MicroRNA-150 targets PU.1 and regulates macrophage differentiation and function in experimental autoimmune encephalomyelitis

Accepted Manuscript MicroRNA-150 targets PU.1 and regulates macrophage differentiation and function in experimental autoimmune encephalomyelitis

Leila Shakerian, Samira Ghorbani, Farideh Talebi, Farshid Noorbakhsh PII: DOI: Reference:

S0165-5728(18)30048-1 doi:10.1016/j.jneuroim.2018.06.010 JNI 476797

To appear in:

Journal of Neuroimmunology

Received date: Revised date: Accepted date:

26 January 2018 9 May 2018 13 June 2018

Please cite this article as: Leila Shakerian, Samira Ghorbani, Farideh Talebi, Farshid Noorbakhsh , MicroRNA-150 targets PU.1 and regulates macrophage differentiation and function in experimental autoimmune encephalomyelitis. Jni (2018), doi:10.1016/ j.jneuroim.2018.06.010

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT MicroRNA-150 targets PU.1 and regulates macrophage differentiation and function in experimental autoimmune encephalomyelitis

Department of Immunology, School of Medicine, Tehran University of Medical Sciences, Tehran,

CR

1

IP

T

Leila Shakerian1,2& , Samira Ghorbani1& , Farideh Talebi1, Farshid Noorbakhsh 1*

US

Iran, 2Shefa Neuroscience Research Center, Khatam Al-Anbia Hospital, Tehran, Iran,

AN

& These two authors have contributed to this work equally.

M

* Correspondence to: Dr Farshid Noorbakhsh

ED

Department of Immunology, School of Medicine, Tehran University of Medical Sciences, Tel: +98-912-9360057

PT

Tehran, Iran

microRNA,

AC

Keywords:

CE

E-mail: f-noorbakhsh @sina.tums.ac.ir

encephalomyelitis

miR-150,

PU1,

macrophage,

Experimental

autoimmune

ACCEPTED MANUSCRIPT Abstract PU.1 is a transcription factor which is expressed in myeloid cells. Herein, we investigated the expression of PU.1 and its potentially targeting miRNAs in the central nervous system (CNS) of mice with experimental autoimmune encephalitis (EAE) and in cultured primary macrophages.

T

PU.1 levels where highly induced in EAE spinal cords and in activated macrophages; this was

IP

associated with a significant reduction in miR-150 levels at chronic phase of disease and in

CR

activated cells. Luciferase assays confirmed the PU.1-miR150 interaction. Overexpression of miRNA-150 in macrophages decreased the expression of proinflammatory cytokines and shifted

AC

CE

PT

ED

M

AN

US

the polarization of macrophages away from the M1-like phenotype.

ACCEPTED MANUSCRIPT 1. Introduction MicroRNAs (miRNAs) are small noncoding RNA molecules which exert regulatory roles in gene expression through inhibition of translation or degradation of transcripts (Ambros, 2001, Nilsen, 2007). Research on these molecules has shown their involvement in various biological processes,

T

ranging from cellular to organismal levels (Ebert and Sharp, 2012, Pillai, 2005). Studies on

IP

different categories of human disease have demonstrated altered expression of various miRNAs in

CR

diseased tissues and/or organs, with altered miRNA(s) both influencing and/or influenced by the

US

disease process. Central nervous system (CNS) disorders have been of particular interest to miRNA researchers over the last few years and dysregulation of multiple miRNAs has been

AN

reported in tissues or cells derived from patients with Alzheimer’s, Parkinson’s or Huntington’s diseases as well as in autoimmune disorders like multiple sclerosis (MS) (Johnson et al., 2008,

ED

M

Hebert et al., 2008, Abe and Bonini, 2013, Pauley et al., 2009).

MS is an inflammatory disease of the central nervous system (CNS), which is characterized by

PT

aberrant activation of both innate and adaptive arms of the immune system. Immune cell

CE

infiltration, microglial activation, demyelination and neural cell damage are pathological hallmarks of MS (Dendrou et al., 2015). Previous studies on MS patients’ brain tissue or

AC

leukocytes have revealed perturbed expression of various protein coding and noncoding RNAs including microRNAs (Lock et al., 2002, Noorbakhsh et al., 2009, Huang et al., 2016). Indeed, distinct miRNA expression profiles have been observed in blood and brain lesions of MS patients (Keller et al., 2009, Martinelli-Boneschi et al., 2012, Junker et al., 2009, Noorbakhsh et al., 2011). Bioinformatics analyses on the function of genes which could be targeted by dysregulated miRNAs have shown that a substantial fraction of these genes regulate inflammation and the activity of

ACCEPTED MANUSCRIPT immune cells (Noorbakhsh et al., 2011). Indeed, several miRNAs which show dysregulation in MS are known to modulate development, activation and polarization of macrophages and microglia, both being crucial players in MS pathogenesis (Self-Fordham et al., 2017, Guedes et al., 2013). Of note, a brain miRNA profiling study has shown upregulation of several miRNAs in

T

multiple sclerosis lesions that target CD47 transcripts, leading to the activation of macrophages

IP

(Junker et al., 2009). Another study has shown that overexpression of miR-124 can result in

CR

deactivation of macrophages and suppression of experimental autoimmune encephalitis (EAE) through targeting the transcription factor CCAAT/enhancer-binding protein-α (C/EBP-α) and its

US

downstream molecule, PU.1 (Ponomarev et al., 2011). PU.1 (with the official symbol SPI1) is a

AN

key transcription factor which is involved in the differentiation, activation and inflammatory responses of macrophages (Hume, 2012). Based on sequence homology and bioinformatics

M

analyses, PU.1 can be a potential target for various microRNAs, some of them showing a high

ED

degree of conservation between different species. (Gerloff et al., 2015, Martinez-Nunez et al.,

PT

2009, Vigorito et al., 2007, Hikami et al., 2011, Rosa et al., 2007).

CE

In this study, we focused on three miRNAs with the potential ability to target murine and human PU.1 transcripts. Selected miRNAs (i.e. miR-18a, miR-150 and miR-155) were chosen based on

AC

bioinformatic criteria, as explained in the Methods section. Of these, miR-155 has been previously shown to directly target PU.1 transcripts (Gerloff et al., 2015, Vigorito et al., 2007). We first investigated the expression of PU.1 and the microRNAs in the CNS of EAE mice, an established animal model for MS, at different stages of disease. Expression analyses were next performed in activated bone marrow derived macrophages (BMDMs), in the resting state and following LPS stimulation. miRNA species showing a negative correlation with PU.1 levels in vivo and in vitro

ACCEPTED MANUSCRIPT were analyzed for direct molecular interactions, using transfection experiments and luciferase reporter assays. We next evaluated the effect of miRNA overexpression on production of

AC

CE

PT

ED

M

AN

US

CR

IP

T

inflammatory cytokines by macrophages as well as on macrophage polarization.

ACCEPTED MANUSCRIPT 2. Materials and Methods 2.1. EAE induction C57BL/6 female mice (6 weeks old) were obtained from Pasteur Institute of Iran and maintained in animal services facility at Tehran University of Medical Sciences. EAE was induced in 30 12-

T

week-old mice, as previously described (Talebi et al., 2017). Briefly, mice were injected

IP

subcutaneously with myelin oligodendrocyte glycoprotein (MOG) 35–55 peptide emulsified in

CR

complete Freund’s adjuvant (Hooke Laboratories, EK-2110). Intraperitoneal injections of

US

pertussis toxin were also administered. Following immunization, clinical assessment of EAE was performed daily using a 15-point scoring system as reported previously (Giuliani et al., 2005).

AN

CNS tissues of EAE mice were removed at 3 time points following disease induction including the preonset phase (before appearance of symptoms, i.e. day 10 post immunization), at the peak of

M

disease (here called the acute phase, i.e. days 18-20) and the late phase of disease (here called the

ED

chronic phase, i.e. days 25-30). All experiments were performed in accordance with guidelines

PT

from Tehran University of Medical Sciences Animal Care Committee.

CE

2.2. Bone marrow-derived macrophage (BMDM) culture

AC

Bone marrow-derived macrophages were obtained from femurs and tibiae of C57/BL6 mice, as previously described (Tsutsui et al., 2004). Briefly, unimmunized C57/BL6 mice were euthanized by an overdose of ketamine and xylazine, followed by removal of femur and tibia. The two ends of femur and tibia were cut and cells were forced out of bones by a syringe filled with culture media. The cells were counted and cultured in complete DMEM containing 10% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin (Gibco) and 50 ng/ml recombinant M-CSF (eBioscience) in 24-well plates (1×106 cells per well). Cells were allowed to differentiate towards macrophages for

ACCEPTED MANUSCRIPT a 7-day period in the presence of recombinant M-CSF. To assert the identity of the cells, immuno fluorescent staining was performed using an anti-CD11b antibody (Abcam). On day 7, macrophages were treated with different concentrations of lipopolysaccharide (LPS) (Sigma, 10 ng/ml and 100 ng/ml) for 12 hours. After harvesting the cells, the gene and miRNA

IP

T

expression levels were measured by real-time PCR as described below.

CR

2.3. miRNA mimic transfections

US

Mouse BMDM cells were transfected with miRNA-150 mimic as well as negative control sequences (Qiagen) at a concentration of 50 nM using Hiperfect transfection reagent (Qiagen)

AN

according to manufacturer’s instructions. Briefly, 3 microliters of Hiperfect Transfection Reagent

M

was mixed with 100 microliters of serum free DMEM medium containing miR-150 mimic or

ED

negative control at a final concentration of 50 nM before adding to cells cultured in 24-well plates. Transfection with a green fluorescent protein (GFP) expression vector was done in parallel to

PT

check for transfection efficiency which was approximately 65 to 70%. Moreover, miR-150 expression level in transfected cells was quantified using real-time RT-PCR with miRNA-specific

CE

primers (described below) .After 4 hours, transfected macrophage cells were stimulated with 100

AC

ng/ml LPS for 12 hours. Total RNA was extracted from transfected cells and transcript levels for PU.1, proinflammatory cytokines and M1/M2 macrophage markers were measured by real-time RT-PCR.

2.4. RNA isolation and Real-time RT-PCR

ACCEPTED MANUSCRIPT Cultured BMDM cells and lumbar spinal cords were homogenized in QIAzol lysis reagent (Qiagen). Total RNA was extracted by miRNeasy mini kit (Qiagen) according to manufacturer’s instructions, and RNA concentration was measured using UV-spectrophotometry by a Nanodrop (Thermo Scientific). First-strand cDNA was synthesized from 0.5-1µg of total RNA using

T

miScript II RT Kit (Qiagen) for microRNAs and PrimeScriptRT reagent Kit for mRNAs

IP

(TAKARA). Real-time PCR (Syber Green method) was performed on a Bio-Rad CFX96 system

CR

using miScript primers for miR-18a, miR-150 and miR-155 (Qiagen) and primers shown in Table 1. MicroRNA expression data were normalized against snord72 transcript levels (Qiagen) whereas

F: CATAGCGATCACTACTGGGATT

ED

mmu-PU.1

Sequence(5'→3')

M

Gene name

AN

Table 1. Primer sequences for real-time RT-PCR

US

β-actin levels were used to normalize mRNA expression.

R: TGGTTCTCAGGGAAGTTCTCAA

CE

mmu-βactin

PT

F: ATGCTCCCCGGGCTGTAT

AC

R: CATAGGAGTCCTTCTGACCCATTC

mmu-IL6

mm-TNF-α

F: TCCAGTTGCCTTCTTGGGAC R :GTGTAATTAAGCCTCCGACTTG F: CCAGTGTGGGAAGCTGTCTT R: AAGCAAAAGAGGAGGCAACA F :GCACCTTACACCTACCAGAGT

mmu-IL-1α

R : AAACTTCTGCCTGACGAGCTT F:GGCAGCCTGTGAGACCTTTG

ACCEPTED MANUSCRIPT mmu-iNOS

R:GCATTGGAAGTGAAGCGTTTC

F: AGCACTGAGGAAAGCTGGTC mmu-Arg1

CR

IP

T

R: CAGACCGTGGGTTCTTCACA

US

2.5. Luciferase assays

To verify direct interaction between PU.1 transcripts and miR-150, we used a luciferase-3′-UTR

AN

reporter system. PU.1 3′ UTR entire fragment was PCR-amplified with primers containing appropriate restriction sites and then cloned downstream of the Renilla luciferase coding

M

sequence (NotI/XhoI sites) in the psiCheck vector (Promega). The following primer sequences

ED

were used to amplify 3'UTR region of PU.1:

PT

Pu.1-F 5’ TTA GCA CTC GAG CAAGAAAAAGATTCGCCTGT 3’

CE

Pu.1-R 5’ TGC TAA GC GGC CGC GGGAGAATAGCTGTCAATAA3’ To evaluate the effect of miR-150 on luciferase activity, HEK293T cells were co-transfected with

AC

recombinant plasmid psiCheck vector (200 ng) and microRNA mimics (100 nM) using Attractene transfection reagent (Qiagen) according to the manufacturer's protocol. Co-transfection with a negative control siRNA (Qiagen) sequence was used as a control. Following 48 hours of incubation, luciferase activity was measured using the Dual Luciferase system ((Promega). Renilla luciferase activity was normalized to firefly luciferase levels as the internal control. 2.6. Bioinformatic analyses TargetScan Ver 7.1 database was used to determine miRNAs which could potentially target PU.1 transcripts. miRNAs whose mature sequence were broadly conserved in vertebrates and their

ACCEPTED MANUSCRIPT binding sites were also conserved between primates and rodents were given priority for further analysis. 2.7. Statistical analyses Statistical analyses were performed using SPSS version 20. GraphPad Prism was used to generate

T

graphs. ANOVA followed by appropriate post-hoc testing for multiple comparisons and Student’s

IP

t test for two-group comparisons were used to determine statistical significance. p values below 0.05 were considered statistically significant. All data are shown as average ± SEM.

CR

3. Results

US

3.1. PU.1 and related miRNAs are dysregulated in the CNS of EAE mice. Bioinformatics approaches which search for sequence homology between the 3’ UTR of

AN

transcripts and the sequence of mature miRNAs have been widely used to predict miRNA-target interactions. In addition to sequence homology, other factors including the conservation of mature

M

miRNA sequence as well as the conservation of miRNA binding site on the transcript can help increase the chances of finding biologically significant miRNA-mRNA interactions. That said, all

ED

potential miRNA-mRNA interactions require to be validated by experimental methods. To find miRNAs which might regulate PU.1 expression, we used predicted miRNA-mRNA interaction

PT

tables provided by TargetScan, one of the most widely used miRNA target prediction algorithms/databases. In our search for PU.1-targeting miRNAs, we focused on broadly conserved

CE

miRNAs (i.e. conserved in vertebrates) whose PU.1 binding sites were also conserved between human and mouse. Two miRNA species met this criteria; miR-150-5p and miR-155-5p (Figure 1).

AC

Of these two miRNAs, miR-155-5p has been previously shown to target PU.1 using molecular methods (Gerloff et al., 2015, Vigorito et al., 2007). Another miRNA, i.e. miR-18-5p whose TargetScan score was considerable but its binding site was not conserved between human and mouse was also considered for experiments (Supplementary Figure 1).

We first examined the expression of PU.1 in the spinal cords of mice with EAE. Expression analyses showed that PU.1 transcript levels were markedly increased at the acute and chronic phases of disease compared with control mice (Figure 1d). Studying the expression of miRNAs in the same tissue revealed significant up-regulation of miR-155 and miR-18a at acute and chronic

ACCEPTED MANUSCRIPT phases of disease (Figure 1f, g). miR-150 was also increased in the acute phase but its expression was reduced in the chronic phase of EAE compared with normal non-inflamed spinal cords (Figure 1e).

3.2. miR-150 expression is reduced in macrophages following activation. Altered expression of mRNAs and/or miRNAs in inflamed CNS tissues reflects the average gene

T

expression in different cell types, including neurons, glial cells and infiltrating leukocytes. Studies

IP

investigating the composition of inflammatory cells in and around MS lesions have shown that

CR

infiltrating macrophages as well as locally activated microglia comprise the majority of immune cells in MS lesions (Dendrou et al., 2015). The role of these so-called monocytoid cells in MS

US

pathogenesis is two-fold; they act as activators of myelin-reactive T cells and they also cause myelin damage through phagocytosis and cytokine production and various studies have

AN

highlighted the role of these cells in MS pathogenesis and treatment(Bhasin et al., 2007, Martiney et al., 1998, Tran et al., 1998). To investigate the expression of PU.1 and miRNA transcript levels

M

in macrophages, we established primary bone marrow derived macrophage cultures (BMDM) from C57/BL6 mice. Monocytoid cell activation and differentiation during neuroinflammation

ED

takes place in a complex inflammatory microenvironment, which is difficult to replicate in vitro. Hence, we decided to use a simplified LPS stimulation model, which has been shown to simulate

PT

some major aspects of macrophage activation. As shown in Figure 2a, PU.1 expression was detectable in unstimulated BMDMs, but its expression was considerably induced in cells following

CE

stimulation with 100 ng/ml of LPS. We then explored whether macrophage activation might result in altered expression of miRNAs which could potentially target PU.1. Expression analyses of

AC

activated macrophages showed a significant decrease in miR-150 levels at 100 ng/ml of LPS whereas miR-155 levels were increased at both 10 and 100 ng/ml concentrations of LPS (Figure 2b, c). Levels of miR-18a were unchanged following stimulation (Figure 2d). A correlation analysis between miR-150 and PU.1 levels revealed a significant negative correlation between miR-150 and PU.1 expression levels both in spinal cord tissues and in activated macrophages (Figure 3a, b) Overall, these data point to the possibility that the downregulation of miR-150 might be linked with enhanced PU.1 expression in activated macrophages and CNS tissues.

ACCEPTED MANUSCRIPT 3.3. miR-150 directly targets and regulates PU.1 To investigate whether miR-150 can directly interact with PU.1 transcripts we used a standard luciferase assay in which the 3' UTR region of the target gene is cloned into a vector downstream of the coding sequence of Renilla luciferase. The recombinant vector is next cotransfected with the mature miRNA sequence (or a control scrambled sequence) into HEK293 cells, followed by measuring the luciferase activity. Performing the assay using PU.1 3’UTR vectors and miR-150

T

mimic sequences showed significant reduction in luciferase activity, compared with cells that had

IP

received a control scrambled sequence, indicating a direct interaction between miR-150 and PU1

CR

(Figure 4a). We then asked whether miR-150 overexpression might affect PU.1 levels in primary macrophages. Consistent with luciferase data, transfection of BMDMs with miR-150 mimic

US

sequences led to a significant reduction in PU.1 transcript levels (Figure 4b). Altogether, these findings indicate that miR-150 can directly interact with and suppresses PU.1

AN

mRNA in cells.

M

3.4. miR-150 regulates macrophage activation and differentiation We next asked whether altered miR-150 levels might affect macrophage biology, i.e. inflammatory

ED

response and/or polarization. To explore this, BMDM cells were transfected with miR-150 mimic or negative control sequences and were then stimulated with LPS. Expression analyses for

PT

inflammatory cytokines revealed no significant change in TNF-a levels in miR-150 overexpressing cells (Figure 5a). However, transcript levels for IL-1 and IL-6 were significantly reduced in miR-

5b and c).

CE

150-transfected cells, compared with cells transfected with the negative control sequence (Figure

AC

Macrophage polarization towards proinflammatory M1-like or anti-inflammatory M2-like phenotypes is known to play a role in the pathogenesis of autoimmune disorders, including MS/EAE. Indeed, PU.1 transcription factor has been reported to play an important role in differentiation of macrophages towards the proinflammatory M1-like phenotype(Juhas et al., 2015, Lawrence and Natoli, 2011). Considering our previous findings with regard to targeting of PU.1 by miR-150, we asked whether miR-150 overexpression might affect macrophage differentiation towards M1-like or M2-like phenotypes. To this end, we studied the transcript levels of iNOS (an important M1 marker) and arginase-1 (a key M2 marker) in cells transfected

ACCEPTED MANUSCRIPT with miR-150. Interestingly, iNOS transcript levels were markedly diminished in cells overexpressing miR-150, whereas arginase-1 levels were induced (Figure 5d and e). Altogether, these results indicate that miR-150 can alter macrophage activation and inflammatory response, a phenomenon which was associated with shifting the balance of macrophage polarization away from proinflammatory M1-like and towards anti-inflammatory M2-like phenotype.

IP

T

4. Discussion

CR

Monocytoid cells, including infiltrating macrophages and resident microglia contribute to the pathogenesis of various neuroinflammatory disorders (Lucchinetti et al., 2000, Prineas et al., 2001,

US

Luo et al., 2017). Molecular mechanisms which underlie the activation and differentiation of monocytoid cells in physiological and/or pathological situations have been investigated for years

AN

and numerous cell surface receptors, signaling molecules and transcription factors have been demonstrated to be involved in these processes. PU.1 (official symbol SPI1), is a transcription

M

factor belonging to the ETS-domain family of transcription factors, and it regulates gene expression through binding to purine-rich sequences near the promoters of target genes

ED

(Turkistany and DeKoter, 2011, van Riel and Rosenbauer, 2014). PU.1 influences different aspects of myeloid cell biology, including differentiation and activation of monocytes and macrophages

PT

(Hume, 2012). Indeed, studies have illustrated that macrophage development is dependent on PU.1, perhaps through its effects on the expression of M-CSF receptor (Hume and Freeman, 2014,

CE

Gomez Perdiguero et al., 2013, Juhas et al., 2015). Activation of PU.1 also occurs following the activation of TLR4 and GM-CSF receptors and in turn influences the expression of downstream

AC

inflammatory genes (Juhas et al., 2015, Joo et al., 2009). In addition to affecting macrophage activation, PU.1 is an essential transcription factor for M1 polarization (Juhas et al., 2015, Lawrence and Natoli, 2011). In this study, we explored the potential role of miRNAs in regulating the expression of PU.1 in the context of autoimmune neuroinflammation. Our findings showed increased levels of PU.1 in the spinal cords of EAE mice as well as in activated primary macrophages. Three miRNAs were initially considered for analyses; miR-18a-5p, miR-150-5p and miR-155-5p. These miRNAs were selected based on bioinformatics criteria (as described in Section 3.1). Interestingly, however, two of these miRNAs, i.e. miR-150 and miR-155 have been shown to interact in regulatory networks

ACCEPTED MANUSCRIPT in leukocytes. In one study miR-150 has been shown to block the expression of MYB, which in turn induces the expression of miR-155(Vargova et al., 2017). Other studies (El Gazzar and McCall, 2012, Tu et al., 2012)have shown induction of miR-155 expression by PU.1, which in turn is targeted by miR-150 (as well as PU.1 itself). Expression analyses in the spinal cords of EAE/control mice as well as primary macrophages showed elevated levels of all three miRNA in EAE spinal cords and also altered levels for miR-150 and miR-155 in LPS-stimulated

T

macrophages. Nonetheless, only miR-150 levels showed inverse correlations with PU.1 levels in

IP

both tissues and cells. It should be noted that lack of inverse correlation between the levels of a

CR

miRNA and the transcripts of a potential target does not rule out an interaction, considering that some miRNAs inhibit translation to protein rather than mRNA stability. Moreover, when

US

analyzing inflamed tissues, a third variable, i.e. degree of leukocyte infiltration, might determine the levels of both miRNA and its target. That said, following expression analyses in the current

AN

study, we focused on miR-150 and its potential regulation of PU.1. Further experiments showed a direct interaction between miR-150 and PU.1 transcript sequences, and that overexpression of

M

miR-150 can suppress PU.1 levels and also affect cytokine production and polarization of macrophages.

ED

Elevated expression of PU.1 transcription factor has been has been demonstrated in the CNS of EAE/MS cases (Ponomarev et al., 2011, Hoppmann et al., 2015, Ibrahim et al., 2001) as well as in

PT

activated macrophages (Xiao et al., 2012, Tu et al., 2012). From a cell biology perspective, upstream signaling pathways are generally believed to control the levels of downstream

CE

transcription factors. However, there is increasing evidence that interactions between transcription factors and non-coding regulatory RNAs are also crucial in regulating transcription factors. Human

AC

and mouse PU.1 genes each produce four different transcript variants (including predicted variants) with multiple highly conserved miRNA binding sites on their 3’UTR segments, pointing to the possibility of functionally relevant regulation by miRNAs. Dysregulation of numerous miRNAs has also been reported in MS brain and leukocytes. Of interest, perturbed expression of miR-150 has been shown in the CSF and peripheral blood mononuclear cells (PBMCs) of MS patients (Quintana et al., 2017, Martinelli-Boneschi et al., 2012). Some studies have reported decreased miR-150 levels in PBMCs of MS patients (Martinelli-Boneschi et al., 2012, Jernas et al., 2013), whereas other investigation have found no differences in miR-150 levels (Fenoglio et

ACCEPTED MANUSCRIPT al., 2011). On the contrary, significant higher levels of miR-150 in the CSF of MS patients were observed (Bergman et al., 2016).

Macrophage phenotype is of importance in the initiation and progression of inflammatory demyelination (Cao and He, 2013, Mikita et al., 2011). Two major phenotypes of differentiated macrophages

have

been

identified;

a

proinflammatory

phenotype

and

an

anti-

T

inflammatory/regulatory phenotype. Some authors have labelled the former phenotype as M1 and

IP

the latter as M2 macrophages. However, this M1/M2 distinction is controversial as it does not

CR

capture the complexity of macrophage polarization/differentiation. Some authors have suggested using the activating agent to distinguish the two types, e.g. M(LPS) instead of M1, or M1-like/M2-

US

like nomenclature, as we have used in the current paper. While M1-like macrophages express inducible nitric oxide synthase (iNOS) and proinflammatory cytokines in response to stimulation

AN

with TLR ligands and/or Th1 cytokines, M2-like macrophages produce alternative activation markers, including arginase- 1 (Arg1) and are critical for suppressing inflammation, tissue repair

M

and remodeling (Stephens et al., 2011, Murray and Wynn, 2011, Mosser and Edwards, 2008, Ruffell et al., 2012).Various signaling pathways, transcription factors and epigenetic factors are

ED

known to influence macrophage polarization in health and disease. As mentioned before, PU.1 together with nuclear factor κB (NF-κB) and CCAAT/enhancer binding protein-α (C/EBPα) are

PT

essential transcription factors for M1 polarization, while C/EBPβ, peroxisome proliferator– activated receptor-γ( PPARγ) and STAT6 act as M2-polarizers (Juhas et al., 2015, Lawrence and

CE

Natoli, 2011, Bosca et al., 2015). There is increasing evidence about miRNAs which influence macrophage polarization by targeting these transcription factors. . Of note, previous studies have

AC

shown that miRNA-155 contributes to macrophage polarization toward the M1-like through targeting C/EBP-β(Arranz et al., 2012), while miRNA-124 and miR-181a promotes differentiation towards M2-like phenotype by targeting C/EBPα (Ponomarev et al., 2011, Bi et al., 2016). Some reports have also highlighted the role microRNAs in determining macrophage polarization in MS or EAE (Ivashkiv, 2013, Essandoh et al., 2016, Self-Fordham et al., 2017, El Gazzar and McCall, 2012). Our data showed that overexpression of miRNA-150 in primary macrophages could reduce LPS-induced macrophage inflammatory responses as well as differentiation towards M1-like phenotype. This was associated with decreased expression of M1-associated macrophage marker, iNOS and enhanced expression M2 macrophage markers, Arginase 1.

ACCEPTED MANUSCRIPT

5. Conclusion Our findings point to the potential role of miRNA-150-PU.1 interaction in regulating neuroinflamation. miRNA-150-PU.1 interaction might affect macrophage cytokine production and the balance of macrophage phenotypes towards M2-like anti-inflammatory phenotype.

T

Understanding the factors the regulate macrophage activation and polarization might lead to

IP

development of new therapies for many inflammatory diseases. Our results suggest that miR-150PU1 interaction might be a likely target for therapeutic interventions in autoimmune

AC

CE

PT

ED

M

AN

US

CR

neuroinflammation

ACCEPTED MANUSCRIPT Acknowledgments This research was supported by grants from Tehran University of Medical Sciences (91-02-0318069). L.S and S.G. performed the experiments, analyzed the results and wrote the manuscript. F.T. helped with the experiments and data analysis. F.N. developed the hypothesis, designed the project, applied for funding, supervised the research and edited the final manuscript.

AC

CE

PT

ED

M

AN

US

CR

IP

None of the authors have a commercial interest in the present report.

T

Disclosures

ACCEPTED MANUSCRIPT Figure Legends

AN

US

CR

IP

T

Figure 1. Expression levels of PU.1 and its potentially targeting miRNAs in the CNS of EAE mice. Predicted target sites for miR-150, miR-155 and miR-18a on PU.1 mRNA 3' UTR according to TargetScan algorithm (A). Homology between human and mouse mature miRNA sequences (B). Sequence of predicted binding sites for miR-150, miR-155 and miR-18a on 3' UTR of mouse PU.1 mRNA (C).Expression analyses were performed by quantitative real-time PCR in the spinal cord at three different phases of EAE. PU.1 levels at pre-onset, acute and chronic phases of disease (D). Expression of miR-150 (E), miR-155 (F) and miR-18a (G) in different phases of disease. RFC is “relative fold change” compared with control animals. Data are shown as average +/- standard error of mean of all mice, n=10. (ANOVA-Tukey post hoc; p*<0.05, p**<0.01, P***< 0.001)

CE

PT

ED

M

Figure 2. Transcript levels of PU.1 and its potentially targeting miRNAs in activated macrophages. Bone marrow-derived macrophages were stimulated with LPS (10 and 100 ng/ml) for 12 hours and the expression of PU.1 and microRNAs were measured. Bar graphs showed PU.1 expression levels in vehicle-treated and LPS-treated macrophages (A). Expression of miR-150 (B), miR-155 (C) and miR-18 (D) are shown for the same groups of cells. RFC= Relative Fold Change. Data are shown as average +/- SEM values derived from replicates in cells, n-3. Experiment was repeated twice. (ANOVA-Tukey post hoc; p*<0.05, P***< 0.001)

AC

Figure 3.Correlation analysis between PU.1 mRNA and miR-150 levels. Dot plot shows PU.1 levels versus miR-150 in mouse spinal cords in chronic phase of EAE (A) and activated BMDM (B). (Pearson correlation; *p < 0.05, **p < 0.01)

ACCEPTED MANUSCRIPT

CR

IP

T

Figure 4. PU.1 transcripts are targeted by miR-150. Molecular interaction between PU.1 transcripts and miR-150 was assessed using luciferase assay. Luciferase activity was measured after co-transfection of PU.1 3' UTR -containing vectors together with miR-150 sequences into HEK cells. Cells transfected with a scrambled negative control sequence served as control. Renilla luciferase activity was normalized against internal Firefly luciferase (A). Levels of PU.1 transcripts in miR-150 transfected macrophages (B). RLU= Relative Light Unit , RFC= Relative Fold Change. Data are Shown as average +/- standard error, n=5. Experiment was repeated twice. (Student’s t test, *p < 0.05, p**<0.01).

ED

M

AN

US

Figure 5. Effects of miR-150 on macrophage activation and polarization. Primary macrophages were transfected with miR-150 or negative control sequences and then treated with LPS (100 ng) for 12 h. The expression of inflammatory cytokines TNF-a, IL-1, and IL-6 together with M1/M2 markers iNOS and arginase-1 (Arg-1) were then quantified. Bar graphs show the expression of proinflammatory cytokines TNF-a (A), IL1b (B), and IL6 (C) in control and miR150 overexpressing cells. Expression of iNOS (M1 marker) and Arginase -1 (M2 marker) are also shown (D,E). RFC= Relative Fold Change. Data are shown as mean ± SEM, n=3. Experiment was repeated twice. (Student’s t test, *p < 0.05, p**< 0.01).

AC

CE

PT

Supp Figure 1. Target scan prediction score for microRNAs targeting PU.1 (A). miR-155, miR150 and miR-18a binding region in human and mouse for PU.1 (B).

ACCEPTED MANUSCRIPT

References: ABE, M. & BONINI, N. M. 2013. MicroRNAs and neurodegeneration: role and impact. Trends Cell Biol, 23, 30-6. AMBROS, V. 2001. microRNAs: tiny regulators with great potential. Cell, 107, 823-6.

AC

CE

PT

ED

M

AN

US

CR

IP

T

ARRANZ, A., DOXAKI, C., VERGADI, E., MARTINEZ DE LA TORRE, Y., VAPORIDI, K., LAGOUDAKI, E. D., IERONYMAKI, E., ANDROULIDAKI, A., VENIHAKI, M., MARGIORIS, A. N., STATHOPOULOS, E. N., TSICHLIS, P. N. & TSATSANIS, C. 2012. Akt1 and Akt2 protein kinases differentially contribute to macrophage polarization. Proc Natl Acad Sci U S A, 109, 9517-22. BERGMAN, P., PIKET, E., KHADEMI, M., JAMES, T., BRUNDIN, L., OLSSON, T., PIEHL, F. & JAGODIC, M. 2016. Circulating miR-150 in CSF is a novel candidate biomarker for multiple sclerosis. Neurol Neuroimmunol Neuroinflamm, 3, e219. BHASIN, M., WU, M. & TSIRKA, S. E. 2007. Modulation of microglial/macrophage activation by macrophage inhibitory factor (TKP) or tuftsin (TKPR) attenuates the disease course of experimental autoimmune encephalomyelitis. BMC Immunol, 8, 10. BI, J., ZENG, X., ZHAO, L., WEI, Q., YU, L., WANG, X., YU, Z., CAO, Y., SHAN, F. & WEI, M. 2016. miR181a Induces Macrophage Polarized to M2 Phenotype and Promotes M2 Macrophage-mediated Tumor Cell Metastasis by Targeting KLF6 and C/EBPalpha. Mol Ther Nucleic Acids, 5, e368. BOSCA, L., GONZALEZ-RAMOS, S., PRIETO, P., FERNANDEZ-VELASCO, M., MOJENA, M., MARTINSANZ, P. & ALEMANY, S. 2015. Metabolic signatures linked to macrophage polarization: from glucose metabolism to oxidative phosphorylation. Biochem Soc Trans, 43, 740-4. CAO, L. & HE, C. 2013. Polarization of macrophages and microglia in inflammatory demyelination. Neurosci Bull, 29, 189-98. DENDROU, C. A., FUGGER, L. & FRIESE, M. A. 2015. Immunopathology of multiple sclerosis. Nat Rev Immunol, 15, 545-58. EBERT, M. S. & SHARP, P. A. 2012. Roles for microRNAs in conferring robustness to biological processes. Cell, 149, 515-24. EL GAZZAR, M. & MCCALL, C. E. 2012. MicroRNAs regulatory networks in myeloid lineage development and differentiation: regulators of the regulators. Immunol Cell Biol, 90, 587-93. ESSANDOH, K., LI, Y., HUO, J. & FAN, G. C. 2016. MiRNA-Mediated Macrophage Polarization and its Potential Role in the Regulation of Inflammatory Response. Shock, 46, 122-31. FENOGLIO, C., CANTONI, C., DE RIZ, M., RIDOLFI, E., CORTINI, F., SERPENTE, M., VILLA, C., COMI, C., MONACO, F., MELLESI, L., VALZELLI, S., BRESOLIN, N., GALIMBERTI, D. & SCARPINI, E. 2011. Expression and genetic analysis of miRNAs involved in CD4+ cell activation in patients with multiple sclerosis. Neurosci Lett, 504, 9-12. GERLOFF, D., GRUNDLER, R., WURM, A. A., BRAUER-HARTMANN, D., KATZERKE, C., HARTMANN, J. U., MADAN, V., MULLER-TIDOW, C., DUYSTER, J., TENEN, D. G., NIEDERWIESER, D. & BEHRE, G. 2015. NF-kappaB/STAT5/miR-155 network targets PU.1 in FLT3-ITD-driven acute myeloid leukemia. Leukemia, 29, 535-47. GIULIANI, F., METZ, L. M., WILSON, T., FAN, Y., BAR-OR, A. & YONG, V. W. 2005. Additive effect of the combination of glatiramer acetate and minocycline in a model of MS. J Neuroimmunol, 158, 213-21. GOMEZ PERDIGUERO, E., SCHULZ, C. & GEISSMANN, F. 2013. Development and homeostasis of "resident" myeloid cells: the case of the microglia. Glia, 61, 112-20. GUEDES, J., CARDOSO, A. L. & PEDROSO DE LIMA, M. C. 2013. Involvement of microRNA in microgliamediated immune response. Clin Dev Immunol, 2013, 186872. HEBERT, S. S., HORRE, K., NICOLAI, L., PAPADOPOULOU, A. S., MANDEMAKERS, W., SILAHTAROGLU, A. N., KAUPPINEN, S., DELACOURTE, A. & DE STROOPER, B. 2008. Loss of microRNA cluster miR-29a/b-1 in sporadic Alzheimer's disease correlates with increased BACE1/betasecretase expression. Proc Natl Acad Sci U S A, 105, 6415-20. HIKAMI, K., KAWASAKI, A., ITO, I., KOGA, M., ITO, S., HAYASHI, T., MATSUMOTO, I., TSUTSUMI, A., KUSAOI, M., TAKASAKI, Y., HASHIMOTO, H., ARINAMI, T., SUMIDA, T. & TSUCHIYA, N. 2011.

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

Association of a functional polymorphism in the 3'-untranslated region of SPI1 with systemic lupus erythematosus. Arthritis Rheum, 63, 755-63. HOPPMANN, N., GRAETZ, C., PATERKA, M., POISA-BEIRO, L., LAROCHELLE, C., HASAN, M., LILL, C. M., ZIPP, F. & SIFFRIN, V. 2015. New candidates for CD4 T cell pathogenicity in experimental neuroinflammation and multiple sclerosis. Brain, 138, 902-17. HUANG, Q., XIAO, B., MA, X., QU, M., LI, Y., NAGARKATTI, P., NAGARKATTI, M. & ZHOU, J. 2016. MicroRNAs associated with the pathogenesis of multiple sclerosis. J Neuroimmunol, 295-296, 148-61. HUME, D. A. 2012. Plenary perspective: the complexity of constitutive and inducible gene expression in mononuclear phagocytes. J Leukoc Biol, 92, 433-44. HUME, D. A. & FREEMAN, T. C. 2014. Transcriptomic analysis of mononuclear phagocyte differentiation and activation. Immunol Rev, 262, 74-84. IBRAHIM, S. M., MIX, E., BOTTCHER, T., KOCZAN, D., GOLD, R., ROLFS, A. & THIESEN, H. J. 2001. Gene expression profiling of the nervous system in murine experimental autoimmune encephalomyelitis. Brain, 124, 1927-38. IVASHKIV, L. B. 2013. Epigenetic regulation of macrophage polarization and function. Trends Immunol, 34, 21623. JERNAS, M., MALMESTROM, C., AXELSSON, M., NOOKAEW, I., WADENVIK, H., LYCKE, J. & OLSSON, B. 2013. MicroRNA regulate immune pathways in T-cells in multiple sclerosis (MS). BMC Immunol, 14, 32. JOHNSON, R., ZUCCATO, C., BELYAEV, N. D., GUEST, D. J., CATTANEO, E. & BUCKLEY, N. J. 2008. A microRNA-based gene dysregulation pathway in Huntington's disease. Neurobiol Dis, 29, 438-45. JOO, M., KWON, M., CHO, Y. J., HU, N., PEDCHENKO, T. V., SADIKOT, R. T., BLACKWELL, T. S. & CHRISTMAN, J. W. 2009. Lipopolysaccharide-dependent interaction between PU.1 and c-Jun determines production of lipocalin-type prostaglandin D synthase and prostaglandin D2 in macrophages. Am J Physiol Lung Cell Mol Physiol, 296, L771-9. JUHAS, U., RYBA-STANISLAWOWSKA, M., SZARGIEJ, P. & MYSLIWSKA, J. 2015. Different pathways of macrophage activation and polarization. Postepy Hig Med Dosw (Online), 69, 496-502. JUNKER, A., KRUMBHOLZ, M., EISELE, S., MOHAN, H., AUGSTEIN, F., BITTNER, R., LASSMANN, H., WEKERLE, H., HOHLFELD, R. & MEINL, E. 2009. MicroRNA profiling of multiple sclerosis lesions identifies modulators of the regulatory protein CD47. Brain, 132, 3342-52. KELLER, A., LEIDINGER, P., LANGE, J., BORRIES, A., SCHROERS, H., SCHEFFLER, M., LENHOF, H. P., RUPRECHT, K. & MEESE, E. 2009. Multiple sclerosis: microRNA expression profiles accurately differentiate patients with relapsing-remitting disease from healthy controls. PLoS One, 4, e7440. LAWRENCE, T. & NATOLI, G. 2011. Transcriptional regulation of macrophage polarization: enabling diversity with identity. Nat Rev Immunol, 11, 750-61. LOCK, C., HERMANS, G., PEDOTTI, R., BRENDOLAN, A., SCHADT, E., GARREN, H., LANGER-GOULD, A., STROBER, S., CANNELLA, B., ALLARD, J., KLONOWSKI, P., AUSTIN, A., LAD, N., KAMINSKI, N., GALLI, S. J., OKSENBERG, J. R., RAINE, C. S., HELLER, R. & STEINMAN, L. 2002. Gene-microarray analysis of multiple sclerosis lesions yields new targets validated in autoimmune encephalomyelitis. Nat Med, 8, 500-8. LUCCHINETTI, C., BRUCK, W., PARISI, J., SCHEITHAUER, B., RODRIGUEZ, M. & LASSMANN, H. 2000. Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination. Ann Neurol, 47, 707-17. LUO, C., JIAN, C., LIAO, Y., HUANG, Q., WU, Y., LIU, X., ZOU, D. & WU, Y. 2017. The role of microglia in multiple sclerosis. Neuropsychiatr Dis Treat, 13, 1661-1667. MARTINELLI-BONESCHI, F., FENOGLIO, C., BRAMBILLA, P., SOROSINA, M., GIACALONE, G., ESPOSITO, F., SERPENTE, M., CANTONI, C., RIDOLFI, E., RODEGHER, M., MOIOLA, L., COLOMBO, B., DE RIZ, M., MARTINELLI, V., SCARPINI, E., COMI, G. & GALIMBERTI, D. 2012. MicroRNA and mRNA expression profile screening in multiple sclerosis patients to unravel novel pathogenic steps and identify potential biomarkers. Neurosci Lett, 508, 4-8. MARTINEY, J. A., RAJAN, A. J., CHARLES, P. C., CERAMI, A., ULRICH, P. C., MACPHAIL, S., TRACEY, K. J. & BROSNAN, C. F. 1998. Prevention and treatment of experimental autoimmune encephalomyelitis by CNI-1493, a macrophage-deactivating agent. J Immunol, 160, 5588-95. MARTINEZ-NUNEZ, R. T., LOUAFI, F., FRIEDMANN, P. S. & SANCHEZ-ELSNER, T. 2009. MicroRNA-155 modulates the pathogen binding ability of dendritic cells (DCs) by down-regulation of DC-specific intercellular adhesion molecule-3 grabbing non-integrin (DC-SIGN). J Biol Chem, 284, 16334-42.

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

MIKITA, J., DUBOURDIEU-CASSAGNO, N., DELOIRE, M. S., VEKRIS, A., BIRAN, M., RAFFARD, G., BROCHET, B., CANRON, M. H., FRANCONI, J. M., BOIZIAU, C. & PETRY, K. G. 2011. Altered M1/M2 activation patterns of monocytes in severe relapsing experimental rat model of multiple sclerosis. Amelioration of clinical status by M2 activated monocyte administration. Mult Scler, 17, 2-15. MOSSER, D. M. & EDWARDS, J. P. 2008. Exploring the full spectrum of macrophage activation. Nat Rev Immunol, 8, 958-69. MURRAY, P. J. & WYNN, T. A. 2011. Obstacles and opportunities for understanding macrophage polarization. J Leukoc Biol, 89, 557-63. NILSEN, T. W. 2007. Mechanisms of microRNA-mediated gene regulation in animal cells. Trends Genet, 23, 2439. NOORBAKHSH, F., ELLESTAD, K. K., MAINGAT, F., WARREN, K. G., HAN, M. H., STEINMAN, L., BAKER, G. B. & POWER, C. 2011. Impaired neurosteroid synthesis in multiple sclerosis. Brain, 134, 2703-21. NOORBAKHSH, F., OVERALL, C. M. & POWER, C. 2009. Deciphering complex mechanisms in neurodegenerative diseases: the advent of systems biology. Trends Neurosci, 32, 88-100. PAULEY, K. M., CHA, S. & CHAN, E. K. 2009. MicroRNA in autoimmunity and autoimmune diseases. J Autoimmun, 32, 189-94. PILLAI, R. S. 2005. MicroRNA function: multiple mechanisms for a tiny RNA? RNA, 11, 1753-61. PONOMAREV, E. D., VEREMEYKO, T., BARTENEVA, N., KRICHEVSKY, A. M. & WEINER, H. L. 2011. MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU.1 pathway. Nat Med, 17, 64-70. PRINEAS, J. W., KWON, E. E., CHO, E. S., SHARER, L. R., BARNETT, M. H., OLESZAK, E. L., HOFFMAN, B. & MORGAN, B. P. 2001. Immunopathology of secondary-progressive multiple sclerosis. Ann Neurol, 50, 646-57. QUINTANA, E., ORTEGA, F. J., ROBLES-CEDENO, R., VILLAR, M. L., BUXO, M., MERCADER, J. M., ALVAREZ-CERMENO, J. C., PUEYO, N., PERKAL, H., FERNANDEZ-REAL, J. M. & RAMIOTORRENTA, L. 2017. miRNAs in cerebrospinal fluid identify patients with MS and specifically those with lipid-specific oligoclonal IgM bands. Mult Scler, 23, 1716-1726. ROSA, A., BALLARINO, M., SORRENTINO, A., STHANDIER, O., DE ANGELIS, F. G., MARCHIONI, M., MASELLA, B., GUARINI, A., FATICA, A., PESCHLE, C. & BOZZONI, I. 2007. The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation. Proc Natl Acad Sci U S A, 104, 19849-54. RUFFELL, B., AFFARA, N. I. & COUSSENS, L. M. 2012. Differential macrophage programming in the tumor microenvironment. Trends Immunol, 33, 119-26. SELF-FORDHAM, J. B., NAQVI, A. R., UTTAMANI, J. R., KULKARNI, V. & NARES, S. 2017. MicroRNA: Dynamic Regulators of Macrophage Polarization and Plasticity. Front Immunol, 8, 1062. STEPHENS, S. L., WALKER, N. R. & LEGON, A. C. 2011. Molecular geometries of H2S...ICF3 and H2O...ICF3 characterised by broadband rotational spectroscopy. Phys Chem Chem Phys, 13, 21093-101. TALEBI, F., GHORBANI, S., CHAN, W. F., BOGHOZIAN, R., MASOUMI, F., GHASEMI, S., VOJGANI, M., POWER, C. & NOORBAKHSH, F. 2017. MicroRNA-142 regulates inflammation and T cell differentiation in an animal model of multiple sclerosis. J Neuroinflammation, 14, 55. TRAN, E. H., HOEKSTRA, K., VAN ROOIJEN, N., DIJKSTRA, C. D. & OWENS, T. 1998. Immune invasion of the central nervous system parenchyma and experimental allergic encephalomyelitis, but not leukocyte extravasation from blood, are prevented in macrophage-depleted mice. J Immunol, 161, 3767-75. TSUTSUI, S., SCHNERMANN, J., NOORBAKHSH, F., HENRY, S., YONG, V. W., WINSTON, B. W., WARREN, K. & POWER, C. 2004. A1 adenosine receptor upregulation and activation attenuates neuroinflammation and demyelination in a model of multiple sclerosis. J Neurosci, 24, 1521-9. TU, J., XING, Y., GUO, Y., TANG, F., GUO, L. & XI, T. 2012. TanshinoneIIA ameliorates inflammatory microenvironment of colon cancer cells via repression of microRNA-155. Int Immunopharmacol, 14, 35361. TURKISTANY, S. A. & DEKOTER, R. P. 2011. The transcription factor PU.1 is a critical regulator of cellular communication in the immune system. Arch Immunol Ther Exp (Warsz), 59, 431-40. VAN RIEL, B. & ROSENBAUER, F. 2014. Epigenetic control of hematopoiesis: the PU.1 chromatin connection. Biol Chem, 395, 1265-74. VARGOVA, K., PESTA, M., OBRTLIKOVA, P., DUSILKOVA, N., MINARIK, L., VARGOVA, J., BERKOVA, A., ZEMANOVA, Z., MICHALOVA, K., SPACEK, M., TRNENY, M. & STOPKA, T. 2017. MiR-

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

M

AN

US

CR

IP

T

155/miR-150 network regulates progression through the disease phases of chronic lymphocytic leukemia. Blood Cancer J, 7, e585. VIGORITO, E., PERKS, K. L., ABREU-GOODGER, C., BUNTING, S., XIANG, Z., KOHLHAAS, S., DAS, P. P., MISKA, E. A., RODRIGUEZ, A., BRADLEY, A., SMITH, K. G., RADA, C., ENRIGHT, A. J., TOELLNER, K. M., MACLENNAN, I. C. & TURNER, M. 2007. microRNA-155 regulates the generation of immunoglobulin class-switched plasma cells. Immunity, 27, 847-59. XIAO, L., ORNATOWSKA, M., ZHAO, G., CAO, H., YU, R., DENG, J., LI, Y., ZHAO, Q., SADIKOT, R. T. & CHRISTMAN, J. W. 2012. Lipopolysaccharide-induced expression of microsomal prostaglandin E synthase-1 mediates late-phase PGE2 production in bone marrow derived macrophages. PLoS One, 7, e50244.

ACCEPTED MANUSCRIPT Highlights 

PU.1, miR-155 and miR-18a expression levels are up-regulated at both acute and chronic phases of EAE disease.



While showing an increase at acute phase, miRNA-150 expression is significantly reduced at chronic phase of EAE. miR-150 expression is decreased in macrophages following LPS treatment and shows a

T



IP

negative correlation with PU.1.

miR-150 directly interacts and suppresses PU.1 transcript sequences.



Overexpression of miR-150 can modulate macrophage inflammatory response and

CR



AC

CE

PT

ED

M

AN

US

polarization.

Graphics Abstract

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6