MicroRNA-122 targets genes related to goose fatty liver

MicroRNA-122 targets genes related to goose fatty liver Jun Zhang,∗ Qian Wang,∗ Xing Zhao,∗ Laidi Wang,∗ Xingguo Wang,∗,† Jian Wang,‡ Biao Dong,‡ and Daoqing Gong∗,1 ∗

College of Animal Science and Technology, Yangzhou University, Yangzhou, Jiangsu, 225009, PR China; † Jiangsu Institute of Poultry Science, Yangzhou, Jiangsu 225125, PR China; and ‡ Jiangsu Agri-Animal Husbandry Vocational College, Taizhou, Jiangsu, 225300, PR China down-regulated after overfeeding; some genes related to lipid metabolism, including prolyl 4-hydroxylase subunit alpha 1 (P4HA1); aldolase, fructose-bisphosphate B (ALDOB); and pyruvate kinase, muscle (PKM2), were predicted and validated as target genes of goose miR-122. After overexpression or inhibition of miR-122 in primary goose hepatocytes, the expression of ALDOB and PKM2 was changed, but not that of P4HA1, indicating miR-122 regulates ALDOB and PKM2 expression at the mRNA level. These findings suggest miR-122 play important roles in goose fatty liver by targeting some of the genes related to lipid metabolism.

ABSTRACT MicroRNA-122 (miR-122), a completely conserved, liver-specific miRNA in vertebrates, is essential for the maintenance of liver homeostasis. This 22-nucleotide-length RNA regulates diverse functions such as cholesterol, glucose, and lipid metabolism as well as iron homeostasis and infection of hepatitis C virus (HCV). Landes goose, which has a good, fatty liver, has important significance for us in studying miR122 function in goose fatty liver. In the current study, we identified miR-122 in goose liver and its expression pattern and target genes. We found that miR-122 was highly expressed in goose liver and its expression was

Key words: miR-122, goose fatty liver, target gene, lipid metabolism, function 2017 Poultry Science 0:1–7 http://dx.doi.org/10.3382/ps/pex307

INTRODUCTION

vation of the central metabolic sensors protein kinase AMP-activated catalytic subunit alpha 1, which can inhibit the activity of key enzymes in cholesterol and fatty acid synthesis, was enhanced. Inhibition of miR122 expression in an obese mouse model using the same method led to repression of plasma cholesterol, and significantly improved steatosis in liver by repressing the expression of genes related to fatty acid synthesis (Esau et al., 2006). Nocturnin is a circadian deadenylase; a mouse lacking it can defend against obesity and fatty liver induced by diet. In mouse liver, miR-122 targets nocturnin to regulate its expression, and thereby affects hepatic metabolism and circadian control (Kojima et al., 2010). In addition, treating mice with a miR-122 inhibitor, a large portion of predicted target genes of miR-122 in liver were up-regulated, such as NDRG family member 3, aldolase, fructose-bisphosphate A (ALDOA), branched chain ketoacid dehydrogenase kinase, and CD320 molecule, and finally liver metabolism was regulated (Elmen et al., 2008). Landes goose is a breed used to produce fatty liver (Hermier et al., 1991). Fatty liver produced by overfeeding has large amounts of unsaturated fatty acids, which are said to effectively prevent cardiovascular disease in humans (Fournier et al., 1997; Mourot et al., 2000). Therefore, the Landes goose is an excellent model to study to research the regulatory functions of miR-122 on liver metabolism. In the current study, Illumina’s

MicroRNA (miRNA) is a class of important regulators of gene expression. It negatively regulates target gene expression by binding to the 3 UTR of target gene, leading to inhibition of translation or messenger RNA (mRNA) degradation (Lee et al., 1993; Bartel, 2004). miRNA takes part in many biological processes such as growth, development, and metabolism (Bartel, 2004; Wienholds and Plasterk, 2005). Recent research has revealed that miR-122 plays important roles in liver. miR-122 occupies 70% of miRNAs in adult mouse liver, and it is conserved among many species. It is processed from the transcript of a non-coding gene, Hcr, which is also conserved among species (Chang et al., 2004; Tsai et al., 2012). miR-122 has important regulatory functions in lipid metabolism in liver. Overexpression or inhibition of miR-122 leads to changes of cholesterol and fatty acid synthesis. Using antisense oligonucleotide to inhibit miR-122 expression in normal mouse, researchers found that the level of cholesterol in plasma decreased, the oxidation of fatty acid in liver increased and the synthesis rate of hepatic fatty acid and cholesterol decreased, and the acti-

 C 2017 Poultry Science Association Inc. Received September 25, 2016. 1 Corresponding author: [email protected]

1 Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex307/4653045 by University of Florida user on 05 January 2018

2

ZHANG ET AL.

Solexa sequencing technology was used to screen for miRNAs in goose liver; the miR-122 in goose was described for the first time using this resource, and the expression level was determined. The miRNA target genes were predicted by bioinformatic methods and the dual luciferase reporter assay was used to verify some of the target genes and the impacts of miR-122 overexpression or suppression on goose liver were studied in the primary hepatocytes from goose.

MATERIALS AND METHODS Experimental Animals and Breeding Management Forty male Landes geese (60 d of age) were randomly divided into treated (n = 20) and control groups (n = 20). All of the animals were kept in cages and fed with maize. In the treated group, the geese were forcefed with a carbohydrate diet that consisted of boiled maize (boiled maize, 1.0% plant oil, 0.8% salt), whereas the control group was allowed free-choice feeding with maize. After 24 d of overfeeding (84 d of age), liver samples were obtained and weighed, snap-frozen in liquid nitrogen, and stored at –70◦ C until use.

Real-Time Quantitative Reverse-Transcription PCR The expression of miR-122 from 10 samples was detected by real-time quantitative reverse-transcription (qRT)-PCR according to the protocol of TaqMan MicroRNA Assay (Applied Biosystems, Foster City, CA). All reactions were run in duplicate. The expression levels of miRNA were measured in terms of CT value and normalized to U6 rRNA using 2−ΔΔCT (Livak and Schmittgen, 2001). The expression of the target gene was detected according to the protocol of PrimeScript RT reagent kit and SYBR Premix Ex Taq (TaKaRa, Dalian, China). GAPDH was used as an internal control. The sequences of primers for this study are listed in Table S1.

Construction of Plasmids The 3 UTRs of P4HA1, ALDOB and PKM2 predicted to contain miR-122 binding sites were amplified from goose genomic DNA and inserted into the pMIRREPORT vector between the SacI and HindIII sites to construct the pMIR-3 UTR vectors.

Transfection of Cultured Cells and Luciferase Reporter Assay RNA Isolation and Deep Sequencing Total RNA from 10 liver samples of each group described above was isolated using Trizol reagent (Ambion, Carlsbad, CA). The RNA concentrations and quality were determined by NanoDrop ND2000 spectrophotometry and formaldehyde-agarose gel electrophoresis. Then, miRNA from 3 samples was linked to an adapter, reverse transcribed, and enriched by polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) (Wang et al., 2012). Deep sequencing was performed by Shanghai Biotechnology Corporation using an Illumina Miseq system. Unique reads of 15 to 30 nt were selected by counting and grouping identical sequences; the unique reads were compared with the chicken miRNAs to find miR-122, and the expression level of miR-122 between groups were compared by reads per million (RPM).

Computational Prediction of miR-122 Target Genes

The Chinese hamster ovary (CHO) cells were cultured in a CO2 incubator (37◦ C, 5% CO2 ) with Dulbecco’s Modified Eagle’s medium (DMEM; Gibco, Grand Island, NY) as the culture medium. When the CHO cells reached confluence, they were digested with 0.25% trypsin for cell counting. The pMIR-3 UTR was diluted to 50 ng/μL, whereas pRL-TK was diluted to 1 ng/μL. The miR-122 mimic and pMIR-3 UTR vectors were transfected into CHO cells using the Lipofectamine 2000 transfection reagent (Applied Biosystems, Foster City, CA). miR-122 mimic negative control (miR-122 mimic NC) was used as control. Dual luciferase activity was detected after 48 h. We detected dual luciferase activity according to the dual-luciferase reporter assay system kit (Promega, Madison, WI) instruction.

Culture of Primary Goose Hepatocytes and Transfection

Goose hepatocytes were isolated from 23 d of incubation embryonic goose liver using a collagenase method The transcriptome information of Landes goose we as previously described (Wang et al., 2013). The isoobtained previously and chicken genome information lated hepatocytes were cultured at a density of 6 × was used to predict goose miR-122 target genes. The 105 cells/mL in DMEM at 37◦ C with 5% CO2 in a humiRNA target prediction software miRanda v 1.0b (Enmidified incubator. The goose hepatocytes cultured to right et al., 2003), miRcosm (Griffiths-Jones et al., a density of 60 to 70% were transfected with miR-122 2008), miRDB (Wang, 2008) and TargetScan (Lewis mimic or miR-122 inhibitor using Lipofectamine 2000 et al., 2005) were used to predict the binding sites betransfection reagent. miR-122 mimic NC and miR-122 tween miR-122 and predicted target genes using the inhibitor negative control (miR-122 inhibitor NC) were default parameters. used as controls. Total RNA was isolated 48 h later. Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex307/4653045 by University of Florida user on 05 January 2018

3

MICRORNA-122 TARGETS GOOSE GENES Table 1. Carcass traits of Landes goose after overfeeding. Group Control Overfeeding

Body weight (kg)

Liver weight (kg)

Liver weight/BW (%)

4.42 ± 0.38 6.87 ± 0.45b

0.10 ± 0.02 0.83 ± 0.16b

2.33 ± 0.47a 12.09 ± 2.12b

a

a

a,b Means with column with no common superscript are significantly different (P < 0.01).

Statistical Analysis

(A)

8000

miR-122 expression level

All data are presented as mean ± SEM of at least 3 independent experiments. Statistical analysis was performed using the Student’s t-test or one-way analysis of variance (ANOVA) in SPSS software. A difference with P < 0.05 was considered statistically significant.

RESULTS Liver and Body Weight After overfeeding, we detected some carcass traits of Landes goose and found the body weight and liver weight of overfeeding group were significantly higher compared with control group (Table 1), indicating the overfeeding was successful at increasing both body and liver weight.

7000 6000 5000 4000 3000 2000 1000 0 Control

Overfeeding

(B)

miR-122 Sequence Then we detected the miRNAs in goose liver by deep sequencing. We found there was the same sequence (UGGAGUGUGACAAUGGUGUUUGU) in goose liver as miR-122 sequence in chicken miRBase.

Expression of miR-122 in liver The result from deep sequencing showed that the expression level of miR-122 in goose liver of treated group was lower compared with the control group (Figure 1A). To further verify the result, real-time qRT-PCR was performed, and the result showed the expression level of miR-122 in goose liver also decreased after 24 d of overfeeding (Figure 1B). These results revealed that miR122 is down-regulated in the process of goose fatty liver.

Prediction of miR-122 Target Genes The chicken genome was used to predict potential target genes by miRcosm, miRDB and TargetScan. Twelve genes were found overlapping the genes predicted by these 3 bioinformatics software, respectively. Moreover, the transcriptome information of Landes goose we obtained previously was also used to predict potential target genes by miRanda and TargetScan. One hundred seventy-five genes were found overlapping the genes predicted by the 2 softwares. Finally, we selected 3 genes according to the potential genes predicted by the 2 methods above and some references. They

Figure 1. Expression of miR-122 in liver of Landes goose after overfeeding. (A) Expression level of miR-122 in liver of Landes goose after 24 d of overfeeding by deep sequencing. (B) Expression level of miR-122 in liver of Landes goose after 24 d of overfeeding by real-time qRT-PCR. n = 10. Data are means ± SEM. ∗ P < 0.05.

are P4HA1, ALDOB and PKM2. The miR-122 binding sites of these potential genes are shown in Figure 2.

Verification of miR-122 Target Genes miR-122 overexpression was verified previously by detecting the expression level of miR-122 in miR-122 mimic transfected CHO cells using real-time qRT-PCR.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex307/4653045 by University of Florida user on 05 January 2018

4

ZHANG ET AL.

Figure 2. Prediction of miR-122 target genes. Schema of miR-122 binding sites in 3 UTRs of goose P4HA1, ALDOB, and PKM2. The matched base pairs are connected by vertical lines and the U:G wobble is connected by dots.

genes. The inhibition rate for PKM2 gene is the highest and reaches 47%.

Effect of miR-122 Overexpression or Knockdown on Target Gene Expression in Goose Hepatocytes

Figure 3. Verification of miR-122 target genes The CHO cells were cotransfected with pMIR-3 UTR (Firefly luciferase) and miR-122 NC or miR-122 mimic. pRL-TK (Renilla luciferase) was also cotransfected. Relative luciferase activity was determined by normalizing Firefly luciferase activity to Renilla luciferase activity. Data are means ± SEM of at least 3 independent experiments and analyzed by Student’s t-test. ∗ P < 0.05; ∗∗ P < 0.01.

To verify whether the potential target genes are real miR-122 target genes, dual luciferase reporter assay was used. As shown in Figure 3, in comparison with the control groups, the luciferase activities was significantly lower for the P4HA1, ALDOB, and PKM2 genes in the miR-122 overexpression groups (P < 0.05). This is to say, P4HA1, ALDOB, and PKM2 are miR-122 target genes, miR-122 bind to the predicted target sites in the 3 UTRs of P4HA1, ALDOB, and PKM2 to partly inhibit the expression of the associated luciferase reporter

To further investigate the miR-122 regulation on genes P4HA1, ALDOB, and PKM2, we detected them in primary goose hepatocytes where miR-122 was overexpressed or knocked-down by real-time qRT-PCR. As shown in Figure 4A, comparing with miR-122 mimic NC, the expression level of miR-122 was much higher in cells transfected with miR-122 mimic. When comparing with miR-122 inhibitor NC, miR-122 was expressed at a much lower level in cells transfected with miR122 inhibitor (Figure 4B). These results indicated that overexpression and inhibition of miR-122 in goose hepatocytes result in changes in observed RNA expression levels. As shown in Figure 4C, the mRNA expression level of a potential miR-122 target gene PKM2 was significantly lower in miR-122 overexpressed cells than in miR-122 mimic NC, while the mRNA expression levels of ALDOB and P4HA1 was not changed significantly. The mRNA expression level of ALDOB was significantly higher in miR-122 inhibited cells than in NC, and the mRNA expression level of PKM2 had a trend of increase by miR-122 inhibition, though not significantly, while the mRNA expression level of P4HA1 was not changed (Figure 4D). These findings indicated that

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex307/4653045 by University of Florida user on 05 January 2018

5

MICRORNA-122 TARGETS GOOSE GENES

miR-122 regulates PKM2 and ALDOB mRNA expression at the mRNA level.

DISCUSSION

Figure 4. Effect of miR-122 on target genes in goose hepatocytes. (A) miR-122 in goose hepatocytes was overexpressed by miR122 mimic. (B) Expression level of miR-122 in goose hepatocytes was knocked down by miR-122 inhibitor. (C) Expression levels of P4HA1, ALDOB, and PKM2 in miR-122 overexpressed goose hepatocytes. (D) Expression levels of P4HA1, ALDOB, and PKM2 in miR-122 knockdown goose hepatocytes.

The result of deep sequencing of miRNAs in the current study was consistent with the previous study, showing miR-122 was expressed high in normal goose liver, which was the control group. Previous study showed miR-122 was highly expressed in mammalian liver (Chang et al., 2004). This result suggested miR122 plays an important role in goose liver. In nonalcohol fatty liver patients, the expression of miR-122 in livers significantly decreased from 70% to 63% (Chang et al., 2004; Cheung et al., 2008). In human livers with disease such as liver cirrhosis and liver cancer, the expression of miR-122 in livers was also down-regulated usually (Bai et al., 2009; Padgett et al., 2009). In this study, the expression level of miR-122 was downregulated by overfeeding using deep sequencing, and the real-time qRT-PCR showed the same result, which was consistent with the previous studies. These results indicated that the down-regulation of miR-122 expression in goose liver was involved in the regulation of lipid and cholesterol metabolism, and it may play important roles in the forming process of goose fatty liver. miR-122 takes part in liver-related metabolism by interacting with its target genes. We select 3 predicted target genes: P4HA1, ALDOB, and PKM2. In lipid metabolism, PKM2 and ALDOB are associated with glycolysis. Jung showed that PKM2 is the key gene in aerobic glycolysis in liver cancer cells (Jung et al., 2013). He also found that the expression of miR-122 increased in primary human hepatocytes, but in differentiated cells, such as human embryonic stem cells and liver cancer cells, its expression decreased, while PKM2 had a contrary expression compared with miR122, so PKM2 was verified as a target gene of miR-122 and it played a role in cell proliferation (Jung et al., 2011). P4HA1 is related to the formation of collagen; it was proven as a target gene of miR-122 in study on rats, and played an important part in the maturation of collagen (Li et al., 2013). ALDOB is an isozyme of ALDOA, and its lack is connected with hereditary fructose intolerance disease in human (Choi et al., 2012); its expression was down-regulated significantly in goose fatty liver (Zhu et al., 2011). ALDOA and P4HA1 as miR-122 target genes have been proven by Esau at the cellular level, which were said to be involved in lipid metabolism, so we predicted they took part in liver steatosis. Through sequencing the liver of mice after injecting miR-122 inhibitor in vivo, the expression of some lipid metabolism related genes such as fatty acid synthase, acetyl-CoA carboxylase 1, acetylCoA carboxylase 2, stearoyl-Coenzyme A desaturase 1, and ATP citrate lyase were found to be significantly decreased; the expression of many predicted target genes of miR-122 in the liver such as ALDOA, P4HA1 was found to be increased; and finally, liver metabolism was

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex307/4653045 by University of Florida user on 05 January 2018

6

ZHANG ET AL.

regulated (Elmen et al., 2008; Esau et al., 2006). In summary, these 3 genes P4HA1, ALDOB, and PKM2 may participate in the formation of goose fatty liver, and they are very likely to be target genes of miR-122. The result of luciferase assay revealed that miR122 target to inhibit the expression of P4HA1, PKM2, and ALDOB significantly. The functions of miR-122 on P4HA1 and PKM2 were the same as the results in other species in previous studies (Jung et al., 2011; Li et al., 2013). The studies of Esau et al. (2006) and Elmen et al. (2008) showed ALDOA was target gene of miR-122. ALDOA is an isozyme of ALDOB, but there was no report about ALDOB as target of miR-122, so the current study was the first time that ALDOB was validated as target gene of miR-122. By transfecting miR-122 mimic or inhibitor into primary goose hepatocytes, we found the effects of miR-122 overexpression and inhibition are high. The real-time qRT-PCR results of target genes showed the expression of PKM2 decreased by miR-122 overexpression, and the expression of ALDOB increased by miR122 inhibition, but neither miR-122 overexpression nor miR-122 inhibition had effect on P4HA1 expression. So in mRNA level miR-122 was validated to target and repress PKM2 and ALDOB. Jung et al. (2011) validated PKM2 mRNA was regulated by miR-122 in human embryonic stem cells and hepatocarcinoma cells. Esau et al. validated ALDOA (isozyme of ALDOB) mRNA was regulated by miR-122 in mouse (Elmen et al., 2008; Esau et al., 2006). These results were consistent with ours, indicating goose miR-122 was the same as mammal miR-122, its inhibition of PKM2 and ALDOB was in mRNA level. Esau et al. (2006) and Li et al. (2013) validated P4HA1 mRNA was regulated by miR-122 in mouse. This result was not consistent with ours, it is possible that goose miR-122 inhibited P4HA1 in protein level, which indicated goose miR-122 regulation of P4HA1 had a special manner. Therefore, we predicted that when lipids are accumulated in the liver of Landes goose after overfeeding, the expression of miR-122 decreased, the inhibition of target genes was depressed, followed by enhancement of carbohydrate metabolism and increase of energy release. That was beneficial to formation of the goose fatty liver.

SUPPLEMENTARY DATA Supplementary data are available at PSCIEN online. Table S1. Primers for real time RT-PCR and plasmid construction.

ACKNOWLEDGMENTS This work was supported financially by the Natural Sciences Foundation of China (31372298, 31540093), the Natural Sciences Foundation of the Education Department of Jiangsu Province (11KJB30005) and the Jiangsu Agriculture Science and Technology Innovation

Fund (CX(12)2033). The authors thank Dr. Ian Dunn for critical reading of the manuscript.

REFERENCES Bai, S., M. W. Nasser, B. Wang, S. H. Hsu, J. Datta, H. Kutay, A. Yadav, G. Nuovo, P. Kumar, and K. Ghoshal. 2009. MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J. Biol. Chem. 284:32015–32027. Bartel, D. P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116:281–297. Chang, J., E. Nicolas, D. Marks, C. Sander, A. Lerro, M. A. Buendia, C. Xu, W. S. Mason, T. Moloshok, R. Bort, K. S. Zaret, and J. M. Taylor. 2004. miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1. RNA Biol. 1:106– 113. Cheung, O., P. Puri, C. Eicken, M. J. Contos, F. Mirshahi, J. W. Maher, J. M. Kellum, H. Min, V. A. Luketic, and A. J. Sanyal. 2008. Nonalcoholic steatohepatitis is associated with altered hepatic MicroRNA expression. Hepatology. 48:1810–1820. Choi, H. W., Y. J. Lee, S. H. Oh, K. M. Kim, J. M. Ryu, B. H. Lee, G. H. Kim, and H. W. Yoo. 2012. A Novel frameshift mutation of the ALDOB gene in a Korean girl presenting with recurrent hepatitis diagnosed as hereditary fructose intolerance. Gut Liver. 6:126–128. Elmen, J., M. Lindow, A. Silahtaroglu, M. Bak, M. Christensen, A. Lind-Thomsen, M. Hedtjarn, J. B. Hansen, H. F. Hansen, E. M. Straarup, K. McCullagh, P. Kearney, and S. Kauppinen. 2008. Antagonism of microRNA-122 in mice by systemically administered LNA-antimiR leads to up-regulation of a large set of predicted target mRNAs in the liver. Nucleic Acids Res. 36:1153– 1162. Enright, A. J., B. John, U. Gaul, T. Tuschl, C. Sander, and D. S. Marks. 2003. MicroRNA targets in Drosophila. Genome Biol. 5:R1. Esau, C., S. Davis, S. F. Murray, X. X. Yu, S. K. Pandey, M. Pear, L. Watts, S. L. Booten, M. Graham, R. McKay, A. Subramaniam, S. Propp, B. A. Lollo, S. Freier, C. F. Bennett, S. Bhanot, and B. P. Monia. 2006. miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab. 3:87–98. Fournier, E., R. Peresson, G. Guy, and D. Hermier. 1997. Relationships between storage and secretion of hepatic lipids in two breeds of geese with different susceptibility to liver steatosis. Poult. Sci. 76:599–607. Griffiths-Jones, S., H. K. Saini, S. van Dongen, and A. J. Enright. 2008. miRBase: tools for microRNA genomics. Nucleic Acids Res. 36:D154–D158 Hermier, D., A. Saadoun, M.-R. Salichon, N. Sellier, D. RousselotPaillet, and M. J. Chapman. 1991. Plasma lipoproteins and liver lipids in two breeds of geese with different susceptibility to hepatic steatosis: changes induced by development and force-feeding. Lipids. 26:331–339. Jung, C. J., S. Iyengar, K. R. Blahnik, T. P. Ajuha, J. X. Jiang, P. J. Farnham, and M. Zern. 2011. Epigenetic modulation of miR-122 facilitates human embryonic stem cell self-renewal and hepatocellular carcinoma proliferation. PLoS One. 6:e27740. Jung, Y., Y. J. Jang, M. H. Kang, Y. S. Park, S. J. Oh, D. C. Lee, Z. Xie, H. S. Yoo, K. C. Park, and Y. I. Yeom. 2013. Metabolic signature genes associated with susceptibility to pyruvate kinase, muscle type 2 gene ablation in cancer cells. Mol. Cells. 35:335– 341. Kojima, S., D. Gatfield, C. C. Esau, and C. B. Green. 2010. MicroRNA-122 modulates the rhythmic expression profile of the circadian deadenylase Nocturnin in mouse liver. PLoS One. 5:e11264. Lee, R. C., R. L. Feinbaum, and V. Ambros. 1993. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843–854. Lewis, B. P., C. B. Burge, and D. P. Bartel. 2005. Conserved seed pairing, often flanked by adenosines, indicates that

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex307/4653045 by University of Florida user on 05 January 2018

MICRORNA-122 TARGETS GOOSE GENES thousands of human genes are microRNA targets. Cell. 120: 15–20. Li, J., M. Ghazwani, Y. Zhang, J. Lu, J. Fan, C. R. Gandhi, and S. Li. 2013. miR-122 regulates collagen production via targeting hepatic stellate cells and suppressing P4HA1 expression. J. Hepatol. 58:522–528. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. Mourot, J., G. Guy, S. Lagarrigue, P. Peiniau, and D. Hermier. 2000. Role of hepatic lipogenesis in the susceptibility to fatty liver in the goose (Anser anser). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 126:81–87. Padgett, K. A., R. Y. Lan, P. C. Leung, A. Lleo, K. Dawson, J. Pfeiff, T. K. Mao, R. L. Coppel, A. A. Ansari, and M. E. Gershwin. 2009. Primary biliary cirrhosis is associated with altered hepatic microRNA expression. J. Autoimmun. 32:246–253. Tsai, W. C., S. D. Hsu, C. S. Hsu, T. C. Lai, S. J. Chen, R. Shen, Y. Huang, H. C. Chen, C. H. Lee, T. F. Tsai, M. T. Hsu, J. C. Wu, H. D. Huang, M. S. Shiao, M. Hsiao, and A. P. Tsou.

7

2012. MicroRNA-122 plays a critical role in liver homeostasis and hepatocarcinogenesis. J. Clin Invest. 122:2884–2897. Wang, X. 2008. miRDB: a microRNA target prediction and functional annotation database with a wiki interface. RNA. 14:1012– 1017. Wang, X. G., F. Shao, H. J. Wang, L. Yang, J. F. Yu, D. Q. Gong, and Z. L. Gu. 2013. MicroRNA-126 expression is decreased in cultured primary chicken hepatocytes and targets the sproutyrelated EVH1 domain containing 1 mRNA. Poult Sci. 92:1888– 1896. Wang, X. G., J. F. Yu, Y. Zhang, D. Q. Gong, and Z. L. Gu. 2012. Identification and characterization of microRNA from chicken adipose tissue and skeletal muscle. Poult. Sci. 91:139– 149. Wienholds, E., and R. H. Plasterk. 2005. MicroRNA function in animal development. FEBS Lett. 579:5911– 5922. Zhu, L. H., H. Meng, X. J. Duan, G. Q. Xu, J. Zhang, and D. Q. Gong. 2011. Gene expression profile in the liver tissue of geese after overfeeding. Poult. Sci. 90:107–117.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex307/4653045 by University of Florida user on 05 January 2018