- Email: [email protected]
MicroRNA-7 regulates IL-1β-induced extracellular matrix degeneration by targeting GDF5 in human nucleus pulposus cells
Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
Available online at
ScienceDirect www.sciencedirect.com
MicroRNA-7 regulates IL-1b-induced extracellular matrix degeneration by targeting GDF5 in human nucleus pulposus cells Wei Liua,b,1, Yukun Zhanga,1, Ping Xiab , Shuai Lia , Xintong Fenga , Yong Gaoa , Kun Wanga , Yu Songa , Zhenfeng Duanc , Shuhua Yanga , Zengwu Shaoa , Cao Yanga,* a Department of Orthopedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Jiefang Road, No. 1277,Wuhan 430022, China b Department of Orthopedics, First Hospital of Wuhan, Zhongshan Road, No.215, Wuhan 430022, China c Sarcoma Biology Laboratory, Center for Sarcoma and Connective Tissue Oncology, Massachusetts General Hospital, 100 Blossom St., Jackson 1106, Boston, MA, 02114, USA
A R T I C L E I N F O
Article history: Received 3 June 2016 Received in revised form 1 August 2016 Accepted 25 August 2016 Keywords: Intervertebral disc degeneration miR-7 GDF5 Nucleus pulposus IL-1b
A B S T R A C T
The precise role of interleukin-1 beta (IL-1b)-induced extracellular matrix degeneration in the pathogenesis of intervertebral disc degeneration (IDD) is currently unknown. Recent evidence has revealed that microRNAs (miRNAs) are associated with IDD, but their function in the extracellular matrix degradation of nucleus pulposus (NP) tissues is also poorly understood. The aim of this study was to evaluate the expression and functional role of miR-7 in IL-1b-induced disc degeneration. The expression level of miR-7 was investigated in degenerative NP tissues and in IL-1b-induced NP cells using quantitative reverse transcription-polymerase chain reaction amplification analysis. A dual-luciferase reporter assay was then utilized to determine whether growth differentiation factor 5 (GDF5) is a target of miR-7. Finally, mRNA and protein levels of known matrix components and of matrix degradation enzymes were determined to elucidate the function of miR-7 in IL-1b-induced disc degeneration. In this study, we found that miR-7 is highly expressed in human degenerative NP tissues and in IL-1b stimulated NP cells compared to normal controls. We also determined that GDF5 was a target of miR-7. Functional analysis showed that the overexpression of miR-7 significantly enhanced the IL-1b-induced extracellular matrix degeneration, whereas inhibition of miR-7 function by antagomiR-7 prevented NP cell detrimental catabolic changes in response to IL-1b. Additionally, the prevention of IL-1b-induced NP extracellular matrix degeneration by miR-7 silencing was attenuated by GDF5 siRNA. These findings suggest that miR-7 contributes to an impaired ECM in intervertebral discs through targeting GDF5 and miR-7 might therefore represent a novel therapeutic target for the prevention of IDD. ã 2016 Elsevier Masson SAS. All rights reserved.
1. Introduction Chronic lower back pain resulting from intervertebral disc (IVD) degeneration (IDD) is a global burden with severe healthcare and socioeconomic consequences [1,2]. Both the etiology of IDD and the cause of the resulting lower back pain are poorly understood, although the current consensus is that the former is complex and multifactorial, involving age, genetics, and biomechanical and environmental factors such as immobilization, trauma, tobacco use, diabetes, vascular disease, and infection [3–6]. Although multiple factors are involved in triggering IDD, IDD is generally
* Corresponding author. E-mail address: [email protected] (C. Yang). These authors contributed equally to this work.
1
http://dx.doi.org/10.1016/j.biopha.2016.08.062 0753-3322/ã 2016 Elsevier Masson SAS. All rights reserved.
believed to represent an imbalance between anabolism and catabolism of the extracellular matrix (ECM), leading to large structural changes therein. During IDD, the cells of the IVD function abnormally with decreased synthesis of normal IVD matrix components and increased production of degradative enzyme matrix metalloproteinases (MMPs) and ADAMTSs, which constitute a disintegrin and metalloproteinase with thrombospondin motifs; consequently, the normal homeostatic metabolism in the IVD is lost [7–9]. Among the multiple molecular events involved in IDD, GDF5, also known as cartilage-derived morphogenetic protein-1 (CDMP-1), has been shown to play important roles. In humans, GDF5 was shown to be expressed in both nondegenerate and degenerate IVD, particularly in cells of the NP. However, the number of cells expressing GDF5 decreased in degenerate human IVDs. Conversely, treatment of human NP cells
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
with GDF5 led to increase expression of the aggrecan and type II collagen genes and increased production of proteoglycans (e.g., glycosaminoglycans (GAGs)) [10]. In addition, the treatment of mouse disc cells with recombinant GDF-5 protein in vitro decreasedMMP-3 gene expression [11]. Furthermore, GDF-5 has been shown to enhance the proliferation of bovine NP cells in vitro [12]. Together, these data identify GDF5 as a potential regulator of matrix metabolism and NP cell survival. MicroRNAs, a class of non-coding small RNAs, control gene expression primarily through base-pairing with the 3 untranslated regions (30 UTRs) of their target mRNAs and triggering either the repression of translation or the RNA degradation thereof [13]. Accumulating evidence has shown that miRNAs participate in regulating multiple cellular processes including cell proliferation, differentiation, and apoptosis [13,14]. However, to date the pathogenesis of IDD in relation to miRNAs is still unclear. Consequently, the functions of miRNAs in the pathogenesis of IDD warrant further analysis. MiR-7, originally identified as a tumor suppressor in several types of cancer, has been shown to suppress cancer cell growth, proliferation, survival, migration, and invasion [15–17]. However, as of yet there have been no reports regarding the functional activity of miR-7 in spine tissue. The potent proinflammatory cytokine IL-1b plays a pivotal role in the pathogenesis of IDD by decreasing synthesis of the normal IVD matrix and promoting production of degradative enzymes [19,20]. Furthermore, IL-1b-induced IVD degeneration can be reduced by miRNAs such as mir-146a [21]. However, to our knowledge this is the only current report related to the function of miRNAs in IL-1b-induced NP ECM degradation. Thus, the relationship between the two remains to be further investigated. Here, we examined the relative miR-7 expression levels in human degenerative NP tissues and in IL-1b stimulated NP cells and explored the mechanism of miR-7 action in IL-1b-induced IVD degeneration. Our results suggest that miR-7 acts as a novel regulator of NP ECM homeostasis by suppressing GDF5 expression in human NP cells and that alteration of miR-7 expression might significantly affect IL-1b-induced IDD. 2. Materials and methods 2.1. Patients and samples Human lumbar NP specimens were collected from patients with idiopathic scoliosis (n = 8, average age 21.8, range 18–40 years) and from patients with IDD (n = 12, average age 27.4, range 20–42 years). Routine MRI scans of the lumbar spine were taken prior to the operation and the degree of disc degeneration was graded from the T2-weighted images using a modified Pfirrmann classification [22]. All of the experimental protocols were approved by the Clinical Research Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology and all patients or their parents (on behalf of children) provided informed consent. 2.2. Isolation and primary culture of human NP cells Four normal tissue specimens were collected from the patients with idiopathic scoliosis and were first washed twice in PBS and then the NP tissue was separated from the annulus fibrosus using a stereotaxic microscope and cut into pieces (2–3 mm3). The NP cells were released from the normal NP tissues by incubation with 0.25 mg/mL type II collagenase (Invitrogen, Carlsbad, CA, USA) for 8 h at 37 C in Dulbecco’s modified Eagle medium (DMEM; Gibco, Grand Island, NY, USA). After isolation, the NP cells were
1415
resuspended in DMEM containing 15% fetal bovine serum (FBS; Gibco), 100 mg/mL streptomycin, 100 U/mL penicillin, and 1% Lglutamine and then incubated at 37 C in a humidified atmosphere with 95% (v/v) air and 5% (v/v) CO2. The culture medium was replaced twice a week with the exception that the primary cells were allowed more time (6.7 1.4 days) to adhere prior to the first change. The confluent cells were dissociated by trypsinization, and second-passage cells were used for subsequent experiments.The NP cells from two IDD NP specimens were cultured according to the method described above. Second-passage cells were used for IL-1b treatment and as the control. HEK293 cells (American Type Culture Collection, Manassas, VA, USA) were cultured in DMEM containing 10% FBS and incubated at 37 C with 5% CO2 in a humidified incubator. The culture medium was replaced every 3 days. 2.3. Cell treatment When cultured NP cells from two IDD NP specimens reached 80% confluence, the cells(2 105 cells/well) were seeded in 6-well plates and subjected to serum starvation overnight to synchronize the cell cycles. The cells were then stimulated with 10 ng/mL recombinant human IL-1b (Sino Biological Inc., North Wales, PA, USA) for 24 h and harvested for mRNA and protein analysis. 2.4. Transfection The miR-7 (mimic), antagomiR-7 (inhibitor), and their negative controls were purchased from GenePharma (Shanghai, China). MiR-7 (50 nM), antagomiR-7 (150 nM) or their negative controls were transfected, respectively, into cells at 80% confluence using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 24 h of transfection, cells were treated with IL-1b (10 ng/mL) (Sino Biological Inc., North Wales, PA, USA) for 24 h. Cells were then harvested for subsequent experiments. GDF5 siRNAs and their negative controls were purchased from GenePharma. After validation of their inhibition efficacies, a selective GDF5 siRNA (150 nM) or negative control was cotransfected with antagomiR-7 (150 nM) into cells cultured in a 6-well plate using Lipofectamine 2000. 2.5. RNA extraction and quantitative real-time PCR (qRT-PCR) Total RNA was isolated from the harvested cells and tissues using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. After determination of RNA concentration using spectrophotometry, total RNA was reverse transcribed using PrimeScript RT Master Mix (TakaRa, Dalian, China) according to manufacturer's instructions. cDNA coding genes and miR-7 were amplified using Power SYBR Green PCR Master Mix on a 7900HT thermocycler (Applied Biosystems; Foster City, CA, USA). Briefly, the RNA was denatured for 5 min at 70 C and placed on ice for 5 min. Denatured RNA was added to a mixture of MMLV-RT, MMLVRT buffer, HRP (RRI)/RNase inhibitor, and dNTPs and incubated for 60 min at 42 C. Then, the reagent was inactivated by heating at 95 C for 5 min. Following amplification, the relative gene expression levels were calculated using the 2DDCT method [23]. The expression levels of b-actin and U6 were used as endogenous controls to normalize each mRNA and miRNA, respectively. The primers used are shown in Table 1 and miR-7 loop primer was as follows: 50 -GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAACAAA. All experiments were performed at least in triplicate.
1416
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
Table 1 List of Primers Used in qRT-PCR. Name
Primer
Sequence
Homo U6
F R F R F R F R F R F R F R F R
50 - CGCTTCGGCAGCACATATAC 30 50 - AAATATGGAACGCTTCACGA-30 50 - TGCGCTGGAAGACTAGTGATTTT-30 50 - CCAGTGCAGGGTCCGAGGTATT-30 50 - AGCGAGCATCCCCCAAAGTT 30 50 - GGGCACGAAGGCTCATCATT 30 50 - CGATAAGACCGTGTATGAGT-30 50 - CTCGCAGTGGAAAGCCTCGT-30 50 - TGAGCGGCAGCACTTTGAC 30 50 - TGAGTACAGGAGGCTTGAG 30 50 - TCCAGATGACCTTCCTACGC 30 50 - GGTATGTTTCGTGCAGCCAT 30 50 - GCAGTCTTTCTTCGGCTTAG 30 50 - CATTGTATTCACCCACATCAG 30 50 -ACTGGGCTACTACTATGTGCTGGA-30 50 -CACACACCATGCACTTGTCGAACT-30
hsa-miR-7 Homo b-actin Homo GDF5 Homo aggrecan Homo Collagen Homo MMP13 Homo ADAMTS4
2.6. Luciferase constructs and the reporter assay The full length GDF5 30 UTR was obtained via PCR using the primers 50 -GCG CTC GAG TGC CAA CAA CGT GGT GTA T-30 and 50 AAT GCG GCC GCC ACA GTT TTA GGC ACA GTT-30 , and then cloned into the XhoI/NotI site of the pmiR-RB-Report vector (RiboBio Co., Guangzhou, China) to generate the wild-type pmiR-GDF5 plasmid. To produce constructs that carry mutations at the putative miR-7– binding site in the wild-type GDF5 30 UTR, we performed sitedirected mutagenesis to generate the mutant-type pmiR-GDF5 plasmid construct (primers: FW: 50 -GGC CCT CTC AGA AGG TGG GTG GCA CAT CCC AAG-30 , and RV: 50 -GCC ACC CAC CTT CTG AGA GGG CCA GTG CTG CTA-30 ), with wild-type pmiR-GDF5 as a template. All of the constructs were verified by sequencing. For luciferase activity analysis, HEK293 cells were co-transfected with a combination of 200 ng wild-type pmiR-GDF5 plasmid or mutanttype pmiR-GDF5 plasmid and 100 nM miR-7 mimic or the miR-7 negative control using Lipofectamine 2000 in 48-well plates. After 24 h, cell lysates were prepared and subjected to luciferase assays using the Dual-Luciferase1 Reporter Assay System(Promega, Madison,WI,USA),according to the manufacturer’s instructions. Each experiment was performed three times. 2.7. Western blotting The culture supernatants were collected and the cells were washed with cold PBS and lysed for 20 min in cold RIPA Lysis Buffer (Beyotime, Beijing, China). The extracted proteins were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After blocking in 10% non-fat dried milk in TBST for 2 h, the blots were incubated with anti-GDF5 (ab93855, Abcam, Cambridge, UK), anti-aggrecan (ab3778, Abcam), anti-collagen type II (ab34712, Abcam), anti-mmp-13 (Ab39012, Abcam), anti-adamts-4 (Eap1002, Elabscience), and anti- b-actin (ab8227, Abcam) overnight at 4 C. b-Actin served as an internal control. After washes in TBST, the immobilized primary antibodies were then incubated with anti-rabbit IgG conjugated to IRDye(800CW) for 1 h at 25 C and visualized with the Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, USA). 2.8. Statistical analysis The results are presented as means standard deviation (SD). The statistical analysis was performed using SPSS 20.0 software (SPSS, Chicago, IL, USA). Two groups were compared using the
independent samples t test, and three or more groups were compared by one-way analysis of variance (ANOVA) followed by post hoc analysis. A P-value < 0.05 was considered as a statistically significant difference. 3. Results 3.1. MiR-7 expression is up-regulated in degenerative NP tissues and in IL-1b stimulated NP cells As a multi-functional miRNA, miR-7 is expressed in diverse tissues, and aberrant expression of miR-7 has been associated with various diseases [15–18]. To determine the regulatory effect of miR-7 in the processes of IDD, relative expression of miR-7 in four idiopathic scoliosis NP tissues and ten degenerative NP tissues was determined by qRT-PCR. As shown in Fig. 1a, miR-7 was significantly up-regulated in degenerative NP tissues in comparison with controls. Subsequently, human NP cells were treated with IL-1b for 24 h. Relative expression of miR-7 was determined by qRT-PCR. Untreated NP cells were used as controls. Our results demonstrated that miR-7 was significantly up-regulated in NP cells treated with IL-1b compared to untreated cells. (Fig. 1b). 3.2. Stimulation of NP cells with IL-1b recapitulated IDD in vitro To explore whether stimulation of NP cells with IL-1b could simulate IDD, human NP cells from IDD NP specimens were treated with IL-1b, and the expression of type II collagen, aggrecan, MMP13, and ADAMTS-4 was analyzed by qRT-PCR and western blot. The mRNA expression and protein concentrations of type II collagen and aggrecan were decreased in NP cells treated with IL-1b in comparison with untreated cells (Fig. 1c and d). In addition, IL-1b treatment significantly increased MMP-13 and ADAMTS-4 mRNA and protein expression in human NP cells (Fig. 1c and d). 3.3. MiR-7 mediates IL-1b-induced matrix degradation in NP cells To understand whether miR-7 has an effect the IL-1b-induced matrix degradation process, miR-7 mimic and an antagomir were transfected into human NP cells and then the cells were stimulated with IL-1b. After NP cell treatment with IL-1b for 24 h, we quantified the mRNA expression of type II collagen and aggrecan using qRT-PCR. We found that the expression of type II collagen and aggrecan in NP cells was significantly decreased after treatment with IL-1b (Fig. 2a and c). In addition,overexpression of miR-7 strengthened the IL-1b-induced down-regulation of type II collagen and aggrecan mRNA expression. However, the miR-7 antagomir resulted in a significant suppression of IL-1b-induced type II collagen and aggrecan mRNA down-regulation (Fig. 2a and c). Western blotting was then used to evaluate the protein concentration of type II collagen and aggrecan. Similar to the changes observed for mRNA expression, the concentrations of type II collagen and aggrecan were significantly decreased after treatment with IL-1b (Fig. 2b and d). Overexpression of miR-7 led to decreased type II collagen and aggrecan protein concentrations in NP cells stimulated with IL-1b. On the other hand, silencing of miR-7 inhibited the effects of IL-1b and resulted in maintenance of type II collagen and aggrecan content(Fig. 2b and d). We also used qRT-PCR and western blot analysis to analyze the expression of genes encoding catabolic factors, including MMP-13 and ADAMTS4, in NP cells that were transfected with either miR-7 mimic or antagomiR-7 and then stimulated with IL-1b. We found that miR-7 overexpression significantly increased the mRNA expression and protein concentrations of MMP-13 and ADAMTS4
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
1417
Fig. 1. MiR-7 expression is up-regulated in degenerative NP tissues and in IL-1b stimulated NP cells. (a) MiR-7 had significantly higher expression in degenerative NP tissues than in normal controls. (b) The expression of miR-7 is significantly higher in NP cells treated with IL-1b compared to untreated cells. Human NP cells from IDD NP specimens were treated with IL-1b, and the (c) gene and (d) protein expression of type II collagen, aggrecan, MMP-13, and ADAMTS-4 was analyzed by qRT-PCR and western blot. U6 or b-actin was used as an internal control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to control.
upon stimulation with IL-1b (Fig. 2e–h). In turn, repression of miR7 had the opposite effect (Fig. 2e–h). 3.4. GDF5 is a target gene of miR-7 To investigate how miR-7 effects IL-1b-induced matrix degradation of NP cells, we predicted the target genes of miR-7 using miRanda (http://www.microrna.org/) and Microcosm Targets Version 5 (http://www.ebi.ac.uk/enright-srv/microcosm/ htdocs/targets/v5/). Notably, we identified considerable complementarity between the seed region of the miR-7 and the 30 UTR of GDF5 (Fig. 3a). In the validation of these database results, a distinct decrease (P < 0.01) in luciferase activity was measured in cells cotransfected with miR-7 mimic and pmiR-GDF5 (WT). In addition, a mutation of the miR-7 binding sequence located at 16–22 nt of the GDF5 30 UTR (Mut) evidently abrogated the repression of the luciferase activity owing to miR-7 overexpression (Fig. 3b). Furthermore, to verify GDF5 as a target of miR-7 in NP cells, the NP cells were transfected with the miR-7 mimic and antagomiR-7 and their negative controls.qRT-PCR and western blot analysis were used to evaluate GDF5 expression. Overexpression of miR-7 reduced both GDF5 protein and mRNA levels, whereas GDF5 protein and mRNA were significantly up-regulated by antagomiR-7 transfection (Fig. 3c, d). These results indicate that miR-7 can directly target the 30 UTR of GDF5 and thus inhibit GDF5 gene expression. 3.5. The effect of miR-7 modulation on GDF5 expression in IL-1bstimulated NP cells An inverse correlation between miR-7 expression and GDF5 level was observed when human NP cells were stimulated with IL-
1b. IL-1b stimulation of NP cells resulted in significantly increased miR-7 expression at 12 and 24 h and suppressed GDF5 expression in a time-dependent manner (Fig. 4a and b). Subsequently, miR-7 mimic and antagomir were transfected into human NP cells and then the cells were stimulated with IL-1b. qRT-PCR and western blot analysis demonstrated that transfection of miR-7 mimic inhibited GDF-5 expression, whereas the miR-7 inhibitor elevated endogenous expression of GDF-5 at both the mRNA and protein levels in IL-1b-stimulated NP cells (Fig. 4c and d). 3.6. Silencing of miR-7 prevents IL-1b-induced matrix degradation in NP cells via GDF5 targeting To further confirm whether miR-7 mediated matrix degradation in response to IL-1b through changes in GDF5 expression, we co-transfected human NP cells with antagomiR-7 along with GDF5 siRNA and then treated the cells with IL-1b. siGDF5 significantly suppressed the mRNA and protein expression of GDF5; furthermore, the increased GDF5 level observed after transfection with antagomiR-7 alone was reduced by co-transfection with siGDF5 (Fig. 5a and b). The prevention of IL-1b-induced down-regulation of type II collagen and aggrecaneffected by miR-7 silencing was also attenuated by adding GDF5 siRNA (Fig. 5c and d). In addition, comparison between co-transfection with the antagomiR-7 and GDF5 siRNA with transfection with the antagomiR-7 alone demonstrated a remarkable increase in the expression levels of MMP13 and ADAMTS4 (Fig. 5e andf). 4. Discussion MiRNAs have been known to play important roles in diverse biological and pathological processes including cell proliferation,
1418
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
Fig. 2. MiR-7 mediates IL-1b-induced matrix degradation in NP cells. The miR-7 mimic, antagomiR-7 and their negative controls were transfected, respectively, into human NP cells. The gene and protein expression of (a, b) type II collagen and (c, d) aggrecan in NP cells at 24 h after IL-1b stimulation was analyzed by qRT-PCR and western blotting, respectively. The levels of gene and protein expression of (e, f) MMP-13 and (g, h) ADAMTS4 in NP cells at 24 h after IL-1b stimulation were determined by qRT-PCR and western blotting, respectively. The relative expression levels of mRNA in untransfected NP cells untreated with IL-1b was set to one, as control1. The untransfected NP cells treated with IL-1b were indicated as control2. b-actin was used as an internal control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to controls.
Fig. 3. GDF5 is a target gene of miR-7. (a) Schematic representation of the GDF5 30 UTR showing the putative miRNA target site. (b) The luciferase activity of the GDF5 30 UTR reporter was analyzed in HEK293 cells. MiR-7 and its negative control were co-transfected with the wild-type GDF5 30 UTR or mutant vector. The relative GDF5 mRNA (c) and protein (d) expression of transfected NP cells with mir-7 mimic, antagomir-7, and their negative controls was assessed using qRT-PCR and western blotting, respectively. b-actin was used as an internal control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to controls.
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
1419
Fig. 4. The effect of miR-7 modulation on GDF5 expression in IL-1b-stimulated NP cells. The relative (a) miR-7 and (b) GDF5 mRNA expression levels in NP cells stimulated with IL-1b for 12 and 24 h were determined using qRT-PCR. U6 or b-actin was used as an internal control for miR-7 or GDF5 detection, respectively. The relative (c) mRNA and (d) protein expression levels of GDF5 in NP cells transfected with mir-7 mimic, antagomir-7, and their negative controls at 24 h after IL-1b stimulation were determined by qRT-PCR and western blotting, respectively. b-actin was used as an internal control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to controls.
differentiation, apoptosis, and carcinogenesis [13,14,24]. In addition, the results of this study demonstrated that miR-7 can efficiently regulate IL-1b-induced NP cell matrix degeneration. Overexpression of miR-7 significantly strengthened the IL-1binduced down-regulation of aggrecan and type II collagen expression and the up-regulation of MMP-13 and ADAMTS4 expression, whereas inhibition of miR-7 function by antagomiR7prevented detrimental catabolic changes in response to IL-1b. Furthermore, we demonstrated that miR-7 selectively and directly regulates GDF5 expression by targeting the 30 UTR of the GDF5 mRNA. Previous studies have revealed that miR-7 is critical for suppressing cancer cell growth, proliferation, survival, migration, and invasion [15–17]. However, the expression level of miR-7 in degenerative NP tissues and its function in the pathogenesis of IDD is still unknown. In this study, we observed significantly higher expression of miR-7 in degenerative NP tissues. In addition, treating NP cells with IL-1b induced significant overexpression of miR-7. Therefore, we hypothesized that miR-7 has a key function in IL-1b-induced NP ECM degradation. In accordance with our hypothesis, we validated the role of miR-7 in the pathogenesis of IL-1b-induced NP cell matrix degradation. Our results provide evidence that miR-7 can regulate the expression levels of aggrecan, type II collagen, MMP13, and ADAMTS4. Previous studies had shown that the loss of aggrecan and type II collagen plays an important role in the development of disc degeneration and that MMP13 and ADAMTS 4 are primary enzymes that cleave type II collagen and aggrecan [7,25]. In addition, inactivation or down-relation of MMP-13 and ADAMTS4 has shown tremendous potential in promoting ECM restoration
[26]. During IL-1b-induced IVD degeneration, synthesis of the normal IVD matrix is inhibited and matrix-degrading enzymes perform a key function in the degenerative process [19,20]. Thus, our results suggest that miR-7 might be involved in disc matrix degradation such as that induced by proinflammatory cytokines such as IL-1b, and that down-regulation of miR-7 plays a pivotal role in preserving the fidelity of disc matrix homeostasis. As predicted by bioinformatics analysis, GDF5 was identified as a direct target of miR-7 in NP cells. Overexpression of miR-7 suppressed GDF5 30 UTR luciferase reporter activity and a mutation of the seed site efficiently abrogated miR-7-mediated repression of luciferase activity. Furthermore, our results also show that miR-7 targeted GDF5, showing that miR-7 mimic significantly decreased GDF5 mRNA and protein expression whereas an miR-7 inhibitor elevated their levels in human NP cells treated with IL-1b. These results indicate that miR-7 mediates the effect of IL-1b responses in NP cells, likely by repressing GDF5 expression. Previously, it had been demonstrated that IL-1b down-regulates GDF-5 expression in human disc cells [27], although the mechanism by which this occurred was unknown. Our results suggest that IL-1b stimulation up-regulates the expression of miR-7, which then suppresses GDF5 expression in NP cells. As a member of the TGF-b superfamily, GDF5 plays a crucial role in skeletal development and is effective in suppressing ECM degradation and in enhancing the proliferation and matrix anabolism of IVD cells [10]. Overexpression of GDF5 significantly enhances type II collagen and aggrecan gene expression in IVD cells, whereas down-regulation of GDF5 attenuates these processes [28,29]. Additionally, it is possible that GDF5 suppress the catabolic metabolism in IVD through down-regulatingthe
1420
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
Fig. 5. Silencing of miR-7 prevents IL-1b-induced matrix degradation in NP cells via GDF5 targeting The NP cells were co-transfected with antagomiR-7 along with GDF5 siRNA and their negative controls and then treated with IL-1b 24 h post-miRNA transfection. mRNA levels of (a)GDF5, (c)type II collagen, (d)aggrecan, (e) MMP-13, and (f) ADAMTS4 were analyzed by qRT-PCR. (b) Protein levels of GDF5 were analyzed by western blot. b-actin was used as an internal control. The relative expression levels of mRNA in untransfected NP cells untreated with IL-1b was set to one, as a control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to controls.
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
expression of catabolic genes such as MMPs [11]. In our study, the prevention of IL-1b-induced down-regulation of aggrecan and type II collagen and up-regulation of MMP13 and ADAMTS4 effected by silencing of miR-7 was attenuated by the addition ofGDF5 siRNA. This suggests that miR-7 regulates IL-1b-induced NP cell homeostasis through modification of GDF5 expression. The present study has some limitations. The mechanism underlying the significant overexpression of miR-7 in NP cells after IL-1b treatment is still unclear. A previous study demonstrated that IL-1b treatment of NP cells can activate MAPK- and MAPK-induced up-regulation of miR-7 in pancreatic cancer cells [30,31]. However, there have been no reports regarding the relationship amongIL-1b, MAPK, and miR-7 in NP cells. Further studies are needed to clarify whether IL-1b up-regulates miR-7 by activation of MAPK signaling in NP cells, and the associated mechanism underlying this effect. In conclusion, this study provides the first evidence that miR-7 is up-regulated in human degenerative NP tissues and that miR-7 functions as a positive regulator of IL-1b-induced metabolism disturbance of human NP cells through directly targeting GDF5. These findings suggest thatmiR-7 contributes to the impaired ECM in IVDs by targeting GDF5and that miR-7 might represent a novel therapeutic target for the prevention of IDD. Author disclosure statement The authors declare that they have no competing interests. Acknowledgement This work was supported by National Natural Science Foundation of China (grant no.81272025). References [1] G. Waddell, Low back pain: a twentieth century health care enigma, Spine 21 (1996) 2820–2825. [2] L.C. Lambeek, M.W. van Tulder, I.C. Swinkels, et al., The trend in total cost of back pain in The Netherlands in the period 2002–2007, Spine 36 (2011) 1050– 1058. [3] K.M. AladinD.M. Cheung, D. Chan, et al., Expression of the Trp2 allele of COL9A2 is associated with alterations in the mechanical properties of human intervertebral discs, Spine 32 (2007) 2820–2826. [4] A. LotzJ.C. Staples, A. Walsh, et al., Mechanobiology in intervertebral disc degeneration and regeneration, Conf. Proc. IEEE Eng. Med. Biol. Soc. 7 (2004) 5459. [5] S.R. Pye, D.M. Reid, J.E. Adams, et al., Influence of weight: body mass index and lifestyle factors on radiographic features of lumbar disc degeneration, Ann. Rheum. Dis. 66 (2007) 426–427. [6] N. Boos, S. Weissbach, H. Rohrbach, l. eta, Classification of age-related changes in lumbar intervertebral discs: 2002 Volvo award in basic science, Spine 27 (2002) 2631–2644. [7] N.V. Vo, R.A. Hartman, T. Yurube, et al., Expression and regulation of metalloproteinases and their inhibitors in intervertebral disc aging and degeneration, Spine J. 13 (2013) 331–341.
1421
[8] C.L. Le Maitre, A.J. Freemont, J.A. Hoyland, Localization of degradative enzymes and their inhibitors in the degenerate human intervertebral disc, J. Pathol. 204 (2004) 47–54. [9] C.L. Le Maitre, A.J. Freemont, J.A. Hoyland, Human disc degeneration is associated with increased MMP 7 expression, Biotech. Histochem. 81 (2006) 125–131. [10] C.L. Le Maitre, A.J. Freemont, J.A. Hoyland, Expression of cartilage-derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells, Arthritis Res. Ther. 11 (2009) R137. [11] M. Cui, Y. Wan, D.G. Anderson, et al., Mouse growth and differentiation factor-5 protein and DNA therapy potentiates intervertebral disc cell aggregation and chondrogenic gene expression, Spine J. 8 (2008) 287–295. [12] T. Chujo, H.S. An, K. Akeda, et al., Effects of growth differentiation factor-5 on the intervertebral disc–in vitro bovine study and in vivo rabbit disc degeneration model study, Spine 31 (2006) 2909–2917. [13] D.P. Bartel, MicroRNAs: genomics, biogenesis, mechanism, and function, Cell 116 (2004) 281–297. [14] C.Z. Chen, L. Li, H.F. Lodish, et al., MicroRNAs modulate hematopoietic lineage differentiation, Science 303 (2004) 83–86. [15] F.C. Kalinowski, K.M. Giles, P.A. Candy, et al., Regulation of epidermal growth factor receptor signaling and erlotinib sensitivity in head and neck cancer cells by miR-7, PLoS One 7 (2012) e47067. [16] K.M. Giles, R.A. Brown, M.R. Epis, et al., MiRNA-7-5p inhibits melanoma cell migration and invasion, Biochem. Biophys. Res. Commun. 430 (2013) 706–710. [17] F.C. Kalinowski, R.A. Brown, C. Ganda, et al., MicroRNA-7: a tumor suppressor miRNA with therapeutic potential, Int. J. Biochem. Cell Biol. 54 (2014) 312–317. [18] A.D. Chaudhuri, D.C. Choi, S. Kabaria, et al., MicroRNA-7 regulates the function of mitochondrial permeability transition pore by targeting VDAC1 expression, J. Biol. Chem. 291 (2016) 6483–6493. [19] C.L. Le Maitre, J.A. Hoyland, A.J. Freemont, Catabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1beta and TNFalpha expression profile, Arthritis Res. Ther. 9 (2007) R77. [20] J.M. Lee, J.Y. Song, M. Baek, et al., Interlukin-1b induces angiogenesis and innervation in human intervertebral disc degeneration, J. Orthop. Res. 29 (2011) 265–269. [21] X. GuS.X. Li, J.L. Hamilton, et al., MicroRNA-146a reduces IL-1 dependent inflammatory responses in the intervertebral disc, Gene 555 (2015) 80–87. [22] C.W. Pfirrmann, A. Metzdorf, M. Zanetti, et al., Magnetic resonance classification of lumbar intervertebral disc degeneration, Spine 26 (2001) 1873–1878. [23] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta DeltaC(T)) method, Methods 25 (2001) 402–408. [24] A. Ruepp, A. Kowarsch, F. Theis, R. Phenomi, microRNAs in human diseases and biological processes, Methods MolBiol. 822 (2012) 249–260. [25] S.S. Sivan, E. Wachtel, P. Roughley, Structure, function, aging and turnover of aggrecan in the intervertebral disc, Biochim. Biophys. Acta 1840 (2014) 3181– 3189. [26] C.L. Le Maitre, A. Pockert, D.J. Buttle, et al., Matrix synthesis and degradation in human intervertebral disc degeneration, Biochem. Soc. Trans. 35 (2007) 652– 655. [27] H.E. Gruber, G.L. Hoelscher, J.A. Ingram, et al., Growth and differentiation factor-5 (GDF-5) in the human intervertebral annulus cells and its modulation by IL-1ß and TNF-a in vitro, Exp. Mol. Pathol. 96 (2014) 225–229. [28] H. Liang, S.Y. Ma, G. Feng, et al., Therapeutic effects of adenovirus-mediated growth and differentiation factor-5 in a mice disc degeneration model induced by annulus needle puncture, Spine J. 10 (2010) 32–41. [29] X. Li, B.M. Leo, G. Beck, et al., Collagen and proteoglycan abnormalities in the GDF-5-deficient mice and molecular changes when treating disk cells with recombinant growth factor, Spine 29 (2004) 2229–2234. [30] Jianru Wang, Ye Tian, L.E. Kate Phillips, et al., TNF-a and IL-1b dependent induction of CCL3 expression by nucleus pulposus cells promotes macrophage migration through CCR1, Arthritis Rheum. 65 (2013) 832–842. [31] Yushi Ikeda, Etsuko Tanji, Naohiko Makino, et al., MicroRNAs associated with mitogen-activated protein kinase in human pancreatic cancer, Mol. Cancer Res. 10 (2011) 259–269.
Available online at
ScienceDirect www.sciencedirect.com
MicroRNA-7 regulates IL-1b-induced extracellular matrix degeneration by targeting GDF5 in human nucleus pulposus cells Wei Liua,b,1, Yukun Zhanga,1, Ping Xiab , Shuai Lia , Xintong Fenga , Yong Gaoa , Kun Wanga , Yu Songa , Zhenfeng Duanc , Shuhua Yanga , Zengwu Shaoa , Cao Yanga,* a Department of Orthopedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Jiefang Road, No. 1277,Wuhan 430022, China b Department of Orthopedics, First Hospital of Wuhan, Zhongshan Road, No.215, Wuhan 430022, China c Sarcoma Biology Laboratory, Center for Sarcoma and Connective Tissue Oncology, Massachusetts General Hospital, 100 Blossom St., Jackson 1106, Boston, MA, 02114, USA
A R T I C L E I N F O
Article history: Received 3 June 2016 Received in revised form 1 August 2016 Accepted 25 August 2016 Keywords: Intervertebral disc degeneration miR-7 GDF5 Nucleus pulposus IL-1b
A B S T R A C T
The precise role of interleukin-1 beta (IL-1b)-induced extracellular matrix degeneration in the pathogenesis of intervertebral disc degeneration (IDD) is currently unknown. Recent evidence has revealed that microRNAs (miRNAs) are associated with IDD, but their function in the extracellular matrix degradation of nucleus pulposus (NP) tissues is also poorly understood. The aim of this study was to evaluate the expression and functional role of miR-7 in IL-1b-induced disc degeneration. The expression level of miR-7 was investigated in degenerative NP tissues and in IL-1b-induced NP cells using quantitative reverse transcription-polymerase chain reaction amplification analysis. A dual-luciferase reporter assay was then utilized to determine whether growth differentiation factor 5 (GDF5) is a target of miR-7. Finally, mRNA and protein levels of known matrix components and of matrix degradation enzymes were determined to elucidate the function of miR-7 in IL-1b-induced disc degeneration. In this study, we found that miR-7 is highly expressed in human degenerative NP tissues and in IL-1b stimulated NP cells compared to normal controls. We also determined that GDF5 was a target of miR-7. Functional analysis showed that the overexpression of miR-7 significantly enhanced the IL-1b-induced extracellular matrix degeneration, whereas inhibition of miR-7 function by antagomiR-7 prevented NP cell detrimental catabolic changes in response to IL-1b. Additionally, the prevention of IL-1b-induced NP extracellular matrix degeneration by miR-7 silencing was attenuated by GDF5 siRNA. These findings suggest that miR-7 contributes to an impaired ECM in intervertebral discs through targeting GDF5 and miR-7 might therefore represent a novel therapeutic target for the prevention of IDD. ã 2016 Elsevier Masson SAS. All rights reserved.
1. Introduction Chronic lower back pain resulting from intervertebral disc (IVD) degeneration (IDD) is a global burden with severe healthcare and socioeconomic consequences [1,2]. Both the etiology of IDD and the cause of the resulting lower back pain are poorly understood, although the current consensus is that the former is complex and multifactorial, involving age, genetics, and biomechanical and environmental factors such as immobilization, trauma, tobacco use, diabetes, vascular disease, and infection [3–6]. Although multiple factors are involved in triggering IDD, IDD is generally
* Corresponding author. E-mail address: [email protected] (C. Yang). These authors contributed equally to this work.
1
http://dx.doi.org/10.1016/j.biopha.2016.08.062 0753-3322/ã 2016 Elsevier Masson SAS. All rights reserved.
believed to represent an imbalance between anabolism and catabolism of the extracellular matrix (ECM), leading to large structural changes therein. During IDD, the cells of the IVD function abnormally with decreased synthesis of normal IVD matrix components and increased production of degradative enzyme matrix metalloproteinases (MMPs) and ADAMTSs, which constitute a disintegrin and metalloproteinase with thrombospondin motifs; consequently, the normal homeostatic metabolism in the IVD is lost [7–9]. Among the multiple molecular events involved in IDD, GDF5, also known as cartilage-derived morphogenetic protein-1 (CDMP-1), has been shown to play important roles. In humans, GDF5 was shown to be expressed in both nondegenerate and degenerate IVD, particularly in cells of the NP. However, the number of cells expressing GDF5 decreased in degenerate human IVDs. Conversely, treatment of human NP cells
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
with GDF5 led to increase expression of the aggrecan and type II collagen genes and increased production of proteoglycans (e.g., glycosaminoglycans (GAGs)) [10]. In addition, the treatment of mouse disc cells with recombinant GDF-5 protein in vitro decreasedMMP-3 gene expression [11]. Furthermore, GDF-5 has been shown to enhance the proliferation of bovine NP cells in vitro [12]. Together, these data identify GDF5 as a potential regulator of matrix metabolism and NP cell survival. MicroRNAs, a class of non-coding small RNAs, control gene expression primarily through base-pairing with the 3 untranslated regions (30 UTRs) of their target mRNAs and triggering either the repression of translation or the RNA degradation thereof [13]. Accumulating evidence has shown that miRNAs participate in regulating multiple cellular processes including cell proliferation, differentiation, and apoptosis [13,14]. However, to date the pathogenesis of IDD in relation to miRNAs is still unclear. Consequently, the functions of miRNAs in the pathogenesis of IDD warrant further analysis. MiR-7, originally identified as a tumor suppressor in several types of cancer, has been shown to suppress cancer cell growth, proliferation, survival, migration, and invasion [15–17]. However, as of yet there have been no reports regarding the functional activity of miR-7 in spine tissue. The potent proinflammatory cytokine IL-1b plays a pivotal role in the pathogenesis of IDD by decreasing synthesis of the normal IVD matrix and promoting production of degradative enzymes [19,20]. Furthermore, IL-1b-induced IVD degeneration can be reduced by miRNAs such as mir-146a [21]. However, to our knowledge this is the only current report related to the function of miRNAs in IL-1b-induced NP ECM degradation. Thus, the relationship between the two remains to be further investigated. Here, we examined the relative miR-7 expression levels in human degenerative NP tissues and in IL-1b stimulated NP cells and explored the mechanism of miR-7 action in IL-1b-induced IVD degeneration. Our results suggest that miR-7 acts as a novel regulator of NP ECM homeostasis by suppressing GDF5 expression in human NP cells and that alteration of miR-7 expression might significantly affect IL-1b-induced IDD. 2. Materials and methods 2.1. Patients and samples Human lumbar NP specimens were collected from patients with idiopathic scoliosis (n = 8, average age 21.8, range 18–40 years) and from patients with IDD (n = 12, average age 27.4, range 20–42 years). Routine MRI scans of the lumbar spine were taken prior to the operation and the degree of disc degeneration was graded from the T2-weighted images using a modified Pfirrmann classification [22]. All of the experimental protocols were approved by the Clinical Research Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology and all patients or their parents (on behalf of children) provided informed consent. 2.2. Isolation and primary culture of human NP cells Four normal tissue specimens were collected from the patients with idiopathic scoliosis and were first washed twice in PBS and then the NP tissue was separated from the annulus fibrosus using a stereotaxic microscope and cut into pieces (2–3 mm3). The NP cells were released from the normal NP tissues by incubation with 0.25 mg/mL type II collagenase (Invitrogen, Carlsbad, CA, USA) for 8 h at 37 C in Dulbecco’s modified Eagle medium (DMEM; Gibco, Grand Island, NY, USA). After isolation, the NP cells were
1415
resuspended in DMEM containing 15% fetal bovine serum (FBS; Gibco), 100 mg/mL streptomycin, 100 U/mL penicillin, and 1% Lglutamine and then incubated at 37 C in a humidified atmosphere with 95% (v/v) air and 5% (v/v) CO2. The culture medium was replaced twice a week with the exception that the primary cells were allowed more time (6.7 1.4 days) to adhere prior to the first change. The confluent cells were dissociated by trypsinization, and second-passage cells were used for subsequent experiments.The NP cells from two IDD NP specimens were cultured according to the method described above. Second-passage cells were used for IL-1b treatment and as the control. HEK293 cells (American Type Culture Collection, Manassas, VA, USA) were cultured in DMEM containing 10% FBS and incubated at 37 C with 5% CO2 in a humidified incubator. The culture medium was replaced every 3 days. 2.3. Cell treatment When cultured NP cells from two IDD NP specimens reached 80% confluence, the cells(2 105 cells/well) were seeded in 6-well plates and subjected to serum starvation overnight to synchronize the cell cycles. The cells were then stimulated with 10 ng/mL recombinant human IL-1b (Sino Biological Inc., North Wales, PA, USA) for 24 h and harvested for mRNA and protein analysis. 2.4. Transfection The miR-7 (mimic), antagomiR-7 (inhibitor), and their negative controls were purchased from GenePharma (Shanghai, China). MiR-7 (50 nM), antagomiR-7 (150 nM) or their negative controls were transfected, respectively, into cells at 80% confluence using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 24 h of transfection, cells were treated with IL-1b (10 ng/mL) (Sino Biological Inc., North Wales, PA, USA) for 24 h. Cells were then harvested for subsequent experiments. GDF5 siRNAs and their negative controls were purchased from GenePharma. After validation of their inhibition efficacies, a selective GDF5 siRNA (150 nM) or negative control was cotransfected with antagomiR-7 (150 nM) into cells cultured in a 6-well plate using Lipofectamine 2000. 2.5. RNA extraction and quantitative real-time PCR (qRT-PCR) Total RNA was isolated from the harvested cells and tissues using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. After determination of RNA concentration using spectrophotometry, total RNA was reverse transcribed using PrimeScript RT Master Mix (TakaRa, Dalian, China) according to manufacturer's instructions. cDNA coding genes and miR-7 were amplified using Power SYBR Green PCR Master Mix on a 7900HT thermocycler (Applied Biosystems; Foster City, CA, USA). Briefly, the RNA was denatured for 5 min at 70 C and placed on ice for 5 min. Denatured RNA was added to a mixture of MMLV-RT, MMLVRT buffer, HRP (RRI)/RNase inhibitor, and dNTPs and incubated for 60 min at 42 C. Then, the reagent was inactivated by heating at 95 C for 5 min. Following amplification, the relative gene expression levels were calculated using the 2DDCT method [23]. The expression levels of b-actin and U6 were used as endogenous controls to normalize each mRNA and miRNA, respectively. The primers used are shown in Table 1 and miR-7 loop primer was as follows: 50 -GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAACAAA. All experiments were performed at least in triplicate.
1416
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
Table 1 List of Primers Used in qRT-PCR. Name
Primer
Sequence
Homo U6
F R F R F R F R F R F R F R F R
50 - CGCTTCGGCAGCACATATAC 30 50 - AAATATGGAACGCTTCACGA-30 50 - TGCGCTGGAAGACTAGTGATTTT-30 50 - CCAGTGCAGGGTCCGAGGTATT-30 50 - AGCGAGCATCCCCCAAAGTT 30 50 - GGGCACGAAGGCTCATCATT 30 50 - CGATAAGACCGTGTATGAGT-30 50 - CTCGCAGTGGAAAGCCTCGT-30 50 - TGAGCGGCAGCACTTTGAC 30 50 - TGAGTACAGGAGGCTTGAG 30 50 - TCCAGATGACCTTCCTACGC 30 50 - GGTATGTTTCGTGCAGCCAT 30 50 - GCAGTCTTTCTTCGGCTTAG 30 50 - CATTGTATTCACCCACATCAG 30 50 -ACTGGGCTACTACTATGTGCTGGA-30 50 -CACACACCATGCACTTGTCGAACT-30
hsa-miR-7 Homo b-actin Homo GDF5 Homo aggrecan Homo Collagen Homo MMP13 Homo ADAMTS4
2.6. Luciferase constructs and the reporter assay The full length GDF5 30 UTR was obtained via PCR using the primers 50 -GCG CTC GAG TGC CAA CAA CGT GGT GTA T-30 and 50 AAT GCG GCC GCC ACA GTT TTA GGC ACA GTT-30 , and then cloned into the XhoI/NotI site of the pmiR-RB-Report vector (RiboBio Co., Guangzhou, China) to generate the wild-type pmiR-GDF5 plasmid. To produce constructs that carry mutations at the putative miR-7– binding site in the wild-type GDF5 30 UTR, we performed sitedirected mutagenesis to generate the mutant-type pmiR-GDF5 plasmid construct (primers: FW: 50 -GGC CCT CTC AGA AGG TGG GTG GCA CAT CCC AAG-30 , and RV: 50 -GCC ACC CAC CTT CTG AGA GGG CCA GTG CTG CTA-30 ), with wild-type pmiR-GDF5 as a template. All of the constructs were verified by sequencing. For luciferase activity analysis, HEK293 cells were co-transfected with a combination of 200 ng wild-type pmiR-GDF5 plasmid or mutanttype pmiR-GDF5 plasmid and 100 nM miR-7 mimic or the miR-7 negative control using Lipofectamine 2000 in 48-well plates. After 24 h, cell lysates were prepared and subjected to luciferase assays using the Dual-Luciferase1 Reporter Assay System(Promega, Madison,WI,USA),according to the manufacturer’s instructions. Each experiment was performed three times. 2.7. Western blotting The culture supernatants were collected and the cells were washed with cold PBS and lysed for 20 min in cold RIPA Lysis Buffer (Beyotime, Beijing, China). The extracted proteins were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After blocking in 10% non-fat dried milk in TBST for 2 h, the blots were incubated with anti-GDF5 (ab93855, Abcam, Cambridge, UK), anti-aggrecan (ab3778, Abcam), anti-collagen type II (ab34712, Abcam), anti-mmp-13 (Ab39012, Abcam), anti-adamts-4 (Eap1002, Elabscience), and anti- b-actin (ab8227, Abcam) overnight at 4 C. b-Actin served as an internal control. After washes in TBST, the immobilized primary antibodies were then incubated with anti-rabbit IgG conjugated to IRDye(800CW) for 1 h at 25 C and visualized with the Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, USA). 2.8. Statistical analysis The results are presented as means standard deviation (SD). The statistical analysis was performed using SPSS 20.0 software (SPSS, Chicago, IL, USA). Two groups were compared using the
independent samples t test, and three or more groups were compared by one-way analysis of variance (ANOVA) followed by post hoc analysis. A P-value < 0.05 was considered as a statistically significant difference. 3. Results 3.1. MiR-7 expression is up-regulated in degenerative NP tissues and in IL-1b stimulated NP cells As a multi-functional miRNA, miR-7 is expressed in diverse tissues, and aberrant expression of miR-7 has been associated with various diseases [15–18]. To determine the regulatory effect of miR-7 in the processes of IDD, relative expression of miR-7 in four idiopathic scoliosis NP tissues and ten degenerative NP tissues was determined by qRT-PCR. As shown in Fig. 1a, miR-7 was significantly up-regulated in degenerative NP tissues in comparison with controls. Subsequently, human NP cells were treated with IL-1b for 24 h. Relative expression of miR-7 was determined by qRT-PCR. Untreated NP cells were used as controls. Our results demonstrated that miR-7 was significantly up-regulated in NP cells treated with IL-1b compared to untreated cells. (Fig. 1b). 3.2. Stimulation of NP cells with IL-1b recapitulated IDD in vitro To explore whether stimulation of NP cells with IL-1b could simulate IDD, human NP cells from IDD NP specimens were treated with IL-1b, and the expression of type II collagen, aggrecan, MMP13, and ADAMTS-4 was analyzed by qRT-PCR and western blot. The mRNA expression and protein concentrations of type II collagen and aggrecan were decreased in NP cells treated with IL-1b in comparison with untreated cells (Fig. 1c and d). In addition, IL-1b treatment significantly increased MMP-13 and ADAMTS-4 mRNA and protein expression in human NP cells (Fig. 1c and d). 3.3. MiR-7 mediates IL-1b-induced matrix degradation in NP cells To understand whether miR-7 has an effect the IL-1b-induced matrix degradation process, miR-7 mimic and an antagomir were transfected into human NP cells and then the cells were stimulated with IL-1b. After NP cell treatment with IL-1b for 24 h, we quantified the mRNA expression of type II collagen and aggrecan using qRT-PCR. We found that the expression of type II collagen and aggrecan in NP cells was significantly decreased after treatment with IL-1b (Fig. 2a and c). In addition,overexpression of miR-7 strengthened the IL-1b-induced down-regulation of type II collagen and aggrecan mRNA expression. However, the miR-7 antagomir resulted in a significant suppression of IL-1b-induced type II collagen and aggrecan mRNA down-regulation (Fig. 2a and c). Western blotting was then used to evaluate the protein concentration of type II collagen and aggrecan. Similar to the changes observed for mRNA expression, the concentrations of type II collagen and aggrecan were significantly decreased after treatment with IL-1b (Fig. 2b and d). Overexpression of miR-7 led to decreased type II collagen and aggrecan protein concentrations in NP cells stimulated with IL-1b. On the other hand, silencing of miR-7 inhibited the effects of IL-1b and resulted in maintenance of type II collagen and aggrecan content(Fig. 2b and d). We also used qRT-PCR and western blot analysis to analyze the expression of genes encoding catabolic factors, including MMP-13 and ADAMTS4, in NP cells that were transfected with either miR-7 mimic or antagomiR-7 and then stimulated with IL-1b. We found that miR-7 overexpression significantly increased the mRNA expression and protein concentrations of MMP-13 and ADAMTS4
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
1417
Fig. 1. MiR-7 expression is up-regulated in degenerative NP tissues and in IL-1b stimulated NP cells. (a) MiR-7 had significantly higher expression in degenerative NP tissues than in normal controls. (b) The expression of miR-7 is significantly higher in NP cells treated with IL-1b compared to untreated cells. Human NP cells from IDD NP specimens were treated with IL-1b, and the (c) gene and (d) protein expression of type II collagen, aggrecan, MMP-13, and ADAMTS-4 was analyzed by qRT-PCR and western blot. U6 or b-actin was used as an internal control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to control.
upon stimulation with IL-1b (Fig. 2e–h). In turn, repression of miR7 had the opposite effect (Fig. 2e–h). 3.4. GDF5 is a target gene of miR-7 To investigate how miR-7 effects IL-1b-induced matrix degradation of NP cells, we predicted the target genes of miR-7 using miRanda (http://www.microrna.org/) and Microcosm Targets Version 5 (http://www.ebi.ac.uk/enright-srv/microcosm/ htdocs/targets/v5/). Notably, we identified considerable complementarity between the seed region of the miR-7 and the 30 UTR of GDF5 (Fig. 3a). In the validation of these database results, a distinct decrease (P < 0.01) in luciferase activity was measured in cells cotransfected with miR-7 mimic and pmiR-GDF5 (WT). In addition, a mutation of the miR-7 binding sequence located at 16–22 nt of the GDF5 30 UTR (Mut) evidently abrogated the repression of the luciferase activity owing to miR-7 overexpression (Fig. 3b). Furthermore, to verify GDF5 as a target of miR-7 in NP cells, the NP cells were transfected with the miR-7 mimic and antagomiR-7 and their negative controls.qRT-PCR and western blot analysis were used to evaluate GDF5 expression. Overexpression of miR-7 reduced both GDF5 protein and mRNA levels, whereas GDF5 protein and mRNA were significantly up-regulated by antagomiR-7 transfection (Fig. 3c, d). These results indicate that miR-7 can directly target the 30 UTR of GDF5 and thus inhibit GDF5 gene expression. 3.5. The effect of miR-7 modulation on GDF5 expression in IL-1bstimulated NP cells An inverse correlation between miR-7 expression and GDF5 level was observed when human NP cells were stimulated with IL-
1b. IL-1b stimulation of NP cells resulted in significantly increased miR-7 expression at 12 and 24 h and suppressed GDF5 expression in a time-dependent manner (Fig. 4a and b). Subsequently, miR-7 mimic and antagomir were transfected into human NP cells and then the cells were stimulated with IL-1b. qRT-PCR and western blot analysis demonstrated that transfection of miR-7 mimic inhibited GDF-5 expression, whereas the miR-7 inhibitor elevated endogenous expression of GDF-5 at both the mRNA and protein levels in IL-1b-stimulated NP cells (Fig. 4c and d). 3.6. Silencing of miR-7 prevents IL-1b-induced matrix degradation in NP cells via GDF5 targeting To further confirm whether miR-7 mediated matrix degradation in response to IL-1b through changes in GDF5 expression, we co-transfected human NP cells with antagomiR-7 along with GDF5 siRNA and then treated the cells with IL-1b. siGDF5 significantly suppressed the mRNA and protein expression of GDF5; furthermore, the increased GDF5 level observed after transfection with antagomiR-7 alone was reduced by co-transfection with siGDF5 (Fig. 5a and b). The prevention of IL-1b-induced down-regulation of type II collagen and aggrecaneffected by miR-7 silencing was also attenuated by adding GDF5 siRNA (Fig. 5c and d). In addition, comparison between co-transfection with the antagomiR-7 and GDF5 siRNA with transfection with the antagomiR-7 alone demonstrated a remarkable increase in the expression levels of MMP13 and ADAMTS4 (Fig. 5e andf). 4. Discussion MiRNAs have been known to play important roles in diverse biological and pathological processes including cell proliferation,
1418
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
Fig. 2. MiR-7 mediates IL-1b-induced matrix degradation in NP cells. The miR-7 mimic, antagomiR-7 and their negative controls were transfected, respectively, into human NP cells. The gene and protein expression of (a, b) type II collagen and (c, d) aggrecan in NP cells at 24 h after IL-1b stimulation was analyzed by qRT-PCR and western blotting, respectively. The levels of gene and protein expression of (e, f) MMP-13 and (g, h) ADAMTS4 in NP cells at 24 h after IL-1b stimulation were determined by qRT-PCR and western blotting, respectively. The relative expression levels of mRNA in untransfected NP cells untreated with IL-1b was set to one, as control1. The untransfected NP cells treated with IL-1b were indicated as control2. b-actin was used as an internal control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to controls.
Fig. 3. GDF5 is a target gene of miR-7. (a) Schematic representation of the GDF5 30 UTR showing the putative miRNA target site. (b) The luciferase activity of the GDF5 30 UTR reporter was analyzed in HEK293 cells. MiR-7 and its negative control were co-transfected with the wild-type GDF5 30 UTR or mutant vector. The relative GDF5 mRNA (c) and protein (d) expression of transfected NP cells with mir-7 mimic, antagomir-7, and their negative controls was assessed using qRT-PCR and western blotting, respectively. b-actin was used as an internal control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to controls.
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
1419
Fig. 4. The effect of miR-7 modulation on GDF5 expression in IL-1b-stimulated NP cells. The relative (a) miR-7 and (b) GDF5 mRNA expression levels in NP cells stimulated with IL-1b for 12 and 24 h were determined using qRT-PCR. U6 or b-actin was used as an internal control for miR-7 or GDF5 detection, respectively. The relative (c) mRNA and (d) protein expression levels of GDF5 in NP cells transfected with mir-7 mimic, antagomir-7, and their negative controls at 24 h after IL-1b stimulation were determined by qRT-PCR and western blotting, respectively. b-actin was used as an internal control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to controls.
differentiation, apoptosis, and carcinogenesis [13,14,24]. In addition, the results of this study demonstrated that miR-7 can efficiently regulate IL-1b-induced NP cell matrix degeneration. Overexpression of miR-7 significantly strengthened the IL-1binduced down-regulation of aggrecan and type II collagen expression and the up-regulation of MMP-13 and ADAMTS4 expression, whereas inhibition of miR-7 function by antagomiR7prevented detrimental catabolic changes in response to IL-1b. Furthermore, we demonstrated that miR-7 selectively and directly regulates GDF5 expression by targeting the 30 UTR of the GDF5 mRNA. Previous studies have revealed that miR-7 is critical for suppressing cancer cell growth, proliferation, survival, migration, and invasion [15–17]. However, the expression level of miR-7 in degenerative NP tissues and its function in the pathogenesis of IDD is still unknown. In this study, we observed significantly higher expression of miR-7 in degenerative NP tissues. In addition, treating NP cells with IL-1b induced significant overexpression of miR-7. Therefore, we hypothesized that miR-7 has a key function in IL-1b-induced NP ECM degradation. In accordance with our hypothesis, we validated the role of miR-7 in the pathogenesis of IL-1b-induced NP cell matrix degradation. Our results provide evidence that miR-7 can regulate the expression levels of aggrecan, type II collagen, MMP13, and ADAMTS4. Previous studies had shown that the loss of aggrecan and type II collagen plays an important role in the development of disc degeneration and that MMP13 and ADAMTS 4 are primary enzymes that cleave type II collagen and aggrecan [7,25]. In addition, inactivation or down-relation of MMP-13 and ADAMTS4 has shown tremendous potential in promoting ECM restoration
[26]. During IL-1b-induced IVD degeneration, synthesis of the normal IVD matrix is inhibited and matrix-degrading enzymes perform a key function in the degenerative process [19,20]. Thus, our results suggest that miR-7 might be involved in disc matrix degradation such as that induced by proinflammatory cytokines such as IL-1b, and that down-regulation of miR-7 plays a pivotal role in preserving the fidelity of disc matrix homeostasis. As predicted by bioinformatics analysis, GDF5 was identified as a direct target of miR-7 in NP cells. Overexpression of miR-7 suppressed GDF5 30 UTR luciferase reporter activity and a mutation of the seed site efficiently abrogated miR-7-mediated repression of luciferase activity. Furthermore, our results also show that miR-7 targeted GDF5, showing that miR-7 mimic significantly decreased GDF5 mRNA and protein expression whereas an miR-7 inhibitor elevated their levels in human NP cells treated with IL-1b. These results indicate that miR-7 mediates the effect of IL-1b responses in NP cells, likely by repressing GDF5 expression. Previously, it had been demonstrated that IL-1b down-regulates GDF-5 expression in human disc cells [27], although the mechanism by which this occurred was unknown. Our results suggest that IL-1b stimulation up-regulates the expression of miR-7, which then suppresses GDF5 expression in NP cells. As a member of the TGF-b superfamily, GDF5 plays a crucial role in skeletal development and is effective in suppressing ECM degradation and in enhancing the proliferation and matrix anabolism of IVD cells [10]. Overexpression of GDF5 significantly enhances type II collagen and aggrecan gene expression in IVD cells, whereas down-regulation of GDF5 attenuates these processes [28,29]. Additionally, it is possible that GDF5 suppress the catabolic metabolism in IVD through down-regulatingthe
1420
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
Fig. 5. Silencing of miR-7 prevents IL-1b-induced matrix degradation in NP cells via GDF5 targeting The NP cells were co-transfected with antagomiR-7 along with GDF5 siRNA and their negative controls and then treated with IL-1b 24 h post-miRNA transfection. mRNA levels of (a)GDF5, (c)type II collagen, (d)aggrecan, (e) MMP-13, and (f) ADAMTS4 were analyzed by qRT-PCR. (b) Protein levels of GDF5 were analyzed by western blot. b-actin was used as an internal control. The relative expression levels of mRNA in untransfected NP cells untreated with IL-1b was set to one, as a control. Data are represented as means SD. *P < 0.05, **P < 0.01 compared to controls.
W. Liu et al. / Biomedicine & Pharmacotherapy 83 (2016) 1414–1421
expression of catabolic genes such as MMPs [11]. In our study, the prevention of IL-1b-induced down-regulation of aggrecan and type II collagen and up-regulation of MMP13 and ADAMTS4 effected by silencing of miR-7 was attenuated by the addition ofGDF5 siRNA. This suggests that miR-7 regulates IL-1b-induced NP cell homeostasis through modification of GDF5 expression. The present study has some limitations. The mechanism underlying the significant overexpression of miR-7 in NP cells after IL-1b treatment is still unclear. A previous study demonstrated that IL-1b treatment of NP cells can activate MAPK- and MAPK-induced up-regulation of miR-7 in pancreatic cancer cells [30,31]. However, there have been no reports regarding the relationship amongIL-1b, MAPK, and miR-7 in NP cells. Further studies are needed to clarify whether IL-1b up-regulates miR-7 by activation of MAPK signaling in NP cells, and the associated mechanism underlying this effect. In conclusion, this study provides the first evidence that miR-7 is up-regulated in human degenerative NP tissues and that miR-7 functions as a positive regulator of IL-1b-induced metabolism disturbance of human NP cells through directly targeting GDF5. These findings suggest thatmiR-7 contributes to the impaired ECM in IVDs by targeting GDF5and that miR-7 might represent a novel therapeutic target for the prevention of IDD. Author disclosure statement The authors declare that they have no competing interests. Acknowledgement This work was supported by National Natural Science Foundation of China (grant no.81272025). References [1] G. Waddell, Low back pain: a twentieth century health care enigma, Spine 21 (1996) 2820–2825. [2] L.C. Lambeek, M.W. van Tulder, I.C. Swinkels, et al., The trend in total cost of back pain in The Netherlands in the period 2002–2007, Spine 36 (2011) 1050– 1058. [3] K.M. AladinD.M. Cheung, D. Chan, et al., Expression of the Trp2 allele of COL9A2 is associated with alterations in the mechanical properties of human intervertebral discs, Spine 32 (2007) 2820–2826. [4] A. LotzJ.C. Staples, A. Walsh, et al., Mechanobiology in intervertebral disc degeneration and regeneration, Conf. Proc. IEEE Eng. Med. Biol. Soc. 7 (2004) 5459. [5] S.R. Pye, D.M. Reid, J.E. Adams, et al., Influence of weight: body mass index and lifestyle factors on radiographic features of lumbar disc degeneration, Ann. Rheum. Dis. 66 (2007) 426–427. [6] N. Boos, S. Weissbach, H. Rohrbach, l. eta, Classification of age-related changes in lumbar intervertebral discs: 2002 Volvo award in basic science, Spine 27 (2002) 2631–2644. [7] N.V. Vo, R.A. Hartman, T. Yurube, et al., Expression and regulation of metalloproteinases and their inhibitors in intervertebral disc aging and degeneration, Spine J. 13 (2013) 331–341.
1421
[8] C.L. Le Maitre, A.J. Freemont, J.A. Hoyland, Localization of degradative enzymes and their inhibitors in the degenerate human intervertebral disc, J. Pathol. 204 (2004) 47–54. [9] C.L. Le Maitre, A.J. Freemont, J.A. Hoyland, Human disc degeneration is associated with increased MMP 7 expression, Biotech. Histochem. 81 (2006) 125–131. [10] C.L. Le Maitre, A.J. Freemont, J.A. Hoyland, Expression of cartilage-derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells, Arthritis Res. Ther. 11 (2009) R137. [11] M. Cui, Y. Wan, D.G. Anderson, et al., Mouse growth and differentiation factor-5 protein and DNA therapy potentiates intervertebral disc cell aggregation and chondrogenic gene expression, Spine J. 8 (2008) 287–295. [12] T. Chujo, H.S. An, K. Akeda, et al., Effects of growth differentiation factor-5 on the intervertebral disc–in vitro bovine study and in vivo rabbit disc degeneration model study, Spine 31 (2006) 2909–2917. [13] D.P. Bartel, MicroRNAs: genomics, biogenesis, mechanism, and function, Cell 116 (2004) 281–297. [14] C.Z. Chen, L. Li, H.F. Lodish, et al., MicroRNAs modulate hematopoietic lineage differentiation, Science 303 (2004) 83–86. [15] F.C. Kalinowski, K.M. Giles, P.A. Candy, et al., Regulation of epidermal growth factor receptor signaling and erlotinib sensitivity in head and neck cancer cells by miR-7, PLoS One 7 (2012) e47067. [16] K.M. Giles, R.A. Brown, M.R. Epis, et al., MiRNA-7-5p inhibits melanoma cell migration and invasion, Biochem. Biophys. Res. Commun. 430 (2013) 706–710. [17] F.C. Kalinowski, R.A. Brown, C. Ganda, et al., MicroRNA-7: a tumor suppressor miRNA with therapeutic potential, Int. J. Biochem. Cell Biol. 54 (2014) 312–317. [18] A.D. Chaudhuri, D.C. Choi, S. Kabaria, et al., MicroRNA-7 regulates the function of mitochondrial permeability transition pore by targeting VDAC1 expression, J. Biol. Chem. 291 (2016) 6483–6493. [19] C.L. Le Maitre, J.A. Hoyland, A.J. Freemont, Catabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1beta and TNFalpha expression profile, Arthritis Res. Ther. 9 (2007) R77. [20] J.M. Lee, J.Y. Song, M. Baek, et al., Interlukin-1b induces angiogenesis and innervation in human intervertebral disc degeneration, J. Orthop. Res. 29 (2011) 265–269. [21] X. GuS.X. Li, J.L. Hamilton, et al., MicroRNA-146a reduces IL-1 dependent inflammatory responses in the intervertebral disc, Gene 555 (2015) 80–87. [22] C.W. Pfirrmann, A. Metzdorf, M. Zanetti, et al., Magnetic resonance classification of lumbar intervertebral disc degeneration, Spine 26 (2001) 1873–1878. [23] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta DeltaC(T)) method, Methods 25 (2001) 402–408. [24] A. Ruepp, A. Kowarsch, F. Theis, R. Phenomi, microRNAs in human diseases and biological processes, Methods MolBiol. 822 (2012) 249–260. [25] S.S. Sivan, E. Wachtel, P. Roughley, Structure, function, aging and turnover of aggrecan in the intervertebral disc, Biochim. Biophys. Acta 1840 (2014) 3181– 3189. [26] C.L. Le Maitre, A. Pockert, D.J. Buttle, et al., Matrix synthesis and degradation in human intervertebral disc degeneration, Biochem. Soc. Trans. 35 (2007) 652– 655. [27] H.E. Gruber, G.L. Hoelscher, J.A. Ingram, et al., Growth and differentiation factor-5 (GDF-5) in the human intervertebral annulus cells and its modulation by IL-1ß and TNF-a in vitro, Exp. Mol. Pathol. 96 (2014) 225–229. [28] H. Liang, S.Y. Ma, G. Feng, et al., Therapeutic effects of adenovirus-mediated growth and differentiation factor-5 in a mice disc degeneration model induced by annulus needle puncture, Spine J. 10 (2010) 32–41. [29] X. Li, B.M. Leo, G. Beck, et al., Collagen and proteoglycan abnormalities in the GDF-5-deficient mice and molecular changes when treating disk cells with recombinant growth factor, Spine 29 (2004) 2229–2234. [30] Jianru Wang, Ye Tian, L.E. Kate Phillips, et al., TNF-a and IL-1b dependent induction of CCL3 expression by nucleus pulposus cells promotes macrophage migration through CCR1, Arthritis Rheum. 65 (2013) 832–842. [31] Yushi Ikeda, Etsuko Tanji, Naohiko Makino, et al., MicroRNAs associated with mitogen-activated protein kinase in human pancreatic cancer, Mol. Cancer Res. 10 (2011) 259–269.