MicroRNA profiling of cystic fibrosis intestinal disease in mice

Molecular Genetics and Metabolism 103 (2011) 38–43

Contents lists available at ScienceDirect

Molecular Genetics and Metabolism j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / y m g m e

MicroRNA profiling of cystic fibrosis intestinal disease in mice Mark Bazett a, Alexandra Paun a, Christina K. Haston a,b,⁎ a b

Meakins-Christie Laboratories and the Department of Human Genetics, McGill University, Montreal, PQ, Canada Meakins-Christie Laboratories and the Department of Medicine, McGill University, Montreal, PQ, Canada

a r t i c l e

i n f o

Article history: Received 25 November 2010 Received in revised form 12 January 2011 Accepted 12 January 2011 Available online 27 January 2011 Keywords: Cystic fibrosis MicroRNA Mouse model Intestinal disease

a b s t r a c t Cystic fibrosis (CF) intestinal disease is characterized by alterations in processes such as proliferation and apoptosis which are known to be regulated in part by microRNAs. Herein, we completed microRNA expression profiling of the intestinal tissue from the cystic fibrosis mouse model of cystic fibrosis transmembrane conductance regulator (Cftr) deficient mice (BALBc/J Cftrtm1UNC), relative to that of wildtype littermates, to determine whether changes in microRNA expression level are part of this phenotype. We identified 24 microRNAs to be significantly differentially expressed in tissue from CF mice compared to wildtype, with the higher expression in tissue from CF mice. These data were confirmed with real time PCR measurements. A comparison of the list of genes previously reported to have decreased expression in the BALB × C57BL/6J F2 CF intestine to that of genes putatively targeted by the 24 microRNAs, determined from target prediction software, revealed 155 of the 759 genes of the expression profile (20.4%) to overlap with predicted targets, which is significantly more than the 100 genes expected by chance (p = 1 × 10− 8). Pathway analysis identified these common genes to function in phosphatase and tensin homolog-, protein kinase A-, phosphoinositide-3 kinase/Akt- and peroxisome proliferator-activated receptor alpha/retinoid X receptor alpha signaling pathways, among others, and through real time PCR experiments genes of these pathways were demonstrated to have lower expression in the BALB CF intestine. We conclude that altered microRNA expression is a feature which putatively influences both metabolic abnormalities and the altered tissue homeostasis component of CF intestinal disease. © 2011 Elsevier Inc. All rights reserved.

1. Introduction Cystic fibrosis (CF) is an autosomal recessive disorder caused by mutations in the CF transmembrane conductance regulator (CFTR) gene [1]. CF affects epithelial organs, including the intestine, where both meconium ileus and distal intestinal obstruction syndrome can occur as complications [2]. Mouse models with nonfunctional Cftr develop these complications [3,4] and are a model for clinical meconium ileus. The exact mechanism through which CFTR muta-

Abbreviations: CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane conductance regulator; miRNA, microRNA; CVA, crypt–villus axis; WT, wildtype; qRT-PCR, quantitative real-time PCR; Lipe, lipase hormone-sensitive; Plcd1, phospholipase C, delta 1; FoxO1, forkhead box O1; Ppara, peroxisome proliferator activated receptor alpha; Itga3, integrin alpha 3; Atxn10, Ataxin 10; PI3K, phosphoinositide-3-kinase; AKT, thymoma viral proto-oncogene 1; PKA, protein kinase A; RXRα, retinoid X receptor alpha; PTEN, phosphatase and tensin homolog; TGF-β, transforming growth factor-β; HGF, hepatocyte growth factor; CREB, cAMP response element binding; FXR, farnesoid X receptor; RXR, retinoid X receptor alpha. ⁎ Corresponding author at: Meakins-Christie Laboratories, Department of Medicine, McGill University, 3626 St. Urbain, Montreal, PQ, Canada H2X 2P2. Fax: +1 514 398 7483. E-mail address: [email protected] (C.K. Haston). 1096-7192/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ymgme.2011.01.012

tions lead to intestinal disease is not known but mouse models of cystic fibrosis show the disease to include mucus plugging [3,4], inflammation [5], and crypt dilation and elongation [3], which is associated with reduced apoptosis [6] and an increased rate of crypt proliferation [7]. The phenotype of CF intestinal disease includes processes which have been demonstrated to be regulated by microRNAs (miRNAs), a recently identified level of gene expression regulation. MiRNAs are non-coding RNA of 19–24 nucleotides which regulate the expression of specific genes. Through complimentary binding of a 7–8 nucleotide 5′ “seed” region, usually to the 3′ untranslated region of the specific target gene, the mRNA stability and/or translation of this gene is disrupted [8–10]. This regulation can significantly change cellular processes through a combination of one miRNA repressing multiple targets or multiple miRNAs binding to the same target [11,12]. The processes for which miRNA control has been demonstrated include, generally, cell differentiation [13,14], growth [15] and death [16,17] and specifically their effects have been shown in cancer [16], lung disease [18,19] and autoimmunity/inflammatory disease [16,20] phenotypes. Disease associated miRNA expression level has also been assessed in airway epithelial cells from CF patients, and in this context may function to alter the innate immune response [21]. In addition to these proliferative

M. Bazett et al. / Molecular Genetics and Metabolism 103 (2011) 38–43

and inflammatory responses, of relevance to CF intestinal disease is the reported miRNA action in the development of metabolic disease [16,22] and in the processes of lipid and energy metabolism [23], the genes of which are of altered expression in the cystic fibrosis intestine [5,6,24]. In this report, we investigated whether miRNAs contribute to the different phenotypic changes observed in the CF intestine by initially measuring the miRNA signature of this tissue with an array, and using bioinformatic analyses of these data to identify potential genes regulated by differentially expressed miRNA. We subsequently compared this dataset to a previously documented CF intestinal disease gene expression profile [6] to identify the putative biological functions influenced by these miRNAs in an approach similar to that used to implicate miRNAs in the pathology of heart failure [25] and of endometrosis [26]. 2. Materials and methods 2.1. Mice BALBc/J Cftrtm1UNC (BALB CF) mice were bred in house from Cftr +/− heterozygous parents. The Cftr genotype was determined using genomic DNA isolated from tails of mice clipped at 16 days of age and a previously described PCR assay [27]. All mice were housed in microisolator cages in a specific pathogen-free room and maintained on colyte in drinking water from 3 weeks of age until euthanasia at 12 weeks of age [28,29]. At this age mice were sacrificed by sodium pentobarbital overdose and the dissected ileum was immediately homogenized in TRIZOL (Invitrogen) and stored at −80 °C until RNA isolation. Animal experiments were completed under a protocol approved by the McGill University Animal Care Committee in agreement with the guidelines of the Canadian Council on Animal Care. 2.2. Histology Crypt–villus axis (CVA) measurements were obtained as previously reported [6,30]. In short, paraffin embedded tissues were cut to 5 μm and stained with hematoxylin and eosin to enable observation of intestinal structure. Crypt depth and villus height measurements were taken from an average of 25 CVA's/section and only complete and intact CVA samples were measured using image analysis (Olympus BX51, Image-Pro Plus 5.1, Media Cybernetics). Group differences were assessed with Student's T tests. All sections were scored by an observer blinded to the mouse genotype. 2.3. RNA isolation and microarray Total RNA from 4 male and 4 female CF mice, as well as 3 male and 4 female wildtype (WT) mice, was isolated using miRNeasy Mini kits according to the manufacturer's protocol (Qiagen). The RNA quality was determined by nanodrop assessment to have A260/280 values of 2.0 to 2.1. Target preparation and array hybridization were performed by Exiqon (Vedbaek, Denmark) according to their protocol. In this assay, 1 μg of total RNA from sample and reference was fluorescently labeled with Hy3 or Hy5 respectively and hybridized to a miRCURY LNA array version 11.0 (Exiqon) containing probes for all mouse miRNAs registered in miRBASE (version 12) [31]. A total of 598 miRNA probes were assessed in quadruplicate. Hybridization was performed on a Tecan HS480 hybridization station (Tecan, Männedorf, Switzerland) and the slides were scanned using an Agilent G2565BA Microarray Scanner System (Agilent Technologies, Inc.). Image analysis was carried out using ImaGene 8.0 software (BioDiscovery, Inc.). Data were background corrected [32] and normalized using the global Lowess (LOcally WEighted Scatterplot Smoothing) regression algorithm. Differential expression between CF and control tissue was determined by two tailed Student's T-tests with p b 0.0005.

39

The dataset was deposited into Genome Expression Omnibus (GEO; accession number: GEO19621).

2.4. Quantitative real-time PCR The expression of specific miRNAs was analyzed by quantitative realtime PCR (qRT-PCR) using miRCURY LNA™ miRNA PCR system according to the manufacturer's protocol (Exiqon). 25 ng of total RNA from intestinal tissue of 5 male CF mice and of 8 male WT mice was converted to cDNA using universal reverse transcriptase primers (Exiqon). cDNA samples were diluted 1:10 in water and then PCR amplified using SYBR Green master mix and specific LNA™ miRNA primers (Exiqon) for mmumiR-193 (target sequence AACUGGCCUACAAAGUCCCAGU), mmu-miR19b (target sequence UGUGCAAAUCCAUGCAAACUGA), mmu-miR-365 (target sequence UAAUGCCCCUAAAAAUCCUUAU), mmu-miR-16 (target sequence UAGCACGUAAAUAUUGGCG), and mmu-miR-106b (target sequence UAAAGUGCUGACAGUGCAGUA). Samples were run in duplicate on an Applied Biosystem's International Prism 7500 instrument. The data were normalized to a U6 RNA control and relative expression was calculated using the comparative CT method, as previously described [33]. Gene expression experiments were completed on male and female BALB CF and WT mice as described previously [34]. Briefly, 4–5 μg of total RNA from the ileal tissue was reverse transcribed with oligo(dT) 12–18Primer using Superscript™ II RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA) to cDNA. qRT-PCR assays were performed using the Applied Biosystems International Prism 7500 Sequence Detection System and assays on demand (Lipe, lipase, hormonesensitive, Assay Mm00495359_m1; Plcd1, phospholipase C, delta 1, Assay Mm00479962_m1; FoxO1, forkhead box O1, Assay Mn00390672; Ppara, peroxisome proliferator activated receptor alpha, Assay Mn00440939_m1; Itga3, integrin alpha 3, Assay Mn00442890_m1), with Ataxin 10 (Atxn10, Assay Mm00450332_m1) as the reference gene. Relative expression was calculated by the comparative CT method as previously described [33]. Differences in miRNA and gene expression, between groups defined by Cftr genotype, were assessed with Student's T tests.

2.5. MiRNA target prediction and pathway analysis Predicted targets for the most significantly differentially expressed miRNAs were identified using Targetscan Human 5.1 [35]. This database predicts mouse genes using orthologs to human annotation owing to the improved documentation of the 3′UTR region of human genes. Additional target predictions were completed using the algorithms in PicTar [36] and Diana microT 3.0 [37]. MiRNAs predicted to bind to Cftr were located using Targetscan, PicTar and Diana microT 3.0. Pathway analysis was completed by uploading specific gene lists into the Ingenuity Pathway Analysis (Ingenuity® Systems, www. ingenuity.com) and identifying the significant pathways represented in this list by application of Fisher's exact test. This test calculates the probability of an association between the genes in the list and the database pathway occurring by chance alone. The significance threshold of pathways was p b 0.005. To determine the extent of overlap between the set of predicted targets and the gene expression profiles we tested the null hypothesis of no biologically relevant overlap between the two sets. In this analysis the first set, which is the differentially expressed genes, is of size a. The second set, the miRNA predicted targets, is of size n. Under H0 the probability of obtaining k (0 to a) genes in the intersection of n the two sets equals (Cka Cn–k b ) / CN where N is the total number of genes in the genome and b = N − a. In our analysis N = 25,000, a = 759 and n = 3298. The p value was defined as the probability of obtaining k ≥ c if H0 is true, where c is the number of genes common to both sets, and in our dataset c = 155.

40

M. Bazett et al. / Molecular Genetics and Metabolism 103 (2011) 38–43

3. Results 3.1. BALB CF weight and intestinal phenotype A population of 12 week old BALB CF and WT mice was bred for the purpose of assessing the miRNA profile of the intestinal tissue. The average weight of the CF mice was significantly lower than that of WT mice in both males (21.1 ± 2.5 g versus 29.9 ± 0.5 g; p = 0.004) and females (18.5 ± 2.6 g versus 22.8 ± 0.7; p = 0.04), in agreement with prior studies of CF mice in this strain [30,38]. To confirm the phenotypic differences between CF and WT ileum, intestinal histology was reviewed. Fig. 1 shows that CVA distention was apparent in this population of cystic fibrosis mice which is in agreement with prior reports in CftrtmlUNC mice [39,40] including on the BALB/c background [30]. 3.2. MiRNA are differentially expressed in the CF ileum To determine whether the miRNA expression profile of the ileum differs between CF and WT mice we harvested the ilea from these animals and completed a microarray analysis. As shown in Fig. 2 and Appendix Table A1, 24 miRNAs were differentially expressed (p b 0.0005) between CF and WT mice, and the expression values of these miRNAs in intestinal tissue segregates the samples into groups based on CF status. All of the miRNAs differentially expressed at the p b 0.0005 level of significance were more highly expressed in tissue from CF mice than in WT mice as shown in Fig. 2. MiRNAs of decreased expression level in CF tissue, relative to WT, were evident at a lower level of significance (data not shown). Two related polycistronic miRNA clusters were located in the data. Of the miRNA 17–92 cluster,

Fig. 2. MiRNA profile of BALB CF and WT intestine. RNA was processed from the ilea of mice maintained with colyte in drinking water to 12 weeks of age. 24 miRNAs were identified to be significantly differentially expressed (p b 0.0005) in this tissue between CF and WT mice. Relative expression is log2 transformed. Red indicates over expression, and green indicates under expression compared to a reference expression level.

three (miRNA-19a, 19b, and 20a) of the six miRNA are included in Fig. 2, and the p values for two others, miRNA-17 and miRNA-18a were p = 0.0005 and p = 0.001, respectively. Of the miRNA 106b–25 cluster, miRNA-106b and miRNA-25 were significantly differentially expressed between CF and WT mice, as shown in Fig. 2, while the p value for the remaining miRNA of this cluster, miRNA-93 was p = 0.0006. In addition, a compilation of results from the Targetscan, Diana microT 3.0 and PicTar databases revealed the list of differentially expressed miRNAs to include five (miR-19a, 19b, 101b, 381, and 22) which are predicted to bind to Cftr (in WT mice). 3.3. qRT-PCR confirmation of miRNA expression To verify the differential expression of the miRNAs identified by microarray, we completed a qRT-PCR assessment of 5 miRNAs from Fig. 2 using intestinal RNA from a second population of CF and WT mice. As shown in Fig. 3, miRNAs of differential expression by array were also significantly differentially expressed by qRT-PCR. 3.4. Functional analysis of miRNA targets

Fig. 1. Intestinal histology and crypt–villus axis (CVA) measures of BALB CF and WT mice. A) Hematoxylin and eosin stained intestinal sections of representative CF and WT ilea at 400× resolution. B) Average CVA measurement of CF (n = 5) and WT mice (n = 9) showing crypt depth and villi height, ± standard deviation. * indicates a significant difference in CVA height between groups (p = 0.03). ** indicates a significant difference in crypt depth between groups (p = 0.03).

To evaluate the potential biological consequence of the differentially expressed pattern of miRNAs in the CF tissue we initially compiled a list of genes predicted to be regulated by the most significantly differentially expressed miRNAs (n = 24, Fig. 2) using Targetscan. We refer to this gene list as the “predicted targets”. As we had previously measured the gene expression profile of the ileum in 12 week old C57BL/6 × BALB F2 CF mice [6], we next assessed the extent of overlap of the genes with decreased expression in the CF tissue compared to WT, (list name = CF gene expression profile, decreased expression) with the dataset of predicted targets. Of the 3424 predicted targets, 3298 were located on the microarray chip and

M. Bazett et al. / Molecular Genetics and Metabolism 103 (2011) 38–43

Relative Expression

6

WT CF 4

*

*

*

miR-16

miR-106b

*

*

2

0 miR-19b

miR-365

miR-193

Fig. 3. MiRNA expression in the intestines of 12 week old CF and WT mice. RNA was isolated from tissue collected at necropsy and expression, relative to the U6 RNA control, was assessed by qRT-PCR. Average ± std. dev. of 5 male CF and 8 male WT mice presented. * indicates a significant difference between groups, p b 0.05.

as shown in Fig. 4, the intersection revealed 155 predicted target genes (Appendix Table A2) to overlap with the genes of decreased expression in the CF profile (n = 759). To investigate the possible significance of the overlap in predicted target genes with genes of the CF intestinal profile we calculated the number of genes expected to be common to these datasets by chance. Using the analysis presented in section 2.5, the mean number of overlapping genes in datasets of n = 759 and n = 3298, is 100.13 ± 9.18. Further, the probability of obtaining at least 155 overlapping genes in the intersection is 1 × 10− 8, indicating more commonality between the groups (CF profile and target gene list) than expected by chance alone. To determine which components of CF intestinal disease are predicted to be affected by the altered expression of miRNAs we completed pathway analysis on three lists of genes. The first list was predicted targets and part of the CF gene expression profile, decreased expression. This assessed the predicted pathways of miRNAs in CF intestine. The second list was predicted targets not part of the CF gene

Predicted Targets n= 3143, 95%

41

expression profile, decreased expression. This was an indication of the general pathways targeted by our specific miRNAs. The third list was CF genes of decreased expression and not overlapping predicted targets. This showed components of CF intestinal disease not influenced by the specific differentially expressed miRNAs. This analysis revealed the miRNAs to potentially affect particular signaling pathways such as phosphoinositide-3-kinase/thymoma viral protooncogene 1 (PI3K/AKT) and protein kinase A (PKA) signaling in CF, while metabolism pathways were prominent in the list of genes not overlapping the predicted targets as illustrated in Fig. 4. In addition, specific miRNAs targeted genes within more than one pathway. The same analyses completed using target genes predicted by Diana microT 3.0 and by PicTar resulted in similar predicted pathways to those of Fig. 4 (data not shown). To investigate genes of the pathways common to the miRNA target prediction and CF response as indeed of altered expression in the BALB CF intestine, we measured the expression of genes from PI3K/ AKT and PTEN signaling (FoxO1, Itga3), PKA signaling (Plcd1, Lipe) and CREB signaling (Plcd1) and PPARα/RXRα activation (Ppara). As shown in Fig. 5, these genes were confirmed to be differentially expressed in ileal tissue between CF and WT mice, implicating these paths as part of the CF intestinal disease response at the expression level.

4. Discussion The results of the present study provide evidence of specific miRNAs which are of altered expression in the CF mouse intestine. Secondly, through bioinformatic analysis of the predicted targets and a previously documented gene expression profile, pathways through which the miRNAs could affect CF intestinal disease were identified. MiRNA have been previously investigated in CF by analysis of their expression level in human bronchial tissue [21]. In this work Oglesby et al. reported 36 miRNAs to be more highly expressed in the tissue from CF patients than in non-CF and of these, 14 (39%) were similarly more highly expressed in murine intestinal tissue. A greater number of miRNAs of decreased expression in CF were evident in the profiling of clinical samples, compared to the data of the present mouse study, which likely indicates tissue specific, or species specific, expression

Decreased in CF/WT n=604, 80% Common Genes

Molecular Mechanisms of Cancer n=155 Axonal Guidance Signaling 20% of CF profile Renal Cell Carcinoma 5% of Predicted Targets TGF-B Signaling HGF Signaling ERK/MAPK Signaling

Histidine Metabolism Arginine and Proline Metabolism Lysine Degradation Butanoate Metabolism FXR/RXR Activation Glycerolipid Metabolism

PI3K/AKT Signaling Protein Kinase A Signaling PTEN Signaling CREB Signaling in Neurons PPARα /RXRα Activation Leptin Signaling in Obesity

Fig. 4. Pathway analysis of miRNA target genes and CF intestinal gene expression profile. Left circle is genes predicted to be targets by Targetscan of the identified set of differentially expressed miRNAs, for which probes are present on the Affymetrix MOE 430A 2.0 genechip. Right circle indicates the number of genes measured to be of decreased expression in the BALB × C57BL/6J F2 CF intestine compared to WT [6]. Common genes are present in both datasets. The most significant pathways, by IPA analysis, p b 0.005 are given for each gene list. PI3K/AKT is phosphoinositide-3-kinase/thymoma viral proto-oncogene 1, PTEN is phosphatase and tensin homolog, TGF-β is transforming growth factor-β, HGF is hepatocyte growth factor, PPAR is peroxisome proliferator-activated receptor, CREB is cAMP response element binding and FXR/RXR stands for farnesoid X receptor and retinoid X receptor alpha.

42

M. Bazett et al. / Molecular Genetics and Metabolism 103 (2011) 38–43

1.5

Relative Expression

*

WT

CF

*

*

*

*

1.0

0.5

0.0 Ppara

Itga3

Fox01

Lipe

Plcd1

Fig. 5. Gene expression in BALB CF and WT intestinal samples. The ratio of expression from the ileal tissue of 12 week old CF mice, relative to WT mice is given with the std. dev., for each gene, (CF n = 7–9, WT n = 5–7 mice per group). Each gene was significantly differentially expressed in the intestines of CF mice compared to WT, * is p b 0.05.

patterns of miRNA in the CF disease state, and may also be due to the different statistical analyses between the investigations. Among the pathways both putatively targeted by the differentially expressed miRNAs and which are a component of CF intestinal disease were PI3K/AKT, PKA and cAMP responsive element binding protein signaling, each of which is known to influence CFTR function[41–44]. For example the phosphorylation of protein kinase A sites in the regulatory domain of CFTR has been demonstrated to alter its ion transport function [41,45] and Tuo et al. [44] have shown phosphatidylinositol 3-kinase inhibitors wortmannin and LY294002 to inhibit duodenal bicarbonate secretion. In addition to potentially influencing CFTR related pathways, five of the miRNAs of significantly increased expression in the intestines of CF mice are predicted to bind to Cftr which, if confirmed, would add a new layer of regulation to this gene. The increased expression of these miRNAs in the CF intestine may be due in part to the absence of the Cftr target in these mice, and the resultant availability of these miRNAs could contribute to the intestinal phenotype by affecting the expression of non-Cftr gene targets. More investigation is needed. Further to effects on Cftr, the miRNAs were identified as part of the CF intestinal response function in regulating cellular proliferation and apoptosis, and thus may alter this feature of the CF phenotype. In detail, the miRNA clusters miR-17–92 and miR-106b–25, which were differentially expressed in the CF intestine, have been shown to have higher expression in tumor samples and to induce the proliferation of cells following transfection [46,47]. It is therefore possible that the aberrant miRNA levels of these miRNA clusters contribute to the increased crypt epithelial cell proliferation seen in the CF intestine [6,7,30]. Similar approaches have demonstrated miR-15a and miR-16, also of significantly altered expression in this study, to induce apoptosis in prostate cancer xenografts [48] and miR-101 to have this effect on hepatoma cell lines [49] which supports a putative effect on CF intestinal homeostasis. Given the distended CVA of the CF intestine, it is not clear whether the tissue level increase in specific miRNAs is due to changes in expression or occurred as a result of altered tissue composition; therefore, it is not apparent whether miRNA levels are driving the tissue change or occurred because of tissue change. An effect of miRNA levels on metabolism is predicted as peroxisome proliferation-activator receptor alpha (PPARα)/retinoid X receptor alpha (RXRα) signaling was determined to be among the processes putatively influenced by miRNAs in CF intestinal disease. The PPAR family of genes are transcription factors which regulate lipid metabolism [50], a process which can be altered in the intestines of CF patients [51] and mice [52]. The potentially affected PPARα/RXRα pathway, along with decreased expression of Ppara which is predicted to be targeted by eight of our 24 differentially expressed miRNAs,

indicates that the miRNA could be contributing to the metabolic defect in the CF intestine. Supporting the relevance of the specific finding of decreased expression of Ppara in the BALB CF intestine are data showing the gene, PPARα, to be down-regulated in lymphocytes of CF patients [53], and data validating the regulatory effect of miR-22, differentially expressed in this study, on PPARα expression [54]. Further, interactions among the signaling pathways may contribute to the intestinal response as protein kinase A signaling, a predicted component of this disease, is known to enhance PPARα activity [55]. Finally, additional components of the CF intestinal response, principally involving specific metabolic pathways, were not predicted to be regulated by miRNAs in this work which likely indicates the specificity of miRNA action to particular pathways and the complexity of the CF intestinal response. The analysis presented here is predicated on reliable target gene predictions. To increase reliability we repeated the analyses of target gene to gene expression profile overlap, presented in Fig. 4, using each of PicTar and Diana microT 3.0 target prediction databases. The pathways listed in Fig. 4 were among the most significant based on predictions from all three algorithms. This approach has some validity in that five of the genes from the CF intestinal gene expression profile which were predicted to be targets, and the corresponding miRNA, are listed in miRecords [56] a database for which the miRNA:target interaction is deemed validated. Despite this, the presented pathways are predicted effects, and subject to review with new miRNA:target data and predictions and with revised pathway data. Beyond predictions, functional validation studies wherein the altered expression of specific miRNAs possibly achieved through transfection [57] or transgenesis [58] to the appropriate intestinal cell type affects cell proliferation or metabolism would more definitively support the interaction. A second limitation in this work is the use of the gene expression profile from B6 × BALB F2, or genetically mixed, CF mice, while the miRNA expression profile was completed on tissue from mice of a BALB (inbred) background. The 50% B6 background may contribute to the difference between miRNA predicted targets and the F2 gene expression profile in that genes expressed from the B6 allele may not be subject to regulation by a BALB specific miRNA. The extent to which such strain specific regulation exists has not been extensively explored. In conclusion, using miRNA profiling of tissue from an established CF mouse model, combined with gene expression data, we have identified specific miRNAs and their regulated pathways which putatively contribute to the cystic fibrosis intestinal disease course. Supplementary materials related to this article can be found online at doi:10.1016/j.ymgme.2011.01.012. Disclosure statement The authors have no conflicts of interest to disclose. Role of funding source This research was funded by the Canadian Cystic Fibrosis Foundation and Fonds de la Recherche en Sante Quebec. Neither agency was involved in the study design; in the collection, analysis, and interpretation of data, in the writing of the report, or in the decision to submit the paper for publication. References [1] B.J. Rosenstein, P.L. Zeitlin, Cystic fibrosis, Lancet 351 (1998) 277–282. [2] P.B. Davis, M. Drumm, M.W. Konstan, Cystic fibrosis, Am. J. Respir. Crit. Care Med. 154 (1996) 1229–1256. [3] D.J. Davidson, M. Rolfe, Mouse models of cystic fibrosis, Trends Genet. 17 (2001) S29–S37.

M. Bazett et al. / Molecular Genetics and Metabolism 103 (2011) 38–43 [4] P.R. Durie, G. Kent, M.J. Phillips, C.A. Ackerley, Characteristic multiorgan pathology of cystic fibrosis in a long-living cystic fibrosis transmembrane regulator knockout murine model, Am. J. Pathol. 164 (2004) 1481–1493. [5] O. Norkina, S. Kaur, D. Ziemer, R.C. De Lisle, Inflammation of the cystic fibrosis mouse small intestine, Am. J. Physiol. Gastrointest. Liver Physiol. 286 (2004) G1032–G1041. [6] J.C. Canale-Zambrano, M.C. Poffenberger, S.M. Cory, D.G. Humes, C.K. Haston, Intestinal phenotype of variable-weight cystic fibrosis knockout mice, Am. J. Physiol. Gastrointest. Liver Physiol. 293 (2007) G222–G229. [7] A.M. Gallagher, R.A. Gottlieb, Proliferation, not apoptosis, alters epithelial cell migration in small intestine of CFTR null mice, Am. J. Physiol. Gastrointest. Liver Physiol. 281 (2001) G681–G687. [8] D. Baek, J. Villen, C. Shin, F.D. Camargo, S.P. Gygi, D.P. Bartel, The impact of microRNAs on protein output, Nature 455 (2008) 64–71. [9] D.P. Bartel, MicroRNAs: target recognition and regulatory functions, Cell 136 (2009) 215–233. [10] M. Selbach, B. Schwanhausser, N. Thierfelder, Z. Fang, R. Khanin, N. Rajewsky, Widespread changes in protein synthesis induced by microRNAs, Nature 455 (2008) 58–63. [11] A.S. Flynt, E.C. Lai, Biological principles of microRNA-mediated regulation: shared themes amid diversity, Nat. Rev. Genet. 9 (2008) 831–842. [12] Y. Lee, K. Jeon, J.T. Lee, S. Kim, V.N. Kim, MicroRNA maturation: stepwise processing and subcellular localization, EMBO J. 21 (2002) 4663–4670. [13] J.Y. Yu, K.H. Chung, M. Deo, R.C. Thompson, D.L. Turner, MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation, Exp. Cell Res. 314 (2008) 2618–2633. [14] I. Naguibneva, M. Ameyar-Zazoua, A. Polesskaya, S. Ait-Si-Ali, R. Groisman, M. Souidi, S. Cuvellier, A. Harel-Bellan, The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation, Nat. Cell Biol. 8 (2006) 278–284. [15] J. Zhang, Y.Y. Du, Y.F. Lin, Y.T. Chen, L. Yang, H.J. Wang, D. Ma, The cell growth suppressor, mir-126, targets IRS-1, Biochem. Biophys. Res. Commun. 377 (2008) 136–140. [16] L.M. Tsai, D. Yu, MicroRNAs in common diseases and potential therapeutic applications, Clin. Exp. Pharmacol. Physiol. 37 (2010) 102–107. [17] Y. Wang, A.T. Lee, J.Z. Ma, J. Wang, J. Ren, Y. Yang, E. Tantoso, K.B. Li, L.L. Ooi, P. Tan, C.G. Lee, Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224specific target, J. Biol. Chem. 283 (2008) 13205–13215. [18] A. Izzotti, G.A. Calin, V.E. Steele, C.M. Croce, S. De Flora, Relationships of microRNA expression in mouse lung with age and exposure to cigarette smoke and light, FASEB J. 23 (2009) 3243–3250. [19] T.X. Lu, A. Munitz, M.E. Rothenberg, MicroRNA-21 is up-regulated in allergic airway inflammation and regulates IL-12p35 expression, J. Immunol. 182 (2009) 4994–5002. [20] D. Yu, A.H. Tan, X. Hu, V. Athanasopoulos, N. Simpson, D.G. Silva, A. Hutloff, K.M. Giles, P.J. Leedman, K.P. Lam, C.C. Goodnow, C.G. Vinuesa, Roquin represses autoimmunity by limiting inducible T-cell co-stimulator messenger RNA, Nature 450 (2007) 299–303. [21] I.K. Oglesby, I.M. Bray, S.H. Chotirmall, R.L. Stallings, S.J. O'Neill, N.G. McElvaney, C.M. Greene, miR-126 is downregulated in cystic fibrosis airway epithelial cells and regulates TOM1 expression, J. Immunol. 184 (2010) 1702–1709. [22] H.M. Heneghan, N. Miller, M.J. Kerin, Role of microRNAs in obesity and the metabolic syndrome, Obes. Rev. 11 (2010) 354–361. [23] F.C. Lynn, Meta-regulation: microRNA regulation of glucose and lipid metabolism, Trends Endocrinol. Metab. 20 (2009) 452–459. [24] E.M. Bradford, M.A. Sartor, L.R. Gawenis, L.L. Clarke, G.E. Shull, Reduced NHE3mediated Na+ absorption increases survival and decreases the incidence of intestinal obstructions in cystic fibrosis mice, Am. J. Physiol. Gastrointest. Liver Physiol. 296 (2009) G886–G898. [25] S.V. Naga Prasad, Z.H. Duan, M.K. Gupta, V.S. Surampudi, S. Volinia, G.A. Calin, C.G. Liu, A. Kotwal, C.S. Moravec, R.C. Starling, D.M. Perez, S. Sen, Q. Wu, E.F. Plow, C.M. Croce, S. Karnik, Unique microRNA profile in end-stage heart failure indicates alterations in specific cardiovascular signaling networks, J. Biol. Chem. 284 (2009) 27487–27499. [26] E.M. Ohlsson Teague, K.H. Van der Hoek, M.B. Van der Hoek, N. Perry, P. Wagaarachchi, S.A. Robertson, C.G. Print, L.M. Hull, MicroRNA-regulated pathways associated with endometriosis, Mol. Endocrinol. 23 (2009) 265–275. [27] B.H. Koller, H.S. Kim, A.M. Latour, K. Brigman, R.C. Boucher Jr., P. Scambler, B. Wainwright, O. Smithies, Toward an animal model of cystic fibrosis: targeted interruption of exon 10 of the cystic fibrosis transmembrane regulator gene in embryonic stem cells, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 10730–10734. [28] L.L. Clarke, L.R. Gawenis, C.L. Franklin, M.C. Harline, Increased survival of CFTR knockout mice with an oral osmotic laxative, Lab. Anim. Sci. 46 (1996) 612–618. [29] C.K. Haston, W. Li, A. Li, M. Lafleur, J.E. Henderson, Persistent osteopenia in adult cystic fibrosis transmembrane conductance regulator-deficient mice, Am. J. Respir. Crit. Care Med. 177 (2008) 309–315. [30] J.C. Canale-Zambrano, M.L. Auger, C.K. Haston, Toll-like receptor-4 genotype influences the survival of cystic fibrosis mice, Am. J. Physiol. Gastrointest. Liver Physiol. 299 (2010) G381–G390. [31] S. Griffiths-Jones, R.J. Grocock, S. van Dongen, A. Bateman, A.J. Enright, miRBase: microRNA sequences, targets and gene nomenclature, Nucleic Acids Res. 34 (2006) D140–D144. [32] M.E. Ritchie, J. Silver, A. Oshlack, M. Holmes, D. Diyagama, A. Holloway, G.K. Smyth, A comparison of background correction methods for two-colour microarrays, Bioinformatics 23 (2007) 2700–2707.

43

[33] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C(T) method, Nat. Protoc. 3 (2008) 1101–1108. [34] C.K. Haston, S. Cory, L. Lafontaine, G. Dorion, M.T. Hallett, Strain-dependent pulmonary gene expression profiles of a cystic fibrosis mouse model, Physiol. Genomics 25 (2006) 336–345. [35] B.P. Lewis, C.B. Burge, D.P. Bartel, Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets, Cell 120 (2005) 15–20. [36] A. Krek, D. Grun, M.N. Poy, R. Wolf, L. Rosenberg, E.J. Epstein, P. MacMenamin, I. da Piedade, K.C. Gunsalus, M. Stoffel, N. Rajewsky, Combinatorial microRNA target predictions, Nat. Genet. 37 (2005) 495–500. [37] M. Maragkakis, M. Reczko, V.A. Simossis, P. Alexiou, G.L. Papadopoulos, T. Dalamagas, G. Giannopoulos, G. Goumas, E. Koukis, K. Kourtis, T. Vergoulis, N. Koziris, T. Sellis, P. Tsanakas, A.G. Hatzigeorgiou, DIANA-microT web server: elucidating microRNA functions through target prediction, Nucleic Acids Res. 37 (2009) W273–W276. [38] C.K. Haston, M. Corey, L.C. Tsui, Mapping of genetic factors influencing the weight of cystic fibrosis knockout mice, Mamm. Genome 13 (2002) 614–618. [39] G. Kent, M. Oliver, J.K. Foskett, H. Frndova, P. Durie, J. Forstner, G.G. Forstner, J.R. Riordan, D. Percy, M. Buchwald, Phenotypic abnormalities in long-term surviving cystic fibrosis mice, Pediatr. Res. 40 (1996) 233–241. [40] J.N. Snouwaert, K.K. Brigman, A.M. Latour, N.N. Malouf, R.C. Boucher, O. Smithies, B.H. Koller, An animal model for cystic fibrosis made by gene targeting, Science 257 (1992) 1083–1088. [41] S.H. Cheng, D.P. Rich, J. Marshall, R.J. Gregory, M.J. Welsh, A.E. Smith, Phosphorylation of the R domain by cAMP-dependent protein kinase regulates the CFTR chloride channel, Cell 66 (1991) 1027–1036. [42] A. Robay, G. Toumaniantz, V. Leblais, C. Gauthier, Transfected beta3- but not beta2-adrenergic receptors regulate cystic fibrosis transmembrane conductance regulator activity via a new pathway involving the mitogen-activated protein kinases extracellular signal-regulated kinases, Mol. Pharmacol. 67 (2005) 648–654. [43] J. Roux, M. Carles, H. Koh, A. Goolaerts, M.T. Ganter, B.B. Chesebro, M. Howard, B.T. Houseman, W. Finkbeiner, K.M. Shokat, A.C. Paquet, M.A. Matthay, J.F. Pittet, TGF{beta}1 inhibits CFTR-dependent cAMP-stimulated alveolar epithelial fluid transport via a PI3K-dependent mechanism, J. Biol. Chem. 285 (2010) 4278–4290. [44] B. Tuo, G. Wen, Y. Zhang, X. Liu, X. Wang, H. Dong, Involvement of phosphatidylinositol 3-kinase in cAMP- and cGMP-induced duodenal epithelial CFTR activation in mice, Am. J. Physiol. Cell Physiol. 297 (2009) C503–C515. [45] T. Hegedus, A. Aleksandrov, A. Mengos, L. Cui, T.J. Jensen, J.R. Riordan, Role of individual R domain phosphorylation sites in CFTR regulation by protein kinase A, Biochim. Biophys. Acta 1788 (2009) 1341–1349. [46] L. He, J.M. Thomson, M.T. Hemann, E. Hernando-Monge, D. Mu, S. Goodson, S. Powers, C. Cordon-Cardo, S.W. Lowe, G.J. Hannon, S.M. Hammond, A microRNA polycistron as a potential human oncogene, Nature 435 (2005) 828–833. [47] T. Kan, S.J. Meltzer, MicroRNAs in Barrett's esophagus and esophageal adenocarcinoma, Curr. Opin. Pharmacol. 9 (2009) 727–732. [48] D. Bonci, V. Coppola, M. Musumeci, A. Addario, R. Giuffrida, L. Memeo, L. D'Urso, A. Pagliuca, M. Biffoni, C. Labbaye, M. Bartucci, G. Muto, C. Peschle, R. De Maria, The miR-15a–miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities, Nat. Med. 14 (2008) 1271–1277. [49] H. Su, J.R. Yang, T. Xu, J. Huang, L. Xu, Y. Yuan, S.M. Zhuang, MicroRNA-101, downregulated in hepatocellular carcinoma, promotes apoptosis and suppresses tumorigenicity, Cancer Res. 69 (2009) 1135–1142. [50] C. Christodoulides, A. Vidal-Puig, PPARs and adipocyte function, Mol. Cell. Endocrinol. 318 (2010) 61–68. [51] S.D. Freedman, P.G. Blanco, M.M. Zaman, J.C. Shea, M. Ollero, I.K. Hopper, D.A. Weed, A. Gelrud, M.M. Regan, M. Laposata, J.G. Alvarez, B.P. O'Sullivan, Association of cystic fibrosis with abnormalities in fatty acid metabolism, N. Engl. J. Med. 350 (2004) 560–569. [52] S.D. Freedman, M.H. Katz, E.M. Parker, M. Laposata, M.Y. Urman, J.G. Alvarez, A membrane lipid imbalance plays a role in the phenotypic expression of cystic fibrosis in cftr(−/−) mice, Proc. Natl. Acad. Sci. U. S. A. 96 (1999) 13995–14000. [53] V. Reynders, S. Loitsch, C. Steinhauer, T. Wagner, D. Steinhilber, J. Bargon, Peroxisome proliferator-activated receptor alpha (PPAR alpha) down-regulation in cystic fibrosis lymphocytes, Respir. Res. 7 (2006) 104. [54] D. Iliopoulos, K.N. Malizos, P. Oikonomou, A. Tsezou, Integrative microRNA and proteomic approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory networks, PLoS ONE 3 (2008) e3740. [55] G. Lazennec, L. Canaple, D. Saugy, W. Wahli, Activation of peroxisome proliferatoractivated receptors (PPARs) by their ligands and protein kinase A activators, Mol. Endocrinol. 14 (2000) 1962–1975. [56] F. Xiao, Z. Zuo, G. Cai, S. Kang, X. Gao, T. Li, miRecords: an integrated resource for microRNA-target interactions, Nucleic Acids Res. 37 (2009) D105–D110. [57] G. Dalmasso, H.T. Nguyen, Y. Yan, H. Laroui, M.A. Charania, T.S. Obertone, S.V. Sitaraman, D. Merlin, MicroRNA-92b regulates expression of the oligopeptide transporter PepT1 in intestinal epithelial cells, Am. J. Physiol. Gastrointest. Liver Physiol. 300 (2011) G52–G59. [58] P.A. Martins, K. Salic, M.M. Gladka, A.S. Armand, S. Leptidis, H. el Azzouzi, A. Hansen, C.J. Coenen-de Roo, M.F. Bierhuizen, R. van der Nagel, J. van Kuik, R. de Weger, A. de Bruin, G. Condorelli, M.L. Arbones, T. Eschenhagen, L.J. De Windt, MicroRNA-199b targets the nuclear kinase Dyrk1a in an auto-amplification loop promoting calcineurin/NFAT signalling, Nat. Cell Biol. 12 (2010) 1220–1227.