reperfusion injury by promoting oxidative stress via targeting growth factor receptor-bound protein 2

Journal Pre-proof MicroRNA-27a-3p aggravates renal ischemia/reperfusion injury by promoting oxidative stress via targeting growth factor receptor-bound protein 2 X.-R. Zhao, Z. Zhang, M. Gao, L. Li, P.-Y. Sun, L.-N. Xu, Y. Qi, L.-H. Yin, J.-Y. Peng

PII:

S1043-6618(19)32663-5

DOI:

https://doi.org/10.1016/j.phrs.2020.104718

Reference:

YPHRS 104718

To appear in:

Pharmacological Research

Received Date:

22 November 2019

Revised Date:

28 January 2020

Accepted Date:

18 February 2020

Please cite this article as: Zhao X-R, Zhang Z, Gao M, Li L, Sun P-Y, Xu L-N, Qi Y, Yin L-H, Peng J-Y, MicroRNA-27a-3p aggravates renal ischemia/reperfusion injury by promoting oxidative stress via targeting growth factor receptor-bound protein 2, Pharmacological Research (2020), doi: https://doi.org/10.1016/j.phrs.2020.104718

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

MicroRNA-27a-3p aggravates renal ischemia/reperfusion injury by promoting oxidative stress via targeting growth factor receptor-bound protein 2 X.-R. Zhaoa, Z. Zhanga, M. Gaoa, L. Lia, P.-Y. Suna, L.-N. Xua, Y. Qia, L.-H. Yina, J.-Y. Penga,b,c* a

Department of Pharmaceutical Analysis, Dalian Medical University, Western 9 Lvshunnan Road, Dalian 116044, China b Key Laboratory for Basic and Applied Research on Pharmacodynamic Substances of Traditional Chinese Medicine of Liaoning Province, Dalian Medical University, Dalian, China c National-Local Joint Engineering Research Center for Drug Development (R&D) of Neurodegenerative Diseases, Dalian Medical University, Dalian, China

-p

ro of

Corresponding author, Dr. J.-Y. Peng Dalian Medical University Dalian, China Tel.: +86 411 8611 0417 Fax: +86 411 8611 0417 Email:[email protected]

Highlights

miR-27a-3p aggravated RI/R injury by promoting oxidative stress.

Jo



RI/R injury significantly increased the expression level of miR-27a-3p.

ur



na

lP

re

Graphical abstract



miR-27a-3p directly targeted Grb2.



Grb2siRNA further enhanced RI/R-caused renal injury.

Abstract

Renal ischemia-reperfusion (RI/R) injury with high morbidity and mortality is one common clinical disease. Development of drug targets to treat the disorder is critical important. MiR-27a-3p plays important roles in regulating oxidative stress. However, its effects on RI/R injury have not been reported. In this paper, hypoxia/reoxygenation (H/R) models on NRK-52E and HK-2 cells, and RI/R model in C57BL/6 mice were established. The results showed that H/R in vitro decreased cell viability and increased ROS levels in cells, and RI/R caused renal injury and oxidative damage in mice. The expression levels of miR-27a-3p were up-regulated based on real-time PCR and FISH assays in model groups compared with control groups, which directly targeted Grb2 based on dual

ro of

luciferase reporter assay and co-transfaction test. In addition, miR-27a- 3p markedly reduced Grb2 expression to down-regulate the expression levels of p-PI3K, p-AKT, Nrf2, HO-1, and up-regulate Keap1 expression in model groups. MiR-27a-3p mimics in vitro enhanced H/R-caused oxidative stress via increasing ROS levels and decreasing Grb2

-p

expression to down-regulate PI3K-AKT signal. In contrary, miR-27a-3p inhibitor in vitro significantly reduced H/R-caused oxidative damage via decreasing ROS levels and

re

increasing Grb2 expression to up-regulate PI3K-AKT signal. In vivo, miR-27a- 3p agomir exacerbated RI/R-caused renal damage by decreasing SOD level and increasing Cr, BUN,

lP

MDA levels via suppressing Grb2 expression to down-regulate PI3K- AKT signal. However, miR-27a -3p antagomir alleviated RI/R-caused oxidative damage via increasing Grb2 expression to up-regulate PI3k-AKT signal. Grb2siRNA in mice further enhanced RI/R-

na

caused renal injury by increasing Cr, BUN, MDA levels and decreasing SOD level via inhibiting the expression levels of Grb2, Nrf2, HO-1, and increasing Keap1 expression.

ur

Our data showed that miR-27a-3p aggravated RI/R injury by promoting oxidative stress via targeting Grb2, which should be considered as one new drug target to treat RI/R

Jo

injury.

Abbreviation: creatinine, Cr; blood urea nitrogen, BUN; malondialdehyde, MDA; total superoxide dismutase, T-SOD; reactive oxygen species, ROS; Growth factor receptorbound protein 2, Grb2; phosphor-phosphoinositide-3-kinase, p-PI3K; phosphor-Protein kinase B, p-AKT; nuclear erythroid factor 2-reated factor 2, Nrf2; heme oxygenase-1, HO1; kelch like ECH-associated protein 1, Keap1; 3-(4,5-dimethyl-2-thiazolyl)-2,5- diphenyl2-H-tetrazolium bromide, MTT; 4',6-diamidino-2-phenylindole; DAPI

Keywords: drug target; renal ischemia-reperfusion injury; miR-27a-3p/Grb2 signal; oxidative stress

1. Introduction Acute kidney injury (AKI) is characterized by abnormal changes in kidney excretion functions including the accumulation of metabolic waste and/or sharp decreased urine output [1]. As one major pathogenesis of AKI, renal ischemia-reperfusion (RI/R) injury is

ro of

one common disease in surgery, cardiovascular disorders and hemorrhagicshock, which also is the inevitable injury of renal transplantation [2–4]. In RI/R process, the structure of glomerular filtration membraneis is destroyed, and renal tubular epithelial cells can

-p

be damaged [5,6].

It has been confirmed that oxidative stress plays important roles in RI/R injury [7].

re

During reperfusion, the accumulation of reactive oxygen species (ROS) can induce the

lP

damage of lipids, DNA and proteins [8,9]. In addition, the activities of superoxide dismutase (SOD) and catalase (CAT) are decreased, and their inhibition effects on ROS

na

production are weakened [10–12]. Some evidences have shown that antioxidant therapies can effectively ameliorate RI/R injury [13–15]. Thus, exploration of active drug

ur

targets on suppressing oxidative stress should be one potent method for the treatment of RI/R injury.

Jo

MicroRNAs (miRNAs) show potent effects on regulating mRNA expression [16]. In

RI/R injury, miR-494 can enhance inflammation and apoptosis by targeting activating transcription factor 3 (ATF3) [17]. Overexpression of miR-126 can increase the numbers of hematopoietic stem cells and progenitor cells to promote the recovery of capillary network near renal tubules [18]. In the early stages, miR-21 can inhibit cell apoptosis by targeting programmed cell death 4 (PDCD4) [19]. MiR-21 can inhibit peroxisome

proliferator-activated receptor-α (PPAR-α) and exacerbate renal fibrosis [20]. MiR-27a3p can mediate the development and progression of carcinomas [21–24], which can also decrease hippocampal neuron apoptosis and oxidative damage via targeting peroxisome proliferator-activated receptor-γ (PPAR-γ) [25]. However, the actions of miR-27a-3p on RI/R injury have not been reported. Growth factor receptor-bound protein 2 (Grb2), an adaptor protein, contains one Src homology 2 (SH2) domain and two Src homology 3 (SH3) domains [26]. As one

ro of

important molecule in oxidative stress, suppressing the expression of Grb2 can improve hepatic steatosis and oxidative damage [27]. Grb2 is also involved in activating PI3K/ Akt pathway [28,29], which can prevent oxidative damage via regulating Nrf2/HO-1

re

miR-27a-3p and Grb2 have not been reported.

-p

pathway [30]. However, the effects of Grb2 on RI/R injury, and the relationship between

The aim of the present paper was to investigate the effects of miR-27a-3p on RI/R

lP

injury by adjusting oxidative stress via targeting Grb2.

na

2. Materials and methods 2.1 Chemicals and reagents

(MTT)

was

ur

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-2-H-tetrazoliumbromide

purchased from Roche Diagnostics (Basel, Switzerland). Creatinine (Cr), Blood urea

Jo

nitrogen (BUN), malondialdehyde (MDA) and total superoxide dismutase (T-SOD) detection kits were purchased from Nanjing Jiancheng Institute of Biotechnology (Nanjing, China). Reactive Oxygen Species Assay Kit was provided by Beyotime (Shanghai, China). Protein Extraction Kit, the bicinchoninic acid (BCA) protein assay kit, phenylmethanesulfonyl fluoride (PMSF), Dual-Luiferase Reporter assay kit, RNAiso Plus kit, TransScript All-in-one First-Strand cDNA Synthesis SuperMix for qPCR kit and

TansStart Top Green qPCRSuperMix kit was purchased from TansGen Biotech (Beijing, China). High-sig ECL Western Blotting Substrated was provided by Tanon (Shanghai, China). 4′,6′-Diamidino-2-phenylindole (DAPI) and SDS-PAGE Gel Kit was purchased from Solarbio (Beijing, China). The sequences of miR-27a-3p and Grb2, Lipofectamin 2000 were obtained from InvitrogenTM (Shanghai, China). SanPrep Column microRNA Extraction Kit, miRNA First Strand StrandcDNA Synthesis (Tailing Reaction) and microRNA

ro of

qPCR kit (SYBR Green Method) were purchased from Sangon Biotech (Shanghai, China).The wild-type miR-27a-3p-Grb2 (WT Grb2) and mutant miR-27a-3p- Grb2 (Mut Grb2) plasmids were designed and purchased from RioBio (Guangzhou, China). miR-27a-

-p

3p mimic, miR-27a-3p mimic NC, miR-27a-3p inhibitor, miR-27a-3p inhibitor NC, miR27a-3p agomir, miR-27a-3p agomir NC, miR-27a-3p antagomir, miR- 27a-3p antagomir

re

NC, Grb2 siRNA and Grb2 siRNA NC were purchased from RioBio (Guangzhou, China). The Grb2 overexpression plasmids were obtained from Gene CopoeiaTM (Rockville, USA).

2.2 Cell culture

na

(Shanghai, China).

lP

The Fluorescence in Situ Hybridization (FISH) kit was purchased from GenePharma

HK-2 and NRK-52E cells were obtained from Shanghai Institutes for Biological

ur

Sciences (Shanghai, China) and cultured at 37°C in a 5%CO2 and 95%O2 environment. The

Jo

culture solution including DMEM solution, 10% fetal bovine serum, 100 IU/mL of penicillin and 100 mg/mL of streptomycin was used 2.3 Hypoxia/reoxygenation (H/R) models on cells HK-2 and NRK-52E cells were divided into control groups and H/R groups. The medium in control groups were replaced by DMEM and incubated in a humidified atmosphere of 5%CO2 and 95%O2 at 37°C. The medium in H/R groups were replaced by

PBS buffer and incubated in 1%O2, 94%N2 and 5%CO2 at 37°C for 4 h to simulate hypoxia condition. Then, the reoxygenation tests under 3, 6, 12 and 24 h were established with replacement of medium by DMEM and incubated in a humidified atmosphere of 5%CO2 and 95%O2 at 37°C. 2.4 Cell viability assay HK-2 and NRK-52E cells were plated in 96-well plates at a density of 1 × 105 cells /mL. Then, H/R models in control groups and H/R groups were established. After that,

ro of

MTT solution was added into each well for 4 h and then replaced by 150 μL of DMSO solution. A microplate reader (HITACHI, Japan) was used to measure the absorbance. 2.5 Cellular reactive oxygen species assay

-p

HK-2 and NRK-52E cells were plated in 6-well plates at a density of 1 × 105 cells /mL.

re

After incubation for 24 h, the H/R models in control groups and H/R groups were established. After that, 1 mL of diluted DCFH-DA solution at 1: 1000 was added into per

lP

well and then incubated at 37°C in a 5%CO2 and 95%O2 environment for 20 min. The residual DCFH-DA solution was removed and the wells were washed by serum-free

na

DMEM. Then, the cells were directly observed and imaged by a fluorescent microscope (Olympus, Tokyo, Japan) at 200× magnification.

ur

2.6 Animals

Jo

Forty male C57BL/6J mice (18 ± 2 g) were purchased from Liaoning Changsheng Biotechnology Co., Ltd (Benxi, Liaoning, China) (SCXK (Liao): 2015-0001). The animals were feed at standardized temperature at 23 ± 2ºC, relative humidity at 60 ± 10%, and 12 h light/dark. Free food and water were provided. After acclimating for one week, the animals were randomly divided into five groups (n = 8): control group and RI/R groups (45 min ischemia followed by 6, 12, 24 and 48 h reperfusion ). The study was authorized

by the Animal Care and Ethics Committee of Dalian Medical University and the processes complied with the China National Institutes of Healthy Guidelines for the Care and Use of Laboratory Animals. 2.7 RI/R model in mice After preoperative fasting and water deprivation for 24 h, the animals in RI/R groups were anesthetized by 4% isoflurane inhalation and remained narcosis by 2% isoflurane inhalation. Animals were fixed in prone position to isolate double renal pedicle and the

ro of

renal pedicles were blocked rapidly with small-sized bulldog clamps for 45 min to simulate ischemia, followed by reperfusion for 6, 12, 24 and 48 h. After the process, the kidney tissues and serum samples were collected and stored at -80ºC.

-p

2.8 Histopathological evaluation

re

The kidney tissues of mice were routinely fixed with 10% formalin, embedded in paraffin and cut into slices. Then, the kidney tissues were stained with Hematoxylin &

lP

Eosin (H&E). A light microscopy (Nikon Eclipse TE2000-U, Nikon, Japan) was used to observe and image the H&E slices.

na

2.9 Assay of Cr, BUN, MDA and SOD levels

The serum levels of Cr and BUN in mice were measured according to the kit

ur

instructions. The kidney tissues were made into 10% tissue homogenate and the

Jo

supernatant was collected to detect the levels of MDA and SOD according to the kit instructions.

2.10 Detection of miR-27a-3p level The column miRNA Extraction kit was used to extract the miRNA from cells and kidney tissues of mice. The purities of miRNA samples were measured by micro nucleic acid protein detector (BIODROP, Cambridge, US). miRNA First Strand cDNA Synthesis kit

was used for the reverse transcription, and cDNA samples were obtained and diluted 50 times for next quantitative assay. According to microRNA qPCR (SYBR Green Method) kit instructions, CFX96 TouchTM Real-Time PCR Detection System (BIO-RAD, California, USA) was used. The mmu-miR-27a-3p, rno-miR-27a-3p and has-miR-27a-3p primer sequence is TTCACAGTGGCTAAGTTCCGC, and U6 was used for normalization. 2.11 Fluorescence in situ hybridization (FISH) assay HK-2 and NRK-52E cells were added into 48 well plates at a density of 1 × 105 cells/

ro of

mL, and H/R models were established. Then, the cells were fixed with absolute ethyl alcohol, and 0.1% triton-100 solution was added into per well. After that, 2 × SSC solution was added into per well and then 70%, 85% and 100% ethanol solution was plated. Next,

-p

1 μg/μL of miR-27a-3p probe diluted by diethypyrocarbonate (DEPC) water was added

re

into wells at 37ºC for 24 h. Finally, the nucleus was stained with DAPI (5 μg/mL) for 20

at 400× magnification.

lP

min. The cells were observed and imaged by fluorescent microscope (Olympus, Japan)

The kidney tissue sections were also treated by FISH kit. After gradient elution by

na

100%, 95%, 90% and 80% ethanol solutions, the sections were treated by proteinase K and the degeneration was carried out. Next, miR-27a-3p probe solution was used for

ur

hybridization. Finally, 5 μg/mL of DAPI solution was dropped into the sections for nucleus

Jo

staining. A fluorescent microscope (Olympus, Japan) was used to observe and image the sections at 400× magnification. 2.12 Western blotting assay The protein samples from kidney tissues and cells were extracted by IP buffer and the concentrations were kept consistent by BCA kit. Then, 8-12% SDS-polyacrylamide gel was made according to the protein molecular weights and the samples were injected

and separated by electrophoresis. After electrophoresis, the protein samples were transferred to PVDF membranes and blocked with 3% BSA for 1 h at 37ºC. The members were then covered with primary antibodies overnight at 4ºC. On the next day, the members were incubated with HRP conjugated anti-rabbit antibodies at 1: 2000 for 1 h and observed by Bio-Spectrum Gel Imaging Systerm (UVP, CA, USA) with High-sig ECL Western Blotting Enhancer Solution. The primary antibodies are listed in Supplementary Table 1, and the expression levels of the proteins were normalized to β-actin.

ro of

2.13 Real-time PCR assay

Total mRNA samples from NRK-52E cells were obtained. Micro nucleic acid protein detector (BIODROP, Cambridge, US) was used to detect the purity of the samples. After

-p

reverse transcription, according to TransSart Top Green qPCRSuperMix kit instructions,

re

CFX96 TouchTM Real-Time PCR Detection System (BIO-RAD, California, USA) was used for the detection. The mRNA levels of Grb2 was assayed based on the forward (F) primer (ATTCCTCCGGGACATAGAACAG)

lP

sequence

and

reverse

(R)

primer

sequence

(CCTTTCCACCAATTGGGATCT). β-actin was used for normalization with the forward (F)

na

primer sequence (CCTGTGGCATCCATGAAACTAC) and reverse (R) primer sequence (CCAGGGCAGTAATCTCCTTCTG).

ur

2.14 Grb2 expression level after transfection with miR-27a-3p mimics

Jo

NRK-52E cells were added into 6 well plates at a density of 1 × 105 cells/mL. After incubation for 24 h, different concentrations of miR-27a-3p mimics (12.5, 25, 50 and 100 nM) were tranfected into the cells. Then, the expression levels of Grb2 were measured by real-time PCR and Western blotting assays. 2.15 Co-transfection of miR-27a-3p mimic and Grb2 overexpression plasmids

NRK-52E cells were added into 6 well plates at the concentration of 1 × 105 cells/ mL. Lipofectamine2000 was used for the co-transfection of Grb2 overexpression plasmid and miR-27a-3p mimics (50 nM) or miR-27a-3p mimic negative control (50 nM). DMEM was used to replace the medium after transfection for 4 h, and the cells were then incubated for another 24 h at 37ºC. Finally, the cells were collected, and the mRNA and protein levels of Grb2 were measured. 2.16 Dual-luciferase gene reporter assay

ro of

The wild-type miR-27a-3p-Grb2 (WT Grb2) and mutant miR-27a-3p-Grb2 (Mut Grb2) plasmids were designed. Lipofectamine2000 was used for the co-transfection of WT Grb2 or Mut Grb2 and miR-27a-3p mimics or miR-27a-3p mimic negative control in NRK-

-p

52E cells for 4 h. After incubation for 24 h at 37ºC, the cells were treated based on the

re

Dual-Luciferase Reporter Assay Kit. Finally, fluorescence microplate reader (Berthold, Gentro, Germany) was used to measure the activities of luciferase reporter gene.

lP

2.17 MiR-27a-3p mimic transfection in vitro

NRK-52E and HK-2 cells were added into 6 well plates at a density of 1 × 105 cells /mL.

na

Lipofectamine2000 was used for the co-transfection of miR-27a-3p mimics (50 nM) or miR-27a-3p mimic negative control (50 nM). DMEM was used to replace the medium

ur

after transfection for 4 h, and then the cells were incubated for another 24 h at 37ºC.

Jo

Next, H/R process was carried out in model group and H/R + miR-27a-3p mimic group. Then, the levels of ROS were detected. In addition, the expression levels of miR-27a-3p were measured by real-time PCR and FISH assays. The expression levels of Grb2, p-PI3K, PI3K, p-AKT, AKT, Nrf2, Keap1 and HO-1 were also detected. 2.18 MiR-27a-3p inhibitor transfection in vitro NRK-52E and HK-2 cells were seeded into 6 wells at a density of of 1× 105 cells /mL.

Lipofectamine2000 was used for the co-transfection of miR-27a-3p inhibitors (100 nM) or miR-27a-3p inhibitors negative control (100 nM). DMEM was used to replace the medium after transfection for 4 h, and then the cells were incubated for another 24 h at 37ºC. Next, H/R process was carried out in model group and H/R + miR-27a-3p inhibitor group. Then, cellular ROS levels were detected. In addition, the expression levels of miR27a-3p were measured by real-time PCR and FISH assays. The expression levels of Grb2, p-PI3K, PI3K, p-AKT, AKT, Nrf2, Keap1 and HO-1 were also detected.

ro of

2.19 MiR-27a-3p agomir transfection in vivo

Male C57BL/6 mice (20 ± 2 g) were randomly divided into four groups (n = 5): Control group, RI/R group, miR-27a-3p agomir NC group and miR-27a-3p agomir + RI/R group.

-p

Total of 10 nmoL of miR-27a-3p agomir NC and 10 nmoL of miR-27a-3p agomir were

re

injected via tail veins into the mice in NC group and agomir + RI/R group for 3 consecutive days. The same dosages of saline were injected into the mice in Control group and RI/R

lP

group. On day 4, RI/R on mice was established in model group and agomir + RI/R group. After sacrifice, the pathological changes of kidney tissues were observed by H&E staining.

na

The levels of Cr and BUN in serum, and the levels of MDA and SOD in kidney tissues were measured. In addition, the expression level of miR- 27a-3p was detected by real-time

ur

PCR and FISH assays. The expression levels of Grb2, p-PI3K, PI3K, P-AKT, AKT, Nrf2, Keap1

Jo

and HO-1 were measured. 2.20 MiR-27a-3p antagomir transfection in vivo Male C57BL/6 mice (20 ± 2 g) were randomly divided into four groups (n = 5): Control

group, RI/R group, miR-27a-3p antagomir NC group and miR-27a-3p antagomir + RI/R group. Total of 50 nmoL of miR-27a-3p negative control and 50 nmoL of miR-27a-3p antagomir were injected via tail veins into the mice in NC group and antagomir + RI/R

group for 3 consecutive days. The same dosages of saline were injected into the mice in Control group and RI/R group. On day 4, RI/R on mice were established in model group and miR-27a-3p antagomir + RI/R group. After sacrifice, the pathological changes of the animals were observed by H&E staining. The levels of Cr and BUN in serum, and levels of MDA and SOD in kidney tissues were measured. In addition, the expression level of miR27a-3p was detected by real-time PCR and FISH assays. The expression levels of Grb2, pPI3K, PI3K, P-AKT, AKT, Nrf2, Keap1 and HO-1 were measured.

ro of

2.21 Grb2 siRNA transfection in vivo

Male C57BL/6 mice (20 ± 2 g) were randomly divided into four groups (n = 5): Control group, RI/R group, Grb2 siRNA NC group and Grb2 siRNA + RI/R group. Total of 20 nmoL

-p

of Grb2 siRNA negative control and 20 nmoL of Grbd2 siRNA were injected via tail veins

re

into the mice in NC group and Grb2 siRNA + RI/R group for 3 consecutive days. The same dosages of saline were injected into mice in Control group and RI/R group. On day 4, RI/R

lP

process was carried out in model group and Grb2 siRNA + RI/R group. After sacrifice, the levels of Cr, BUN in serum, and SOD, MDA levels in kidney tissues in mice were measured.

na

The pathological changes of kidney tissues were observed and the expression levels of Grb2, Nrf2, Keap1 and HO-1 were also detected.

ur

2.22 Statistical analysis

Jo

GraphaPad Prism 5.0 software was used for analyzing, and the experimental data were expressed as the mean ± standard deviation (SD). The comparisons between two groups were performed via unpaired Student’s t-test. The differences among groups were detected through using One-way ANOVA. The results were statistically significant at p < 0.05 and p < 0.01.

3. Results

3.1 H/R induces cell damage and aggravates oxidative damage in vitro As showed in Fig. 1A, H/R process inhibited the viabilities of HK-2 and NRK-52E cells. After hypoxia for 4 h and reoxygenation for 6 h, the viabilities of HK-2 and NRK-52E cells were decreased to 66.99% and 60.22%. As shown in Fig. 1B, the cellular ROS levels in NRK-52E and HK-2 cells were increased after reoxygenation from 3 h to 24 h, and the highest levels were produced under 6 h of reoxygenation. 3.2 RI/R induces kidney damage and aggravates oxidative damage in vivo

ro of

H&E staining in Fig. 1C showed that RI/R induced renal tubular necrosis, glomerulin swollen and interstitial edema under 24 h of reperfusion. As shown in Fig. 1D, compared with Control group, the serum levels of Cr and BUN in mice were increased under 6, 12

-p

and 24 h of reperfusion. As shown in Fig. 1E, compared with Control group, the level of

re

MDA was increased, and SOD level was decreased after reperfusion from 6 h to 24 h. MDA level was increased to peak level at 2.79 ± 0.80 nmoL/mgprot, and SOD level was

lP

decreased to peak level at 169.49 ± 45.28 U/mg under reperfusion for 24 h. 3.3 Grb2 is the target gene of miR-27a-3p

na

As shown in Fig. 2A-B, the results showed that the expression levels of Grb2 were decreased after transfection with miR-27a-3p mimic from 25 nM to 100 nM, which was

ur

reached to the lowest level after transfection with 50 nM of miR-27a-3p. As shown in Fig.

Jo

2C, compared with Grb2 overexpression plasmids group, Grb2 mRNA and protein levels were significantly down-regulated after co-transfection with Grb2 over- expression plasmids and miR-27a-3p mimic (50 nM). As shown in Fig. 2D, in WT Grb2 transfection group, the luciferase activity was inhibited by miR-27a-3p compared with miR-27a-3p mimic NC group. In Mut Grb2 transfection group, the inhibiting action of miR-27a-3p was

not observed. Above all, these data suggested that Grb2 is the target gene of miR-27a3p. 3.4 H/R and RI/R increase miR-27a-3p expression levels in vitro and in vivo As shown in Fig. 3A, the expression levels of miR-27a-3p in NRK-52E and HK-2 cells were increased after reoxygenation from 6 h to 12 h compared with control groups, and the highest levels were produced under 6 h of reoxygenation. The expression level of miR-27a-3p in mice was increased to the highest level after reperfusion for 24 h. As

ro of

shown in Fig. 3B, compared with control groups, FISH assay showed that the fluorescence intensities of miR-27a-3p were significantly increased after reoxygenation for 6 h in vitro and reperfusion for 24 h in vivo, suggesting that the expression levels of

-p

miR-27a-3p wwer reached to the highest level under 6 h of reoxygenation in vitro and

re

24 h of reperfusion in vivo.

3.5 H/R and RI/R adjust Grb2 signal in vitro and in vivo

lP

As shown in Fig. 3C, compared with control groups, the protein levels of Grb2 were decreased in model groups with the lowest levels at 6 h of reoxygenation in vitro and 24

na

h of reperfusion in vivo. In addition, compared with control groups, the protein levels of p-PI3K, p-AKT, Nrf2 and HO-1 were decreased, and Keap1 expression levels were

ur

increased in model groups (Fig. 4).

Jo

3.6 MiR-27a-3p mimics accelerates oxidative damage caused by H/R in vitro As shown in Fig. 5A, the ROS levels in NRK-52E and HK-2 cells were increased in H/R

groups compared with control groups. MiR-27a-3p mimics transfection aggravated cellular ROS production caused by H/R injury. 3.7 MiR-27a-3p mimics inhibits Grb2 signal caused by H/R in vitro

As shown in Fig. 5B, compared with H/R groups, the expression levels of miR-27a3p were significantly up-regulated by miR-27a-3p mimics. FISH assay showed that miR27a-3p mimics further increased miR-27a-3p expression levels compared with H/R groups (Fig. 5C). As shown in Fig. 5D, the protein levels of Grb2, p-PI3K, p-AKT, Nrf2 and HO-1 were decreased, and Keap1 expression levels were increased after transfection with miR-27a-3p mimics compared with H/R groups. 3.8 MiR-27a-3p inhibitor reduces oxidative damage caused by H/R in vitro

ro of

As shown in Fig. 6A, the ROS levels of NRK-52E and HK-2 cells were increased in H/R groups compared with control groups. MiR-27a-3p inhibitor transfection reduced ROS production in cells caused by H/R.

-p

3.9 MiR-27a-3p inhibitor activates Grb2 signal caused by H/R in vitro

re

As shown in Fig. 6B, the increased expression levels of miR-27a-3p caused by H/R were markedly weakened by miR-27a-3p inhibitor. Compared with H/R groups, the

lP

fluorescent intensities of miR-27a-3p based on FISH assay were decreased by miR-27a 3p inhibitor (Fig. 6C). Moreover, the protein levels of Grb2, p-PI3K, p-AKT, Nrf2 and HO-

na

1 were increased and Keap1 expression levels were decreased after transfection with miR-27a-3p inhibitor compared with H/R groups (Fig. 6D).

ur

3.10 MiR-27a-3p agomir accelerates oxidative damage caused by RI/R in vivo

Jo

As shown in Fig. 7A, the serum Cr and BUN levels were increased to 1.25 and 1.24 times compared with RI/R group. As shown in Fig. 7B, MDA level was significantly upregulated to 1.43 times, and SOD level was slightly down-regulated compared with RI/R group. 3.11 MiR-27a-3p agomir inhibits Grb2 signal caused by RI/R in vivo

As shown in Fig. 7C, the expression level of miR-27a-3p was increased in RI/R+ agomir group compared with RI/R group. As shown in Fig. 7D, compared with RI/R group, the protein levels of Grb2, p-PI3K, p-AKT, Nrf2 and HO-1 were decreased and Keap1 expression level was increased after miR-27a-3p agomir transfection. 3.12 MiR-27a-3p antagomir reduces oxidative damage caused by RI/R in vivo As shown in Fig. 7E, the serum Cr and BUN levels were decreased to 72.46% and 76.33% after transfection with miR-27a-3p antagomir compared with RI/R group. As

ro of

shown in Fig. 7F, MDA level was decreased, and SOD level was slightly increased by miR27a-3p antagomir compared with RI/R group.

3.13 MiR-27a-3p antagomir activates Grb2 signal caused by RI/R in vivo

-p

As shown in Fig. 7G, compared with RI/R group, miR-27a-3p antagomir markedly

re

decreased the expression level of miR-27a-3p. As shown in Fig. 7H, compared with RI/R group, the protein levels of Grb2, p-PI3K, p-AKT, Nrf2 and HO-1 were increased, and

lP

Keap1 expression level was decreased after miR-27a-3p antagomir transfection. 3.14 Grb2 siRNA accelerates oxidative damage caused by RI/R in vivo

na

After transfection with Grb2 siRNA, the serum levels of Cr and BUN were also decreased by Grb2 siRNA compared with RI/R group (Fig. 7I). As shown in Fig. 7J,

ur

compared with RI/R group, MDA level was up-regulated, and SOD level was down-

Jo

regulated in Grb2 siRNA + RI/R group. 3.15 Grb2 siRNA inhibits Grb2 signal caused by RI/R in vivo The protein levels of Grb2, Nrf2 and HO-1 were down-regulated, and Keap1

expression level was up-regulated by Grb2 siRNA compared with RI/R group based on western blotting assay (Fig. 7K).

4. Discussion

As one common acute severe disease, AKI has become one important public health problem. Investigating the pathogenesis and new drug targets to treat AKI is critical important. The accumulation of metabolic waste is one main pathogenic factor of AKI, which can cause acute renal failure [31]. During RI/R injury, potentially decreasing of mitochondrial swelling and mitochondrial membrane can cause over accumulation of ROS [32]. The excess production of ROS can accelerate the proliferation of interstitial cells, cause renal insufficiency and decrease repair capability [33]. Furthermore, some

ro of

experiments have found that the activities of some antioxidant enzymes including SOD, CAT and GPX are significantly reduced during RI/R injury. Thus, protection of kidney tissue via suppressing oxidative stress is an effective method to treat RI/R injury.

-p

In the present work, NRK-52E and HK-2 cells were used to establish H/R models, and

re

C57BL/6 mice were used to establish RI/R model. The results showed that cell structures were damaged, the numbers of cells were reduced and cellular ROS levels

lP

were decreased. Renal glomerulus and tubules were destroyed in mice. The levels of Cr, BUN and MDA were significantly increased, and SOD level was decreased. These data

na

indicated that H/R in cells and RI/R in mice caused oxidative damage. Suppression of oxidative stress should be one effective method to treat RI/R-induced kidney damage.

ur

In recent years, the regulation and clinical application of miRNAs have been caused

Jo

extensive attentions, and some reports have suggested that miRNAs can be considered as the predictive biomarkers and therapeutic targets [34,35]. Some miRNAs have been confirmed to be associated with ischemia/reperfusion injury [36–39], and exploring the regulating effects may contribute to improve the diagnosis and treatment of RI/R injury. In the present work, we found that Grb2 is one of the targeted genes of miR-27a-3p. In addition, after transfection with different concentrations of miR-27a-3p mimics, the

expression levels of Grb2 were decreased. The results of co-transfection experiments also showed that miR-27a-3p overexpression suppressed the expression levels of Grb2. Double-luciferase gene reporter assay showed the binding sites between miR-27a-3p and Grb2, suggesting that Grb2 is the target gene of miR-27a-3p. During H/R damage in cells and RI/R injury in mice, we found that miR-27a-3p expression levels were increased and Grb2 expression levels were decreased. As an adaptor protein, Grb2 can be regulated by miRNAs, which can activate Rat sarcoma (Ras)

ro of

and cause PI3K phosphorylation [40, 41]. PI3K phosphorylation can cause AKT phosphorylation to regulate Nrf2/HO-1 signal [42]. In cardiac and cerebral ischemiareperfusion injury, PI3K/AKT/Nrf2 signal has been confirmed to regulate oxidative stress

-p

[43,44]. It has reported that PI3K/AKT can adjust Nrf2 activation, and inhibition of

re

PI3K/AKT pathway can decrease the transcription activity of Nrf2 [45]. Nrf2, a transcription factor, plays important roles in adjustment of cellular redox balance, which

lP

is also a key regulator of HO-1 against oxidative stress [46,47]. Moreover, Kelch-like ECH associating protein 1 (Keap1), an action binding protein, can inactivate Nrf2 under

na

oxidative stress state [48,49]. Nevertheless, the actions of Grb2 on regulating oxidative stress via PI3K/AKT/Nrf2/HO-1 signaling during RI/R injury remain known. In the present

ur

work, we found that the expression levels of p-PI3K, p-AKT, Nrf2 and HO-1 were

Jo

decreased, and Keap1 expression levels were increased. These results indicated that miR-27a-3p can regulate RI/R injury by targeting Grb2 signal. In order to further confirm the regulating effects of miR-27a-3p in RI/R injury, miR-

27a-3p mimics and inhibitor transfection tests were carried out in NRK-52E and HK-2 cells. MiR-27a-3p agomir and antaogimr transfection tests were also used in mice. We found that miR-27a-3p mimics further increased H/R-caused cellular ROS levels, and miR-

27a-3p inhibitor decreased ROS levels. Up-regulation of miR-27a-3p decreased Grb2 expression level, further reduced the expression levels of p-PI3K, p-AKT, Nrf2 and HO-1, and increased Keap1 expression levels. Down-regulation of miR-27a-3p increased Grb2 expression, increased p-PI3K/AKT signal and decreased Keap1 expression levels. We also found that miR-27a-3p overexpression aggravated RI/R-induced pathological damage, increased Cr, BUN and MDA levels, and increased SOD level. MiR-27a-3p inhibition relieved RI/R-induced pathological damage, decreased Cr, BUN and MDA levels, and

ro of

increased SOD level. Thus, up-regulation of miR-27a-3p expression decreased Grb2 signal, and down-regulation of miR-27a-3p expression increased Grb2 signal. These results showed that miR-27a-3p aggravated RI/R injury by promoting oxidative stress via

-p

targeting Grb2.

re

In addition, Grb2 siRNA was transfected to verify the regulating effect of Grb2 in RI/R injury. We found that Grb2 siRNA aggravated RI/R-induced pathological damage,

lP

increased Cr, BUN, MDA levels, and increased SOD level. Inhibiting Grb2 expression further reduced Nrf2 and HO-1 expression levels, and increased Keap1 expression. These

na

data provided evidences that Grb2 participated in regulating RI/R injury by adjusting oxidative stress.

ur

In conclusion, miR-27a-3p aggravated RI/R injury by promoting oxidative stress via

Jo

targeting Grb2 to adjust PI3K/AKT/Nrf2/HO-1 pathway (Supplementary Fig. 1), which should be considered as a potential biomarker for diagnostics in clinical application of RI/R injury.

Conflict of Interest In this paper, the authors asserted that they had no conflict of interest.

Acknowledgement

This work was supported by the Project of Leading Talents of Dalian (China), and LiaoNing Revitalization Talents Program (XLYC1802121).

References [1] Bellomo R, Kellum JA, Ronco C. Acute kidney injury. Lancet (2012) 380 (9843): 756– 766. [2] Kristovic D, Horvatic I, Husedzinovic I, et al. Cardiac surgery-associated acute kidney injury: risk factors analysis and comparison of prediction models. Interactive Cardiovasc Thorac Surg (2015) 21(3): 366–373.

ro of

[3] Jacobi J, Rebhan D, Heller K, et al. Donor acute kidney injury and short-term graft outcome in renal transplantation. Clin Transplant (2014) 28(10): 1131–1141.

[4] Powell TC, Powell SL, Allen BK, et al. Association of inflammatory and endothelial cell activation biomarkers with acute kidney injury after sepsis. Springer Plus (2014) 3(1):

-p

207.

[5] Rippe C, Rippe A, Larsson A, et al. Nature of glomerular capillary permeability changes

(2006) 291(6): F1362–F1268.

re

following acute renal ischemia-reperfusion injury in rats. Am J Physiol Renal Physiol

lP

[6] Lee SY, Shin JA, Kwon HM, et al. Renal ischemia–reperfusion injury causes intercalated cell-specific disruption of occluding in the collecting duct. Histochem Cell Biol (2011) 136(6): 637–647.

na

[7] Aragno M, Cutrin JC, Mastrocola R, et al. Oxidative stress and kidney dysfunction due to ischemia reperfusion in rat: Attenuation by dehydroepiandrosterone. Kidney Int

ur

(2003) 64(3): 836–843.

[8] Minutoli L, Puzzolo D, Rinaldi M, et al. ROS Mediated NLRP3 Inflammasome Activation

Jo

in Brain, Heart, Kidney, and Testis Ischemia Reperfusion Injury. Oxid Med Cell Longev (2016) 2016: 1–10.

[9] Rhee SG. Cell signaling. H2O2, a necessary evil for cell signaling. Science (2006) 312 (5782): 1882–1883.

[10] Cruthirds DL, Novak L, Akhi KM, et al. Mitochondrial targets of oxidative stress during renal ischemia/reperfusion. Arch Biochem Biophys (2003) 412(1): 27–33. [11] Yang CC, Hsu SP, Chen KH, et al. Effect of Adenoviral Catalase Gene Transfer on Renal Ischemia Reperfusion Injury in Rats. Chin J Physiol(2015) 58(6): 420–430.

[12] Ozden A, Aybek Z, Saydam N, et al. Cytoprotective Effect of Trimetazidine on 75 min Warm Renal Ischemia Reperfusion Injury in Rats. Eur Surgi Res (1998) 30(4): 227– 234. [13] Suyani E, Derici UB, Sahin T, et al. Effects of Everolimus on Cytokines, Oxidative Stress and Renal Histology in Ischemia-Reperfusion Injury of the Kidney. Ren Fail (2009) 31(8): 698–703. [14] Kinght SF, Kundu K, Joseph G, et al. Folate receptor-targeted antioxidant therapy ameliorates renal ischemia-reperfusion injury. J Am Soc Nephrol (2010) 23(5): 793 –800.

ro of

[15] Saqiroqlu T, Sezer A, Torun N, et al. Protective effect of everolimus on renal ischemia reperfusion injury in rats. Saudi J Kideny Dis Transpl (2014) 25(2): 294– 302.

[16] Stark A, Brennecke J, Russell RB, et al. Identification of Drosophila MicroRNA Targets. PLoS Biology (2003) 1(3): E60.

-p

[17] Lan YF, Chen HH, et al. MicroRNA-494 Reduces ATF3 Expression and Promotes AKI. J Am Soc Nephrol (2012) 23(12): 2012–2023.

re

[18] Bijkerk R, van Solingen C, de Boer HC, et al. Hematopoietic microRNA-126 protects against renal ischemia reperfusion injury by promoting vascular integrity. J Am Soc

lP

Nephrol (2014) 25(8): 1710–1722.

[19] Song N, Zhang T, Xu X, et al. MiR-21 Protects Against Ischemia Reperfusion- Induced Acute Kidney Injury by Preventing Epithelial Cell Apoptosis and Inhibiting Dendritic

na

Cell Maturation. Front Physiol (2018) 9: 790. [20] Xu X, Kriegel AJ, Jiao X, et al. MiR-21 in ischemia/reperfusion injury: a double-edged

ur

sword? Physiol Genomics (2014) 46(21): 789–797. [21] Zhao N, Sun H, Sun B, et al. MiR-27a-3p suppresses tumor metastasis and VM by

Jo

down-regulating VE-cadherin expression and inhibiting EMT: an essential role for Twist-1 in HCC. Sci Rep (2016) 6: 23091.

[22] Zhou L, Liang X, Zhang L, et al. MiR-27a-3p functions as an oncogene in gastric cancer by targeting BTG2. Oncotarget (2016) 7(32): 51943–51954.

[23] Wu XZ, Wang KP, Song HJ, et al. MiR-27a-3p promotes esophageal cancer cell proliferation via F-box and WD repeat domain-containing 7 (FBXW7) suppression. Int J Clin Exp Med (2015) 8(9): 15556–15562.

[24] Towers CG, Guarnieri AL, Micalizzi DS, et al. The Six1 oncoprotein down-regulates p53 via concnmitant regulation of RPL26 and microRNA-27a-3p. Nat Commun (2015) 6: 10077. [25] Lv X, Yan J, Jiang J, et al. MiRNA-27a-3p Suppression of PPAR-γ Contributes to Cognitive Impairments Resulting from Sevoflurane Treatment. J Neurochem (2017) 143(3): 306–319. [26] Buday L. Epidermal growth factor regulates p21ras through the formation of a complex of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor. Cell (1993) 73(3): 611–620.

ro of

[27] Shan X, Miao Y, Fan R, et al. Supperssion of Grb2 expression improved hepatic steatosis, oxidative stress, and apoptosis induced by palmiticc acid in vitro partly through insulin signaling alteration. In Vitro Cellular Dev Biol Anim (2013) 49(8): 576–582.

-p

[28] Saleem A, Kharbanda S, Yuan ZM, et al. Monocyte Colony-stimulating Factor Stimulates Binding of Phosphatidylinositol 3-Kinase to Grb2. Sos Complexes in

re

Human Monocytes. J Biol Chem (1995) 270(18): 10380–10383. [29] Wheeler M, Domin J. Recruitment of the Class II Phosphoinositide 3-Kinase C2beta

6660–6667.

lP

to the Epidermal Growth Factor Receptor: Role of Grb2. Mol Cell Biol (2001) 21 (19):

[30] Ali T, Kim T, Rehman SU, et al. Natural Dietary Supplementation of Anthocyanins via

na

PI3K/Akt/Nrf2/HO-1 Pathways Mitigate Oxidative Stress, Neurodegeneration, and Memory Impairment in a Mouse Model of Alzheimer’s Disease. Mol Neurobiol

ur

(2017) 55(7): 6076–6093.

[31] Fujii T, Uchino S, Takinami M, et al. Validation of the Kidney Disease Improving

Jo

Global Outcomes Criteria for AKI and Comparison of Three Criteria in Hospitalized Patients. Clin J Am Soc Nephrol (2014) 9(5): 848–854.

[32] Zhao K, Zhao GM, Wu D, et al. Cell-permeable peptide antioxidants targeted to inner mitochondrial membrane inhibit mitochondrial swelling oxidative cell death, and reperfusion injury. J Biol Chem (2004) 279(33): 34682–34690. [33] Kim J, Junq KJ, Park KM. Reactive oxygen species differently regulate renal tubular epithelial and interstitial cell proliferation after ischemia and reperfusion injury. Am J Physiol Renal Physiol (2010) 298(5): F1118- F1129.

[34] Iorio MV, Croce CM. MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeutics. A comprehensive review. EMBO Mol Med (2012) 4(3): 143–159. [35] Nikiforova MN, Tseng GC, Steward D, et al. MicroRNA expression profiling of thyroid tumors: biological significance and diagnostic utility. J Clin Endocrinol Metab (2008) 93(5): 1600–1608 [36] Ren XP, Wu J, Wang X, et al. MicroRNA-320 is involved in the regulation of cardiac ischemia/reperfusion injury by targeting heat-shock protein 20. Circulation (2009) 119(17): 2357–2366. [37] Tang XJ, Yang MH, Cao G, et al. Protective effect of microRNA-138 against cerebral

ro of

ischemia/reperfusion injury in rats. Exp Ther Med (2016) 11(3): 1045–1050.

[38] Yu CH, Xu CF, Li YM. Association of MicroRNA-233 expression with hepatic ischemia/reperfusion injury in mice. Dig Dis Sci (2009) 54(11): 2362–2366.

[39] Shapiro MD, Bagley J, Latz J, et al. MicroRNA expression data reveals a signature of

-p

kidney damage following ischemia reperfusion injury. PLoS One (2011) 6(8): e23011. [40] Zhao H, Okada S, Pessin JE, et al. Insulin receptor-mediated dissociation of Grb2 from

re

Sos involves phosphorylation of Sos by kinase(s) other than extracellular signalregulated kinase. J Biol Chem (1998) 273(20): 12061–12067.

lP

[41] Yoshikawa Y, Takano O, Kato I, et al. Ras inhibitors display an anti-metastatic effect by down-regulation of lysyl oxidase through inhibition of the Ras-PI3K-Akt- HIF-1α pathway. Cancer Lett 2017, 410: 82–91.

na

[42] Xu X, Li H, Hou X, et al. Punicalagin Induces Nrf2/HO-1 Expression via Up-reguation of PI3K/AKT Pathway and Inhibits LPS-Induced Oxidative Stress in RAW267,7

ur

Macrophages. Mediators Inflamm (2015) 2015: 380218. [43] Li L, Yang N, Nin L, et al. Chinese herbal medicine formula Tao Hong Si Wu decoction

Jo

protects against cerebral ischemia-reperfusion injury via PI3K/Akt and the Nrf2 signaling pathway. J Nat Med (2015) 69(1): 76-–85.

[44] Tong G, Zhang B, Zhou X, et al. Kappa-Opioid Agonist U50, 488H-Mediated Protection Against Heart Failure Following Myocardial Ischemia Reperfusion: Dual Roles of Heme Oxygenase-1. Cell Physiol Biochem (2016) 39(6): 2158–-2172. [45] Chartoumpekis D, Ziros PG, Psyrogiannis A, et al. Simvastatin lowers reactive oxygen species level by Nrf2 activation via PI3K/Akt pathway. Biochem Biophys Res Commun (2010) 396(2): 463–464.

[46] Aboonabi A, Singh I. Chenopreventive role of anthocyanins in atherosclerosis via activation of Nrf2-ARE as an indicator and modulator of redox. Biomed Pharmacother (2015) 72:30–36. [47] Koskela A, Reinisalo M, Hyttinen JM, et al. Pinosylvin-mediated protection against oxidative stress in human retinal pigment epithelial cells. Mol Vis (2014) 20: 760– 769. [48] Davies TG, Wixted WE, Coyle JE, et al. Monoacidic Inhibitors of the Kelch-like ECHAssociated Protein 1: Nuclear Factor Erythroid 2-Related Factor2 (KEAP1:NRF2)

Discover. J Med Chem (2016) 9(8): 3991–4006.

ro of

Protein-Protein Interaction with High Cell Potency Identified by Fragment-Based

[49] Abiko Y, Mizokawa M, Kumaqai Y. Activation of the Kelch-like ECH-associated protein 1 (Keap1)/NF-E2-related factor2 (Nrf2) pathway through covalent

Food Chem (2014) 62(45):10936–10944.

-p

modification of the 2-alkenal group of aliphatic electrophiles in Coriandrum. J Agric

re

Fig. 1. RI/R and H/R caused kidney damage in vitro and in vivo. (A) The viability of HK-2

lP

and NRK-52E cells after H/R injury. (B) The ROS levels in HK-2 and NRK-52E cells after H/R injury. (C) H&E staining images of kidney tissues after RI/R injury. As indicated by the

na

arrow, renal tubular necrosis, glomerulin swollen and interstitial edema were observed after RI/R injury. (D) The serum levels of Cr and BUN in mice after RI/R injury. (E) The levels of MDA and SOD in kidney tissues of mice after RI/R injury. Values are expressed

ur

as the mean ± SD (n = 5 for in vitro and n = 8 for in vivo), *p < 0.05 and **p < 0.01

Jo

compared with control groups. Fig. 2. MiR-27a-3p targets Grb2. (A) The mRNA levels of Grb2 after transfection with miR-27a-3p mimics at the concentrations of 12.5, 25, 50 and 100 nM. (B) The protein levels of Grb2 after transfection with miR-27a-3p mimics at the concentrations of 12.5, 25, 50 and 100 nM. (C) The mRNA and protein levels of Grb2 after transfection with Grb2 overexpression plasmids and miR-27a-3p mimic (50 nM). (D) The relative luciferased expression with Grb2 3′-UTR after co-transfection with miR-27a-3p mimic or NC in NRK-

52E cells. Values are expressed as the mean ± SD (n = 3). *p < 0.05 and **p < 0.01 compared with control groups. Fig. 3. H/R and RI/R up-regulated miR-27a-3p expression levels and down-regulated Grb2 expression levels in vitro and in vivo. (A) The mRNA levels of miR-27a-3p in vitro and in vivo based on Real-time PCR assay. (B) The expression levels of miR-27a-3p in vitro and in vivo based on FISH assay (400 × original magnification). (C) The protein levels of Grb2 in vitro and in vivo based on western blotting assay. Values are expressed as the mean SD (n = 3). *p < 0.05 compared with control groups. Fig. 4. H/R and RI/R adjusted Grb2 signal in vitro and in vivo. The protein levels of p-

ro of

PI3K, PI3K, p-AKT, AKT, Nrf2, Keap1 and HO-1 in vitro and in vivo based on Western blotting assay. Values are expressed as the mean SD (n = 3). *p < 0.05 compared with control groups.

Fig. 5. MiR-27a-3p mimics accelerated oxidative damage and inhibited Grb2 signal in

-p

vitro. (A) The cellular ROS levels in NRK-52E and HK-2 cells after H/R with miR-27a-3p mimics transfection. (B) The mRNA levels of miR-27a-3p in NRK-52E and HK-2 cells after

re

H/R with miR-27a-3p mimics transfection based on Real-time PCR assay. (C) The expression levels of miR-27a-3p in NRK-52E and HK-2 cells after H/R with miR-27a-3p

lP

mimics transfection based on FISH assay (400 × original magnification). (D) The protein levels of Grb2, p-PI3K, PI3K, p-AKT, AKT, Nrf2, Keap1 and HO-1 in NRK- 52E and HK-2 cells after H/R with miR-27a-3p mimics transfection based on Western blotting assay. Values

na

are expressed as the mean SD (n = 3). *p < 0.05 compared with control groups and #p < 0.05 compared with H/R groups.

ur

Fig. 6. MiR-27a-3p inhibitor reduced oxidative damage and activated Grb2 signal in vitro. (A) The cellular ROS levels in NRK-52E and HK-2 cells after H/R with miR-27a-3p

Jo

inhibitors transfection. (B) The mRNA levels of miR-27a-3p in NRK-52E and HK-2 cells after H/R with miR-27a-3p inhibitors transfection based on Real-time PCR assay. (C) The expression levels of miR-27a-3p in NRK-52E and HK-2 cells after H/R with miR-27a-3p inhibitors transfection based on FISH assay (400 × original magnification). (D) The protein levels of Grb2, p-PI3K, PI3K, p-AKT, AKT, Nrf2, Keap1 and HO-1 in NRK-52E and HK-2 cells after after H/R with miR-27a-3p inhibitors transfection based on Western blotting assay. Values are expressed as the mean SD (n = 3). *p < 0.05 compared with control groups and #p < 0.05 compared with H/R groups.

Fig. 7. Effects of miR-27a-3p agomir and antagomir, and Grb2 siRNA on oxidative damage and Grb2 signal in vivo. (A) The serum levels of Cr and BUN in mice after RI/R with agomir injection. (B) MDA and SOD levels in kidney tissues of mice after RI/R with agomir injection. (C) The expression levels of miR-27a-3p in kidney tissues of mice after RI/R with agomir injection based on Real-time PCR. (D) The expression levels of Grb2, pPI3K, PI3K, p-AKT, AKT, Nrf2, Keap1 and HO-1 in mice after RI/R with agomir injection based on Western blotting assay. (E) The serum levels of Cr and BUN in mice after RI/R with antagomir injection. (F) MDA and SOD levels in mice kidney tissues after RI/R with antagomir injection. (G) The expression levels of miR-27a- 3p in mice kidney tissues after

ro of

RI/R with antagomir injection based on Real-time PCR. (H) The expression levels of Grb2, p-PI3K, PI3K, p-AKT, AKT, Nrf2, Keap1 and HO-1 in mice after RI/R with antagomir injection based on Western blotting assay. (I) The serum levels of Cr and BUN in mice after RI/R with Grb2 siRNA injection. (J) MDA and SOD levels in mice kidney tissues after

-p

RI/R with Grb2 siRNA injection. (K) The expression levels of Grb2, Nrf2, Keap1 and HO-1 in mice after RI/R with Grb2 siRNA injection based on Western blotting assay. Values are

re

expressed as the mean SD (n = 3). *p < 0.05 compared with control groups and #p < 0.05

Jo

ur

na

lP

compared with RI/R group.

re

lP

rn a

Jo u

Fig. 1

-p

ro

of

ro of

-p

re

lP

na

ur

Jo Fig. 2

ro of

-p

re

lP

na

ur

Jo Fig. 3

ro of

-p

re

lP

na

ur

Jo Fig. 4

ro of

-p

re

lP

na

ur

Jo Fig. 5

ro of

-p

re

lP

na

ur

Jo Fig. 6

Fig. 7

re

lP

rn a

Jo u -p

ro

of