MicroRNA-126 participates in lipid metabolism in mammary epithelial cells

Molecular and Cellular Endocrinology xxx (2017) 1e10

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

MicroRNA-126 participates in lipid metabolism in mammary epithelial cells Meiqiang Chu a, 1, Yong Zhao a, 1, Yanni Feng a, Hongfu Zhang b, Jing Liu c, Ming Cheng d, Lan Li a, Wei Shen a, Hongfang Cao e, Qiang Li e, Lingjiang Min a, * a

College of Animal Science and Technology, Qingdao Agricultural University, Qingdao 266109, PR China State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing, PR China Core Laboratories of Qingdao Agricultural University, Qingdao 266109, PR China d Qingdao Veterinary and Livestock Administration, Qingdao 266000, PR China e Laiwu Veterinary and Livestock Administration, Laiwu 271100, PR China b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 17 March 2017 Received in revised form 31 May 2017 Accepted 31 May 2017 Available online xxx

Lipids are a major component of milk and are important for infant growth and development. MicroRNA126 (miR-126) has previously been observed in mammary glands and adipocytes and is known to be involved in lipid metabolism during the process of atherosclerosis. However, it remains unknown whether miR-126 also participates in lipid metabolism in mammary luminal epithelial cells (MECs). In the current investigation, miR-126-3p inhibition stimulated lipid synthesis in MECs in part through increasing levels of the lipid synthesis enzymes FASN, ACSL1, and Insig1. Overexpression of miR-126-3p decreased lipid content in MECs with a reduction in FASN and Insig1. Furthermore, the expression of miR-126-3p was diminished by the steroid hormones estradiol and progesterone with a subsequent elevation of lipid formation in MECs. We also noted that miR-126-3p was expressed differentially at various stages of murine mammary gland development, exhibiting a negative correlation with FASN. Together these findings suggest that miR-126-3 might be involved in lipid metabolism in mammary gland. © 2017 Elsevier B.V. All rights reserved.

Keywords: MicroRNA-126-3p Mammary luminal epithelial cells Lipid metabolism Estradiol Progesterone

1. Introduction The mammary gland is the organ of milk synthesis and is regulated by steroids, the thyroid, lactogenic hormones, and a variety of growth factors (Topper and Freeman, 1980). The human mammary gland is also one of three major lipid synthesizing organs of the body (Mohammad and Haymond, 2013; Wakil and AbuElheiga, 2009); the others are the liver and adipose tissue. Mammary luminal epithelial cells (MECs) are a single layer of cells that encircle the lumen of alveolar structures and produce milk (Neville, 2006; Akers, 2002). Lipids are the main component of milk, as demonstrated by murine mammary gland synthesis and secretion of over 30 g of triglycerides, 12 g of proteins, and 5 g of lactose during a 20-d lactation period (Akers, 2002; Smith, 2009; Anderson et al., 2007). It is known that milk lipids provide around half of an

* Corresponding author. E-mail address: [email protected] (L. Min). 1 Co-first authors.

infant's energy intake (Emken et al., 1989; Lammi-Keefe and Jensen, 1984) and these lipids can be de novo synthesized within MECs (Smith, 2009; Emken et al., 1989). MicroRNAs (miRNAs), one class of noncoding RNAs, have been found to be involved in many physiological functions: cell proliferation (Jonas and Izaurralde, 2015; Bartel, 2004), metabolism (Chen et al., 2006), development (Reinhart et al., 2000), cell death (Bartel, 2004) or cancers (Hamilton et al., 2013), and even lipid metabolism (Esau et al., 2006; Rayner et al., 2010). miR-33a and miR-33b regulate cholesterol metabolism (Rayner et al., 2011; Marquart et al., 2010; Gerin et al., 2010; Horie et al., 2010; NajafiShoushtari et al., 2010); miR-27b binds to the 30 -UTR of several lipid-associated genes: heparan sulfate N-deacetylase/N-sulfotransferase 1 (NDST1), angiopoietin-like 3 (ANGPTL3), peroxisome proliferator activated receptor g (PPARg), and glycerol-3-phosphate acyltransferase 1 (GPAM) to control lipid metabolism (Vickers et al., 2013). miR-144 targets the ATP-binding cassette transporter A1 (ABCA1) to alter the circulating levels of high density lipoprotein (HDL) in mice (Ramirez et al., 2013). miR-106, miR-26, miR-758,

http://dx.doi.org/10.1016/j.mce.2017.05.039 0303-7207/© 2017 Elsevier B.V. All rights reserved.

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

2

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

miR-1, miR-206, miR-613, miR-146a, and miR-155 are also involved in lipid metabolism via ABCA1, liver X receptor alpha (LXRa), or other proteins (Ramirez et al., 2011; Kim et al., 2012; Sun et al., 2012a; Zhong et al., 2013a; Zhong et al., 2013b). Furthermore, miR-125, miR-455-5p, miR-185, miR-96, and miR-233 alter HDL cholesterol uptake (Hu et al., 2012; Wang et al., 2013; Vickers et al., 2011). Recently, it has been found that miRNAs play important roles in mammary gland development and can be identified during different developmental stages (juvenile, pubertal, mature virgin, gestational, lactation, and involution stages) (Piao and Ma, 2012; Jabed et al., 2012; Liao et al., 2010; Avril-Sassen et al., 2009). Moreover, miRNAs are also involved in lipid metabolism in MECs as outlined below (Wang et al., 2012; Zhang et al., 2014). In caprine MECs, miR-145 modulates lipogenesis through targeting insulin induced gene 1 (INSIG1) (Wang et al., 2017). miR-29s alters the epigenetic changes of the lactation-related genes casein alpha s1 (CSN1S1), E74-like factor 5 (ElF5), peroxisome proliferatoractivated receptor gamma (PPARg), sterol regulatory element binding protein-1 (SREBP1), and glucose transporter 1 (GLUT1) to regulate milk lipid metabolism (Bian et al., 2015). miR-24 modifies fatty acid synthase genes to control triacylglycerol synthesis (Wang et al., 2015). miR-181a affects the biosynthesis of milk fat via altering the acyl-CoA synthetase long-chain family member 1 (ACSL1), which is a milk lipid formation enzyme (Lian et al., 2016). Heinz et al. reported that miR-150 was lower in lactation stage murine MECs than that in pregnant stage and miR-150 suppressed lipid synthesis proteins production in MECs to decrease lipid formation (Delbecchi et al., 2005). miR-126 is generated from a retained intron in a subset of Egfl7 pre-mRNAs (Sun et al., 2010). Bockmeyer et al. identified 8 basal miRNAs (let7c, miR-125b, miR-126, miR-127-3p, miR-143, miR-145, miR-146b-5p, and miR-199a-3p) from 116 miRNAs unequivocally expressed in normal MECs (Bockmeyer et al., 2011). Krause et al. found in 10e12 year-old children that plasma levels of miR-126 were positively correlated with plasma triglycerides and VLDL-C (Krause et al., 2015). Cui et al. report that miR-126-3p is involved in development and lactation of the murine mammary gland via progesterone receptors (Cui et al., 2011). Giral et al. suggest that during atherosclerosis, miR-126 is one of the relevant mediators of cholesterol and lipid biosynthesis, lipoprotein metabolism, and cholesterol efflux, as well as taking part in immune responses, endothelial cell biology, and vascular function (Giral et al., 2016). It also has been found that TNFa and triglyceride-rich lipoproteins (TGRL) combined to modulate miR-126 levels in a manner dependent upon TGRL atherogenicity. Moreover, docosahexaenoic acid (DHA) as well as TGRL significantly increased miR-126 in a dosedependent fashion (Sun et al., 2012b). However, the underlying mechanism of miR-126 involved in lipid metabolism is not well understood. Although miR-126 is involved in mammary gland development and many cellular functions, its role during lipid metabolism in MECs is as yet unknown. Therefore, the objectives of this investigation were to explore the effects of miR-126-3p on lipid metabolism in human MECs and the underlying mechanisms. 2. Materials and methods 2.1. Tissue sample collection This investigation was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Committee on the Ethics of Animal Experiments of Qingdao Agricultural University IACUC (Institutional Animal Care and Use Committee) (Zhao et al., 2016a). Animals were housed under a light:dark cycle of 12:12 h and at a temperature of 23  C

and humidity of 50%e70%. Mice were handled humanely during the experiments and, to minimize fighting, 2 mice were housed per shoebox-type cage with a solid floor and woodchip bedding. Mice had constant access to food (chow diet) and water, and bedding was changed every other day (Zhao et al., 2010). One abdominal and one inguinal mammary gland from each animal was surgically removed at different developmental stages (6 animals/group) and immediately frozen in liquid nitrogen (Zhao et al., 2010). Six groups of mice were analyzed: mature virgin (8 wk of age); pregnant day 5 (P-5 d); lactation day 0 (L-0 d; just after parturition); lactation day 5 (L-5 d; 5 d after parturition); lactation day 10 (L-10 d), and involution day 10 (In-10 d; 30 d after parturition). 2.2. Cell culture and medium MCF-10A cells (American Type Culture Collection, Manassas, VA) were cultured in MEGM medium. The MEGM medium (MEGM®SingleQuots®) was obtained from Lonza/Clonetics Corporation (Walkersville, MD) as a kit [Cat. No.: CC-4136, including BPE (2.0 ml, Cat. No.: CC-4009G), hEGF (0.5 ml, Cat. No.: CC-4017G), insulin (0.5 ml, Cat No.: CC-4021G), and hydrocortisone (0.5 ml, Cat No.: CC-4031G) GA-1000 (0.5 ml, Cat. No.: CC-4081G)] with the addition of 100 ng/ml of Cholera Toxin from Vibrio cholera (Cat. No.: C8052, Sigma, St. Louis, MO, USA) (Qu et al., 2015). Because the main purpose of this study was to explore the effect of miR-126 on lipid metabolism in MECs and in our preliminary study it was found MCF-10A (mammary luminal epithelial cells) could produce lipids without prolactin in the culture medium, the culture medium was without prolactin. 2.3. Cell transfection with miRNA mimic/inhibitor and treatments with estradiol/progesterone The miRNA mimics and inhibitors were purchased from GenePharma Co., Ltd (Shanghai, China) and used for the transfection of cells following the manufacturer's instruction. The sequences for the mimics and inhibitors are provided in Table 1. Cells were cultured in 6 cm dishes and separated into 4 groups: mimic negative control group (NC mimic), hsa-miR-126-3p mimic group (miR-126 mimic), inhibitor negative control group (NC inhibitor), and hsa-miR-126-3p inhibitor (miR-126 inhibitor). At the time of transfection, cells that reached 40%e50% confluence were transfected using siRNA-Mate reagent obtained from GenePharma Co., Ltd, according to the manufacturer's instructions. The amount added of both hsa-miR-126-3p mimic and hsa-miR-126-3p inhibitor was 0.025 pmol/well. Cells were collected for analysis at 48 h after transfection (Lian et al., 2016). The experiment was repeated 4e6 times. In early studies (Cui et al., 2011; Mollett et al., 1976; Judge and Chatterton, 1983), it has been found hormones progesterone and estrogen might play some roles in lipid metabolism. In this study we would like to explore whether these hormone can interact with miR-126-3p in lipid metabolism in MECs. For hormone treatment, the cells were plated in dishes overnight and then treated with

Table 1 Sequences for miR-126 mimic, inhibitor, and NCs. Sequence miR-126 mimic NC mimic miR-126 inhibitor NC inhibitor

Sense Antisense Sense Antisense

50 -UCGUACCGUGAGUAAUAAUGCG-30 50 -CAUUAUUACUCACGGUACGAUU-30 50 -UUCUCCGAACGUGUCACGUTT-30 5-'ACGUGACACGUUCGGAGAATT-30 50 -CGCAUUAUUACUCACGGUACGA-30 50 -CAGUACUUUUGUGUAGUACAA-30

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

estradiol, progesterone, or a combination of these 2 for 48 h. After treatment, the cells were collected for analysis. The experiment was repeated 4e6 times with two replications each time. For miR-126-3p mimic/inhibitor transfection plus hormone treatments, the cells were plated overnight and then transfected with miR-126-3p mimic/inhibitor or NC for 4 h; they subsequently underwent treatments with estradiol/progesterone for another 44 h (in total 48 h). The experiment was repeated 4e6 times with two replications each time. 2.4. miRNA q-RT-PCR

2.5. EdU (5-Ethynyl-20 -deoxyuridine) cell proliferation assay After a 46 h transfection, a Click-iT® 5-ethynyl-20 -deoxyuridine (EdU) kit (Molecular Probes, Carlsbad, CA) was used to measure cell proliferation according to the manufacturer's instructions (Xiao et al., 2016). Cells were labeled with EdU (10 mmol/L) for 2 h. After fixation (4% paraformaldehyde, 60 min) and transparency (0.5% Triton X-l00, 30 min) treatment, the cells were incubated with

Table 2 Sequences for miR-126 PCR primers (amplification size: 57 bp for human; 74 bp for mouse). Sequence

Mouse

Forward Primer Reverse Primer Probe Forward Primer Reverse Primer Probe

Click-iT® reaction cocktail, followed by 40 ,6-diamidino-2phenylindole (DAPI) nuclear staining. After 3 rinses, cells were observed under an inverted fluorescence microscope at 3 random fields of view. The stained sections were visualized with a Nikon Eclipse TE2000-U fluorescence microscope (Nikon, Inc., Melville, NY), and captured images were analyzed using MetaMorph software (Liu et al., 2016). A minimum of 1000 cells were counted for each sample of each experiment. Then the data were normalized to NC. The experiment was repeated 4e6 times with two replications each time. 2.6. Oil Red O staining

miRNA q-RT-PCR was performed using the Hairpin-it™ miRNA RT-PCR (probe) Quantitation kit from GenePharma Co., Ltd following the manufacturer's instruction as described in our recent publication (Zhao et al., 2016b). Total RNA from cultured cells or animal mammary gland tissue was extracted using TRIzol Reagent (Invitrogen Corp., Carlsbad, CA) and purified using an RT2 qPCRGrade RNA Isolation Kit (SABiosciences, Frederick, MD). Total RNA was quantified using a Nanodrop 3300 (ThermoScientific, Wilmington, DE). The quality of RNA was controlled by the A260:A280 ratio being greater than 2.0 and confirmed by electrophoreses, with a fraction of each total RNA sample with sharp 18S and 28S ribosomal RNA (rRNA) bands as reported in our recent publication (Zhao et al., 2010). One microgram of total RNA was used to make the first strand of cDNA: 4 ml 5 x RT buffer, 0.75 ml 10 mM dNTP, 1.20 ml 1 mM miRNA and 5s rRNA RT primer mix, 0.2 ml reverse transcriptase (200 U/ml), 1 mg RNA sample, and RNase free water to 20 ml. The program for the reaction was 25  C for 30 min, 42  C for 30 min, 85  C for 5 min, then 4  C or on ice. The generated firststrand cDNAs (2 ml/sample) were diluted to 20 ml with ddH2O for U6 q-PCR. Subsequently, 2 ml of the RT product was used for one PCR reaction (in a 96-well plate) for each miRNA (3 replications for every sample). Each PCR reaction (20 ml) contained 10 ml of 2 x qPCR Master Mix (FAM), 0.4 ml miRNA/5s rRNA specific primer set (10 mM), 0.2 ml of miRNA/5s rRNA specific probe (10 mM), 0.2 ml Taq DNA polymerase (5 U/ml), 2 ml RT product, and ddH2O to 20 mL (Table 2 for primers and probes). The qPCR was performed with the Roche LightCycler1 480 (Roche, Germany) and the reaction was as follows: Step 1, 95  C for 3 min; Step 2, 40 cycles of 95  C for 12 s; 62  C for 40 s. Three or more independent experimental samples were analyzed (Zhao et al., 2010). The data were normalized to NC, or control, or virgin stage. The experiment was repeated 4e6 times with two replications each time.

Human

3

CCCGTCGTACCGTGAGTAAT CGCCTCCACACACTCACC ACCGACGCTGCGAGCGCATT CCAGGACGCGTACCAAAAGT TATGGTTGTTCACGACTCCTTCAC CCCTATCCAACCATACAGACCACATTATT

Cells were seeded on cover slips and incubated overnight, then the cells were treated with hsa-miR-126 mimic, inhibitor, NC, estradiol, or progesterone. After treatment, the cells were washed twice with PBS and fixed with 4% paraformaldehyde. Cells were subsequently stained using an Oil Red O staining kit according to the manufacturer's instructions (Cat No.: D027; Nanjing Jiancheng Bioengineering Institute, Nanjing, China) (Lian et al., 2016; Cui et al., 2014). The Oil-red stained (lipid drop) positive cells were count. A minimum of 1000 cells were counted for each sample of each experiment. The data were normalized to NC or Blank/Control. The experiment was repeated 4e6 times with two replications each time. 2.7. Western blotting Cell samples were lysed in RIPA buffer containing a protease inhibitor cocktail from Sangong Biotech, Ltd. (Shanghai, China). Protein concentration was determined using a BCA kit (Beyotime Institute of Biotechnology, Shanghai, PR China) (Wang et al., 2016). The information for the primary antibodies (Abs) is presented in Table 3. GAPDH and Actin were used as loading controls. Secondary donkey anti-goat Ab (Cat no. A0181) was purchased from the Beyotime Institute of Biotechnology, and goat anti-rabbit (Cat no.: A24531) Abs were bought from Novex®, Life Technologies. Fifty micrograms of total protein per sample were loaded onto 10% SDS polyacrylamide electrophoresis gels. The gels were transferred to a polyvinylidene fluoride (PVDF) membrane at 300 mA for 2.5 h at 4  C. Subsequently, the membranes were blocked with 5% bovine serum albumin (BSA) for 1 h at room temperature (RT), followed by 3 washes with 0.1% Tween-20 in TBS (TBST). The membranes were incubated with primary Abs diluted at 1:500 in TBST with 1% BSA overnight at 4  C. After 3 washes with TBST, the blots were incubated with the HRP-labeled secondary goat anti-rabbit or donkey anti-goat Ab, respectively, for 1 h at RT. After 3 washes, the blots were imaged (Wang et al., 2016). The bands were quantified by Image-J software. The growth related proteins PI3K, P-ERK ERK, AKT, p-AKT IGF1R, Areg, Stat3 and Smad2, and lipid metabolism enzymes FASN, ACSL1, NR1H3, Insig1, and milk protein casein alpha, casein beta, and glucose transporter GLUT1 were analyzed. The intensity of the specific protein band was normalized to GAPDH first, then the data were normalized to NC, or Blank/Control. The experiment was repeated 4e6 times with two replications each time. 2.8. Immunofluorescence staining The collected cells were fixed in 4% paraformaldehyde for 1 h and then spread onto poly-L-lysine coated microscope slides and air-dried. After 3 washes with PBS (5 min each), cells were incubated with 2% (v/v) Triton X-100 in PBS for 1 h at RT. After a further 3 washes with PBS, the cells were blocked with 1% (wt/v) BSA and 1% goat serum in PBS for 30 min at RT; subsequently, cells were

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

4

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

Table 3 Primary antibody information. Gene symbol

Name

Cat. #

Predicted size

Source (Animal)

Company

GAPDH IGF1R GHR ELF5 ACSL1 GLUT1 Alpha casein PPARg Casein beta NR1H3 FASN Smad2 ERa PR ERK p-ERK p-PI3K TAK1 Leptin TOM1

Glyceraldehyde-3-phosphate dehydrogenase Insulin-like growth factor 1 receptor Growth hormone receptor E74-Like Factor 5 (Ets Domain Transcription Factor) Acyl-CoA Synthetase Long-Chain Family Member 1 Glucose transporter 1 Alpha casein Peroxisome Proliferator Activated Receptor Gamma Beta-casein Nuclear Receptor Subfamily 1 Group H Member 3 Fatty Acid Synthase Mothers Against Decapentaplegic Homolog 2 Estrogen receptor alpha Progesterone Receptor Extracellular signal-regulated kinases Phosphorylated Extracellular signal-regulated kinases phosphorylated Phosphoinositide 3-kinase Transforming growth factor (TGFb) activated kinase-1 Leptin Target of myb 1

sc-48166 bs-4985R bs-0654R D152550 bs-5022R bs-0472R bs-8245R D161087 bs-10032R D154187 D162701 bs-0718R bs-2098R bs-0111R bs-0022R bs-3292R bs-5571R bs-3585R bs-0409R bs-17222R

37kd 78/150kd 68kd 31kd 77kd 54kd 28kd 57kd 24kd 50kd 272kd 52kd 66kd 103kd 42kd 41kd 80kd 67kd 16kd 54kd

Goat (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal) Rabbit (polyclonal)

Santa Cruz Biotechnology, Inc. Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Sangon Biotech (Shanghai) CO.Ltd Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Sangon Biotech (Shanghai) CO.Ltd Beijing Biosynthesis Biotechnology Sangon Biotech (Shanghai) CO.Ltd Sangon Biotech (Shanghai) CO.Ltd Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology Beijing Biosynthesis Biotechnology

incubated with primary antibodies (Table 3) diluted in blocking solution overnight at 4  C. Mouse mammary gland sections (5 mm) were prepared and subjected to antigen retrieval and immunostaining as previously described (Liu et al., 2016). Briefly, sections were first blocked with normal goat serum in PBS, followed by incubation (1:150 in PBS-1% BSA) with primary antibody anti-FASN (Table 3). The following morning, after 3 washes with PBS Tween 20 (0.5%), the slides were incubated with Alexa Fluor 546 or 488 goat anti-rabbit IgG (1:200) for 30 min in darkness at RT. The negative control samples were incubated with secondary antibody and without primary antibody. Slides were washed with PBS Tween-20 3 times and then incubated with DAPI (4.6-diamidino-2phenylindole hydrochloride, 100 ng/ml) as a nuclear stain for 5 min. After a brief wash with ddH2O, the slides were covered with an anti-fading mounting medium (Vector, Burlingame, CA). Fluorescent images were obtained using a Leica Laser Scanning Confocal Microscope (LEICA TCS SP5 II, Germany) (Liu et al., 2016). A minimum of 1000 cells were counted for each sample. The stained positive cells were count. A minimum of 1000 cells were counted for each sample of each experiment. Then the data were normalized to NC or virgin stage. The experiment was repeated 4e6 times with two replications each time. 2.9. Statistical analyses The data were statistically analyzed using SPSS statistical software (IBM Co., NY) and ANOVA. Comparisons between groups were tested by one-way ANOVA analysis and the LSD test. All the groups were compared with each other for every parameter (mean ± SE). Differences were considered significant at p < 0.05. 3. Results 3.1. miR-126-3p affects factors related to cell growth Firstly, the expression of miR-126-3p after transfection with mimic or inhibitor was analyzed. After a 24 h transfection period, the cells were collected and the expression of miR-126-3p in transfected cells was quantified by quantitative real time RT-PCR. It was found that miR-126-3p mimic increased the expression of miR126-3p almost 110-fold compared to the negative control (NC mimic), and miR-126-3p inhibitor decreased the expression of miR-

CO. CO. CO. CO. CO. CO.

CO. CO. CO. CO. CO. CO. CO. CO. CO.

126-3p to 0.5-fold of the negative control (NC inhibitor; Fig. 1A). Furthermore, the protein level of miR-126 target TOM1 was reduced in the mimic treatment and elevated in the inhibitor treatment (Fig. 1B and C). This suggested that the miR-126-3p mimic and inhibitor worked well. In order to figure out the cells function well after alteration of the expression of miR-126, we investigated the effect of the expression of miR-126-3p on cell growth and proliferation. Mimic or inhibitor did not influence cell proliferation, with a similar number of proliferating cells in the NC, miR-126-3p mimic, and miR-126-3p inhibitor treatments (Fig. 2A and B). Factors related to cell growth, such as PI3K, IGF1R, p-ERK, ERK, and Smad2 were determined after a 48-h transfection. PI3K, P-ERK ERK, and Smad2 were not changed by miR-126-3p mimic; however, they were increased by miR-126-3p inhibitor. IGF1R was decreased by miR126-3p mimic while it was elevated by miR-126-3p inhibitor (Fig. 2C and D). The data indicated that miR-126-3p may have some effect on cell growth but not proliferation rate in MCF-10A cells.

3.2. MiR-126-3p regulates lipid metabolism After a 48-h transfection, the cells were stained with Oil Red to determine their lipid content. miR-126-3p mimic decreased the number of lipid droplets in cells (Fig. 3A, indicated by black arrows), and miR-126-3p inhibitor elevated the number (Fig. 3A, indicated by black arrows; 3B). Since the expression of miR-126-3p altered cellular lipid content, the enzymes related to lipid metabolism were determined. Protein levels of the fatty acid synthetase (FASN) were not altered by miR-126-3p mimic but were increased by miR-1263p inhibitor (Fig. 3 C). Similarly, the lipid metabolism enzymes ACSL1, and NR1H3 were not changed by miR-126-3p mimic; however, they were increased by miR-126-3p inhibitor (Fig. 3C and D). Another lipid metabolism enzyme, Insig1, was decreased by mimic while it was elevated by the inhibitor. On the one hand, milk protein casein alpha was decreased by miR-126-3p mimic but remained unchanged by miR-126-3p inhibitor. Glucose transporter 1 (GLUT1) was increased by miR-126-3p inhibitor and was unchanged by miR-126-3p mimic (Fig. 3C and D). Data suggested that miR-126-3p may be involved in cell lipid metabolism through altering lipid metabolism enzymes; furthermore, miR-126-3p may alter the protein levels of casein alpha, casein beta and glucose transportation (GLUT1) in MECs (MCF-10A).

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

5

Fig. 1. Mimic or inhibitor regulates miR-126 expression in human mammary epithelial cells (MCF-10A cells). A. miR-126 increased its expression and miR-126 inhibitor decreased its expression by q-RT-PCR analysis; B. miR-126 mimic decreased, and inhibitor increased the levels of TOM1 protein as shown by IHF; C. Quantitative data for TOM1 presented as a fold change of NC after counting the positive cells; a, b and c indicate a significant difference among different treatments (n > 3; p < 0.05).

Fig. 2. Effect of miR-126 mimic or inhibitor on cell growth and proliferation in MCF-10A cells. A. miR-126 mimic or inhibitor did not affect cell proliferation rate by EdU assay; B. Quantitative data for EdU assay presented as a fold change of NC after counting the positive cells; C. Factors related to cell growth were altered by miR-126 mimic or inhibitor as seen by Western blotting; D. The quantitative data for Western blotting presented as the fold change of NC after quantification by Image-J; a, b and c indicate a significant difference among different treatments (n > 3; p < 0.05).

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

6

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

Fig. 3. Effect of miR-126 mimic or inhibitor on lipid metabolism in MCF-10A cells. A. Oil-Red staining for MCF-10A cells after treatment with miR-126 mimic or inhibitor for 48 h. Black arrows indicate the lipid droplets. Scale bar ¼ 50 mm; B. The quantitative data for Oil red staining presented as a fold change of NC after counting the positive cells; C. The protein levels of lipid metabolism enzymes, milk protein, and glucose transporter were altered by miR-126 mimic or inhibitor as seen by Western blotting; D. The quantitative data for Western blotting presented as the fold change of NC after quantified by Image-J; a, b and c indicate a significant difference among different treatments (n > 3; p < 0.05).

3.3. miR-126-3p interacts with the steroid hormones estradiol and progesterone The mammary gland is regulated by autocrine-paracrine signaling, and steroid hormones like estrogen and progesterone play important roles in mammary gland development. It has been found that estrogen and progesterone may also play roles in lipids metabolism in mammary gland. Therefore the interactions of miR126 and these hormones in MECs were investigated. The cells were treated with different concentrations of estradiol and progesterone for 48 h, after which the level of miR-126-3p was quantified by qRT-PCR. At 20 nM, estradiol did not significantly affect miR-126-3p expression. However, 50 nM of estradiol, 20 nM and 200 nM of progesterone significantly reduced miR-126-3p levels. Combinations of 20 nM estradiol þ20 nM progesterone, and 50 nM estradiol þ200 nM progesterone significantly reduced miR-126-3p levels (Fig. 4A). All steroid hormone treatments elevated the fatty acid synthesis enzyme FASN protein level (Fig. 4B and C; Fig. S1). Since estradiol and progesterone increased the protein level of FASN, the lipid content was determined after hormone treatments; both estradiol

and progesterone increased the number of lipid droplets in cells (Fig. 4D and E). The lipid content data agreed closely with the Western blotting data. Next, we aimed to determine the interactions of miR-126-3p and steroid hormones. First, the cells were plated on cover slips then, after overnight attachment and growth, the cells were transfected with miR-126-3p mimic or NC mimic for 4 h, followed by hormone treatments for another 44 h (in total 48 h). The four small photographs in the middle column of Fig. 4D show hormone and NC mimic treatments; photographs in the third column show hormone and miR-126-3p mimic treatments. NC mimic plus hormone treatments increased lipid content. However, miR-126-3p mimic plus hormone treatments decreased the lipid content in a similar manner to miR-126-3p mimic alone (Fig. 4D and E). The protein level of FASN was also detected after these treatments. Estradiol and progesterone increased FASN protein level in the NC mimic treatment; however, they did not increase the protein level of FASN in miR-126-3p mimic treatments (Fig. 4B and C). This suggested that once miR-126-3p blocked lipid formation, the hormones estradiol or progesterone could not rescue this process even though they might reduce miR-126-3p expression.

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

7

Fig. 4. Effect of steroid hormones and/or miR-126 mimic on lipid metabolism in MCF-10A cells. A. The expression of miR-126 after hormone treatments; B. The protein levels of FASN were altered by estradiol, progesterone, and/or miR-126 mimic as seen by Western blotting; C. The quantitative data for Western blotting presented as a fold change of NC after quantification using Image-J; D. Oil-Red staining for MCF-10A cells after transfection with miR-126 or NC for 4 h following treatment with estradiol and/or progesterone for 44 h (in total 48 h). Black arrows indicate lipid droplets. Scale bar ¼ 50 mm; E. The quantitative data for Oil-Red staining presented as the fold change of NC after counting the positive cells; a, b and c indicate a significant difference among different treatments (n > 3; p < 0.05).

3.4. Expression of miR-126-3p negatively correlates with FASN protein level in the mammary glands of mice at different developmental stages The expression of miR-126-3p was highest in mature virgin mouse mammary gland tissue, as compared to gestation or lactation stages. The level of miR-126-3p was decreased with gestation stage, continued decreasing towards lactation, and was lowest at L10 d (peak lactation; Fig. 5A). After lactation, during the involution stage, miR-126-3p started to increase; at In-10 d, it reached a level even higher than that at L-0 d or L-5 d. Morphological changes occurred in mammary gland tissue during virgin, pregnancy, lactation, and involution stages (Fig. S2). Furthermore, the protein level of FASN in the tissue was negatively correlated with miR-126-3p expression. At the virgin stage, FASN was low and similar to that at In-10d; it increased when gestation began and it peaked along with peak lactation stage (L-10d). The animal data suggested that miR-126-3p might be involved in mammalian lactation and confirmed the results from in vitro experiments.

3.5. miR-126's targets It has been reported that TOM1 and progesterone receptor (PR) are targets of miR-126. Even though PI3K, p-ERK, ERK, IGF1R, Smad2, ACSL1, FASN, ELF5, NR1H3, Insig1, GLUT1, and Caseina have been altered by miR-126-3p mimic or inhibitor, they are not predicted targets of miR-126-3p in the TargetScan or MiRanDa databases. 4. Discussion miR-126 plays a key role in many biological processes (Sun et al., 2010; Bockmeyer et al., 2011; Krause et al., 2015; Cui et al., 2011; Giral et al., 2016) and is known to be expressed in the mammary gland (Bockmeyer et al., 2011; Cui et al., 2011). In the current investigation, we found that the inhibition or overexpression of miR-126-3p did not alter the proliferation in MCF-10A cells while some of the growth related proteins were disturbed. In the current investigation, PI3K, P-ERK ERK, and Smad2 were not altered by miR-126-3p mimic; however, they were increased by miR-126-3p

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

8

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

Fig. 5. A. miR-126 expression in different stages of mouse mammary gland development; B. The protein levels of FASN at different stages of mouse mammary gland development as shown by Western blotting. The quantitative data for Western blotting presented as a fold change of NC after quantification by Image-J; a, b, c, d and e indicate a significant difference among different treatments (n > 3; p < 0.05).

inhibitor. IGF1R was decreased by miR-126-3p mimic while it was elevated by miR-126-3p inhibitor. Furthermore, it was found that miR-126-3p regulated lipid metabolism in MECs in vitro through targeting the genes related to lipid synthesis: FASN, ACSL1, and NR1H3. Overexpression of miR-126-3p inhibited lipid formation with a resulting decrease in protein levels of Insig1. Inhibition of miR-126-3p expression promoted lipid content with increasing protein levels of FASN, ACSL1, and NR1H3. Meanwhile, overexpression of miR-126-3p decreased the protein level of casein alpha; however, inhibition of miR-126-3p did not alter casein alpha. One of the glucose transporters, GLUT1, was not affected by miR126-3p mimic; however, it was increased by miR-126-3p inhibitor. These data suggest that miR-126-3p not only alters lipid formation in MECs but also may be involved in milk protein synthesis and glucose transportation. In this investigation, mimic and inhibitor of miR-126-3p don't always produce opposite effects, which might be because of a threshold of miRNA level for the effects. And another possibility is that the effect is not directly from miRNA itself. It may be indirect effects. Mammary gland development and function is modulated by hormones and growth factors (Topper and Freeman, 1980), especially estradiol and progesterone (Smith, 2009). These two hormones might be related to milk lipid formation (Mollett et al., 1976; Delbecchi et al., 2005). Mollett et al. found that estradiol-17b (E2b) and progesterone (P) decreased average milk lactose concentration and percentage of fat while total protein were highest (Mollett et al., 1976). The latter data indicates that these hormones may be involved in lipid metabolism in cattle mammary glands. Since Judge et al. reported that progesterone increases lipid synthesis in breast cancer cells (Judge and Chatterton, 1983), it was not so surprised that estradiol and progesterone were found to promote lipid formation in MECs via the up-regulation of lipid synthesis enzymes in the current investigation. These two hormones decreased miR-1263p expression in MECs in vitro; however, they did not counteract the inhibitory effect of miR-126-3p mimic on lipid formation. Furthermore, levels of the lipid synthesis enzyme FASN were decreased by miR-126-3p mimic and estradiol and/or progesterone in MECs in vitro. This indicates that there might be some interactions between miR-126 and FASN or between E/P and FASN. We also found miR-126-3p differentially expressed at different stages (mature virgin, P-5 d, L-0 d, L-5 d, L-10 d, and In-10 d) in murine mammary gland tissue. miR-126-3p was lowest in L-10 d and highest in virgin tissue. Normally, the levels of estrogen and progesterone are lower in lactation stage and virgin stage, however higher in pregnant stage (Anderson et al., 2007). miR-126-3p was found to be lower in lactation stage and higher in virgin stage in mouse. In our in vitro experiment, estrogen and progesterone were found to decrease miR-126-3p expression and to increase lipid formation. However, in vivo, the level of miR-126-3p and the levels of estrogen and progesterone are in the similar trends in different stage of mammary gland development. Therefore, it might be not easy to simply explain the levels of the hormones or miRNAs and the functions of them. There might be other factors involved. Heinz et al. reported that miR-150 was lower in lactation stage murine MECs than that in pregnant stage and miR-150 suppressed lipid synthesis proteins production in MECs to decrease lipid formation (Heinz et al., 2016). In addition, the protein level of FASN was negatively correlated with the expression of miR-126-3p in mouse mammary gland tissue. Altogether, these data indicate that miR126-3p may be involved in lipid formation in mammary gland. In summary, miR-126-3p alters lipid metabolism in MECs in vitro and is expressed differentially at various stages of murine mammary gland development. The expression of miR-126-3p is lower during lactation, which suggests it's involvement in the lactation process while showing a negative correlation with FASN.

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

Moreover, the hormones estradiol and progesterone reduced miR126-3p and elevated lipid formation in MECs in vitro. Together the data suggest that miR-126-3p might be involved in lipid synthesis in mammary gland. Conflict of interest None of the authors have any conflict of interest to declare. Acknowledgments This work was supported by the Technology System of Modern Agricultural Industry in Shandong Province (SDAIT-10-08). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.mce.2017.05.039. References Akers, R.M., 2002. Lactation and the Mammary Gland, first ed. Iowa State Press, Ames, IA. Anderson, S.M., Rudolph, M.C., McManaman, J.L., Neville, M.C., 2007. Key stages in mammary gland development. secretory activation in the mammary gland: it's not just about milk protein synthesis! Breast Cancer Res. 9, 204. Avril-Sassen, S., Goldstein, L.D., Stingl, J., Blenkiron, C., Le Quesne, J., Spiteri, I.,
, S., Miska, E.A., Caldas, C., 2009. CharKaragavriilidou, K., Watson, C.J., Tavare acterisation of microRNA expression in post-natal mouse mammary gland development. BMC Genomics 10, 548. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism and function. Cell 116, 281e297. Bian, Y., Lei, Y., Wang, C., Wang, J., Wang, L., Liu, L., Liu, L., Gao, X., Li, Q., 2015. Epigenetic regulation of miR-29s affects the lactation activity of dairy cow mammary epithelial cells. J. Cell Physiol. 230 (9), 2152e2163. €nger, F., Bockmeyer, C.L., Christgen, M., Müller, M., Fischer, S., Ahrens, P., La Kreipe, H., Lehmann, U., 2011. MicroRNA profiles of healthy basal and luminal mammary epithelial cells are distinct and reflected in different breast cancer subtypes. Breast Cancer Res. Treat. 130 (3), 735e745. Chen, J.F., Mandel, E.M., Thomson, J.M., Wu, Q., Callis, T.E., Hammond, S.M., Conlon, F.L., Wang, D.Z., 2006. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat. Genet. 38, 228e233. Cui, W., Li, Q., Feng, L., Ding, W., 2011. MiR-126-3p regulates progesterone receptors and involves development and lactation of mouse mammary gland. Mol. Cell Biochem. 355 (1e2), 17e25. Cui, M., Wang, Y., Sun, B., Xiao, Z., Ye, L., Zhang, X., 2014. MiR-205 modulates abnormal lipid metabolism of hepatoma cells via targeting acyl-CoA synthetase long-chain family member 1 (ACSL1) mRNA. Biochem. Biophys. Res. Commun. 444, 270e275. Delbecchi, L., Miller, N., Prud’homme, C., Petitclerc, D., Wagner, G., Lacasse, P., 2005. 17beta-Estradiol reduces milk synthesis and increases stanniocalcin gene expression in the mammary gland of lactating cows. Livest. Prod. Sci. 98, 57e66. Emken, E.A., Adlof, R.O., Hachey, D.L., Garza, C., Thomas, M.R., Brown-Booth, L., 1989. Incorporation of deuterium-labeled fatty acids into human milk, plasma, and lipoprotein phospholipids and cholesteryl esters. J. Lipid Res. 30, 395e402. Esau, C., Davis, S., Murray, S.F., Yu, X.X., Pandey, S.K., Pear, M., Watts, L., Booten, S.L., Graham, M., McKay, R., Subramaniam, A., Propp, S., Lollo, B.A., Freier, S., Bennett, C.F., Bhanot, S., Monia, B.P., 2006. miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab. 3 (2), 87e98. Gerin, I., Clerbaux, L.A., Haumont, O., Lanthier, N., Das, A.K., Burant, C.F., Leclercq, I.A., MacDougald, O.A., Bommer, G.T., 2010. Expression of miR-33 from an SREBP2 intron inhibits cholesterol export and fatty acid oxidation. J. Biol. Chem. 285, 33652e33661. Giral, H., Kratzer, A., Landmesser, U., 2016. MicroRNAs in lipid metabolism and atherosclerosis. Best. Pract. Res. Clin. Endocrinol. Metab. 30 (5), 665e676. Hamilton, M.P., Rajapakshe, K., Hartig, S.M., Reva, B., McLellan, M.D., Kandoth, C., Ding, L., Zack, T.I., Gunaratne, P.H., Wheeler, D.A., Coarfa, C., McGuire, S.E., 2013. Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif. Nat. Commun. 4, 13. Heinz, R.E., Rudolph, M.C., Ramanathan, P., Spoelstra, N.S., Butterfield, K.T., Babbs, B.L., Gordon, M.A., Anderson, S.M., Richer, J.K., et al., 2016. Constitutive expression of microRNA-150 in mammary epithelium suppresses secretory activation and impairs de novo lipogenesis. Development 143, 22. Horie, T., Ono, K., Horiguchi, M., Nishi, H., Nakamura, T., Nagao, K., Kinoshita, M., Kuwabara, Y., Marusawa, H., Iwanaga, Y., Hasegawa, K., Yokode, M., Kimura, T., Kita, T., 2010. MicroRNA-33 encoded by an intron of sterol regulatory elementbinding protein 2 (Srebp2) regulates HDL in vivo. Proc. Natl. Acad. Sci. U. S. A. 107, 17321e17326.

9

Hu, Z., Shen, W.J., Kraemer, F.B., Azhar, S., 2012. MicroRNAs 125a and 455 repress lipoprotein-supported steroidogenesis by targeting scavenger receptor class B type I in steroidogenic cells. Mol. Cell Biol. 32, 5035e5045. Jabed, A., Wagner, S., McCracken, J., Wells, D.N., Laible, G., 2012. Targeted microRNA expression in dairy cattle directs production of b-lactoglobulin-free, highcasein milk. Proc. Natl. Acad. Sci. U. S. A. 109, 16811e16816. Jonas, S., Izaurralde, E., 2015. Towards a molecular understanding of microRNAmediated gene silencing. Nat. Rev. Genet. 16, 421e433. Judge, S.M., Chatterton, R.T., 1983. Progesterone-specific stimulation of triglyceride biosynthesis in a breast cancer cell line (T-47D). Cancer Res. 43 (9), 4407e4412. Kim, J., Yoon, H., Ramirez, C.M., Lee, S.M., Hoe, H.S., Fernandez-Hernando, C., Kim, J., 2012. MiR-106b impairs cholesterol efflux and increases Ab levels by repressing ABCA1 expression. Exp. Neurol. 235, 476e483. Krause, B.J., Carrasco-Wong, I., Dominguez, A., Arnaiz, P., Farías, M., Barja, S., Mardones, F., Casanello, P., 2015. Micro-RNAs Let7e and 126 in plasma as markers of metabolic dysfunction in 10 to 12 years old children. PLoS One 10 (6), e0128140. Lammi-Keefe, C.J., Jensen, R.G., 1984. Lipids in human milk: a review. 2: composition and fat-soluble vitamins. J. Pediatr. Gastroenterol. Nutr. 3, 172e198. Lian, S., Guo, J.R., Nan, X.M., Ma, L., Loor, J.J., Bu, D.P., 2016. MicroRNA Bta-miR-181a regulates the biosynthesis of bovine milk fat by targeting ACSL1. J. Dairy Sci. 99 (5), 3916e3924. € nnerdal, B., 2010. miR-214 regulates lactoferrin expression and Liao, Y., Du, X., Lo pro-apoptotic function in mammary epithelial cells. J. Nutr. 140, 1552e1556. Liu, X., Zhang, H., Zhang, W., Zhang, P., Hao, Y., Song, R., Li, L., Feng, Y., Hao, Z., Shen, W., Min, L., Yang, H., Zhao, Y., 2016. Regulation of neuroendocrine cells and neuron-factors in ovary by zinc oxide nanoparticles. Toxi Lett. 256, 19e32. Marquart, T.J., Allen, R.M., Ory, D.S., Baldan, A., 2010. MiR-33 links SREBP-2 induction to repression of sterol transporters. Proc. Natl. Acad. Sci. U. S. A. 107, 12228e12232. Mohammad, M.A., Haymond, M.W., 2013. Regulation of lipid synthesis genes and milk fat production in human mammary epithelial cells during secretory activation. Am. J. Physiol. Endocrinol. Metab. 305, E700eE716. Mollett, T.A., Erb, R.E., Monk, E.L., Malven, P.V., 1976. Changes in estrogen, progesterone, prolactine and lactation traits associated with injection of estradiol17beta and progesterone into lactating cows. J. Dairy Sci. 42, 655e663. Najafi-Shoushtari, S.H., Kristo, F., Li, Y., Shioda, T., Cohen, D.E., Gerszten, R.E., Naar, A.M., 2010. MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science 328, 1566e1569. Neville, M.C., 2006. Lactation and its hormonal control. In: Neill, J.D. (Ed.), Knobit and Neill's Physiology of Reproduction, third ed., vol 2. Elsevier Academic Press, Amsterdam, The Netherlands, pp. 2993e3054. Piao, H.L., Ma, L., 2012. Non-coding RNAs as regulators of mammary development and breast cancer. J. Mammary Gland. Biol. Neoplasia 17, 33e42. Qu, Y., Han, B., Yu, Y., Yao, W., Bose, S., Karlan, B.Y., Giuliano, A.E., Cui, X., 2015. Evaluation of MCF10A as a reliable model for normal human mammary epithelial cells. PLoS One 10 (7), e0131285. Ramirez, C.M., Davalos, A., Goedeke, L., Salerno, A.G., Warrier, N., Cirera-Salinas, D., Suarez, Y., Fernandez-Hernando, C., 2011. MicroRNA-758 regulates cholesterol efflux through posttranscriptional repression of ATP-binding cassette transporter A1. Arterioscler. Thromb. Vasc. Biol. 31, 2707e2714. Ramirez, C.M., Rotllan, N., Vlassov, A.V., Davalos, A., Li, M., Goedeke, L., Aranda, J.F., Cirera-Salinas, D., Araldi, E., Salerno, A., Wanschel, A., Zavadil, J., Castrillo, A.,
rez, Y., Ferna
ndez-Hernando, C., 2013. Control of cholesterol metaKim, J., Sua bolism and plasma high-density lipoprotein levels by microRNA-144. Circ. Res. 112, 1592e1601. Rayner, K.J., Suarez, Y., Davalos, A., Parathath, S., Fitzgerald, M.L., Tamehiro, N.,
ndez-Hernando, C., 2010. MiR-33 contributes to Fisher, E.A., Moore, K.J., Ferna the regulation of cholesterol homeostasis. Science 328 (5985), 1570e1573. Rayner, K.J., Sheedy, F.J., Esau, C.C., Hussain, F.N., Temel, R.E., Parathath, S., van Gils, J.M., Rayner, A.J., Chang, A.N., Suarez, Y., Fernandez-Hernando, C., Fisher, E.A., 2011. Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis. J. Clin. Investig. 121, 2921e2931. Reinhart, B.J., Slack, F.J., Basson, M., Pasqulnelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., Ruvkun, G., 2000. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, 901e906. Smith, S., 2009. Mechanism of chain length determination in biosynthesis of milk fatty acids. J. Mammary Gland. Biol. Neoplasia 14, 245e260. Sun, Y., Bai, Y., Zhang, F., Wang, Y., Guo, Y., Guo, L., 2010. miR-126 inhibits non-small cell lung cancer cells proliferation by targeting EGFL7. Biochem. Biophys. Res. Commun. 391, 1483e1489. Sun, D., Zhang, J., Xie, J., Wei, W., Chen, M., Zhao, X., 2012. MiR-26 controls LXRdependent cholesterol efflux by targeting ABCA1 and ARL7. FEBS Lett. 586, 1472e1479. Sun, C., Alkhoury, K., Wang, Y.I., Foster, G.A., Radecke, C.E., Tam, K., Edwards, C.M., Facciotti, M.T., Armstrong, E.J., Knowlton, A.A., Newman, J.W., Passerini, A.G., Simon, S.I., 2012. IRF-1 and miRNA126 modulate VCAM-1 expression in response to a high-fat meal. Circ. Res. 111 (8), 1054e1064. Topper, Y.J., Freeman, C.S., 1980. Multiple hormone interactions in the developmental biology of the mammary gland. Physiol. Rev. 60, 1049. Vickers, K.C., Palmisano, B.T., Shoucri, B.M., Shamburek, R.D., Remaley, A.T., 2011. MicroRNAs are transported in plasma and delivered to recipient Cells by highdensity lipoproteins. Nat. Cell Biol. 13, 423e433. Vickers, K.C., Shoucri, B.M., Levin, M.G., Wu, H., Pearson, D.S., Osei-Hwedieh, D., Collins, F.S., Remaley, A.T., Sethupathy, P., 2013. MicroRNA-27b is a regulatory

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039

10

M. Chu et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

hub in lipid metabolism and is altered in dyslipidemia. Hepatology 57, 533e542. Wakil, S.J., Abu-Elheiga, L.A., 2009. Fatty acid metabolism: target for metabolic syndrome. J. Lipid Res. 50 (Suppl. l), S138eS143. Wang, M., Mois
a, S., Khan, M.J., Wang, J., Bu, D., Loor, J.J., 2012. MicroRNA expression patterns in the bovine mammary gland are affected by stage of lactation. J. Dairy Sci. 95, 6529e6535. Wang, L., Jia, X.J., Jiang, H.J., Du, Y., Yang, F., Si, S.Y., Hong, B., 2013. MicroRNAs 185, 96, and 223 repress selective high-density lipoprotein cholesterol uptake through posttranscriptional inhibition. Mol. Cell Biol. 33, 1956e1964. Wang, H., Luo, J., Chen, Z., Cao, W.T., Xu, H.F., Gou, D.M., Zhu, J.J., 2015. MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fattyacid synthase gene. J. Dairy Sci. 98 (12), 9001e9014. Wang, Y., Zhao, Y., Yu, S., Feng, Y., Zhang, H., Kou, X., Chu, M., Cui, L., Li, L., Zhang, P., Shen, W., Min, L., 2016. Regulation of steroid hormones and energy status to alter spermatogenesis by cysteamine. Toxicol. Appl. Pharmacol. 313, 149e158. Wang, H., Shi, H., Luo, J., Yi, Y., Yao, D., Zhang, X., Ma, G., Loor, J.J., 2017. MiR-145 regulates lipogenesis in goat mammary cells via targeting INSIG1 and epigenetic regulation of lipid-related genes. J. Cell Physiol. 232 (5), 1030e1040. Xiao, J., Lin, H.Y., Zhu, Y.Y., Zhu, Y.P., Chen, L.W., 2016. MiR-126 regulates proliferation and invasion in the bladder cancer BLS cell line by targeting the PIK3R2-

mediated PI3K/Akt signaling pathway. Onco Targets Ther. 9, 5181e5193. Zhang, C., Zhao, Y., Wang, Y., Wu, H., Fang, X., Chen, H., 2014. Deep RNA sequencing reveals that microRNAs play a key role in lactation in rats. J. Nutr. 144 (8), 1142e1149. Zhao, Y., Tan, Y.S., Haslam, S.Z., Yang, C., 2010. Perfluorooctanoic acid effects on steroid hormone and growth factor levels mediate stimulation of peripubertal mammary gland development in C57BL/6 mice. Toxicol. Sci. 115 (1), 214e224. Zhao, Y., Zhang, W.D., Liu, X.Q., Zhang, P.F., Hao, Y.N., Li, L., Chen, L., Shen, W., Tang, X.F., Min, L.J., Meng, Q.S., Wang, S.K., Yi, B., Zhang, H.F., 2016. Hydrogen sulfide and/or ammonia reduces spermatozoa motility through AMPK/AKT related pathways. Sci. Rep. 6, 37884. Zhao, Y., Li, L., Min, L.J., Zhu, L.Q., Sun, Q.Y., Zhang, H.F., Liu, X.Q., Zhang, W.D., Ge, W., Wang, J.J., Liu, J.C., Hao, Z.H., 2016. Regulation of MicroRNAs, and the Correlations of MicroRNAs and their targetd genes by Zinc Oxide nanoparticles in ovarian granulosa cells. PLoS One 11 (5), e0155865. Zhong, D., Huang, G., Zhang, Y., Zeng, Y., Xu, Z., Zhao, Y., He, X., He, F., 2013. MicroRNA-1 and microRNA-206 suppress LXRa-Induced Lipogenesis in hepatocytes. Cell Signal. 25, 1429e1437. Zhong, D., Zhang, Y., Zeng, Y.J., Gao, M., Wu, G.Z., Hu, C.J., Huang, G., He, F.T., 2013. MicroRNA-613 represses lipogenesis in HepG2 cells by downregulating LXRa. Lipids Health Dis. 12, 32.

Please cite this article in press as: Chu, M., et al., MicroRNA-126 participates in lipid metabolism in mammary epithelial cells, Molecular and Cellular Endocrinology (2017), http://dx.doi.org/10.1016/j.mce.2017.05.039