MicroRNA-574-5p in gastric cancer cells promotes angiogenesis by targeting protein tyrosine phosphatase non-receptor type 3 (PTPN3)

Gene 733 (2020) 144383

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

MicroRNA-574-5p in gastric cancer cells promotes angiogenesis by targeting protein tyrosine phosphatase non-receptor type 3 (PTPN3) Shu Zhang, Renwen Zhang, Rui Xu, Jiaqi Shang, Haitao He, Qing Yang

T

⁎

Department of Pathogenobiology, College of Basic Medical Sciences, Jilin University, 126 Xinmin Street, Changchun 130021, Jilin Province, China

A R T I C LE I N FO

A B S T R A C T

Keywords: miR-574-5p PTPN3 MAPK VEGF Angiogenesis Gastric cancer

We elucidate in this study that up-regulation of miR-574-5p in gastric cancer cells under hypoxic conditions contributed to angiogenesis. We found that miR-574-5p and HIF-1α were up-regulated in gastric cancer cells cultured under 2% O2 or in medium containing CoCl2, and in muscle tissues of mice injected with NaNO2, indicating up-regulation of miR-574-5p in vitro or in vivo in response to hypoxic conditions. We hypothesized that up-regulation of miR-574-5p could promote angiogenesis. Transfection of gastric cancer cells with miR-5745p mimics or inhibitor resulted in increase or decrease in the expression of VEGFA. Viability, migration, invasion and tube formation of HUVECs cultured with conditioned medium from SGC/574 cells transfected with miR574-5p inhibitor were reduced. Tube formation of HUVECs cultured with conditioned medium from SGC-7901 cells transfected with miR-574-5p mimics was increased. An in vivo study demonstrated that inhibition of miR574-5p in the tumor xenografts of mice reduced the expression of CD31 one of the endothelial cell markers. We identified PTPN3 a tyrosine phosphatase as a target of miR-574-5p that bound to the 3′UTR of PTPN3 mRNA to inhibit the expression of PTPN3. Furthermore, the data in this study demonstrated that inhibition of PTPN3 in gastric cancer cells enhanced phosphorylation of p44/42 MAPKs and promoted angiogenesis. We conclude that miR-574-5p in gastric cancer cells promoted angiogenesis via enhancing phosphorylation of p44/42 MAPKs by miR-574-5p inhibition of PTPN3 expression.

1. Introduction Compared with normal tissue, tumor has higher requirement for blood supply. Cancer cells are capable of promoting dormant blood vessels to sprout new blood vessels so called angiogenesis to maintain growth of tumors (Hanahan and Weinberg, 2011). Angiogenesis is a complex process involving multiple genes and plays a crucial role in the occurrence and development of tumors (De Sanctis et al., 2018; Hisano and Hla, 2019). One of the mechanisms in which tumor promotes angiogenesis is that cancer cells release various soluble factors in tumor microenvironment. These factors enable vascular endothelial cells to dissolve vascular matrix membrane, and the vascular endothelial cells form incomplete branches of vascular cavity and new basement

membrane (De Veirman et al., 2014; Zhang et al., 2018; Boudria et al., 2019). The soluble factors released from the cancer cells include endothelial growth factor (VEGF), fibroblast growth factor (FGF), plateletderived growth factor (PDGF), epidermal growth factor (EGF), and hepatocyte growth factor (HGF) (Brudno et al., 2013; Brandenburg et al., 2016; Zhou et al., 2018). Among them, VEGF is a major factor in promoting angiogenesis. VEGF is consist of five subtypes including VEGF-A, -B, -C, -D, and -E (Ferrara and Adamis, 2016). The expression of VEGF in the cells are predominantly regulated by the transcription factor hypoxia-inducible factor-1 (HIF-1). When the cells are under a hypoxic condition, the level of HIF-1α is raised and HIF-1 consisting of HIF-1α and HIF-1β is formed in the cytoplasm. HIF-1 is translocated into nucleus where it initiates transcription activities including up-

Abbreviations: 3′-UTR, 3′ untranslated region; CM, conditioned medium; ECL, enhanced chemiluminescence; FGF-2, fibroblast growth factor 2; FGFR1, fibroblast growth factor receptor 1; miR-574-5p, microRNA-574-5p; miRNAs, microRNAs; MAPK, mitogen-activated protein kinase; NC inhibitor, negative control inhibitor; NC mimic, negative control mimic; PDGFRβ, platelet derived growth factor receptor-beta; PDGF-BB, platelet-derived growth factor BB; PVDF, polyvinylidene difluoride; RIPA, radio-Immunoprecipitation Assay; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; PTPN3, tyrosine-protein phosphatase non-receptor type 3; VEGFA, vascular endothelial growth factor A ⁎ Corresponding author at: Department of Pathogenobiology, College of Basic Medical Sciences, Jilin University, 126 Xinmin Street, Changchun 130021, Jilin Province, China. E-mail addresses: [email protected] (S. Zhang), [email protected] (R. Zhang), [email protected] (R. Xu), [email protected] (J. Shang), [email protected] (H. He), [email protected] (Q. Yang). https://doi.org/10.1016/j.gene.2020.144383 Received 6 September 2019; Received in revised form 14 January 2020; Accepted 16 January 2020 Available online 20 January 2020 0378-1119/ © 2020 Elsevier B.V. All rights reserved.

Gene 733 (2020) 144383

S. Zhang, et al.

activation of 44/42 MAPKs could be induced by miR-574-5p inhibition of PTPN3, and the angiogenesis promoted by miR-574-5p in gastric cancer cells may through the activation of 44/42 MAPKs.

regulation of VEGF expression (Bruick and McKnight, 2001). Among the subtypes of VEGF family, VEGFA plays a leading role in angiogenesis. When VEGFA binds to vascular endothelial growth factor receptor 2 (VEGFR2) on the surface of vascular endothelial cells, VEGFR2 forms a dimer and gets activated by autophosphorylation that further activates downstream PI3K/AKT and MAPK signaling pathways leading to functional change of the endothelial cells and formation of blood vessels (Sini et al., 2008; MacDonald et al., 2016). Besides, FGF and PDGF also play a vital role in promoting angiogenesis (Beenken and Mohammadi, 2009; Hosaka et al., 2018). Mechanism of promoting angiogenesis by cancer cells remains obscure and a number of studies have shown that microRNAs (miRNAs) in cancer cells are involved in this process. MiRNA is a class of non-coding small-molecule approximately 22 nucleotides single-stranded RNA and highly conserved in evolution in eukaryotes. They are able to inhibit gene expression post-transcriptionally via binding to the 3′ untranslated region (3′-UTR) of their target mRNAs by specific base pairing to cause degradation of the target mRNAs or inhibition of their translation (Li et al., 2016; Ninova et al., 2016). It is reported that miR-25-3p in colorectal cancer plays a biological role in promoting vascular permeability and angiogenesis by regulating the expression of VEGFR2 and related tight junction proteins in endothelial cells by targeting transcription factors KLF2 and KLF4 (Zeng et al., 2018). In chondrosarcoma, knocking down of miR-16-5p expression promotes angiogenesis, growth and development of chondrosarcoma (Chen et al., 2019a). Alternatively, some hypoxia-inducible miRNAs are also engaged in the angiogenesis process. For instance, miR-382 is up-regulated under hypoxia, activates AKT/mTOR signaling pathway by directly inhibiting PTEN expression, and thereby increases the expression of VEGF (Seok et al., 2014). Studies have shown that miR-574-5p plays a non-negligible role not only in normal biological functions, but also in some abnormal conditions. Concerning tumors, the expression of miR-574-5p in serum samples and tumor tissues is higher in patients with metastatic nonsmall cell lung cancer (NSCLC) than that in non-metastatic patients, and miR-574-5p is able to promote migration and infiltration of the cancer cells by targeting PTPRU (Zhou et al., 2016). miR-574-5p is significantly up-regulated in colorectal cancer cells and promotes the proliferation and migration of the cells by inhibiting Qki6/7 to impact β-catenin/Wnt pathway (Ji et al., 2013). Additionally in nervous system, amyloid precursor protein (APP) significantly inhibits the expression of miR-574-5p in neural cells of developing mouse cerebral cortex, and the reduction of miR-574-5p promotes the proliferation of neural progenitor cells (Zhang et al., 2014). miR-574-5p is one of the transcripts encoded by miR-574, and another one is miR-574-3p. Our group has studied extensively the biological functions and molecular mechanisms of miR-574-3p (Zhang et al., 2017; Wang et al., 2019). We also found that miR-574-3p could promote angiogenesis by targeting cullin2 in gastric cancer cells (unpublished data). We hypothesize that miR-574-5p may also exert a function of promoting angiogenesis in cancer cells. In the present study, we report that miR-574-5p in gastric cancer cell SGC-7901 used a different pathway from miR-574-3p in promoting angiogenesis. We found that miR-574-5p in gastric cancer cells was upregulated under hypoxic conditions, and miR-574-5p and VEGFA in the cells were positively correlated in expression implicating promotion of angiogenesis by miR-574-5p. However, the promotion of angiogenesis by miR-574-5p had nothing to do with HIF-1α enhancement in the cells under hypoxic conditions. We further predicted and validated that tyrosine-protein phosphatase non-receptor type 3(PTPN3) to be a target of miR-574-5p. The promotion of angiogenesis by miR-574-5p is correlated with inhibition of PTPN3 as well as activation of 44/42 mitogen-activated protein kinases (MAPKs). Based on the data of the present study and published reports (Yang and Tonks, 1991, Richard et al., 1999; Mazure et al., 2003; Hou et al., 2010; Gao et al., 2014; Chen et al., 2015a; Malecic and Young, 2016), we conclude that

2. Materials and methods 2.1. Cell lines and culture Human gastric cancer cell lines AGS and SGC-7901, human embryonic kidney cell line HEK-293T, human cervical cancer cell line Hela, human colon adenocarcinoma cell line SW480, human breast cancer cell line MCF-7 and human umbilical vein endothelial cell lines HUVECs were purchased from the Cell Bank of Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). RPMI 1640 (Gibco, USA) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin were used for culturing all the cells that were maintained at an incubator of 37 °C, 5% CO2. 2.2. Western blot Cultured cells were collected and lysed using a RIPA buffer (Beyotime, China). The proteins from the lysate were electrophoresed in 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the proteins in the gel were transferred onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, USA). The PVDF membrane was blocked with skimmed milk, incubated with primary antibodies, and then secondary antibodies. After washed three times with TBST, the membrane was incubated briefly with an enhanced chemiluminescence (ECL) working solution (Proteintech, USA). A luminescence on the membrane was detected with Image Quant LAS 4000 digital imaging system (GE, USA). Antibodies used for Western blot included HIF-1α (GeneTex, 1:1000), ERK (abcam, 1:1000), p-ERK (wanlei, 1:1000), VEGFA (Proteintech, 1:1000), VEGFR2 (Proteintech, 1:1000), p-VEGFR2 (SAB, 1:1000), PDGFRβ (SAB, 1:1000), p-PDGFRβ (SAB, 1:1000), FGFR1 (SAB, 1:1000), p-FGFR1 (SAB, 1:1000), PTPN3 (SAB, 1:1000), and β-actin (Proteintech, 1:8000). 2.3. RNA extraction and quantitative real-time PCR (qRT-PCR) Total RNA of the cells or muscle tissue was isolated using Trizol (TaKaRa, China). A reverse transcription from an RNA template to cDNA was carried out using TransScript RT reagent Kit (TransGen, China). The purity or amount of the isolated RNA was determined according to the ultraviolet absorbance at 260 nm or the ratio of 260/ 280 nm measured with a BioSpectrometer (Eppendorf, Hamburg, Germany). qRT-PCR was performed with FastStart Universal SYBR Green Master (ROX) (Roche, USA), and GAPDH or U6 was used to normalize the level of mRNA or miRNA. Results of the qRT-PCR was analyzed using 2-ΔΔCT method. The primers for the qRT-PCR were as follows: GAPDH: 5′-TCCTGGTATGACAACGAAT-3′ and 5′-GGTCTCTC TCTTCCTCCTG-3′; U6: 5′-CGCTTCGGCAGCACATATACTA-3′ and 5′-CGCTTCACGAATTTGCGTGTCA-3′; VEGFA: 5′-CCTTGCCTTGCTGCT CTAC-3′ and 5′-CCAGGGTCTXGATTGAGT-3′; FGF-2: 5′-ACCCATACAG CAGCAGCCTA-3′ and 5′-CATCTGCCGCCTAAAGCCAT-3′; PDGF-BB: 5′-ACCTCTCGCACTTCTCCTTC-3′ and 5′-TGTGTGCGCGCAAAGTA TCT-3′; PTPN3: 5′-CCGTTTCCGTAGTGTAGGTCAT-3′ and 5′-ACCAAA AAGCGAAGTCCTCGG-3′. HIF-1α: 5′ TAGCCGAGGAAGAACTATGAAC ATAA3′ and 5′ TGAGGTTGGTTACTGTTGGTATCATATA 3′. 2.4. Construction of plasmids Construction of pEGFP(C1)-574: A genomic fragment in a human leukocyte genome containing 96-bp miR-574 precursor and 204-bp and 310-bp flanked region at 5′ and 3′ of the precursor was amplified by PCR with primers 5′ CCC aagctt (HindIII) CTGAGCGGTAAGAGC 3′ and 5′ CGC ggatcc (BamHⅠ) GTGTTGGCTGGACTG 3′. The fragment was 2

Gene 733 (2020) 144383

S. Zhang, et al.

seeded in 96-well plates at a density of 5000 cells/well and incubated with conditioned medium for 24 h. The viability of the cells was measured by absorbance at 490 nm with a multifunction microplate reader (BioTek, USA). For the assay of migration and invasion of the cells, a 24 wells of plate and transwell chambers (BD, USA) were used for culturing the cells. The diameter of a transwell chamber is 6.5 mm, and there are pores with size of 0.4 μm at bottom of a transwell chamber allowing the cells to pass through. The migration or invasion (chamber treated with a layer of matrigel) of the cells is evaluated by staining the cells that pass through the pores with crystal violet. In the present study, HUVEC cells were seeded in transwell chambers and cultured with the conditioned medium for 24 h at 37 °C, fixed with 4% paraformaldehyde and stained with 0.1% crystal violet for 15 min. The migration or invasion cells was photographed under an optical microscope, and the numbers of the cells were determined by an IPP software.

subcloned into T vector pMD19 from TAKARA (China). The vector was then cleaved with enzymes HindIII and BamHI to release the fragment. The latter was inserted into an expression vector pEGFP(C1) to generate a recombinant vector pEGFP(C1)-574. Construction of pcDNA3.0/mut HIF-1α: a vector containing a coding region of HIF-1α with mutation at 402 and 564 of double proline-to-alanine substitution was purchased from Addgene (https:// www.addgene.org/19005/). The vector was cleaved by enzymes BamHI and HindIII to release a fragment containing the coding region of the mutated form of HIF-1α. The fragment was then subcloned into an expression vector pcDNA3.0 to generate a recombinant vector pcDNA3.0/mut HIF-1α. All the recombinants were verified by sequencing. 2.5. Transient or stable transfection Transient transfection: miR-574-5p mimics/NC mimics, miR-574-5p inhibitor/NC inhibitor, siRNA against HIF-1α, siRNAs against PTPN3 and siRNA negative control were synthesized by Gene Pharma (Shanghai, China). The sequences are as follows: miR-574-5p mimics: 5′-UGAGUGUGUGUGUGUGAGUGUGU-3′ and 5′-ACACUCACACACAC ACACUCAUU-3′; miR-574-5p inhibitor: 5′-ACACACUCACACACACACA CUCA-3′; siHIF-1α: 5′-CUAUGAACAUAAAGUCUGCTT-3′ and 5′-GCAG ACUUUAUGUUCAUAGTT-3′; siPTPN3-225: 5′-GCGUGGUACAGACCU UUAATT-3′ and 5′-UUAAAGGUCUGUACCACGCTT-3′; siPTPN3-941: 5′-GCUGAAUCCAGGGAACAUATT-3′ and 5′-UAUGUUCCCUGGAUUCA GCTT-3′; siPTPN3-1182: 5′-CCUUAUCAGUGGAGCACUUTT-3′ and 5′-AAGUGCUCCACUGAUAAGGTT-3′. These oligonucleotides or siRNAs were transiently transfected into the cells with Lipofectamine 2000 (Invitrogen, USA) according to the company’s instructions. Stable transfection: SGC-7901 cells were transfected with pEGFP (C1)-574 or its control plasmid pEGFP(C1) by the Lipofectamine 2000. Stable transfectants were selected by G418 (400 μg/ml), and qRT-PCR was used to verify the expression of miR-574 in the selected transfectants. A successful transfectant or a control transfectant used in the present study is named SGC/574 or SGC/C1.

2.9. Tube formation assay 50 μL/well of Matrigel (BD, UAS) was added to a 96-well plate and incubated at 37 °C for 1 h. Each well was then added with 100 μL HUVECs (1 × 104 cells /mL) that was suspended in the conditioned medium (CM). After cultured for 6 h at 37 °C, the cells that formed tubes in the wells were photographed under an optical microscope, and the length of the tubes was calculated by an IPP software. 2.10. ELISA assay SGC-7901 cells were transfected with siRNAs of PTPN3 or siRNA of negative control (NC) and cultured at 37 °C for 24 h. The culture medium was separated from the cells by centrifuge at 12,000g. The levels of VEGFA in the medium were detected by an ELISA kit (RD, USA). 2.11. Mouse models Mice xenograft tumor model: SGC/574 cells were transfected with miR-574-5p inhibitor or NC inhibitor. The transfectans containing 1.5 × 106 cells were mixed with 100 μL of the BD Matrigel, and 4week-old male BALB/c-nc mice were subcutaneously injected with the mixture every 3 days for 2 weeks to form a tumor. The mice were then sacrificed, the tumors were removed from the mice and fixed with 4％ formaldehyde. The expression of CD31, one of the endothelial cell markers, in the tumor tissues was immunohistochemically evaluated with an antibody to CD31. Mouse hypoxic model: 4-week-old nude mice were intraperitoneally injected with 0.25％ of sodium nitrite (NaNO2) to induce hypoxia. At 24 h after the injection, gastrocnemius muscle tissues from the mice were removed, and the level of HIF-1α or the expression of miR-574-5p in the tissues was evaluated by Western Blot or qRT-PCR, respectively.

2.6. Dual‑Luciferase reporter assay PTPN3 was predicted to be a potential target for miR-574-5p by both TargetScan (http://www.tartetscan.org/) and miRWalk (http:// www.ma.uni-heidelberg.de/apps/zmf/mirwalk/). The predicted result was validated by a Dual‑Luciferase reporter assay. Wild type of PTPN3 mRNA 3′UTR or a mutated type of PTPN3 mRNA 3′UTR was subcloned into a report vector (Gene Pharma, Shanghai, China). HEK-293T cells were co-transfected with the recombinant report vector containing wild type of PTPN3 mRNA 3′UTR or mutated type of PTPN3 mRNA 3′UTR and miR-574-5p mimics or miR-574-5p non-specific control (NC). A Dual-luciferase® reporter assay kit (Promega, USA) and Synergy™ H1 microplate reader (BioTek, USA) were used to measure the fluorescence activity of the co-transfectants. Relative fluorescence was calculated by values of firefly luciferase values/renilla luciferase.

2.12. Statistical analysis GraphPad Prism (GraphPad Software, CA, USA) was used for statistical analysis of the data. Student's two-tailed t-test was used to analyze the difference between groups. The data was presented as Mean ± standard deviation (SD). *P < 0.05, **P < 0.01 and ***P < 0.001 were considered as the level for statistical significant.

2.7. Preparation of conditioned medium SGC/574 cells were transfected with miR-574-5p inhibitor or NC inhibitor when the cells reached 40%-50% confluency in 6-well plates. At about 70% of confluency, cell medium was replaced by a serum-free medium. The supernatant and cells were separated by centrifugation at 12,000g after the cells were cultured for 24 h in the serum-free medium, and the supernatant was used as a conditioned medium.

3. Results 3.1. miR-574-5p was upregulated under hypoxia

2.8. Assays of viability, migration and invasion of the cells

MiR-574-5p was upregulated under hypoxia, and the upregulation might be associated with the increase in the level of HIF-1α in the cells. SGC-7901 cells were cultured under a hypoxic condition of 2% O2 for

MTT assay was used to assess the viability of the cells. HUVECs were 3

Gene 733 (2020) 144383

S. Zhang, et al.

Fig. 1. Expression of miR-574-5p under hypoxia A. Cells of SGC-7901, AGS, HEK293T and Hela were cultured under hypoxic condition (2% O2) for 24 h, Levels of HIF-1α protein were evaluated by Western blot, and levels of miR-574-5p were evaluated by qRT-PCR. B. Cells of SGC-7901, AGS, HEK-293T and Hela were cultured in a medium containing CoCl2 (200 μM) for 24 h. Levels of HIF-1α protein were evaluated by Western blot, and levels of miR574-5p were evaluated by qRT-PCR. C. HEK-293T cells were transfected with vectors of pcDNA3.0 or pcDNA3.0/mut HIF-1α for 24 h. Levels of HIF-1α protein were evaluated by Western blot, and levels of miR-574-5p were evaluated by qRTPCR. D. Nude mice were intraperitoneally injected with sodium nitrite. Levels of HIF1α protein were evaluated by Western blot, and levels of miR-574-5p were evaluated by qRT-PCR. Data is presented as Mean ± SD from at least 3 independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001.

were significantly increased in the transfectant (Fig. 1C). We clarified further the positive correlation between the level of HIF-1α and expression of miR-574-5p in gastrocnemius muscle tissues in a hypoxic animal model. In this experiment, mice were injected subcutaneously with 0.25% sodium nitrite at doses of 70 μl/10 g or150 μl/10 g to induce hypoxia. At 24 h after the injection, both the level of HIF-1α and expression of miR-574-5p in the muscle tissues are paralleled increased in a sodium nitrite concentration dependent manner (Fig. 1D).

24 h. Compared with the control cells cultured under normoxia, these hypoxic SCG-7901 cells maintained higher level of HIF-1α indicating a response of the cells to the hypoxic condition (Fig. 1A). Paralleled to the higher level of HIF-1α in the hypoxic SGC-7901 cells, the expression of miR-574-5p in the cells was significantly upregulated (Fig. 1A). A similar phenomenon was also seen in other cell lines of AGS, HEK-293T and Hela (Fig. 1A). Obviously, the level of HIF-1α and expression of miR-574-5p in these hypoxic cells showed perfectly positive correlation. The data from following 2 cell models suggests that HIF-1α is responsible for the increase in the expression of miR-574-5p in the cells. We first added 200 μM of CoCl2 in medium for culturing the cells of SGC-7901, AGS, HEK-293T and Hela to stabilize the HIF-1α of the cells. The results revealed upregulation of HIF-1α and miR-574-5p expression in all these cells (Fig. 1B). In addition, 200 μM of CoCl2 added to the cell culture medium for other two epithelial origin cancer cell lines, SW480 (human colon adenocarcinoma cell line) and MCF-7 (human breast cancer cell line), increased both the levels of HIF-1α of SW480 cells (1.36 ± 0.02-fold of the control) or MCF-7 cells (1.51 ± 0.01-fold of control) and the expression of miR-574-5p of SW480 cells (2.05 ± 0.22-fold of the control) or MCF-7 cells (1.87 ± 0.28-fold of control). We then transfected HEK-293T cells with the plasmid pcDNA3.0/mut HIF-1α that could constitutively expressed an oxygen non-sensitive form of HIF-1α, and the levels of HIF-1α and miR-574-5p

3.2. miR-574-5p up-regulated VEGFA expression HIF-1α is a hypoxia-inducible factor and functions as a primary mediator of angiogenesis. The data in Fig. 1 suggests that miR-574-5p may involve in HIF-1α-mediated angiogenesis. Indeed, SGC-7901 transfected with miR-574-5p mimics up-regulated the expression of VEGFA (Fig. 2A) and SGC/574 cells transfected with miR-574-5p inhibitor down-regulated the expression of VEGFA (Fig. 2B). In addition, the ectopic expression of miR-574-5p mimics in the cells of SW480 or MCF-7 also led to increased mRNA expression of VEGFA in SW480 cells (1.76 ± 0.16-fold of the control) or MCF-7 cells (1.76 ± 0.09-fold of the control). However, the level of HIF-1α in the transfectans of the SGC-7901 and SGC/574 was not affected (Fig. 2A and B). If the increase in the expression of VEGFA induced by miR-574-5p is functional, the 4

Gene 733 (2020) 144383

S. Zhang, et al.

Fig. 2. Effect of miR-574-5p on VEGFA expression and HIF-1α protein level in SGC-7901 cells, and effect of conditioned medium on viability, migration, invasion and tube formation of HUVECs. A. cells were transfected with miR-574-5p mimics/NC mimics. VEGFA expression and HIF-1α level were evaluated by Western blot. B. SGC/574 cells were transfected with miR-574-5p inhibitor. VEGFA expression and HIF-1α level were evaluated by Western blot. C. Viability of HUVECs cultured with conditioned medium from SGC/574 cells transfected with miR-574-5p inhibitor/ NC inhibitor was evaluated by MTT assay. D and E. Migration or invasion of HUVECs cultured with conditioned medium from SGC/574 cells transfected with miR-574-5p inhibitor/NC inhibitor was evaluated by transwell assay. F and G. Tube formation of HUVECs cultured with conditioned medium from SGC/574 cells transfected with miR-574-5p mimics/NC mimics (F) or from SGC/574 cells transfected with miR-574-5p inhibitor/NC inhibitor (G) was evaluated by tube formation assay. Data is presented as Mean ± SD from at least 3 independent experiments. *P < 0.05, **P < 0.01.

than FGF-2 or PDGF-BB was reduced in the SGC/574 cells transfected with miR-574-5p inhibitor (Fig. 4A–C). Correspondingly, the phosphorylation of vascular endothelial growth factor receptor 2 (VEGFR2) rather than fibroblast growth factor receptor 1 (FGFR1) or platelet derived growth factor receptor-beta (PDGFRβ) in HUVECs cultured with conditioned medium from the transfectents of SGC/574 transfected with miR-574-5p inhibitor was reduced (Fig. 4D). These results indicated that miR-574-5p selectively activated the expression of VEGFA, and the VEGFA activates VEGFR2 in HUVECs in a paracrine manner.

VEGFA would be released into cell culture medium and activates HUVEC in a paracrine manner. The data indicated that viability (Fig. 2C), migration (Fig. 2D), invasion (Fig. 2E) and tube formation (Fig. 2G) of HUVECs were all reduced when the HUVECs were cultured with conditioned medium from SGC/574 cells transfected with miR574-5p inhibitor. Conversely, the tube formation of HUVECs was enhanced when the HUVECs were cultured with conditioned medium from SGC-7901 cells transfected with miR-574-5p mimics (Fig. 2F). 3.3. miR-574-5p promoted angiogenesis in vivo The results from Figs. 1 and 2 suggest that up-regulation of miR574-5p under hypoxia may involve angiogenesis of tumors. This thought was further supported by the results from the mice xenograft tumor model. The inhibition of miR-574-5p in the tumor xenografts reduced the expression of CD31 (Fig. 3).

3.5. miR-574-5p led to an increase of VEGFA via increased phosphorylation/activation of ERK1/2 Studies have shown that activation of 44/42 MAPKs signaling pathway rather than p38 MAPK pathway or c-Jun N-terminal kinase pathway are able to phosphorylate HIF-1α and enhance the transcriptional activity of HIF-1 that up-regulates the expression of VEGF (Richard et al., 1999, Suzuki et al., 2001, Mazure et al., 2003). Therefore, we hypothesized that miR-574-5p up-regulation of the expression of VEGFA might through phosphorylation of MAPKs or phosphorylation of HIF-1α as miR-574-5p did not affect the level of HIF-1α

3.4. miR-574-5p selectively activated the expression of VEGFA In addition to VEGFA, fibroblast growth factor 2 (FGF-2) and platelet-derived growth factor BB (PDGF-BB) are also involved in angiogenesis. In the present study, the mRNA expression of VEGFA rather 5

Gene 733 (2020) 144383

S. Zhang, et al.

Fig. 3. CD31 expression of tumor xenografts SGC/ 574 cells transfected with miR-574-5p inhibitor/ NC inhibitor were subcutaneously injected into nude mice. The mice were sacrificed on day 14 after the injection. CD31 expression of tumor xenografts was evaluated by immunohistochemistry technique and visualized under optic microscope (200×).

Fig. 4. MRNA expression of VEGF-A, FGF-2 or PDGF-BB and phosphorylation of VEGFR2, FGFR1 or PDGFRβ A–C. MRNA expression of VEGF-A, FGF-2 or PDGF-BB in SGC/574 cells transfected with miR-574-5p inhibitor/NC inhibitor was evaluated by qRT-PCR. D. Phosphorylation of VEGFR2, FGFR1 or PDGFRβ in HUVECs cultured with conditioned medium from SGC/574 cells transfected with miR-574-5p inhibitor/NC inhibitor was evaluated by Western blot. Data is presented as Mean ± SD from at least 3 independent experiments. *P < 0.05.

Fig. 5. Effect of miR-574-5p on phosphorylation of ERK1/2 and validation of PTPN3 being a target of miR-574-5p A. Protein levels of ERK1/2 or p-ERK1/2 in SGC7901 cells transfected with miR-574-5p mimics or in the transfectants in the presence of a specific MAPK inhibitor PD98059 were evaluated by Western blot. B. Expression of mRNA of HIF-1α or VEGF-A in SGC-7901 cells transfected with miR-574-5p mimics, miR-574-5p mimics plus siHIF-1α, or miR-574-5p mimics in the presence of a specific MAPK inhibitor PD98059 evaluated by qRT-PCR. C. Sequence alignment of miR-574-5p and its predicted binding site in wild type (wt) or mutated type (mut) of PTPN3 mRNA 3′UTR. D. Direct binding of miR-574-5p to 3′UTR of PTPN3 mRNA was evaluated in HEK-293T cells by dual luciferase activity assay. E. Effect of miR-574-5p on PTPN3 expression in SGC-7901 cells transfected with miR-574-5p mimics/NC mimics was evaluated by Western blot. Data is presented as Mean ± SD from at least 3 independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001.

6

Gene 733 (2020) 144383

S. Zhang, et al.

to VEGFA, FGF and PDGF also play a vital role in angiogenesis (Beenken and Mohammadi, 2009; Hosaka et al., 2018). Among the three growth factors in the present study, only VEGFA was involved in the angiogenesis caused by miR-574-5p in gastric cancer cells. In SGC/ 574 cells transfected with miR-574-5p inhibitor, the mRNA expression of VEGFA was reduced, and the expression of FGF-2 or PDGF-BB was not affected. Correspondingly, phosphorylation of VEGFR2 a receptor for VEGFA rather than FGFR1 a receptor for FGF-2 or PDGFRβ a receptor for PDGF-BB in HUVECs cultured with conditioned medium from the SGC/574 cells transfected with miR-574-5p inhibitor was reduced. The data in this study demonstrated that miR-574-5p up-regulated the expression of VEGFA in gastric cancer cells via phosphorylation of 44/42 MAPKs. Under hypoxic conditions of lower O2 cell culture, cell CoCl2 treatment or NaNO2 animal treatment, both miR-574-5p and HIF1α in cells or tissues are parallelly up-regulated. Therefore, miR-574-5p may function as a regulator that associates with HIF-1α adapting to the hypoxic state of cells. Indeed, miR-574-5p was a direct target gene of HIF-1α as the results of both dual-luciferase reporter assay and ChIP assay showed a direct binding between HIF-1α and the promoter of miR-574 gene that encodes miR-574-5p and miR-574-3p (unpublished data). Angiogenesis mediated by HIF/VEGF pathway has been extensively studied. Under hypoxic condition, HIF-1α is stabilized by inhibition of proteasomal degradation, and dimerizes with HIF-1β that is constitutively expressed in the cell to form HIF-1 complex. The complex then translocates into the nucleus where it binds to several HIF-1 responsive elements located within the 5ˊ-end of VEGF gene to activate the gene and promote angiogenesis (Minet et al., 2001; Chen et al., 2015b). However, the data in this study showed that the up-regulation of VEGFA expression by miR-574-5p in the gastric cancer cells had nothing to do with the stability of HIF-1α as the transfection of the cells with either miR-574-5p mimics or miR-574-5p inhibitor did not affect the HIF-1α level at all. It is reported that phosphorylated 44/42 MAPKs are able to up-regulate VEGF expression besides the stability of HIF-1α protein. Phosphorylated 44/42 MAPKs can up-regulate VEGF expression via either enhancing the phosphorylation of HIF-1α (Richard et al., 1999; Suzuki et al., 2001; Mazure et al., 2003) or directly activating proximal region of the VEGF promoter (Milanini et al., 1998; Whitmarsh and Davis, 2016). According to these reports, we transfected the SGC-7901 cells with miR-574-5p mimics, and found that the phosphorylation levels of p44/42 MAPKs (ERK1/2) in the transfectants were truly increased and no change in the presence of a specific MAPK inhibitor PD98059 in the transfectants We then found that the increase in the expression of VEGFA in SGC-7901 cells transfected with miR574-5p was eliminated in the presence of a specific MAPK inhibitor PD98059, while silencing HIF-1α expression with siHIF-1α in the transfectants had no effect on the expression of VEGFA induced by miR574-5p (Fig. 5B). These results suggested that miR-574-5p led to an increase of VEGFA expression independently of HIF1a likely via increased phosphorylation/activation of ERK1/2. We then focused on the search for the targets of miR-574-5p that were responsible for the phosphorylation status of 44/42 MAPKs. During the searching by the target gene prediction database TargetScan and miRWalk, PTPN3 was predicted to be a target of miR-574-5p in mediation of phosphorylation status of 44/42 MAPKs and angiogenesis by miR-574-5p. PTPN3 is a protein tyrosine phosphorylase and is able to remove the phosphate group on the phosphorylated tyrosine residue in kinases to regulate MAPK pathway (Hou et al., 2012). In this study, the results of dual luciferase reporter assay and Western blot demonstrated that miR-574-5p could directly bind to the 3′UTR of PTPN3 mRNA and inhibit the expression of PTPN3 protein. In addition, inhibiting PTPN3 expression in SCG-7901 cells by a silencing technique caused an increase in the phosphorylation of 44/42 MAPKs and the expression or secretion of VEGFA of the cells as well as increase in the viability, migration, invasion and tube formation of the HUVEC cells cultured with the conditioned medium from the SCG-7901 cells with silenced PTPN3.

in the cell. The results in this study revealed that phosphorylation levels of p44/42 MAPKs (ERK1/2) were indeed increased in SGC-7901 cells transfected with miR-574-5p and no change in the presence of a specific MAPK inhibitor PD98059 (Beyotime, China) in the transfectants (Fig. 5A). Furthermore, the increase in the expression of VEGFA in SGC7901 cells transfected with miR-574-5p was eliminated in the presence of PD98059, while silencing HIF-1α expression with siHIF-1α in the transfectants had no effect on the expression of VEGFA induced by miR574-5p (Fig. 5B). 3.6. PTPN3 is one of the target genes of miR-574-5p In searching the target genes of miR-574-5p that could dephosphorylate ERK1/2 by the bioinformatics tools, we found PTPN3 that can remove phosphate groups from phosphorylated tyrosine residues of MAPKs (Hou et al., 2010). It is reasonable to infer that increase in the phosphorylation levels of ERK1/2 in SGC-7901 cells transfected with miR-574-5p was induced by miR-574-5p inhibition of PTPN3. We validated PTPN3 being a target of miR-574-5p by a dual luciferase reporter assay (Fig. 5C and D) and Western blot (Fig. 5E). 3.7. Inhibition of PTPN3 promotes angiogenesis To investigate the relationship between PTPN3 and angiogenesis, we firstly transfected SGC-7901 cells with interfering RNAs of siPTPN3225, siPTPN3-941 or siPTPN3-1182 synthesized by Gene Pharma (Shanghai, China) to silence PTPN3 in the cells. The expression of PTPN3 measured by Western blot (Fig. 6A) or qRT-PCR (Fig. 6B) was used to evaluate the silencing efficiency. Among those interfering RNAs, siPTPN3-225 or siPTPN3-1182 was chosen for further analysis because of their higher silencing efficiency. We measured the levels of phosphorylated form of ERK1/2 (p-ERK1/2) and VEGFA by Western blot after transfecting siPTPN3-225 or siPTPN3-1182 into SGC-7901 cells, and both of them were upregulated (Fig. 6C). The secretion of VEGFA from the transfectans of SGC-7901/ siPTPN3-225 or SGC-7901/ siPTPN3-1182 measured by ELISA assay was increased as the VEGFA levels in the conditioned medium culturing the transfectants were increased (Fig. 6D). The viability, migration, invasion, and tube formation of HUVECs cultured by the same conditioned medium from the transfectans were also increased (Fig. 6E–H). The results above-mentioned suggest that inhibition of PTPN3 in SGC-7901 cells is able to promote angiogenesis. 4. Discussion Angiogenesis is the basis of growth and metastasis of tumors. Tumors can induce phenotype changes of endothelial cells by various pro-angiogenic factors secreted by tumor cells. More and more studies have shown that miRNAs play a very important role in regulation of angiogenesis. For example, miR-370 inhibits angiogenic activity of endothelial cells by targeting bone morphogenetic proteins (Gu et al., 2019); MiRNA-126 regulates angiogenesis and neurogenesis of mouse models at focal cerebral ischemia (Qu et al., 2019). Upregulation of miR-1249 by P53 inhibits tumor growth, metastasis and angiogenesis by targeting VEGFA and HMGA2 (Chen et al., 2019b). In the present study, we found that miR-574-5p in gastric cancer cells could promote angiogenesis. The changes of the level of miR-5745p and the expression of VEGFA in the cells were positively correlated. The viability, migration, invasion and tube formation of HUVECs cultured with a conditioned medium from SGC/574 cells transfected with miR-574-5p inhibitor were reduced, while the tube formation of HUVECs cultured with a conditioned medium from SGC-7901 cells transfected with miR-574-5p mimics was enhanced. It is reported that VEGFA specifically acts on its receptor VEGFR2 on the surface of vascular endothelial cells, activates the downstream cell signal cascade, and initiates neovascularization process (Sini et al., 2008). In addition 7

Gene 733 (2020) 144383

S. Zhang, et al.

Fig. 6. Effect of PTPN3 on angiogenesis A and B. PTPN3 expression in SGC-7901 cells transfected with siPTPN3-225, siPTPN3-941, siPTPN3-1182 or siRNA control was evaluated by Western blot and qRT-PCR. C. Expression of VEGFA or levels of ERK1/2 and p-ERK1/2 in SGC-7901 cells transfected with siPTPN3-225, siPTPN3-1182 and siRNA control were evaluated by Western blot. D. level of VEGFA in the conditioned medium from SGC-7901 cells transfected with siPTPN3-225, siPTPN3-1182 or siRNA control was evaluated by ELISA assay. E-H. Viability, migration and invasion or tube formation of HUVECs cultured with conditioned medium from SGC-7901 cells transfected with siPTPN3225, siPTPN3-1182 or siRNA control was evaluate by MTT assay, transwell assay or tube formation assay, respectively. Data is presented as Mean ± SD from at least 3 independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001.

influence the work reported in this paper.

We conclude that miR-574-5p was up-regulated and one of the factors that contributes to the angiogenesis of gastric cancer under hypoxic conditions. The angiogenesis induced by miR-574-5p was due to the increased level of phosphorylation of 44/42 MAPKs by miR-5745p inhibition of PTPN3, and this had nothing to do with the stability of HIF-1α in the cells.

Acknowledgments This work was supported by the National Natural Science Foundation of China, China (No. 31972890 and No. 31571443 to QY), the Department of Science and Technology of Jilin Province, China (No. 20190201216JC to QY) and the Education Department of Jilin Province, China (No. JJKH20180176KJ to HH).

CRediT authorship contribution statement Shu Zhang: Investigation, Writing-original draft. Renwen Zhang: Investigation. Rui Xu: Investigation. Jiaqi Shang: Investigation. Haitao He: Investigation. Qing Yang: Writing - review & editing.

References Beenken, A., Mohammadi, M., 2009. The FGF family: biology, pathophysiology and therapy. Nat. Rev. Drug Discov. 8 (3), 235–253. Boudria, A., Abou Faycal, C., Jia, T., Gout, S., Keramidas, M., Didier, C., Lemaitre, N., Manet, S., Coll, J.L., 2019. VEGF165b, a splice variant of VEGF-A, promotes lung tumor progression and escape from anti-angiogenic therapies through a beta1 integrin/VEGFR autocrine loop. Oncogene 38 (7), 1050–1066. Brandenburg, S., Muller, A., Turkowski, K., Radev, Y.T., Rot, S., Schmidt, C., Bungert,

Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to 8

Gene 733 (2020) 144383

S. Zhang, et al.

A., Meyer, T., Romano, C., Glinka, M., Yancopoulos, G.D., Stahl, N., Wiegand, S.J., Papadopoulos, N., 2016. Aflibercept exhibits VEGF binding stoichiometry distinct from bevacizumab and does not support formation of immune-like complexes. Angiogenesis 19 (3), 389–406. Malecic, N., Young, H.S., 2016. Novel investigational vascular endothelial growth factor (VEGF) receptor antagonists for psoriasis. Expert Opin. Investig. Drugs 25 (4), 455–462. Mazure, N.M., Brahimi-Horn, M.C., Pouyssegur, J., 2003. Protein kinases and the hypoxia-inducible factor-1, two switches in angiogenesis. Curr. Pharm. Des. 9 (7), 531–541. Milanini, J., Vinals, F., Pouyssegur, J., Pages, G., 1998. p42/p44 MAP kinase module plays a key role in the transcriptional regulation of the vascular endothelial growth factor gene in fibroblasts. J. Biol. Chem. 273 (29), 18165–18172. Minet, E., Michel, G., Mottet, D., Raes, M., Michiels, C., 2001. Transduction pathways involved in Hypoxia-Inducible Factor-1 phosphorylation and activation. Free Radic. Biol. Med. 31 (7), 847–855. Ninova, M., Ronshaugen, M., Griffiths-Jones, S., 2016. MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum. Genome Res. 26 (1), 85–96. Qu, M., Pan, J., Wang, L., Zhou, P., Song, Y., Wang, S., Jiang, L., Geng, J., Zhang, Z., Wang, Y., Tang, Y., Yang, G.Y., 2019. MicroRNA-126 regulates angiogenesis and neurogenesis in a mouse model of focal cerebral ischemia. Mol. Ther. Nucleic Acids 16, 15–25. Richard, D.E., Berra, E., Gothie, E., Roux, D., Pouyssegur, J., 1999. p42/p44 mitogenactivated protein kinases phosphorylate hypoxia-inducible factor 1alpha (HIF1alpha) and enhance the transcriptional activity of HIF-1. J. Biol. Chem. 274 (46), 32631–32637. Seok, J.K., Lee, S.H., Kim, M.J., Lee, Y.M., 2014. MicroRNA-382 induced by HIF-1alpha is an angiogenic miR targeting the tumor suppressor phosphatase and tensin homolog. Nucleic Acids Res. 42 (12), 8062–8072. Sini, P., Samarzija, I., Baffert, F., Littlewood-Evans, A., Schnell, C., Theuer, A., Christian, S., Boos, A., Hess-Stumpp, H., Foekens, J.A., Setyono-Han, B., Wood, J., Hynes, N.E., 2008. Inhibition of multiple vascular endothelial growth factor receptors (VEGFR) blocks lymph node metastases but inhibition of VEGFR-2 is sufficient to sensitize tumor cells to platinum-based chemotherapeutics. Cancer Res. 68 (5), 1581–1592. Suzuki, H., Tomida, A., Tsuruo, T., 2001. Dephosphorylated hypoxia-inducible factor 1alpha as a mediator of p53-dependent apoptosis during hypoxia. Oncogene 20 (41), 5779–5788. Wang, M., Zhang, R., Zhang, S., Xu, R., Yang, Q., 2019. MicroRNA-574-3p regulates epithelial mesenchymal transition and cisplatin resistance via targeting ZEB1 in human gastric carcinoma cells. Gene 700, 110–119. Whitmarsh, A.J., Davis, R.J., 2016. Multisite phosphorylation by MAPK. Science 354 (6309), 179–180. Yang, Q., Tonks, N.K., 1991. Isolation of a cDNA clone encoding a human protein-tyrosine phosphatase with homology to the cytoskeletal-associated proteins band 4.1, ezrin, and talin. Proc. Natl. Acad. Sci. U.S.A. 88 (14), 5949–5953. Zeng, Z., Li, Y., Pan, Y., Lan, X., Song, F., Sun, J., Zhou, K., Liu, X., Ren, X., Wang, F., Hu, J., Zhu, X., Yang, W., Liao, W., Li, G., Ding, Y., Liang, L., 2018. Cancer-derived exosomal miR-25-3p promotes pre-metastatic niche formation by inducing vascular permeability and angiogenesis. Nat. Commun. 9 (1), 5395. Zhang, R., Wang, M., Sui, P., Ding, L., Yang, Q., 2017. Upregulation of microRNA-574-3p in a human gastric cancer cell line AGS by TGF-beta1. Gene 605, 63–69. Zhang, W., Thevapriya, S., Kim, P.J., Yu, W.P., Je, H.S., Tan, E.K., Zeng, L., 2014. Amyloid precursor protein regulates neurogenesis by antagonizing miR-574-5p in the developing cerebral cortex. Nat. Commun. 5, 3330. Zhang, W., Xiong, Z., Wei, T., Li, Q., Tan, Y., Ling, L., Feng, X., 2018. Nuclear factor 90 promotes angiogenesis by regulating HIF-1alpha/VEGF-A expression through the PI3K/Akt signaling pathway in human cervical cancer. Cell Death Dis. 9 (3), 276. Zhou, L., Sun, X., Huang, Z., Zhou, T., Zhu, X., Liu, Y., Wang, J., Cheng, B., Li, M., He, C., Liu, X., 2018. Imatinib ameliorated retinal neovascularization by suppressing PDGFRalpha and PDGFR-beta. Cell Physiol. Biochem. 48 (1), 263–273. Zhou, R., Zhou, X., Yin, Z., Guo, J., Hu, T., Jiang, S., Liu, L., Dong, X., Zhang, S., Wu, G., 2016. MicroRNA-574-5p promotes metastasis of non-small cell lung cancer by targeting PTPRU. Sci. Rep. 6, 35714.

A.D., Acker, G., Schorr, A., Hippe, A., Miller, K., Heppner, F.L., Homey, B., Vajkoczy, P., 2016. Resident microglia rather than peripheral macrophages promote vascularization in brain tumors and are source of alternative pro-angiogenic factors. Acta Neuropathol. 131 (3), 365–378. Brudno, Y., Ennett-Shepard, A.B., Chen, R.R., Aizenberg, M., Mooney, D.J., 2013. Enhancing microvascular formation and vessel maturation through temporal control over multiple pro-angiogenic and pro-maturation factors. Biomaterials 34 (36), 9201–9209. Bruick, R.K., McKnight, S.L., 2001. A conserved family of prolyl-4-hydroxylases that modify HIF. Science 294 (5545), 1337–1340. Chen, K.E., Li, M.Y., Chou, C.C., Ho, M.R., Chen, G.C., Meng, T.C., Wang, A.H., 2015a. Substrate specificity and plasticity of FERM-containing protein tyrosine phosphatases. Structure 23 (4), 653–664. Chen, M.C., Hsu, W.L., Hwang, P.A., Chou, T.C., 2015b. Low molecular weight fucoidan inhibits tumor angiogenesis through downregulation of HIF-1/VEGF signaling under hypoxia. Mar. Drugs 13 (7), 4436–4451. Chen, S.S., Tang, C.H., Chie, M.J., Tsai, C.H., Fong, Y.C., Lu, Y.C., Chen, W.C., Lai, C.T., Wei, C.Y., Tai, H.C., Chou, W.Y., Wang, S.W., 2019a. Resistin facilitates VEGF-Adependent angiogenesis by inhibiting miR-16-5p in human chondrosarcoma cells. Cell Death Disease 10 (1), 31. Chen, X., Zeng, K., Xu, M., Liu, X., Hu, X., Xu, T., He, B., Pan, Y., Sun, H., Wang, S., 2019b. P53-induced miR-1249 inhibits tumor growth, metastasis, and angiogenesis by targeting VEGFA and HMGA2. Cell Death Disease 10 (2), 131. De Sanctis, F., Ugel, S., Facciponte, J., Facciabene, A., 2018. The dark side of tumorassociated endothelial cells. Semin. Immunol. 35, 35–47. De Veirman, K., Rao, L., De Bruyne, E., Menu, E., Van Valckenborgh, E., Van Riet, I., Frassanito, M.A., Di Marzo, L., Vacca, A., Vanderkerken, K., 2014. Cancer associated fibroblasts and tumor growth: focus on multiple myeloma. Cancers (Basel) 6 (3), 1363–1381. Ferrara, N., Adamis, A.P., 2016. Ten years of anti-vascular endothelial growth factor therapy. Nat. Rev. Drug Discov. 15 (6), 385–403. Gao, Q., Zhao, Y.J., Wang, X.Y., Guo, W.J., Gao, S., Wei, L., Shi, J.Y., Shi, G.M., Wang, Z.C., Zhang, Y.N., Shi, Y.H., Ding, J., Ding, Z.B., Ke, A.W., Dai, Z., Wu, F.Z., Wang, H., Qiu, Z.P., Chen, Z.A., Zhang, Z.F., Qiu, S.J., Zhou, J., He, X.H., Fan, J., 2014. Activating mutations in PTPN3 promote cholangiocarcinoma cell proliferation and migration and are associated with tumor recurrence in patients. Gastroenterology 146 (5), 1397–1407. Gu, Y., Becker, V., Zhao, Y., Menger, M.D., Laschke, M.W., 2019. miR-370 inhibits the angiogenic activity of endothelial cells by targeting smoothened (SMO) and bone morphogenetic protein (BMP)-2. Faseb J fj201802085RR. Hanahan, D., Weinberg, R.A., 2011. Hallmarks of cancer: the next generation. Cell 144 (5), 646–674. Hisano, Y., Hla, T., 2019. Bioactive lysolipids in cancer and angiogenesis. Pharmacol. Ther. 193, 91–98. Hosaka, K., Yang, Y., Nakamura, M., Andersson, P., Yang, X., Zhang, Y., Seki, T., Scherzer, M., Dubey, O., Wang, X., Cao, Y., 2018. Dual roles of endothelial FGF-2-FGFR1-PDGFBB and perivascular FGF-2-FGFR2-PDGFRbeta signaling pathways in tumor vascular remodeling. Cell Discov. 4, 3. Hou, S., Suresh, P.S., Qi, X., Lepp, A., Mirza, S.P., Chen, G., 2012. p38gamma Mitogenactivated protein kinase signals through phosphorylating its phosphatase PTPH1 in regulating ras protein oncogenesis and stress response. J. Biol. Chem. 287 (33), 27895–27905. Hou, S.W., Zhi, H.Y., Pohl, N., Loesch, M., Qi, X.M., Li, R.S., Basir, Z., Chen, G., 2010. PTPH1 dephosphorylates and cooperates with p38gamma MAPK to increase ras oncogenesis through PDZ-mediated interaction. Cancer Res. 70 (7), 2901–2910. Ji, S., Ye, G., Zhang, J., Wang, L., Wang, T., Wang, Z., Zhang, T., Wang, G., Guo, Z., Luo, Y., Cai, J., Yang, J.Y., 2013. miR-574-5p negatively regulates Qki6/7 to impact betacatenin/Wnt signalling and the development of colorectal cancer. Gut 62 (5), 716–726. Li, J., Huang, L., Xiao, X., Chen, Y., Wang, X., Zhou, Z., Zhang, C., Zhang, Y., 2016. Photoclickable MicroRNA for the intracellular target identification of microRNAs. J. Am. Chem. Soc. 138 (49), 15943–15949. MacDonald, D.A., Martin, J., Muthusamy, K.K., Luo, J.K., Pyles, E., Rafique, A., Huang, T., Potocky, T., Liu, Y., Cao, J., Bono, F., Delesque, N., Savi, P., Francis, J., Amirkhosravi,

9