Microsatellite marker of interferon-gamma receptor 1 gene correlates with infection following major trauma

Microsatellite marker of interferongamma receptor 1 gene correlates with infection following major trauma Eric G. Davis, BS, M. Robert Eichenberger, BA, Brooke S. Grant, BS, and Hiram C. Polk, Jr, MD, Louisville, Ky

Background. This study hypothesizes that predicted polymorphism of the interferon-γ receptor 1 gene may play an important role in infection after trauma as supported by microsatellite analysis. Methods. DNA was extracted from the peripheral leukocytes of 38 trauma patients with Injury Severity Scores greater than 16. D6S471, a microsatellite marker on chromosome 6 near interferon-γ receptor 1, was amplified with polymerase chain reaction, and genotypes were determined. Results. The mean Injury Severity Score was 32, and 63% of patients (24 of 38) developed major infection. Three alleles and 5 genotypes were identified for D6S471. Twenty-six percent of patients (10 of 38) had genotype AA, all of whom developed major infection (P = .004). Genotype BB accounted for 57% of the uninfected population (8 of 14) but only 21% of the infected group (P = .028). Allele A had a frequency of 33%, of which 22 alleles (88%) were found in infected patients (P = .001). In addition, allele B accounted for 61% of the uninfected group (17 of 28) but only 23% (11 of 48) of the infected group (P = .001). Allele C demonstrated no correlation. Conclusions. Microsatellite polymorphism correlates strongly with infection. These findings portend polymorphism in the receptor itself and thereby represent a genetic basis for the development of infection. We suggest this identifies a high-risk group who could benefit from more specific therapy that may have the potential to overcome this receptor insufficiency. (Surgery 2000;128:301-5.) From the Department of Surgery, Price Institute of Surgical Research, University of Louisville School of Medicine, and the Trauma Program in Surgery, University of Louisville Hospital, Louisville, Ky

THE DEVELOPMENT OF MAJOR INFECTION during hospitalization is one of the most ubiquitous complications in terms of morbidity, mortality, and expense in trauma patients. Infection is at least an associated factor in the deaths of virtually all trauma patients who survive at least 1 week after injury but who then die.1 A plethora of cellular and serologic markers have been studied in an attempt to classify trauma patients soon after injury into categories of high or low risk with respect to developing infection so as to facilitate early intervention through prediction. Simultaneously, these investigations attempt to delineate the basis for why infection occurs in certain patients but not others Presented at the 61st Annual Meeting of the Society of University Surgeons, Toronto, Ontario, Canada, February 1012, 2000. Supported in part by the Mary and Mason Rudd Surgical Endowment of Jewish Hospital, Louisville, Ky. Reprint requests: Hiram C. Polk, Jr, MD, Department of Surgery, University of Louisville, Louisville, KY 40292. Copyright © 2000 by Mosby, Inc. 0039-6060/2000/$12.00 + 0 doi:10.1067/msy.2000.107374

11/6/107374

when clinically relevant variables such as severity of injury, age, and comorbidities are matched. The most reliable of these cellular markers has proved to be peripheral blood monocyte expression of human leukocyte antigen–DR (HLA-DR), a measure of potential antigen-presenting capacity of monocytes. Significantly lower HLA-DR expression after trauma has been found in nonsurvivors and survivors with infection than in those patients experiencing no infectious complications.2 Interferon-γ, produced endogenously by helper T-lymphocytes and natural killer cells (and available in a recombinant form [Genentech, San Francisco, Calif]), has many proven immunostimulatory and proinflammatory activities such as the up-regulation of Class II major histocompatibility complex (MHC) (HLA-DR) expression and tumor necrosis factor–α and interleukin-1 production.3 Studies conducted here and by others in the late 1980s on the use of interferon-γ as an adjuvant in preventing infection in severely injured patients demonstrated mixed results.4-6 Although monocyte HLA-DR expression was restored to normal during treatment, clinically significant reductions in the rate of infection were not consistently observed. SURGERY 301

302 Davis et al

Surgery August 2000

Fig 1. Alleles identified for microsatellite D6S471.

The recent explosion in the application of molecular biologic techniques has made identification of genetic causes for complex multifactorial diseases feasible. Given the known heterogeneity of the genome among populations, it is therefore not unreasonable that inborn, germline polymorphisms of essential elements of immunity may be partly responsible for poor host responses in some patients or supranormal responses in others. Isolated case reports of germline defects in the cellsurface receptor for interferon-γ have been described and the mutations characterized.7,8 Several were nonsense mutations in which receptor truncation resulted in absence of expression. Others were missense mutations in which the binding affinity of receptor to ligand was less than normal and in which cells expressing receptor responded only to high levels of interferon-γ administered exogenously. All affected patients experienced debilitating and unremitting mycobacterial infections. On the basis of these case reports of clinically devastating defects in the receptor for interferon-γ, we undertook a preliminary investigation into the potential role of the interferon-γ receptor 1 gene in infection after major trauma. Microsatellite analysis is a well-established technique in research of multifactorial conditions such as diabetes and inflammatory bowel disease and is a useful technique for screening of candidate genes with potential roles in the pathologic condition under study. The goal of this study was to determine the correlation between allelic variations in microsatellite sequences surrounding the gene coding for the interferon-γ receptor 1 on chromosome 6 and the outcome in trauma patients with respect to major infection. PATIENTS AND METHODS All blunt and penetrating trauma patients 18 years of age or older and with Injury Severity Scores (ISS) of 16 or greater admitted to University of Louisville Hospital were considered for admission into the study. Exclusion criteria were as follows: isolated head injuries, patients predicted to die of

Fig 2. D6S471 genotype frequencies in each population.

massive head injuries within the first 24 to 48 hours, isolated burns, administration of steroids at any time during hospital stay, and inclusion in any other research protocol in which experimental antisepsis drugs, excluding Phase II or III antibiotics, were administered. The patients’ clinical courses were then studied prospectively to identify the development of major infection. The criteria used to define major infection have been previously described9 and, in short, included positive cultures for pneumonia, intra-abdominal abscess, empyema, major wound infection requiring operative intervention, and any other major infection with positive cultures and clear evidence of a systemic response such as fever or leukocytosis. Informed consent was obtained from all patients or their immediate family. The study was approved by the Institutional Review Board. Genomic DNA was extracted from peripheral blood leukocytes on all patients by using a commercially available kit (Puregene; Gentra Systems, Inc, Minneapolis, Minn). Oligonucleotide primers were constructed (Ransom Hill Biosciences, Ramona, Calif) for previously described10 microsatellite D6S471 by using the following sequences: 5´ CGGGCCTTGGGTATACAT 3´ and 5´ ATATCTCTGGGGTGCTATGACC 3´. D6S471 is located within 5 centimorgans (cM) of the gene encoding the interferon-γ receptor 1 gene on chromosome 6. Polymerase chain reaction (PerkinElmer Thermocyclers, Norwalk, Conn) was performed by using 2 µL genomic DNA and P32-labeled deoxycytidine triphosphate under the following conditions: 95°C denaturation for 10 minutes followed by 35 cycles each of 95°C for 30 seconds, 62°C for 1 minute, 72°C for 1.5 minutes, and a final extension of 72°C for 7 minutes. Samples then underwent 10% nondenaturing polyacrylamide gel electrophoresis followed by

Davis et al 303

Surgery Volume 128, Number 2

autoradiography (Eastman-Kodak, Rochester, NY). Alleles were determined by labeling bands using letters A, B, and C from largest to smallest molecular weight (Fig 1). These alleles were then assigned to each patient. Genotypes were determined by combining alleles for each patient; if only 1 allele was present, the patient was considered to be homozygous. Fisher exact test (Primer of Biostatistics for Windows, McGraw-Hill) was used for statistical analysis, with significance at P < .05. RESULTS Three alleles and 5 genotypes were identified for the microsatellite D6S471. They were designated alphabetically according to the distance traveled on nondenaturing polyacrylamide gel electrophoresis. Each was thus named according to molecular weight. Alleles A, B, and C had frequencies of 33%, 37%, and 30%, respectively, which corresponded roughly to frequencies observed in previously published microsatellite databases derived from population studies.11 These observations indicated that our population was not substantially different, in regards to microsatellite frequency, from that found in a generic sampling. Findings. Thirty-eight patients were enrolled in the study, 24 (63%) of whom developed at least 1 major infection during their hospitalization. Twenty-six percent of all patients (10 of 38) had genotype AA, all of whom developed major infection (P = .004). Genotype BB was present in 34% of the total population, accounting for 57% of the uninfected population (8 of 14) but only 21% (5 of 24) of the infected group (P = .028). Allele A had a frequency of 33% (25 of 76 alleles), of which 22 alleles (88%) were found in infected patients (P = .001). In addition, allele B was found to have a frequency of 37% (28 of 76 alleles), accounting for 61% of the uninfected population (17 of 28) but only 23% (11 of 48) of the infected group (P = .001). The presence of allele C demonstrated no correlation with infectious outcome. Pneumonia accounted for the overwhelming majority of the infectious complications, and correlation of specific sites of infection with genotype was unrewarding for this reason. Four patients died, and no statistically significant correlations between genotype and mortality were observed. All results are summarized in Tables I and II and Figure 2. Population characteristics. Virtually no differences in the ISS were observed among the groups studied (Table III). The mean ages were 52 and 35 years, respectively, for patients with genotype AA and BB. Although age is undoubtedly a risk factor for developing infection after trauma, the physio-

Table I. Genotype frequencies of microsatellite D6S471 Genotype AA BB CC AB AC

Infected population (n = 24) (%) 10 (42) 5 (21) 7 (29) 1 (4) 1 (4)

Uninfected population (n = 14) (%) 0 (0) 8 (57) 3 (21) 1 (7) 2 (14)

logic significance of this difference between genotypes is unlikely to be important. The same probably holds true for the difference in mean age of the infected and uninfected populations (Table III). In addition, no significant differences were detected when examining gender between the 2 groups (uninfected group, 21% women; infected group, 29% women). DISCUSSION Discoveries in unraveling the genetic predisposition to the development of cancer and multifactorial conditions such as Alzheimer’s disease and diabetes have exposed the great heterogeneity of the individual human genome. Investigations, therefore, into a genetic predisposition to developing infection after trauma are especially promising. This study attempted to screen a candidate gene that encodes an immunologically crucial cell-surface receptor, interferon-γ receptor 1. We used microsatellite analysis in an attempt to determine whether heterogeneity surrounding the gene for interferon-γ receptor 1 may indirectly predict heterogeneity of the gene itself and therefore further establish a basis for the individuality of host immune responses. Microsatellites are simple repetitive DNA sequences found throughout the human genome that tend to exhibit polymorphism in the number of repeats and are thus polyallelic.12 Although microsatellites themselves do not encode for protein products, their principal value is their close proximity to the candidate gene of choice. The concept of using microsatellite sequences in indirect gene diagnosis is well-established research in the area of multifactorial diseases.13 Because of this proximity, inheritance of a certain microsatellite allele is likely to occur simultaneously with the inheritance of a candidate gene of a certain sequence during homologous recombination of meiosis, resulting in a gamete with a microsatellite allele and a candidate gene from the same parental origin. If a certain allele of a gene arose innumerable generations ago such that the allele exists rel-

304 Davis et al

Surgery August 2000

Table II. Allele frequencies of microsatellite D6S471 Allele

Infected population (n = 48) (%)

A B C

22 (46) 11 (23) 15 (31)

Uninfected population (n = 28) (%) 3 (11) 17 (61) 8 (29)

atively frequently today (as occurs in the multiple alleles of the Class II MHC region), 2 or more functional allelic isoforms would exist within the population as long as the mutation did not confer a major survival disadvantage. This would establish polymorphism of the gene. Through generations of progeny, it is likely that any polymorphism within a gene, whether functionally significant or not, will be closely related to the allelic variant of the microsatellite sequence that immediately accompanies it within the linear genome because of the close linkage of the 2 elements.12 D6S471 was chosen for analysis because its distance of less than 5 cM from the candidate gene translates into a less than 5% chance of recombination between the microsatellite and the gene. Our initial null hypothesis was that variations in allelic frequencies of microsatellite D6S471 from patient to patient do not correlate with infectious outcome after trauma. However, based on our findings, this null hypothesis was rejected. We instead found that D6S741 alleles do confer either a benefit or disadvantage and may themselves portend variations in the receptor itself among the populace. In screening the interferon-γ receptor 1 gene and finding significance within microsatellite sequences, we have demonstrated correlation but not causation. Microsatellites do not confer any information concerning the structure or function of the actual receptor and this correlation does not even mean the receptor is necessarily polymorphic from individual to individual. It simply means that if the receptor is polymorphic, genetic linkage of a certain receptor isoform with a microsatellite is likely to occur because of the small distance between the two in the genome. This would aid in simplified identification of individuals with the isoform and prove, as with the presence of allele A or B in this study, a useful prognostic marker for the trauma patient. Furthermore, if functional differences in the receptor exist, these polymorphisms could be an explanation for the varying intensity of HLA-DR expression in injured patients seen in the period immediately after trauma. In an attempt to define a polymorphism in the gene itself predicted by the microsatellite hetero-

Table III. Population characteristics Population All patients Infected patients Uninfected patients Genotype AA Genotype BB

Mean ISS

Mean age (y)

32 32 31 34 31

44 49 36 52 35

geneity data, we have begun sequencing individual exons of the interferon-γ receptor 1 gene on selected trauma patients. The gene contains 7 exons,14 and the sequencing data currently available on exons 2 and 6 demonstrate no polymorphism when compared with both established genome databases and our patient population itself. Further sequencing of exons and intronic splice regions is forthcoming. Furthermore, studies of HLA-DR expression, tumor necrosis factor–α, and interleukin-1 production among patients with differing microsatellite genotypes would provide evidence of functional heterogeneity, if it exists. This exciting and marked discrepancy in allelic frequencies between the infected and uninfected groups in this study invites confirmation by others, especially with regard to the potentially confounding age differences among groups. D6S471 may represent another predictive marker of infection after trauma. These findings, if reflective of differences in the receptor itself, may carry potential therapeutic implications as well. If functional polymorphisms in the receptor exist within the population and the differences are manifest in the affinity of receptor for ligand, it is plausible that such receptor insufficiency could be overcome with administration of exogenous interferon-γ. This would identify a subpopulation of genuine highrisk trauma patients who may benefit from adjuvant therapy in the prevention of infection after trauma. Most important of all, an identifiable, inborn genetic basis for the diversity of the host immune response may involve the interferon-γ receptor. REFERENCES 1. Polk HC Jr. Continuing search for solutions to trauma associated infections. J R Coll Surg Edinb 1996;41:1-6. 2. Cheadle WG, Hershman MJ, Wellhausen SR, Polk HC Jr. HLA-DR antigen expression in peripheral blood monocytes correlates with surgical infection. Am J Surg 1991;161:639-45. 3. Boehm U, Klamp T, Groot M, Howard JC. Cellular responses to interferon-gamma. Annu Rev Immunol 1997;15:74995. 4. Polk HC Jr, Cheadle WG, Livingston DH, Rodriguez JL, Starko KM, Izu AE, et al. A randomized prospective clinical trial to determine the efficacy of interferon-gamma in severely injured patients. Am J Surg 1992;163:191-6.

Surgery Volume 128, Number 2 5. Dries DJ, Jurkovich GJ, Maier RV, Clemmer TP, Struve SN, Weigelt JA, et al. Effect of interferon gamma on infectionrelated death in patients with severe injuries: a randomized, double-blind, placebo-controlled trial. Arch Surg 1994;129:1031-41. 6. Mock CN, Dries DJ, Jurkovich GJ, Maier RV. Assessment of two clinical trials: interferon-gamma therapy in severe injury. Shock 1996;5:235-40. 7. Newport MJ, Huxley CM, Huston S, Hawrylowicz CM, Oostra BA, Williamson R, et al. A mutation in the interferon-gamma-receptor gene and susceptibility to mycobacterial infection. N Engl J Med 1996;335:1941-9. 8. Jouanguy E, Altare F, Lamhamedi S, Revy P, Emile JF, Newport M, et al. Interferon-gamma-receptor deficiency in an infant with fatal bacille Calmette-Guerin infection. N Engl J Med 1996;335:1956-61. 9. Wakefield CH, Carey PD, Foulds S, Monson JR, Guillou PJ. Surgery and the release of a neutrophil Fc gamma receptor. Am J Surg 1995;170:277-84.

Davis et al 305

10. Weissenbach J. (1999) Genome database object: D6S471. Available at: http://gdbwww.gdb.org. Accessed January 10, 2000. 11. Foundation Jean Dausset-CEPH World-Wide-Web Server. (1998) CEPH genotype database. (V8.2 – December 1998). Available at: http://www.cephb.fr/cgibin/wdb/ceph/frequency/default/4295. Accessed January 10, 2000. 12. Epplen C, Santos EJM, Maueler W, van Helden P, Epplen JT. On simple repetitive DNA sequences and complex diseases. Electrophoresis 1997;18:1577-85. 13. Epplen JT, Buitkamp J, Bocker T, Epplen C. Indirect gene diagnoses for complex (multifactorial) diseases: a review. Gene 1995;159:49-55. 14. Merlin G, van der Leede BJ, McKune K, Knezevic N, Bannwarth W, Romquin N, et al. The gene for the ligand binding chain of the human interferon gamma receptor. Immunogenetics 1997;45:413-21.