species are seawater organisms isolated from different parts of the world. There is only one bacterial species, Erythrobacter citreus that was isolated from the Mediterranean Sea (Corsica Island, by Denner et al., 2002). Most of the OTUs from our study belong to Gammaproteobacteria (> 54%), while Alphaproteobacteria represented > 16% of OTUs. By contrast, in Zettler et al. (2013), the proportion of Gamma- (22%) and Alphaproteobacteria (28%) were more or less the same. Gammaproteobacteria were found as pioneer organisms that colonize LDPE plastic particles (Harrison et al., 2014) and acrylates (Lee et al., 2008) in the first hours (0–9 h) after exposure, while Alphaproteobacteria increased during days 2–3. Which bacterial strain is the first colonizer and what is the overall composition of the plastisphere microbial communities in marine waters depend on the season, geographical location and plastic substrate type (Oberbeckmann et al., 2014. The seasonal dynamics of the plastisfere is indicated by the higher abundance of cyanobacteria during the summer months and heterotrophic bacteria during winter (Oberbeckmann et al., 2014). In our study, where samples were collected during the summer, cyanobacteria Proccloroccocus marinus was identified with a 91% similarity of sequence to sequences in the GenBank, but with only one OTU. In our study, bacterial species able to degrade hydrocarbons were identified from Gammaproteobacteria (Acinetobacter) and from Alphaproteobacteria, family Rhodobacteriaceae (Pseudorugeria, Defluviimonas, Donghicola and Roseovarius). Hydrocarbon-degrading bacterial species increase the surface area of the polymer, thus influencing the absorption of substances present in water, metals and organic pollutants (Caruso, 2015). As microplastics can serve as an ecological niche for the accumulation of pathogenic microorganisms, they can also serve as a suitable substrate for the accumulation of plastic decomposing organisms, as noted by McCormick et al. (2014). By the secretion of specific extracellular enzymes, bacteria should be able to degrade various types of plastics (Ghosh et al., 2013). So far, the mechanisms of biodegradation are not known (Kumar et al., 2016), although there is increasing evidence that suggests microbial biodegradation of plastics is taking place (Reisser et al., 2014; Zettler et al., 2013). It makes sense that hydrocarbon-degrading microorganisms can be found on polyolefins (polyethylene, polypropylene and copolymers) since these materials most resemble the chemical structure of waxes and liquid hydrocarbons to which these microorganisms are likely to be adapted.

Aeromonas species appeared in 16 clones, amplified from DNA samples extracted by two different methods (A. salmonicida – 8 OTUs; A. bestiarum – 1 OTU; A. sanarelli – 1 OTU). From these results we can conclude that A. salmonicida was most likely present in our microplastics samples. Other genera identified within the Gammaproteobacteria class of the 1# clone library were a) Haemophilus, Acinetobacter, Thioalkalivibrio, Haliea and within the 2# clone library were b) Alteromonas, Aestuariibacter, Haemophilus and Acinetobacter (Fig. 4A, B). Among genus Haemophilus species Haemophilus piscium were identified, with high sequence homology (≥96%). This bacteria was found as serologically indistinguishable from A. salmonicida and as such determined as atypical A. salmonicida (Paterson et al., 1980). Bacteria species with high sequence homology to Genbank species were also identified from the Acinetobacter group. Besides bacterial species with high sequence homology to the GenBank sequences, we also discovered several bacterial species with less than ≤ 95% nucleotide sequence similarity to the species documented so far, including genuses Haliea, Thioalkalivibrio, Alteromonas and Aestuariibacter (Fig. 4A, B). Among the second most abundant class of bacteria, Alphaproteobacteria, six different genera were detected in the 1# clone library (Oceanibaculum, Parasphingopyxis, Pseudoruegeria, Tepidamorphus, Reseovarius) (Fig. 4A) and two (Parvularcula and Erythrobacter) in the 2# clone library (Fig. 4B). All sequences had no close matches (≤ 95%). Beside the bacteria from phyla Proteobacteria also other phyla were identified. In the 1# clone library bacteria from classes Planctomycetia, and Anaerolineae were detected and in the 2# clone library, Cyanobacteria and Flavobacteria were detected. Sequences of all four classes were ≤95% homologous with sequences in the GenBank (Fig. 4A, B). The analysis of bacterial diversity showed that bacterial communities directly isolated using the PowerSoil DNA isolation kit (1# clone library) (H = 2.45) or PowerBiofilm DNA Isolation kit (2# clone library) (H = 2.61) are more diverse than the bacterial community isolated after pre-culturing in LB medium (3# clone library) (H = 0.24). 4. Discussion 4.1. Microbial communities It is known that bacteria rapidly colonize microplastics in the marine environment (Harrison et al., 2014). Some studies about this thematic were published in last decades, but none of them considered the bacterial communities colonizing microplastic particles from the Northern Adriatic Sea. In our study, for the first time, the bacterial fish pathogen Aeromonas salmonicida syn Haemophilus piscium was identified on the surface of microplastics based on 16S rDNA sequences. Among all bacteria species identified, A. salmonicida represent the highest number of OTUs (Fig. 4A, B). Discovery of fish pathogenic bacteria on microplastics indicates that microplastics serve as a vector of pathogenic bacterial species in the marine environment. Aeromonas salmonicida is one of the most harmful invasive bacteria on the alien invasive species inventory for Europe (DAISIE) and is responsible for fish infection by furunculosis (Scott, 1968). The bacteria is distributed in the temperate regions of the northern hemisphere, namely in Canada, USA, Japan, and central and northern Europe, including the Nordic countries (Gudmundsdóttir, 1998). It is a significant pathogen of salmonids, and its atypical strain is virulent for cyprinids and marine flatfish (Austin and Austin, 2012). In 2016, Fernández-Álvarez et al. published that it is virulent also for sea bass, turbot and rainbow trout. Its presence in the Adriatic Sea was not recorded, as only other Aeromonas species had been identified (Ottaviani et al., 2006; Fiorentini et al., 1998). In Slovenia the diseases caused by A. salmonicida are known only for the fish living in freshwater and are more typical for farmed fish and less for free-living fish. While the data about distribution of A. salmonicida and 306

Marine Pollution Bulletin 125 (2017) 301–309

M.K. Viršek et al.

in 2014 and 2015 (year 2014: 259,310 ( ± 57,096) particles/km2; year 2015: 1,304,811 ( ± 609,426) particles/km2). Different accumulation rates of microplastics in the marine environment depends of oceanographic features (currents and waves) (Galgani, 2014; Andrady, 2011; Browne et al., 2011). An analysis of factors that influenced our results emphasized weather conditions, especially wind velocity and direction, as the most important factors. Wind is found to be the main forcing factor inducing currents in the northern Adriatic and waves were found to be highly correlated with local wind (Bolaños et al., 2014). During the sampling time in 2014, the weather was sunny with NE wind, while in the 2015, the weather was cloudy with SW wind, which is considered to transfer pollution from the Po River outflow. The importance of conditions was also confirmed by a recent study by Carlson et al. (2017). Globally, the distribution of microplastics is affected by hydrodynamics, geomorphology and human factors (Barnes et al., 2009). In comparison with other Mediterranean regions, where concentration of microplastics in the Northwest Mediterranean was measured as 1,330,000 particles/km2 (Collignon et al., 2012) and in the bay of Calvi on Corsica Island as 62,000 particles/km2, measured concentrations in the North Adriatic region are somewhere in the middle. Although previous surveys recorded in the Adriatic Sea (> 52 items/km2) represented a maximum of plastic sea surface macro litter from the whole Mediterranean Sea (Suaria and Aliani, 2014). As the Adriatic Sea is a small, shallow and semi-enclosed basin it represents one of the hotspots as regards pollution (Halpern et al., 2008). Differences on a larger scale, between different parts of Mediterranean, are affected by regional oceanographic conditions (Collignon et al., 2012; Ribić et al., 2012), while the spatial heterogeneity of microplastic distribution on a smaller scale can be linked with wind forcing (Browne et al., 2011). In addition to the above mentioned factors, marine pollution mainly comes from the land via rivers (UNEP/MAP/Med POL, 2003) and the Po River has the highest yearly discharge into the Adriatic Sea (1569.3 m3/s) (Ludwig et al., 2009). The quantity of microplastic particles discharged by the Po River into the Adriatic Sea was already calculated as 68 billion particles per year (van der Wal et al., 2015). Estimations of microplastics pollution in a distinct area is hard to determine, nevertheless there are several factors that impact the final estimation of microplastics pollution. Factors that influence the process of sampling are: 1) weather conditions (wind speed and direction, direction of sea currents and direction of boat flying), for example if the boat moves in the opposite direction to the sea currents, more microplastics should be caught; 2) the quantity of seston with which microplastic particles collide and accumulate; 3) specific conditions related to the sampling microlocation (near a city, river outflow, outflow from a wastewater treatment plant, harbor, etc.). In the process of separating microplastic particles from the samples factors such as 1) the quantity of seston, which makes separation difficult, 2) the quality of the stereomicroscope, where polarization light can help to distinguish between plastic and non-plastic particles, 3) the experience and precision of the person and 4) the laboratory room, which needs to be clean and closed, due to contamination of samples with air born filaments, can strongly influence the final results. In our study, fragments and filaments were the most abundant microplastics categories. There are a few reasons for this result. Filaments are mainly derived from textiles either during industrial production/use or in domestic use (Browne et al., 2011) and are most likely emitted through wastewater treatment and domestic outflows, where there is no sewage system. Filaments are another category of microplastics that are difficult to recognize and could be easily confused with naturally occurring filaments also present in the sea. For this reason, the error in estimating filament concentration could be quite high. The sources of fragments are not the same as for filaments, since they originate from the fragmentation of large pieces of plastic litter. As both categories have different specific weights, their transport on the sea surface is different and thus the areas of concentration are as well. It seems very

Because microplastics can also be transferred by ballast waters (Matiddi et al., 2016), microorganisms typical for ballast waters should be expected on microplastics. When we compared microorganisms from microplastic biofilms to bacteria isolated from ballast water we found that two bacterial taxa, Alteromonas and Rhodobacteriaceae, isolated from our biofilms, were also isolated from ballast water in China (Ma et al., 2009). Otherwise, the most typical representatives of bacteria in ballast water are Pseudomonas and Vibrio, which we did not identify in our samples. Vibrio sp. has been recorded on polyolefin microplastics from the North and Baltic Sea and the North Atlantic Ocean (Zettler et al., 2013; Kirstein et al., 2016), as well as on polystyrene (Foulon et al., 2016). Phylogenetic trees of the first two clone libraries are similar in the quantity of bacterial classes, while the third clone library include only one bacterial class. Among overlapping bacterial classes identified in the 1# and 2# clone libraries, A. salmonicida and H. piscium were the only species found in both clone libraries and with the highest number of OTUs. This support our finding that A. salmonicida was grown with a high probability on our microplastic samples. When we cultivated bacteria from microplastic in LB medium only Bacillus sp. was grown. Bacillus pumilus is a species that was already found in marine environment (Ivanova et al., 2010; Parvathi et al., 2009; Oguntoyinbo, 2007) and their DNA can be isolated only from their spores. According to the results Bacillus was able to germ spores in LB medium and for this reason isolation of their DNA was possible. Furthermore their growth in LB medium inhibit the growth of other potential bacteria previously grown on microplastic used for cultivation. In our study, 75% of chemically analyzed microplastics particles were identified as PE, followed by PP with < 10%. Interestingly, the impact of plastic type on the plastisphere was identified as minimal, since no clear difference in the bacterial profile appeared between polypropylene (PP) and polyethylene (PE) samples (De Tender et al., 2015). In addition, all bacterial species found in both our and Zettler et al.'s (2013) studies colonized both PE and PP fragments. Significant differences occurred only between polystyrene and polyolefin (PE or PP) (Amaral-Zettler et al., 2015), with polystyrene exhibiting higher bacterial abundance (Carson et al., 2013). From this finding we can conclude that the big discrepancy between the results of our 1# and 2# clone libraries could be the consequence of the DNA isolation method and differences in bacterial community structure and not differences in plastic type. The physical properties of plastic can provide a new ecological niche or biotope, with the buoyant and persistent nature of plastic possibly contributing to the survival and long-distance transport of microbial hitchhikers (Keswani et al., 2016). There is a lot of evidence that plastic particles are being consumed by organisms (Lusher et al., 2013; Farrell and Nelson, 2013; Van Cauwenberghe et al., 2015; Watts et al., 2014). Microplastic ingestion by marine organisms influences microbial communities, as all of the microbial hitchhikers enter into the food web. Some of them are pathogenic and represent a great harm to those ingesting them. Biofilm-coated microplastic particles make them more attractive for grazers, particularly those feeding in the oligotrophic ocean (Amaral-Zettler et al., 2015). 4.2. Microplastic abundance in the North Adriatic Sea The microplastic abundance on the sea surface of the Adriatic Sea was unknown before the start of the DeFishGear project (IPA Adriatic Cross-Border Cooperation Programme 2007–2013, 1 str/00010). The first data on microplastic concentrations in the North Adriatic Sea (the Slovenian part of the Trieste Bay) was collected in the period from 2012 to 2014 (Gajšt et al., 2016). The average concentration reported was 406,000 particles/km2. The reported data had high variability between sampling dates, which was explained by the effects of currents and wind and was confirmed by the use of a modeling tool (Liubartseva et al., 2016). Our results also show a significant difference between sampling 307

Marine Pollution Bulletin 125 (2017) 301–309

M.K. Viršek et al.

Caruso, G., 2015. Microplastics in marine environments: possible interactions with the microbial assemblage. J. Pollut. Eff. Cont. 3, e111. Collignon, A., Hecq, J.-H., Glagani, F., Voisin, P., Collard, F., Goffart, A., 2012. Neustonic microplastic and zooplankton in the North Western Mediterranean Sea. Mar. Pollut. Bull. 64 (4), 861–864. Costello, M.J., Coll, M., Danovaro, R., Halpin, P., Ojaveer, H., Miloslavich, P., 2010. A census of marine biodiversity knowledge, resources, and future challenges. PLoS One 5 (8), 12110. De Tender, C.A., Devriese, L.I., Haegeman, A., Maes, S., Ruttink, T., Dawyndt, P., 2015. Bacterial community profiling of plastic litter in the Belgian part of the North Sea. Environ. Sci. Technol. 49 (16), 9629–9638. 2015 Aug 18. http://dx.doi.org/10. 1021/acs.est.5b01093 (Epub 2015 Aug 6). Denner, E.B., Vybiral, D., Koblizek, M., Kampfer, P., Busse, H.J., Velimirov, B., 2002. Erythrobacter citereus sp. nov., a yellow-pigmented bacterium that lacks bacteriochlorophyll a, isolated from the Western Mediterranean Sea. Int. J. Syst. Evol. Microbiol. 52 (Pt 5), 1655–1661. http://dx.doi.org/10.1099/00207713-52-5-1655. Farrell, P., Nelson, K., 2013. Trophic level transfer of microplastic: Mytilus edulis (L.) to Carcinus maenas (L.). Environ. Pollut. 177, 1–3. Fernández-Álvarez, C., Gijón, D., Álvarez, M., Santos, Y., 2016. First isolation of Aeromonas salmonicida subspecies salmonicida from diseased sea bass, Dicentrarchus labrax (L.), cultured in Spain. Aquaculture Reports 4, 36–41. Fiorentini, C., Barbieri, E., Falzano, L., Matarrese, P., Baffone, W., Pianetti, A., ... Casiere, A., 1998. Occurrence, diversity and pathogenicity of mesophilic Aeromonas in estuarine waters of the Italian coast of the Adriatic Sea. J. Appl. Microbiol. 85 (3), 501–511. Foulon, V., Le Roux, F., Lambert, C., Huvet, A., Soudant, P., Paul-Pont, I., 2016. Colonization of polystyrene microparticles by Vibrio crassostreae: light and electron microscopic investigation. Environ. Sci. Technol. 50 (20), 10988–10996. Gajšt, T., Bizjak, T., Palatinus, A., Liubartseva, S., Kržan, A., 2016. Sea surface microplastics in Slovenian part of the Northern Adriatic. Mar. Pollut. Bull. 113 (1), 392–399. Galgani, F., 2014. In: Briand, F. (Ed.), Distribution, composition and abundance of marine litter in Mediterranean and black seas. CIESM 2014 workshop monograph no. 46. CIESM Publisher, Monaco, pp. 23–30. Galgani, F., Souplet, A., Cadiou, Y., 1996. Accumulation of debris on the deep sea floor off the French Mediterranean coast. Mar. Ecol. Prog. Ser. 142, 225–234. Galgani, F., Hanke, G., Maes, T., 2015. Chapter 2: global distribution, composition and abundance of marine litter. In: Bergmann, M. (Ed.), Marine Anthropogenic Litter, http://dx.doi.org/10.1007/978-3-319-16510-3_2. Ghosh, S.K., Pal, S., Ray, S., 2013. Study of microbes having potentiality for biodegradation of plastics. Environ. Sci. Pollut. Res. 20 (7), 4339–4355. Goldstein, M.C., Titmus, A.J., Ford, M., 2013. Scales of spatial heterogeneity of plastic marine debris in the Northeast Pacific Ocean. PLoS One 8 (11), e80020. http://dx. doi.org/10.1371/journal.pone.0080020. Goldstein, M.C., Carson, H.S., Eriksen, M., 2014. Relationship of diversity and habitat area in North Pacific plastic-associated rafting communities. Mar. Biol. 161, 1441. 2014. http://dx.doi.org/10.1007/s00227-014-2432-8. Gudmundsdóttir, B.K., 1998. Infections by atypical strains of the bacterium Aeromonas salmonicida. Icel. Agric. Sci. 12, 61–72. Halpern, B.S., Walbridge, S., Selkoe, K.A., Kappel, C.V., Micheli, F., D'Agrosa, C., et al., 2008. A global map of human impact on marine ecosystems. Science 319, 948–952. Harrison, J.P., Schratzberger, M., Sapp, M., Osborn, A.M., 2014. Rapid bacterial colonization of low-density polyethylene in coastal sediment microcosms. BMC Microbiol. 14 (1), 232. Ivanova, E.P., Vysotskii, M.V., Svetashev, V.I., Nedashkovskaya, O.I., Gorshkova, N.M., Mikhailov, V.V., ... Yoshikawa, S., 2010. Characterization of bacillus strains of marine origin. Int. Microbiol. 2 (4), 267–271. Ivars-Martinez, E., Martin-Cuadrado, A.B., D'auria, G., Mira, A., Ferriera, S., Johnson, J., ... Rodriguez-Valera, F., 2008. Comparative genomics of two ecotypes of the marine planktonic copiotroph Alteromonas macleodii suggests alternative lifestyles associated with different kinds of particulate organic matter. The ISME Journal 2 (12), 1194–1212. Jambeck, J.R., Geyer, R., Wilcox, C., Siegler, T.R., Perryman, M., Andrady, A., Narayan, R., Law, K.L., 2015. Plastic waste inputs from land into the ocean. Science 347 (6223), 768–771. http://dx.doi.org/10.1126/science.1260352. Jiang, H., Dong, H., Zhang, G., Yu, B., Chapman, L.R., Fields, M.W., 2006. Microbial diversity in water and sediment of Lake Chaka, an athalassohaline lake in northwestern China. Appl. Environ. Microbiol. 72 (6), 3832–3845. Jin, H.M., Kim, J.M., Lee, H.J., Madsen, E.L., Jeon, C.O., 2012. Alteromonas as a key agent of polycyclic aromatic hydrocarbon biodegradation in crude oil-contaminated coastal sediment. Environ. Sci. Technol. 46 (14), 7731–7740. Keswani, A., Oliver, D.M., Gutierrez, T., Quilliam, R.S., 2016. Microbial hitchhikers on marine plastic debris: human exposure risks at bathing waters and beach environments. Mar. Environ. Res. 118, 10–19. Kimura, M., 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Kirstein, I.V., Kirmizi, S., Wichels, A., Garin-Fernandez, A., Erler, R., Löder, M., Gerdts, G., 2016. Dangerous hitchhikers? Evidence for potentially pathogenic Vibrio spp. on microplastic particles. Mar. Environ. Res. 120, 1–8. http://dx.doi.org/10.1016/j. marenvres.2016.07.004. Koelmans, A.A., 2015. Modeling the role of microplastics in bioaccumulation of organic chemicals to marine aquatic organisms. a critical review. In: Bergmann, M., Gutow, L., Klages, M. (Eds.), Marine Anthropogenic Litter. Springer, Berlin, pp. 309–324. Korlević, M., 2015. Detaljna analiza bakterijske raznolikosti Jadranskoga mora. Doctoral dissertation. Kovač Viršek, M., Palatinus, A., Koren, Š., Peterlin, M., Horvat, P., Kržan, A., 2016.

likely that the fragments are concentrated in the same areas as large plastic litter, such as where sea currents make gyres, while filaments are concentrated near cities and other areas influenced by humans. Chemical analyses of the particles for both sampling periods were similar, with polyethylene as the most abundant material, followed by polypropylene. Polyethylene was also identified as the most abundant material in the study by Gajšt et al., 2016 albeit by a different method. This result is to be expected, since polyethylene is the most commonly used plastic polymer in the world because it is strong, light, tough, resistant to acids, alkalis and other organic solvents and resistant to higher temperatures. It is an essential material for power transmission, food packaging, consumer goods, electronics, household goods, industrial storage, and transportation industries. The second reason for this result is the fact that polyethylene and polypropylene have very low densities and will thus tend to float on water and be highly mobile. We believe that the combination of large quantities and mobility due to floating leads to the observed situation. 5. Conclusions Our study is the first study that explores bacterial communities on microplastics particles isolated from the North Adriatic Sea. Several studies related to bacteria communities on microplastics have been done till now, but none have yet identified bacterial fish pathogen A. salmonicida. Based on the 16S rDNA sequences, we found also other important bacterial species such as hydrocarbon-degrading bacterial species and other marine bacterial species. The fact that bacteria A. salmonicida was identified on microplastics and that microplastics concentration in the North Adriatic is high, points to the urgent need to further address the relationship between microplastics abundance and distribution, the microbial communities inhabiting them, and the occurrence of correlated illnesses in fish. Acknowledgements This work was partly supported by the DeFishGear (Derelict Fishing Gear Management System in the Adriatic Region) (http://www. defishgear.net/) IPA Adriatic strategic project 1 str/00010 implemented with co-funding by the European Union, Instrument for PreAccession Assistance (IPA). References Amaral-Zettler, L.A., Zettler, E.R., Slikas, B., Boyd, G.D., Melvin, D.W., Morrall, C.E., ... Mincer, T.J., 2015. The biogeography of the plastisphere: implications for policy. Front. Ecol. Environ. 13 (10), 541–546. Andrady, A.L., 2011. Microplastics in the marine environment. Mar. Pollut. Bull. 62 (8), 1596–1605. Artham, T., Sudhakar, M., Venkatesan, R., Nair, C.M., Murty, K., Doble, M., 2009. Biofouling and stability of synthetic polymers in sea water. Int. Biodeterior. Biodegrad. 63, 884–890. Austin, B., Austin, D.A., 2012. Bacterial Fish Pathogens (p. 652). Springer, Heidelberg, Germany. Balasubramanian, V., Natarajan, K., Hemambika, B., Ramesh, N., Sumathi, C.S., Kottaimuthu, R., Kannan, V.R., 2010. High-density polyethylene (HDPE)-degrading potential bacteria from marine ecosystem of gulf of Mannar, India. Lett. Appl. Microbiol. 51, 205–211. Barnes, D.K., Galgani, F., Thompson, R.C., Barlaz, M., 2009. Accumulation and fragmentation of plastic debris in global environments. Philosophical Transactions of the Royal Society of London B: Biological Sciences 364 (1526), 1985–1998. Bolaños, R., Sørensen, J.V.T., Benetazzo, A., Carniel, S., Sclavo, M., 2014. Modelling ocean currents in the northern Adriatic Sea. Cont. Shelf Res. 87, 54–72. Browne, M.A., Crump, P., Niven, S.J., Teuten, E., Tonkin, A., Galloway, T., Thompson, R., 2011. Accumulation of microplastic on shorelines worldwide: sources and sinks. Environ. Sci. Technol. 45 (21), 9175–9179. Carlson, D.F., Suaria, G., Aliani, S., Fredj, E., Fortibuoni, T., Griffa, A., Russo, A., Melli, V., 2017. Combining litter observations with a regional ocean model to identify sources and sinks of floating debris in a semi-enclosed basin: the Adriatic Sea. Front. Mar. Sci. 4, 78. http://dx.doi.org/10.3389/fmars.2017.00078. Carson, H.S., Nerheim, M.S., Carroll, K.A., Eriksen, M., 2013. The plastic-associated microorganisms of the North Pacific gyre. Mar. Pollut. Bull. 75 (1), 126–132. http://dx. doi.org/10.1016/j.marpolbul.2013.07.054.

308

Marine Pollution Bulletin 125 (2017) 301–309

M.K. Viršek et al.

Parvathi, A., Krishna, K., Jose, J., Joseph, N., Nair, S., 2009. Biochemical and molecular characterization of Bacillus pumilus isolated from coastal environment in Cochin, India. Braz. J. Microbiol. 40 (2), 269–275. Paterson, W.D., Douey, D., Desautels, D., 1980. Relationships between selected strains of typical and atypical Aeromonas salmonicida, Aeromonas hydrophila, and Haemophilus piscium. Can. J. Microbiol. 26 (5), 588–598. PlasticsEurope, 2016. Plastics — The Facts 2016. An Analysis of European Plastics Production, Demand and Waste Data. http://www.plasticseurope.org/documents/ document/20161014113313-plastics_the_facts_2016_final_version.pdf. Reisser, J., Shaw, J., Hallegraeff, G., Proietti, M., Barnes, D.K.A., et al., 2014. Millimetersized marine plastics: a new pelagic habitat for microorganisms and invertebrates. PLoS One 9 (6), e100289. http://dx.doi.org/10.1371/journal.pone.0100289. Ribić, C.A., Sheavly, S.B., Rugg, D.J., Erdmann, E.S., 2012. Trends in marine debris along the U.S. Pacific coast and Hawai'i 1998–2007. Mar. Pollut. Bull. 64, 994–1004. Saitou, N., Nei, M., 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74 (12), 5463–5467. http://dx.doi.org/10. 1073/pnas.74.12.5463. Scott, M., 1968. The pathogenicity of Aeromonas salmonicida (griffin) in sea and brackish waters. Microbiology 50 (2), 321–327. Suaria, G., Aliani, S., 2014. Floating debris in the Mediterranean Sea. Mar. Pollut. Bull. 86 (1), 494–504. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 5.2.2. Mol. Biol. Evol. 24, 1596–1599. Thompson, R.C., 2006. Plastic debris in the marine environment: consequences and solutions. In: Krause, J.C., Nordheim, H., Bräger, S. (Eds.), Marine Nature Conservation in Europe. Bundesamt für Naturschutz, Stralsund, Germany, pp. 107–115. Tuimala, J., 2004. Using ClustalX for Multiple Sequence Alignment. http://tuimala. mbnet.fi/oppaat/clustalx.pdf. UNEP/MAP/Med POL, 2003. Riverine transport of water sediment and pollutants to the Mediterranean Sea. MAP Tech. Rep Ser. 141 111 pp. Van Cauwenberghe, L., Claessens, M., Vandegehuchte, M.B., Janssen, C.R., 2015. Microplastics are taken up by mussels (Mytilus edulis) and lugworms (Arenicola marina) living in natural habitats. Environ. Pollut. 199, 10–17. van der Wal, M., et al., 2015. SFRA0025: Identification and Assessment of Riverine Input of (Marine) Litter, Final Report for the European Commission DG Environment Under Framework Contract No ENV.D.2/FRA/2012/0025. Watts, A.J., Lewis, C., Goodhead, R.M., Beckett, S.J., Moger, J., Tyler, C.R., Galloway, T.S., 2014. Uptake and retention of microplastics by the shore crab Carcinus maenas. Environ. Sci. Technol. 48 (15), 8823–8830. Wilber, R.J., 1987. Plastic in the North Atlantic. Oceanus 30 (3), 61–68. Zarfl, C., Fleet, D., Fries, E., Galgani, F., Gerdts, G., Hanke, G., et al., 2011. Microplastics in oceans. Mar. Pollut. Bull. 62, 1589–1591. Zettler, E.R., Mincer, T.J., Amaral-Zettler, L.A., 2013. Life in the “plastisphere”: microbial communities on plastic marine debris. Environ. Sci. Technol. 47, 7137–7146. http:// dx.doi.org/10.1021/es401288x.

Protocol for microplastics sampling on the sea surface and sample analysis. J. Vis. Exp.(118), e55161. http://dx.doi.org/10.3791/55161. Kühn, S., Bravo Rebolledo, E.L., van Franeker, J.A., 2015. Deleterious effects of litter on marine life. In: Bergmann, M., Gutow, L., Klages, M. (Eds.), Marine Anthropogenic Litter. Springer, Berlin, pp. 75–116. Kumar, M., Xie, A., Curley, J., 2016. Determining the potential secondary impacts associated with microorganismal biodegradation of microplastics in the marine environment. The Journal of Experimental Secondary Science 3 (4). Law, K.L., Morét-Ferguson, S., Maximenko, N.A., Proskurowski, G., Peacock, E.E., et al., 2010. Plastic accumulation in the North Atlantic subtropical gyre. Science 329 (5996), 1185–1188. Lee, J.W., Nam, J.H., Kim, Y.H., Lee, K.H., Lee, D.H., 2008. Bacterial communities in the initial stage of marine biofilm formation on artificial surfaces. J. Microbiol. 46 (2), 174–182. Liubartseva, S., Coppini, G., Lecci, R., Creti, S., 2016. Regional approach to modeling the transport of floating plastic debris in the Adriatic Sea. Mar. Pollut. Bull. 103 (1), 115–127. Ludwig, W., Dumont, E., Meybeck, M., Heussner, S., 2009. River discharges of water and nutrients to the Mediterranean and Black Sea: major drivers for ecosystem changes during past and future decades? Prog. Oceanogr. 80 (3), 199–217. Lusher, A., 2015. Microplastics in the marine environment: distribution, interactions and effects. In: Bergmann, M., Gutow, L., Klages, M. (Eds.), Marine Anthropogenic Litter. Springer, Berlin, pp. 245–307. http://dx.doi.org/10.1007/978-3-319-16510-3_10. Lusher, A.L., McHugh, M., Thompson, R.C., 2013. Occurrence of microplastics in the gastrointestinal tract of pelagic and demersal fish from the English Channel. Mar. Pollut. Bull. 67 (1), 94–99. Ma, Y., Xiong, H., Tang, S., Yang, Q., Li, M., 2009. Comparison of the community structure of planktonic bacteria in ballast water from entry ships and local sea water in Xiamen port. Prog. Nat. Sci. 19 (8), 947–953. Maso, M., Garces, E., Pages, F., Camp, J., 2003. Drifting plastic debris as a potential vector for dispersing Harmful Algal Bloom (HAB) species. Sci. Mar. 67, 107–111. Matiddi, M., Tornambè, A., Silvestri, C., Cicero, A.M., Magaletti, E., 2016. First evidence of microplastics in the ballast water of commercial ships. In: Baztan, J., Jorgensen, B., Pahl, S., Thompson, R.C., Vanderlinden, J.P. (Eds.), MICRO 2016: Fate and Impact of Microplastics in Marine Ecosystems: From the Coastline to the Open Sea. Elsevier. McCormick, A., Hoellein, T.J., Mason, S.A., Schluep, J., Kelly, J.J., 2014. Microplastic is an abundant and distinct microbial habitat in an urban river. Environ. Sci. Technol. 48 (20), 11863–11871. Moore, C.J., Moore, S.L., Leecaster, M.K., Weisberg, S.B., 2001. A comparison of plastic and plankton in the north Pacific central gyre. Mar. Pollut. Bull. 42 (12), 1297–1300. Oberbeckmann, S., Loeder, M.G., Gerdts, G., Osborn, A.M., 2014. Spatial and seasonal variation in diversity and structure of microbial biofilms on marine plastics in Northern European waters. FEMS Microbiol. Ecol. 90 (2), 478–492. Oguntoyinbo, F.A., 2007. Monitoring of marine bacillus diversity among the bacteria community of sea water. Afr. J. Biotechnol. 6 (2). Ottaviani, D., Santarelli, S., Bacchiocchi, S., Masini, L., Ghittino, C., Bacchiocchi, I., 2006. Occurrence and characterization of Aeromonas spp. in mussels from the Adriatic Sea. Food Microbiol. 23 (5), 418–422.

309