Migration pathways of sacral neural crest during development of lower urogenital tract innervation

Author’s Accepted Manuscript Migration pathways of sacral neural crest during development of lower urogenital tract innervation Carrie B. Wiese, Karen K. Deal, Sara J. Ireland, V. Ashley Cantrell, E. Michelle Southard-Smith www.elsevier.com/locate/developmentalbiology

PII: DOI: Reference:

S0012-1606(16)30825-9 http://dx.doi.org/10.1016/j.ydbio.2017.04.011 YDBIO7421

To appear in: Developmental Biology Received date: 11 December 2016 Revised date: 18 January 2017 Accepted date: 19 April 2017 Cite this article as: Carrie B. Wiese, Karen K. Deal, Sara J. Ireland, V. Ashley Cantrell and E. Michelle Southard-Smith, Migration pathways of sacral neural crest during development of lower urogenital tract innervation, Developmental Biology, http://dx.doi.org/10.1016/j.ydbio.2017.04.011 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Migration pathways of sacral neural crest during development of lower urogenital tract innervation.

Carrie B. Wiese1, Karen K. Deal1, Sara J. Ireland, V. Ashley Cantrell, E. Michelle Southard-Smith* Division of Genetic Medicine, Department of Medicine, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-0275

*

Corresponding author. Division of Genetic Medicine, Vanderbilt University Medical Center, 507 Light Hall, 2215 Garland Avenue, Nashville, TN 37232-0275, Telephone: (615) 936-2172, Fax: (615) 343-2601, Email: [email protected]

Abstract: The migration and fate of cranial and vagal neural crest-derived progenitor cells (NCPCs) have been extensively studied; however, much less is known about sacral NCPCs particularly in regard to their distribution in the urogenital system. To construct a spatiotemporal map of NCPC migration pathways into the developing lower urinary tract, we utilized the Sox10-H2BVenus transgene to visualize NCPCs expressing Sox10. Our aim was to define the relationship of Sox10-expressing NCPCs relative to bladder innervation, smooth muscle differentiation, and vascularization through fetal development into adulthood. Sacral NCPC migration is a highly regimented, specifically timed process, with several potential regulatory mileposts. Neuronal differentiation occurs concomitantly with sacral NCPC migration, and neuronal cell bodies are present even before the pelvic ganglia coalesce. Sacral NCPCs reside within the pelvic ganglia anlagen until 13 days post coitum, after which they begin streaming into the bladder 1

These authors contributed equally. 1

body in progressive waves. Smooth muscle differentiation and vascularization of the bladder initiate prior to innervation and appear to be independent processes. In adult bladder, the majority of Sox10+ cells express the glial marker S100, consistent with Sox10 being a glial marker in other tissues. However, rare Sox10+ NCPCs are seen in close proximity to blood vessels and not all are S100+, suggesting either glial heterogeneity or a potential nonglial role for Sox10+ cells along vasculature. Taken together, the developmental atlas of Sox10+ NCPC migration and distribution profile of these cells in adult bladder provided here will serve as a roadmap for future investigation in mouse models of lower urinary tract dysfunction.

Keywords: Sox10; sacral neural crest; lower urinary tract; pelvic ganglia; peripheral nervous system; bladder.

1. Introduction Early in embryonic development, neural crest cells delaminate from the dorsal tube and migrate along prescribed paths to eventually differentiate into Schwann cells and glia, as well as peripheral neurons, melanocytes, chrondrocytes, and adrenal chromaffin cells (Le Douarin et al., 2008; Shakova and Sommer, 2010). These migratory cells, termed neural crest-derived progenitor cells (NCPCs), express Sox10 and differentiate to form sensory and autonomic innervation for a variety of organs, 2

including the lung, heart, kidney, and intestine (Freem et al., 2010; Itaranta et al., 2009; Lajiness et al., 2014; Lake and Heuckeroth, 2013; Musser and Southard-Smith, 2013; Obermayr et al., 2013; Verberne et al., 2000). Detailed spatiotemporal maps of neural crest derived innervation for these organs have been particularly informative for understanding disease processes. In contrast, surprisingly little is known at the cellular level about initial population of the lower urogenital tract (LUT) by Sox10+ NCPCs. Despite the fact that sacral NCPCs give rise to pelvic ganglia, which provide essential autonomic innervation to the LUT, the principal focus of prior sacral NC analysis has been the contribution of these progenitors to the enteric nervous system (Anderson et al., 2006; Kapur, 2000; Mundell et al., 2012). A comprehensive understanding of LUT innervation and the factors that regulate this system have the potential to impact treatment and quality of life for patients who have sustained bladder damage. Injury to the bladder can result from a multitude of insults: congenital disorders, infection, trauma, cancer, or iatrogenic injury occurring during abdominopelvic surgery (Atala, 2011). Significant advances have been made in field of bladder repair using autologous patient cells to seed bladder scaffolds (Atala et al., 2006). However, efforts to innervate bladder scaffolds have not been successful (Lam Van Ba et al., 2015; Oberpenning et al., 1999). Thus, detailed understanding of the normal events that occur in development of LUT innervation may lead to strategies for regeneration of damaged or diseased neural inputs in the bladder. We previously reported the distribution of neural elements in the fetal mouse urogenital tract (Wiese et al., 2012); however, much remains unknown about the initial stages when LUT innervation begins. Sacral NCPCs have been reported migrating

3

around the distal hindgut on their way to the urogenital sinus as early as 11.5 days post coitus (dpc), and neuronal differentiation within pelvic ganglia is ongoing at 15.5 dpc (Anderson et al., 2006; Wiese et al., 2012). It has not yet been determined when autonomic pelvic ganglia first coalesce or when neurogenesis in these ganglia first initiates. Because regenerative strategies aimed at compensating for deficits of bladder innervation would benefit from understanding basic processes in the normal development of LUT nerves, we undertook a study of sacral NCPC migration during development of bladder innervation.

Using our Sox10-Histone2BVenus (Sox10-

H2BVenus) reporter strain (Corpening et al., 2011), we specifically examined when neuronal progenitors first enter the urogenital sinus mesenchyme that will become the primitive bladder, when markers of differentiating neurons and glia first appear within the structures of the LUT, and whether there are temporal variations in migration of NCPCs into the bladder that might suggest key regulatory stages. We concurrently documented the distribution of Sox10+ NCPCs in late fetal and adult bladders to establish a normal baseline that may prove informative in the analysis of mouse models of bladder dysfunction. Based on our initial observations of NCPC migration into the bladder and the potential interdepence between innervation and bladder muscle development and vascularization, we examined the distribution of NCPCs relative to the timeline of fetal smooth muscle and vascular development in the normal mouse bladder. We observed that the processes of innervation, vascularization and smooth muscle development appear to initiate independently of one another. Our initial survey of the distribution of Sox10+ cells in the adult bladder suggests heterogeneity of these cells

4

within the bladder wall and sets the stage for future analysis of discrete neural crestderived lineages in normal maturation and disease of the LUT.

2. Results 2.1 NCPCs that populate the urogenital tract are revealed by Sox10 expression Initial studies characterizing the migration patterns of sacral NCPCs focused on progenitors expressing a dopamine beta-hydroxylase transgene (Dβh-nLacZ) and their differentiation as they approached the hindgut (Anderson et al., 2006; Kapur, 2000). While those studies identified Dβh+ cells within pelvic ganglia by 13 dpc, more comprehensive labeling of NCPCs would be advantageous for visualizing migration patterns throughout the developing genitourinary system. To assess the feasibility of using a Sox10 transgenic reporter for detection and characterization of NCPCs in the genitourinary system, we compared the expression pattern of our previously described transgenic line Sox10-H2BVenus to that of a knock-in allele for Sox10 that expresses LacZ (Sox10LacZ-KO/+ )(Britsch et al., 2001).

The Sox10-H2BVenus transgene line

faithfully recapitulates Sox10 expression in rostral neural crest populations, including cranial ganglia, otic vesicles, branchial arches, dorsal root ganglia, cervical ganglia, and vagal enteric neural crest (Corpening et al., 2011). Thus, we expected transgene expression patterns to mirror endogenous Sox10 among sacral NCPC as well. Intact genitourinary tissues were subdissected from Sox10LacZ-KO/+ and Sox10-H2BVenus embryos at 14-14.5 dpc and either stained for LacZ activity or imaged for fluorescence of the Sox10-H2BVenus reporter in whole mount (Fig. 1). Nearly identical expression patterns were observed, with strong expression in the adrenal glands, celiac ganglia, and numerous nerves tracts of both Sox10LacZ-KO/+ and Sox10-H2BVenus tissues. The 5

consistency between expression of Sox10LacZ-KO/+ and Sox10-H2BVenus in the genitourinary tract extends prior studies that demonstrated that the 28O11 BAC backbone used to drive heterologous transgene reporters recapitulates expression of the endogenous Sox10 gene (Corpening et al., 2011; Deal et al., 2006). While the majority of expression sites were comparable between the two Sox10 lines, one difference we observed was the presence of Sox10-H2BVenus signal in the Sertoli cells of the testes. Sox10 has previously been identified in Sertoli cells (Polanco et al., 2010); however, no comparable LacZ staining was seen in Sox10LacZ-KO/+ testes. While this discrepancy may result from the testes being impermeable to LacZ staining, it is more likely due to loss of essential regulatory elements required to drive testes-specific expression in the Sox10LacZ-KO/+ line. Multiple intronic enhancers have been identified for Sox10 and the Sox10LacZ-KO/+ allele deletes sequences from introns 3 through exon 5 as a result of LacZ reporter integration (Betancur et al., 2010; Betancur et al., 2011; Britsch et al., 2001). In contrast, all intronic regulatory domains are retained in the Sox10H2BVenus transgene, and animals expressing this reporter are phenotypically normal because the transgene does not alter the endogenous Sox10 locus. Because the Sox10-H2BVenus reporter illuminates normally developing NCPCs, we used this line to assess migration of sacral NCPCs in the developing LUT.

2.2 Sox10+ progenitors populate the developing urogenital sinus mesenchyme by 11 dpc Using the Sox10-H2BVenus transgene reporter, we first examined early migration patterns of sacral NCPCs in whole mount tissues. At 10 dpc, it is apparent

6

that sacral NCPCs, which arise at the level of somite 28 and posterior, have not yet delaminated from the dorsal neural tube (Fig. 2A, arrow). A day later at 11 dpc sacral NCPCs have migrated laterally and ventrally, coalescing as a loose stream of cells prior to migration into the urogenital sinus mesenchyme and the genital tubercle (Fig. 2B). At 12 dpc in lateral whole mount views, the relationship of the forming bladder atop the genital tubercle, which is becoming innervated, is evident (Fig. 2C). At this stage, long streams of NCPCs have migrated nearly the entire length of the genital tubercle, remaining close to its dorsal (superior) surface and delineate the developing dorsal nerve. In addition, a second population of NCPCs have traveled caudally toward the ventral (inferior) aspect of the genital tubercle (Fig. 2C, see also Fig. 6). By 12.5 dpc, a definitive pelvic ganglion is visible proximal to the genital tubercle, just at the point of detachment from the remainder of the embryo. At this stage the contribution of the more dorsally situated pelvic plexus to the pelvic ganglion is evident in lateral whole mount views (Fig. 2D). In turn, the pelvic plexus is populated by NCPCs traveling along nerves coming from the dorsal root ganglia. In our efforts to define migration patterns of sacral NCPCs into the LUT, we examined transverse sections stained with the pan-neuronal markers Hu-C/D, which labels cell bodies, and TuJ1, which labels neuronal processes, to determine when NCPCs initiate neuronal differentiation relative to when the pelvic ganglia coalesce within the urogenital sinus mesenchyme. At 11.25 dpc we observed that lumbosacral NCPCs migrating towards the urogenital sinus have reached and nearly surrounded the condensing metanephric mesenchyme, including the entire lateral aspect, but do not appear to enter the mesenchyme (Fig. 3A-B”). This distribution is consistent with a prior

7

report that described migration of 10.5 dpc lumbosacral NCPCs ventrally between the lateral neural tube and somites towards the dorsal aspect of the metanephric mesenchyme (Itaranta et al., 2009). Even at this early stage of development, rare Hu+ neuronal cell bodies and TuJ1+ neuronal fibers are already admixed with Sox10+ cells, indicating that neuronal differentiation occurs as NCPCs are migrating toward the urogenital sinus and prior to aggregation of pelvic ganglia (Fig. 3A-A”). Less than one day later in development, at 12 dpc, the embryo has elongated and the metanephric mesenchyme has ascended. As a result there is no longer any obstacle to NCPC migration toward the urogenital sinus mesenchyme.

In sections

collected at an anatomic level that transects the embryo just above the point of septation of the cloaca from the hindgut, Sox10+ NCPCs are visible in loose aggregates dorsolateral to the cloaca, admixed with TuJ1+ nerve bundles (Fig. 3B-B”). Within these dorsolateral aggregates, NCPC-derived cells have undergone neuronal differentiation so that they have down-regulated the Sox10-H2BVenus transgene and exhibit expression of pan-neuronal markers (Hu and TuJ1) (Fig. 3B”).

2.3 Population of the developing bladder and genital tubercle by Sox10+ progenitor cells is temporally and spatially orchestrated. When viewed in whole-mount from an anterior perspective looking down on the bladder flanked by the umbilical blood vessels, the coalescing pelvic ganglia are much more readily visible as bright clusters of Sox10+ cells than in any single transverse histologic section. At 12 dpc, Sox10+ NCPCs are aggregated in clusters bilaterally at the base of the developing bladder, but no migration into the bladder has begun (Fig.

8

4). Condensation of ganglia cells continues through 13 dpc with increasing numbers of Sox10+ NCPCs becoming more evident in the pelvic ganglia anlagen and little migration away from the ganglion core. By 14 dpc, the pelvic ganglion has increased markedly in size and wraps around the dorsal aspect of the urethra behind the bladder base and extends posteriorly along the urethra. Most notably at 14 dpc individual Sox10+ NCPCs have begun migrating out from the pelvic ganglia in pronounced streams along the lateral walls of the bladder and have nearly reached the bladder dome. At this stage there is minimal migration of NCPCs into the medial bladder body. By 15 dpc, many more NCPCs are evident in the bladder body due to a secondary wave of migration that populates the center of the bladder and produces a more uniform distribution of Sox10+ NCPC in the medial region. However, at this point in development the bladder dome, near the urachus, is still sparsely populated by NCPCs. The consistent restriction of NCPCs within the anlagen of the pelvic ganglia from 12 dpc, when Sox10+ progenitors initially arrive, until 14dpc suggests this region may contain regulatory cues and function as a temporary “stop” along the path of NCPC migration into the bladder. A consistently orchestrated pattern of NCPC migration throughout the developing genital tubercle is likewise observed. Bilateral “streams” of NCPCs migrate laterally and distally along nearly the entire dorsal length of the genital tubercle by 12 dpc (Fig. 5, top row). These two tracts are consistent with the location of the dorsal nerve of the penis/clitoris at maturity. By 13 dpc the dorsal tracts have shifted to a more medial location in the dorsal aspect of the GT and extend in parallel down to the distal region that will eventually form the glans (Georgas et al., 2015). Foci of lateral migration are initiated at the distal tip and midshaft, resulting in a diaphanous, web-like distribution of

9

NCPCs that wrap around the genital tubercle from the dorsal to ventral surfaces by 14 dpc and 15 dpc. On the ventral surface of the genital tubercle, columnar aggregates of NCPCs, which are so apparent at 11.5 dpc, appear to completely dissipate from the area of labioscrotal swelling by 13 dpc as cells migrate around from the dorsal surface to surround the swelling (Fig. 5, bottom row, compare arrows at 11.5, 12, and 13 dpc). The fate of these cells remains unclear and open to speculation. It is unlikely, however, that they undergo cell death, as fragmentation of the nuclear H2BVenus signal characteristic of apoptosis is not evident (Corpening et al., 2011).

2.3 Sox10+ NCPCs undergo differentiation within the pelvic ganglia by 14 dpc. Previously we determined that neurogenesis is well along in the pelvic ganglia by 15 dpc, with Hu+/Phox2b+ neurons evident in large numbers (Wiese et al., 2012); however it has not been clear when gliogenesis occurs in the ganglia. To assess the appearance and distribution of peripheral glia relative to Sox10+ NCPCs, we undertook immunohistochemical analysis in cryosections. By 14 dpc, the pelvic ganglia are highly condensed and visible as large clusters in sagittal sections (Fig. 6, top panel). At this stage within the pelvic ganglia there is readily visible colocalization of the early glial marker BFABP with the majority of Sox10+ cells marked by H2BVenus expression (Fig. 6, first column). BFABP is expressed in many glial cells and is the earliest glial marker detected during differentiation of NCPCs in the enteric nervous system (Young et al., 2003).

Co-localization with the glial marker S100, which appears later in the

progression of peripheral glial cell differentiation, is visible in a subset of Sox10+ NCPC (Fig. 6, second column). Concurrently, the Sox10 transgene has down-regulated in the

10

majority of differentiating neurons marked by PGP9.5; however, there are a few infrequent cells that exhibit weak perdurance of the H2BVenus signal that overlaps with PGP9.5 expression. These observations largely agree with lineage divergence of neurons and glia in the enteric nervous system, where Sox10 expression marks migrating progenitors that populate the intestine and is maintained in enteric glial cells but is extinguished when NCPCs undergo neuronal differentiation (Anderson et al., 2006; Young et al., 2003).

2.4. Smooth muscle differentiation, vascularization, and innervation of the developing LUT appear to be concurrent but spatially independent processes. In order to assess the population of the bladder body by NCPCs relative to differentiation of smooth muscle, we performed immunohistochemical labeling for calponin, which exclusively labels smooth muscle cells, in contrast to smooth muscle actin which is also expressed in other cell types (Duband et al., 1993). At 12.5 dpc, the urachus is strongly positive for calponin and multiple foci of immunoreactive smooth muscle cells are observed within the pericloacal mesenchyme nearest the hindgut that will become the dorsal aspect of the bladder (Fig. 7). We were surprised to observe this regional initiation of calponin expression in one side of the primitive bladder instead of uniform appearance of calponin+ cells around the bladder circumference. Smooth muscle differentiation is also detected by calponin immunoreactivity in the distal end of the hindgut at the entrance to the cloaca. This was unexpected given that differentiation of the bowel occurs in a proximal to distal wave and that more proximal hindgut regions visible on the same sections show little, if any, calponin staining at this stage. One day

11

later in development at 13 dpc, smooth muscle differentiation marked by calponin expression is still most prominent closest to the urachus and continues to extend dorsally from the bladder dome toward the bladder neck. At this stage, no smooth muscle is evident at the dorsalmost aspect of the bladder neck where the ureters will eventually insert into the bladder wall. In contrast, smooth muscle is apparent in the urethra at 13 dpc and is spatially separated from smooth muscle differentiation in the bladder body. These two domains of smooth muscle differentiation in the urethra and bladder body continue to express higher levels of calponin in parallel and converge at the bladder neck at 15 dpc but remain separated by a small isthmus of non-reactive mesenchyme. At the earliest stages when smooth muscle differentiation is ongoing in the LUT, NCPCs have not yet entered the bladder body and remain in the pelvic ganglia anlagen. At 12 dpc, as shown in Figure 7, the bladder and genital tubercle are devoid of NCPCs and any TuJ1+ nerve processes. By 13.5 dpc infrequent NCPCs, marked by nuclear H2BVenus, are detected in the dorsal aspect of the urethra and are observed in large numbers along the dorsal surface of the genital tubercle where innervation by the pudendal nerve occurs.

While NCPCs appear sparse in 14 dpc mid-sagittal

sections that reveal the anatomic structures of the developing LUT, they are present in greater numbers than at 13dpc in the dorsal urethra and have also invaded the smooth muscle of the ventral urethra. Even greater numbers of NCPCs are observed in more lateral areas of the bladder within sections collected further away from the midline, consistent with the higher density of NCPCs in the lateral bladder walls that are evident in the whole mount images of Figure 4 (data not shown).

12

At this stage, the majority of

Sox10+ NCPCs colocalize with the neuronal marker TuJ1, suggesting that NCPC migration and neuronal differentiation occur simultaneously (Fig. 7). By 15 dpc NCPCs are visible in mid-sagittal sections along both the dorsal and ventral aspects of the bladder, within the smooth muscle and submucosa of the urethra, and in large numbers along the length of the genital tubercle.

By 14dpc and 15dpc, Sox10 and TuJ1

generally label distinct populations of cells surrounding the bladder neck, migrating through the posterior bladder wall, and extending down the genital tubercle. Colocalization of Sox10 with TuJ1 is still present at these later timepoints, but is not as prominent. Because close associations between NCPC-derived enteric ganglia and capillaries have been observed, it has been proposed that development of peripheral nerves and vasculature may be coordinated (Fu et al., 2013). To investigate this, we applied the endothelial cell marker PECAM to visualize formation of blood vessels relative to migration of NCPC into the LUT.

Numerous PECAM+ endothelial cells

condensing into vasculature tubes are evident in the LUT as early as 12.5 dpc, despite the near absence of smooth muscle differentiation and total absence of innervation at this stage. Nascent vasculature develops throughout the entire LUT in a fairly uniform manner, in contrast to the dorsal to ventral population of NCPCs into this system. Not until 15 dpc did we observe intimate association of Sox10-H2BVenus+ cells with forming PECAM+ endothelial cells, most notably in the developing urethra. Most likely these Sox10+ NCPC are differentiating glia, as they are closely juxtaposed with TuJ1+ processes. Despite extensive formation of PECAM+ vasculature from 12-15 dpc in the bladder, urethra, and hindgut, we noted that the epithelium and its immediate underlying

13

mesenchyme in these tissues is completely devoid of vascularization at these stages. Our analysis of markers for innervation, smooth muscle differentiation, and vascularization shows that these processes do not proceed concurrently in the developing LUT.

2.5. In late fetal development and adult bladder, Sox10+ sacral NC-derivatives primarily associate with neuronal processes, but a subpopulation are intimately associated with vascular endothelium. By 17.5 dpc, Sox10-H2BVenus cells are distributed extensively throughout the LUT, and we investigated the spatial relationship of those cells to the PGP9.5+ neurons and PECAM+ vasculature within the bladder wall (Fig. 8, top). In contrast to exclusion of endothelial cells from the epithelium that is apparent at 15 dpc, by 17.5 dpc the developing vasculature is widely dispersed throughout the detrusor muscle and is now prominent within the submucosa. Use of PGP9.5 as a neuronal marker, instead of TuJ1, also produces characteristic staining of urothelium in the bladder, which highlights the intimate contact of the vasculature with the basal surface of the urothelium. Throughout the bladder wall, the majority of Sox10+ cells are tightly associated with neuronal processes by 17.5 dpc and no longer show any co-localization with neuronal markers like TuJ1+ and PGP9.5 (Fig. 8, Rows A and B, arrows). Interestingly, we observed rare Sox10+ NCPCs in close proximity to the vascular endothelium, at a distance from neurons and neuronal processes (Fig. 8, Rows A and B, arrowheads). At this same stage, the pelvic ganglia are composed of tight aggregates of cells of multiple lineages, including glia, neurons, and vascular endothelial cells (Fig. 8, Row C). Due to

14

the density of ganglia cells at 17 dpc, it was not possible to reliably assess whether a subpopulation of NCPCs are associating with vascular endothelium within the pelvic ganglia like those seen in the bladder wall. In order to determine whether heterogeneity of expression among Sox10+ cells also occurred at older ages, we performed a similar labeling of PGP9.5+ neurons and PECAM+ vasculature in adult bladder tissue.

Consistent with the distribution of

PECAM+ cells observed at 17 dpc, we observed rich vascularization of the submucosa beneath the urothelium (Fig. 9, left panel).

In addition we also observed Sox10-

H2BVenus+ cells whose nuclei were intimately associated with PECAM+ vasculature, as had been seen at 17 dpc (Fig 9, right panels). These observations indicate that the heterogeneity of Sox10+ cells in the bladder wall observed in fetal stages is due to maintenance of Sox10 expression in a variety of cell types throughout the bladder wall.

2.6. Intramural ganglia of the adult bladder retain expression of Sox10 in glia and cells undergoing neuronal differentiation. In the adult bladder, Sox10+ cells labeled by H2BVenus are relatively uniformly scattered throughout the detrusor and submucosa, with the exception of intramural ganglia located in the dorsal wall of the bladder, where numerous Sox10+ cells are clustered within the ganglia (Fig. 10, left side, dashed oval). Throughout the detrusor muscle, the vast majority of Sox10+ cells express S100+, which is a well established glial lineage marker and is consistent with the role of Sox10 in gliogenesis in multiple aspects of the peripheral nervous system. However, we observed that infrequent Sox10+, S100- cells and rare Sox10-, S100+ cells are also present in the bladder

15

wall (Fig. 10, right, top, arrowheads). In the detrusor muscle of the bladder, no colocalization of Sox10-H2BVenus with the neuronal marker PGP9.5 is present (Fig. 10, right, bottom, “Dome”). However within and nearby intramural ganglia of the bladder wall, we did observe infrequent Sox10+,PGP9.5+ double positive cells (Fig. 10, right, bottom, “Dorsal/Im Ganglia”). Since PGP9.5 is known to label mature neurons and neuronal progenitor populations, it is feasible that these double positive cells within the intramural ganglia may not yet be terminally differentiated and thus are marked by both perduring Sox10-H2BVenus and upregulation of PGP9.5. In contrast to the density of Sox10+ cells we observed in other bladder layers, the serosa and urothelium were devoid of Sox10+ lineages at all stages we examined. 3. Discussion In order to monitor routes of NCPCs to and within the LUT, we examined the distribution of Sox10+ cells labeled by expression of H2BVenus from the Sox10H2BVenus transgene reporter (Corpening et al., 2011). This strategy is advantageous because it is a monoallelic system that permits direct fluorescence visualization, the nuclear localized reporter provides pinpoint localization of individual cells via association of the Histone2B fusion reporter with chromatin, and it does not suffer from effects of Sox10 haploinsufficiency. We initially established that the Sox10-H2BVenus transgene accurately reflects expression of Sox10 in migrating sacral NCPCs in the LUT by comparing it to a Sox10LacZ-KO/+ knockin allele (Fig. 1) and our prior analysis of Sox10+ cells detected by in situ hybridization of fetal urogenital tracts (Wiese et al., 2012). Subsequently, we utilized the Sox10-H2BVenus transgene expression patterns to construct a spatiotemporal map of NCPC progression throughout the developing LUT

16

and investigated the relationship of NCPCs to bladder innervation, smooth muscle differentiation, and vascularization during fetal development and in adult tissue. We observed that by 11.25 dpc, NCPCs have migrated ventrolaterally from the dorsal neural tube to surround the metanephric mesenchyme but do not appear to invade this structure (Fig. 3). This finding is in agreement with the work of others, who concluded that NCPCs are likely not essential to early kidney morphogenesis although they do integrate with the kidney later in development (Itaranta et al., 2009). Previously it has not been clear when sacral NCPCs that populate the urogenital tract initiate neuronal differentiation. Prior studies that traced the migration of sacral NCPCs around the hindgut using a DH-LacZ reporter suggested that neuronal differentiation may be occurring as these progenitors enter the urogenital sinus mesenchyme (Anderson et al., 2006). Consistent with this, we observed that neuronal glial lineage segregation is well underway within the pelvic ganglia at 14 dpc (Fig. 6). However, through sectional analysis at 11.25 dpc, we discovered that NCPCs were already undergoing neuronal differentiation, as evidenced by rare Hu+ cells admixed with Sox10+ cells (Fig. 3A”). The extent of differentiation clearly increased by 12 dpc (Fig. 3B”), when the embryo had elongated and the metanephric mesenchyme had ascended rostrally. These findings provide the first evidence that neuronal differentiation is an ongoing process concurrent with sacral NCPC migration, rather than a stepwise series of events that occur after sacral NCPCs coalesce to form pelvic ganglia. Just as sacral NCPCs appear to follow a prescribed route from the neural tube to the pelvic ganglia, their emigration from the pelvic ganglia into the bladder appears tightly regulated and follows a very stereotypical pattern (Fig. 4). While the pelvic

17

ganglia are clearly formed and recognizable by 12 dpc, exodus of NCPCs from the pelvic ganglia out into the bladder body is delayed until 13 dpc. Migration into the bladder then proceeds in a stepwise fashion, with the first wave of NCPCs trekking along the lateral walls of the bladder toward the dome by 14 dpc, followed by a second wave migrating through the medial aspect of the bladder at 15 dpc. Perhaps the pelvic ganglion is the site of regulatory “instruction” for NCPCs prior to their immigration into the bladder, or perhaps the bladder mesenchyme requires additional time to generate effective levels of signaling molecules to promote entry of NCPCs into the bladder wall. This is definitely an avenue for future investigation, as deficits in guidance cues within the pelvic ganglia, or anywhere along the NCPC migratory pathway, may contribute to congenital abnormalities of bladder innervation (Woolf et al., 2014).

Moreover,

identification of signaling pathways that control trafficking of NCPCs into the bladder wall may be important for efforts seeking to innervate artificial scaffolds in bladder augmentation therapies (Atala, 2011). Migration of NCPCs into the genital tubercle is also highly orchestrated and temporally regulated (Fig. 5). NCPC colonization of the genital tubercle precedes that in the bladder. At 13 dpc, NCPCs have infiltrated the entire length of the genital tubercle but have not yet begun their population of the bladder. Interestingly, there are notable similarities in the patterns of gene expression for a Wnt5-associated network in the genital tubercle and the spatial distribution of Sox10+ neural crest that we observed (Chiu et al., 2010). Chiu et al observed the same distribution of Dkk1 at the dorsal aspect of the distal genital tubercle wrapping around in the spatial pattern we report here for Sox10+ NCPCs.

Moreover, the patterns of Sox10+ NCPCs in the genital

18

tubercle complement those reported for Wnt5a and Frzb, wherein NCPCs are absent from areas expressing these molecules (Chiu et al., 2010). Future studies will be needed to determine whether Wnt signaling functions to promote colonization or patterning of nerves in the developing genital tubercle.

Discerning such regulatory

events in normal development could provide insight for regenerative efforts following surgical or traumatic injury to penile nerves. We also investigated other concomitant developmental processes, including bladder smooth muscle differentiation in relation to NCPC migration (Fig. 7). We found that smooth muscle differentiation is multifocal within the bladder, initiating at the bladder dome, immediately adjacent to the urachus, and shortly thereafter in the dorsal aspect of the primitive bladder near the most anterior aspect of the cloaca. Initial smooth muscle differentiation proceeds in a direction opposite innervation and does not appear to be dependent upon innervation. While it is possible that there could be some interdependency of these processes in the LUT, the spatial patterning and temporal progression that we observed appears distinct at each of the stages of LUT development we examined. The temporal appearance of smooth muscle cells marked by calponin in the developing LUT has not previously been reported and raises several possibilities for how this process is regulated. We observed the earliest and greatest intensity of calponin staining in the urachus. Signals emanating from the urachus is one possibility for regulation of smooth muscle differentiation. However at the temporal and spatial resolution of the studies we conducted, we cannot discern whether smooth muscle cells actually delaminate from the urachus around 12.5-13 dpc and infiltrate the bladder mesenchyme. Another possibility is that there are molecular signals forming a

19

gradient that induces differentiation from the serosal surface inward. Clearly, additional investigation is required, particularly in light of a previous study implicating signaling gradients of Smad family members initiating at the urothelium and extending through bladder mesenchyme as essential for smooth muscle differentiation (Islam et al., 2013). We paid particular attention to the formation of vasculature relative to population of the LUT by Sox10+ sacral NCPCs.

We observed that vascularization of the

developing bladder clearly occurs early (before 12.5 dpc) and precedes both innervation and smooth muscle differentiation (Fig. 7). Moreover, there is a spatial patterning to this process, with the mesenchyme of the bladder wall becoming vascularized first, followed later by extensive vascularization of the submucosa (Fig. 8). This is analogous to processes in the fetal intestine where NCPC migration throughout the gut is always preceded by formation of an established capillary plexus (Delalande et al., 2014; Hatch and Mukouyama, 2015). Despite the fact that there is close apposition of NCPCs to developing capillaries at later stages (17 dpc), our analysis of NCPC migration relative to LUT vascularization suggests that these processes are independent temporally and spatially. Mutant analyses in the fetal intestine have shown unequivocally that NCPC migration proceeds normally in the absence of an established vascular network (Delalande et al., 2014). Similar studies will be required in the future to rule out the possibility that there is any co-dependency between developing vasculature and innervation in the LUT. In the course of our studies, we observed rare Sox10+ cells in the bladder wall that did not co-label with markers of glia (S100) or neurons (PGP9.5) (Figs. 8 and 9). Some of these were found in close association with PECAM+ endothelial cells of the

20

vasculature. It is possible that these cells are glia that are not in immediate contact with neural processes, given prior reports of heterogeneous glial cells in the enteric nervous system that varied in expression of traditional glial markers, morphology and location in the intestinal wall (Boesmans et al., 2015). However, others have reported that vascular pericytes in the thymus, retina, and choroid derive from neural crest based on studies using Cre lineage tracing (Trost et al., 2013; Zachariah and Cyster, 2010). The nature and function of the rare Sox10+ vascular-associated cells we observe in the bladder wall remain to be investigated. Despite attempts to label these rare cells with pericyte lineage markers such as NG2 and PDGFR, we have not yet been successful in optimizing conditions that permit specific cell labeling (data not shown).

Thus it is

possible that NCPCs may give rise to pericytes in the LUT. Future work using robust Cre drivers for lineage tracing of neural crest will be necessary to definitively address this possibility. Within intramural ganglia of mouse bladders, we detected colocalization of Sox10 with PGP9.5 in a minority of cells, both at late fetal (17 dpc) and adult (6 week) ages. This finding suggests that a pool of neuronal progenitors resides within the intramural ganglia that has not yet undergone terminal lineage restriction (Fig. 10). It is known that the number of neurons in the pelvic ganglia more than doubles between birth and adulthood in the mouse, and evidence suggests this is the result of maturation of neuronal precursor cells into differing neuronal types rather than simple cell division (Yan and Keast, 2008). This process could account for the Sox10+/PGP9.5+ cells we observe within the intramural ganglia and in their immediate vicinity in the bladder wall. Less likely is the possibility that NCPCs remain at some undetermined location where

21

they are actively giving rise to differentiating neurons. Future analyses using neural crest lineage tracers such as Wnt1-Cre and Nestin-Cre in combination with physiological labels of dividing cells will be needed to determine whether replacement of LUT neurons is a process that continues in older animals. The studies we present here provide the first spatiotemporal map of sacral NCPC migration extending from the dorsal neural tube throughout the LUT of the mouse, encompassing early fetal development to adulthood. Our study reveals several potential key regulatory pause points along the pathway of sacral NCPC migration that will require further investigation. We have also described the patterns of smooth muscle differentiation and vascularization in the developing bladder and their temporal and spatial relationship to NCPC migration. This wild type sacral NCPC “roadmap” will facilitate future studies in mouse models of LUT dysfunction, as departures from this map should provide insight into pathological mechanisms of disease.

4. Methods 4.1 Animal Husbandry and Genotyping All animal procedures were approved by the Institutional Animal Care and Use Committee at Vanderbilt University. A LacZ knock-in allele of Sox10, Sox10tm1Weg/+, hereafter referred to as Sox10LacZ-KO/+ (RRID:MGI_#5552012) was a kind gift of Dr. Michael Wegner and bred to congenicity on a C3HeB/FeJ strain background (Jackson Laboratory, Stock #000658) (Britsch et al., 2001). transgene

reporter

driven

by

Sox10

Mice carrying the H2BVenus

regulatory

regions,

Tg(Sox10-

HIST2H2BE/Venus)ASout (RRID:MGI_#3769269), hereafter referred to as Sox10-

22

H2BVenus, were maintained by backcrossing to C3Fe females. Sox10LacZ-KO/+ mice were genotyped using primers and PCR parameters listed in Table 1. Sox10-H2BVenus transgenic mice were genotyped with T7, SP6, and internal primers to ensure integrity of the entire transgene as previously described (Corpening et al., 2011; Deal et al., 2006) (See Table 1). Timed matings were set to obtain staged mouse embryos, designating the morning of plug formation as 0.5 days post coitum (dpc).

4.2 Embryo Procurement and Tissue Preparation At the desired time points, embryos were harvested into 1x ice-cold phosphate buffered saline (1x PBS, Sigma) and fixed in 10% neutral buffered formalin (NBF, Sigma) from 6 h to overnight at 4°C, depending on size. Embryos were equilibrated in 1x PBS containing 30% sucrose and stored at 4°C. As needed, further micro-dissection of lower urinary tract organs was performed, and embryos and tissues to be sectioned were cryopreserved in tissue freezing media (General Data Healthcare). Tissues were sectioned (20 µm thickness) using a Leica CM1900 cryostat (Leica) and processed through immunohistochemistry.

4.3 Whole Mount Detection of βGal and Immunohistochemistry For detection of βgal expression, organs of the lower urinary tract were microdissected and subsequently fixed in neutral buffered formalin (NBF) at 4°C for 20 min, then washed, stained at room temperature for up to 72 h, and stored according to established protocol (Chandler et al., 2007; Deal et al., 2006).

23

For immunohistochemical localization of cell type specific markers, cryosections were

mounted

on

microscope

slides

previously

coated

with

3-

aminopropyltriethoxysilane (3-APES, Sigma) to promote adhesion according to established methods (Maddox and Jenkins, 1987) and subsequently warmed to 37°C for 30 min. Tissue freezing media was removed and tissue permeabilization enhanced by washing the slides once in 1x PBS with 0.3% Triton X-100 for 8 min. After blocking for 1 hr at RT in 1x PBS with 0.3% Triton X-100, 5% normal donkey serum (Jackson ImmunoResearch, 017-000-121, RRID:AB_2337258) and 0.1% BSA, Fraction V (Sigma), primary antibodies diluted in blocking solution were applied at 4°C at concentrations specified in Table 2. Following washes in 1x PBS, appropriate secondary antibodies diluted in blocking solution were added for 1 hr at RT. After final washes in 1x PBS with 0.3% TX-100, slides were incubated in quenching solution (0.5mM cupric sulfate in 50mM ammonium acetate buffer, pH 5.0) for 10 min to minimize autofluorescence (Polanco et al., 2010), and the quenching reaction was terminated by transferring the slides to sterile water. Slides were then immediately mounted with Aqua Poly/Mount (Polysciences, Inc.). When it was desirable to visualize nuclei, staining with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, 1:50,000) was performed for 5 min in 1x PBS, followed by three 10-min washes, prior to mounting coverslips.

4.4 Fluorescent Microscopy Initial imaging of embryos and subdissected urogenital tracts was performed on a Leica M205 FA microscope with an ORCA-Flash4.0 V2 digital CMOS camera

24

(Hamamatsu) or a Zeiss M2Bio microscope with a Retiga 4000R-F-M-C camera (QImaging) and accompanying software. Imaging of cryosections was initially performed on a Leica DMI6000 B microscope using SimplePCI version 6.6.0.16 imaging software (Hamamatsu). Confocal microscopy was performed on a Zeiss Scanning Microscope LSM510 using a 633 nm laser for imaging Cy5 (649-745 bandpass filter), 543 nm laser for imaging Cy3 (560-615 bandpass filter), and a 488 nm laser for imaging Venus (YFP, 505-550 bandpass filter) to visualize transgene expression and secondary antibody fluorophores. Images were captured with the Zeiss LSM Image Browser Software (free download,

http://www.zeiss.com/microscopy/en_de/website/downloads/lsm-image-

browser.html). Images were then exported from the Image Browser software as .tiff files and assembled in Adobe Photoshop (2014 2.2 release, Adobe Systems Inc.).

Author contributions AC collected embryos and performed imaging.

SJI collected embryos, performed

immunohistochemistry, and captured images. CBW collected embryos, performed immunohistochemistry, captured images, prepared draft figures, and aided in preparation of the text. KKD collected embryos, performed immunohistochemistry, captured images, participated with data analysis, prepared figures and assisted with compilation of the manuscript. EMS2 conceived the study and directed the project, participated with data analysis, and wrote the manuscript.

25

Acknowledgements The authors thank Dr. Michael Wegner for providing Sox10LacZ-KO/+ mice, Dr. Vanda Lennon for providing Hu antibody, and Dr. T. Muller for providing BFABP antibody. They gratefully acknowledge and thank Dr. Sam Wells and the support staff of the Cell Imaging Shared Resource Core at Vanderbilt for advice and assistance in confocal imaging. The Cell Imaging Shared Resource Core is supported by NIH grants CA68485, DK20593, DK58404, HD15052, DK59637, and EY08126. This work was supported by funding from a US National Institutes of Health grant from NIDDK (R01DK078158, R56DK078158, RC1DK086594) to E.M.S2.

References Anderson, R.B., Stewart, A.L., Young, H.M., 2006. Phenotypes of neural-crest-derived cells in vagal and sacral pathways. Cell Tissue Res 323, 11-25. Atala, A., 2011. Tissue engineering of human bladder. Br Med Bull 97, 81-104. Atala, A., Bauer, S.B., Soker, S., Yoo, J.J., Retik, A.B., 2006. Tissue-engineered autologous bladders for patients needing cystoplasty. Lancet 367, 1241-1246. Betancur, P., Bronner-Fraser, M., Sauka-Spengler, T., 2010. Genomic code for Sox10 activation reveals a key regulatory enhancer for cranial neural crest. Proc Natl Acad Sci U S A 107, 3570-3575. Betancur, P., Sauka-Spengler, T., Bronner, M., 2011. A Sox10 enhancer element common to the otic placode and neural crest is activated by tissue-specific paralogs. Development 138, 3689-3698. Boesmans, W., Lasrado, R., Vanden Berghe, P., Pachnis, V., 2015. Heterogeneity and phenotypic plasticity of glial cells in the mammalian enteric nervous system. Glia 63, 229-241. Britsch, S., Goerich, D.E., Riethmacher, D., Peirano, R.I., Rossner, M., Nave, K.A., Birchmeier, C., Wegner, M., 2001. The transcription factor Sox10 is a key regulator of peripheral glial development. Genes Dev 15, 66-78. Chandler, K.J., Chandler, R.L., Broeckelmann, E.M., Hou, Y., Southard-Smith, E.M., Mortlock, D.P., 2007. Relevance of BAC transgene copy number in mice: transgene 26

copy number variation across multiple transgenic lines and correlations with transgene integrity and expression. Mamm Genome 18, 693-708. Chiu, H.S., Szucsik, J.C., Georgas, K.M., Jones, J.L., Rumballe, B.A., Tang, D., Grimmond, S.M., Lewis, A.G., Aronow, B.J., Lessard, J.L., Little, M.H., 2010. Comparative gene expression analysis of genital tubercle development reveals a putative appendicular Wnt7 network for the epidermal differentiation. Dev Biol 344, 1071-1087. Corpening, J.C., Deal, K.K., Cantrell, V.A., Skelton, S.B., Buehler, D.P., SouthardSmith, E.M., 2011. Isolation and live imaging of enteric progenitors based on Sox10Histone2BVenus transgene expression. Genesis 49, 599-618. Deal, K.K., Cantrell, V.A., Chandler, R.L., Saunders, T.L., Mortlock, D.P., SouthardSmith, E.M., 2006. Distant regulatory elements in a Sox10-beta GEO BAC transgene are required for expression of Sox10 in the enteric nervous system and other neural crest-derived tissues. Dev Dyn 235, 1413-1432. Delalande, J.M., Natarajan, D., Vernay, B., Finlay, M., Ruhrberg, C., Thapar, N., Burns, A.J., 2014. Vascularisation is not necessary for gut colonisation by enteric neural crest cells. Dev Biol 385, 220-229. Duband, J.L., Gimona, M., Scatena, M., Sartore, S., Small, J.V., 1993. Calponin and SM 22 as differentiation markers of smooth muscle: spatiotemporal distribution during avian embryonic development. Differentiation 55, 1-11. Freem, L.J., Escot, S., Tannahill, D., Druckenbrod, N.R., Thapar, N., Burns, A.J., 2010. The intrinsic innervation of the lung is derived from neural crest cells as shown by optical projection tomography in Wnt1-Cre;YFP reporter mice. J Anat 217, 651-664. Fu, X., Rivera, A., Tao, L., Zhang, X., 2013. Genetically modified T cells targeting neovasculature efficiently destroy tumor blood vessels, shrink established solid tumors and increase nanoparticle delivery. Int J Cancer 133, 2483-2492. Georgas, K.M., Armstrong, J., Keast, J.R., Larkins, C.E., McHugh, K.M., SouthardSmith, E.M., Cohn, M.J., Batourina, E., Dan, H., Schneider, K., Buehler, D.P., Wiese, C.B., Brennan, J., Davies, J.A., Harding, S.D., Baldock, R.A., Little, M.H., Vezina, C.M., Mendelsohn, C., 2015. An illustrated anatomical ontology of the developing mouse lower urogenital tract. Development 142, 1893-1908. Hatch, J., Mukouyama, Y.S., 2015. Spatiotemporal mapping of vascularization and innervation in the fetal murine intestine. Dev Dyn 244, 56-68. Islam, S.S., Mokhtari, R.B., Kumar, S., Maalouf, J., Arab, S., Yeger, H., Farhat, W.A., 2013. Spatio-temporal distribution of Smads and role of Smads/TGF-beta/BMP-4 in the regulation of mouse bladder organogenesis. PLoS One 8, e61340. Itaranta, P., Viiri, K., Kaartinen, V., Vainio, S., 2009. Lumbo-sacral neural crest derivatives fate mapped with the aid of Wnt-1 promoter integrate but are not essential to kidney development. Differentiation 77, 199-208. Kapur, R.P., 2000. Colonization of the murine hindgut by sacral crest-derived neural precursors: experimental support for an evolutionarily conserved model. Dev Biol 227, 146-155. Lajiness, J.D., Snider, P., Wang, J., Feng, G.S., Krenz, M., Conway, S.J., 2014. SHP-2 deletion in postmigratory neural crest cells results in impaired cardiac sympathetic innervation. Proc Natl Acad Sci U S A 111, E1374-1382.

27

Lake, J.I., Heuckeroth, R.O., 2013. Enteric nervous system development: migration, differentiation, and disease. Am J Physiol Gastrointest Liver Physiol 305, G1-24. Lam Van Ba, O., Aharony, S., Loutochin, O., Corcos, J., 2015. Bladder tissue engineering: a literature review. Adv Drug Deliv Rev 82-83, 31-37. Le Douarin, N.M., Calloni, G.W., Dupin, E., 2008. The stem cells of the neural crest. Cell Cycle 7, 1013-1019. Maddox, P.H., Jenkins, D., 1987. 3-Aminopropyltriethoxysilane (APES): a new advance in section adhesion. J Clin Pathol 40, 1256-1257. Mundell, N.A., Plank, J.L., LeGrone, A.W., Frist, A.Y., Zhu, L., Shin, M.K., SouthardSmith, E.M., Labosky, P.A., 2012. Enteric nervous system specific deletion of Foxd3 disrupts glial cell differentiation and activates compensatory enteric progenitors. Dev Biol 363, 373-387. Musser, M.A., Southard-Smith, E.M., 2013. Balancing on the crest - Evidence for disruption of the enteric ganglia via inappropriate lineage segregation and consequences for gastrointestinal function. Dev Biol 382, 356-364. Obermayr, F., Hotta, R., Enomoto, H., Young, H.M., 2013. Development and developmental disorders of the enteric nervous system. Nat Rev Gastroenterol Hepatol 10, 43-57. Oberpenning, F., Meng, J., Yoo, J.J., Atala, A., 1999. De novo reconstitution of a functional mammalian urinary bladder by tissue engineering. Nat Biotechnol 17, 149155. Polanco, J.C., Wilhelm, D., Davidson, T.L., Knight, D., Koopman, P., 2010. Sox10 gainof-function causes XX sex reversal in mice: implications for human 22q-linked disorders of sex development. Hum Mol Genet 19, 506-516. Shakova, O., Sommer, L., 2010. Neural crest-derived stem cells. Harvard Stem Cell Institute, Cambridge (MA). Trost, A., Schroedl, F., Lange, S., Rivera, F.J., Tempfer, H., Korntner, S., Stolt, C.C., Wegner, M., Bogner, B., Kaser-Eichberger, A., Krefft, K., Runge, C., Aigner, L., Reitsamer, H.A., 2013. Neural crest origin of retinal and choroidal pericytes. Invest Ophthalmol Vis Sci 54, 7910-7921. Verberne, M.E., Gittenberger-de Groot, A.C., van Iperen, L., Poelmann, R.E., 2000. Distribution of different regions of cardiac neural crest in the extrinsic and the intrinsic cardiac nervous system. Dev Dyn 217, 191-204. Wiese, C.B., Ireland, S., Fleming, N.L., Yu, J., Valerius, M.T., Georgas, K., Chiu, H.S., Brennan, J., Armstrong, J., Little, M.H., McMahon, A.P., Southard-Smith, E.M., 2012. A genome-wide screen to identify transcription factors expressed in pelvic Ganglia of the lower urinary tract. Front Neurosci 6, 130. Woolf, A.S., Stuart, H.M., Roberts, N.A., McKenzie, E.A., Hilton, E.N., Newman, W.G., 2014. Urofacial syndrome: a genetic and congenital disease of aberrant urinary bladder innervation. Pediatr Nephrol 29, 513-518. Yan, H., Keast, J.R., 2008. Neurturin regulates postnatal differentiation of parasympathetic pelvic ganglion neurons, initial axonal projections, and maintenance of terminal fields in male urogenital organs. J Comp Neurol 507, 11691183. Young, H.M., Bergner, A.J., Muller, T., 2003. Acquisition of neuronal and glial markers by neural crest-derived cells in the mouse intestine. J Comp Neurol 456, 1-11. 28

Zachariah, M.A., Cyster, J.G., 2010. Neural crest-derived pericytes promote egress of mature thymocytes at the corticomedullary junction. Science 328, 1129-1135.

Figure Legends Figure 1. Distribution of sacral neural crest-derived progenitor cells (NCPCs) in Sox10LacZ-KO/+ and Sox10-H2BVenus embryos. Ventral views of micro-dissected urogenital tracts are shown in whole mount from (A) a 14 dpc Sox10LacZ-KO/+ and (B) a 14.5dpc Sox10-H2BVenus embryo (70X magnification). The superior (anterior) surface of the genital tubercle is shown. Abbreviations: a, adrenal gland; b, bladder; cg, celiac ganglia; dn, dorsal nerve; e, epididymis; gt, genital tubercle; hg, hindgut; k, kidney; t, testis; vd, vas deferens.

Figure 2. Initial migration of sacral NCPCs towards the the developing urogenital tract viewed in whole mount Sox10-H2BVenus embryos. (A) Lateral view of a 10 dpc embryo imaged for H2BVenus fluorescence. The dorsal surface of the tail is outlined with a dashed line, and the most caudal neural crest cells that are just emerging from the neural tube at the level of the hindlimb are marked with an arrow. (B) Fluorescence image of H2BVenus-expressing NCPC entering the genital tubercle and pelvic mesenchyme of a 11 dpc embryo at the lumbosacral level (53X magnification). (C) Sox10-H2BVenus+ progenitors as visible in this lateral view of a micro-dissected lower urinary tract with the bladder above the genital tubercle at 12 dpc embryo (50X magnification). (D) Lateral view of the urogenital system micro-dissected from a 12.5 dpc embryo shows Sox10+ NCPC migrating through the the pelvic plexus, prominent

29

aggregation of cells within the pelvic ganglia anlagen (red circle), and migration of sacral NCPCs into the genital tubercle. The dashed line indicates the distal aspect of the genital tubercle. The dotted lines in (B), (C) and (D) denote the paths of umbilical blood vessels that flank the bladder. Abbreviations: e, eye; tg, trigeminal ganglion; o, otic vesicle; drg, dorsal root ganglia; gt, genital tubercle; pg, pelvic ganglion; pp, pelvic plexus.

Figure 3. Sacral NCPCs route around the metanephric mesenchyme and form loose aggregates in the pelvic ganglia anlagen by 12 dpc. (A) Transverse cryosection through an 11.25 dpc Sox10-H2BVenus embryo at the level of the hindlimb stained with DAPI shows the anatomy of the metanephric mesenchyme and the junction of the cloaca with the hindgut

(A’) Immunostaining of the section in panel A with

antibodies for Hu (neuronal cell bodies, blue) and TuJ1 (neuronal processes, red) shows the relative position of migrating Sox10-H2BVenus+ NCPC (green) (100X magnification). (A”) High magnification image (200X) of boxed area in A’’ shows Hu+ cells emphasized by arrows. (B). Transverse cryosection through the sacral region of a 12 dpc Sox10-H2BVenus embryo at an axial level comparable to that shown in panel A. DAPI stain at this stage shows extension of nerve tracts from the neural tube and septation of the hindgut and cloaca.

(B’) Immunostaining of the section in panel B for

Hu and TuJ1 antibodies reveals aggregates of NCPC co-mingled with Hu+ cells that are differentiating neurons (100X magnification). (B”) Magnification (200X) of boxed area in panel B’. Abbreviations: cl, cloaca; drg, dorsal root ganglia; hg, hindgut; m, metanephric mesenchyme; n, nerve tract; nt neural tube.

30

Figure 4. Sacral NCPC populate the primitive bladder by migration from the pelvic ganglia out into the bladder body. Fetal bladder tissue micro-dissected from 12 dpc to 15 dpc Sox10H2BVenus embryos was laid flat and imaged by fluorescent stereomicroscopy from the anterior aspect (4X–10X magnification). NCPC are labeled by bright fluorescence of the Sox10-H2BVenus transgene in the pelvic ganglia anlagen and visible as individual discrete cells that migrate out into the bladder body by 14 dpc due to nuclear localization of the H2BVenus reporter. Dashed lines delineate the blood vessels flanking the urogenital sinus/bladder at 12 and 13 dpc. The bladder dome is apparent in the 14 dpc and 15 dpc bladders.

Figure 5. Stereotypical patterns of Sox10+ sacral NCPC migration throughout the developing

genital

tubercle.

Images

of

the

dorsal

(superior)

surfaces of

Sox10H2BVenus transgenic genital tubercle tissue at each developmental time point from 11.5 through 15.5 dpc are shown across the top row with ventral (inferior) surfaces shown immediately below. Arrows indicate the position of ventral columnar aggregates that dissipate over time. Dashed lines delineate the distal tip of the genital tubercle. (100X-150X magnification)

Figure 6. Neuronal-glial lineage divergence is ongoing within the pelvic ganglia at 14 dpc. The relative size and position of a fetal pelvic ganglia in relation to the urinary bladder is shown in a cryosection (top, 100X magnification), where Sox10+ NCPC are labeled by intense H2BVenus expression.

31

Below confocal images of cryosections

immunostained with antibodies against BFAPF (red, early glial marker, left column) identify large numbers of Sox10-H2BVenus+ cells (green) that exhibit co-localization with this antigen (arrows) in merged images, although there are some Sox10+ nuclei that do not show any BFABP co-localization (arrowheads). At 14 dpc fewer Sox10H2BVenus+ show co-localization with the more mature marker of peripheral glial S100b (red, middle column) in cryosections stained for this antigen (arrows), while most H2BVenus+ cells show no S100b labeling (arrowheads). In contrast, confocal images of pelvic ganglia stained for PGP9.5 (red, neuronal marker, right column) reveal minimal co-localization with this marker due to limited perdurance of the Sox10-H2BVenus+ transgene in cells that have progressed towards the neuronal lineage (arrows), while there are many Sox10-H2BVenus+ cells that show no co-localization with PGP9.5 (arrowheads). Confocal magnification is 400X for all images.

Figure 7. Temporal and spatial independence of sacral NCPC migration marked by Sox10H2BVenus expression relative to smooth muscle and vasculature development in the bladder wall. Images of sagittal cryosections through the developing lower urogenital tract of 12.5 dpc through 15 dpc Sox10-H2BVenus+ embryos are shown. Sox10-expressing NCPCs are visible as a result of transgene fluorescence (green) in sections immunostained either for calponin (red, smooth muscle) alone or jointly immunostained for PECAM (blue, endothelial cells) and TuJ1 (red, neuronal processes). In all images, the ventral aspect of the embryo is on the right. Cryosections immunostained for PECAM and TuJ1 were approximately 160um lateral to the midsagittal sections used to detect calponin. For this reason, some midline

32

structures are not visible in the sections used for PECAM/TuJ1 detection. All fluorescent (calponin) and confocal (PECAM/TuJ1) images were taken at 100X magnification and tiled in Adobe Photoshop to generate composite images. An asterisk indicates the location of the hindgut fusion with the cloaca where smooth muscle differentiation appears initially. Arrowheads indicate the locations of individual Sox10+ NCPCs that are integral to the urethral and bladder walls.

Abbreviations: b, bladder; cl, cloaca

(dashed outline); gt, genital tubercle; hg, hindgut; pb, primitive bladder; sp, developing symphysis pubis; u, urethra; ur, ureter; ura, urachus.

Figure 8. Association of NCPCs with both neuronal processes and blood vessels in the 17.5 dpc developing bladder. The top panel shows a low-magnification (70X) midsagittal view of an E17.5 bladder from an Sox10-H2BVenus (green) fetal mouse immunostained with the neuronal marker PGP9.5 (red) and the endothelial marker PECAM (blue). Images in Rows A, B, and C are higher magnification views (200X) of the corresponding areas delineated by dashed squares in the top panel. Typical Sox10+ glial cells intimately associated with neuronal processes are highlighted by arrows in Rows A and B. Rare Sox10+ cells closely associated with vascular endothelium and distant from neuronal processes are highlighted by arrowheads in Row A and B. A high density of Sox10+ cells, neuronal processes, and vascular endothelium is present within the pelvic ganglion shown in Row C. This tight aggregate of cells precludes an assessment of whether a subpopulation of Sox10+ cells associates more closely with endothelial cells than with neuronal processes. The staining of urothelium with PGP9.5 antibody is consistently observed by many laboratories (www.gudmap.org).

33

Figure 9. Association of Sox10+ NC-derived cells with vasculature in the adult bladder.

(A) Confocal image of a cryosection from adult mouse Sox10-H2BVenus

transgenic bladder stained with PECAM (blue, endothelial cells of vasculature) and PGP9.5 (red, neuronal cells and urothelium) shown at 100X magnification. Individual Sox10 expressing cells are labeled by nuclear expression of the H2BVenus reporter (green). (B) Higher zoom confocal images from the boxed region in panel A show individual fluorophore labeling in the bladder wall just beneath the urothelium (200X magnification).

(C)

High magnification images reveal the presence of Sox10-

H2BVenus+ cells whose nuclei are tightly associated with PECAM+ vaculature and appear to wrap around vessels (400X magnification). The staining of urothelium with PGP9.5 antibody is consistently observed by many laboratories (www.gudmap.org). Abbreviations: det, detrusor muscle; sub, submucosa; um, urothelium.

Figure 10. Heterogeneity of Sox10+ NC-derived cells in the adult mouse bladder. The left panel shows a low-magnification sagittal view of an adult bladder expressing the Sox10-H2BVenus transgene (4X magnification). The three anatomic layers, urethra, and bladder dome are labeled to provide orientation. The urothelium and submucosa present as convoluted folds in an empty adult bladder to provide room for expansion when filled with urine. An intramural ganglion is shown within the dashed oval. Two additional, smaller intramural ganglia are present along the dorsal aspect of the bladder. Areas of the bladder wall defined by boxed insets are shown on the right at higher magnification (200X) following immunohistochemistry performed with a glial marker

34

(S100) and a neuronal marker (PGP9.5). Right side, top: In the bladder dome and dorsal wall of the bladder, the vast majority of Sox10+ cells are also S100+. However, rare Sox10+, S100- cells (arrows) and rare Sox10-, S100+ cells (arrowheads) are present. Right side, bottom: In the detrusor muscle of the bladder dome, there is no colocalization of Sox10-H2BVenus with PGP9.5. However, within the intramural ganglia, there is a subset of Sox10-H2BVenus cells that also express PGP9.5 (arrows). A rare Sox10+, PGP9.5+ cell is present outside the ganglion (arrowhead). The staining of urothelium with PGP9.5 antibody is consistently observed by many laboratories (www.gudmap.org). Abbreviations: ser, serosa; det, detrusor muscle; um, urothelium; ig, intramural ganglion.

Table 1. Primers Used to Genotype Sox10LacZ-KO and Sox10-H2BVenus Mice Genotype

LacZ-

Sox10 KO

5’ to 3’ Sequence

PCR Parameters

1: CAGGTGGGCGTTGGGCTCTT 2: CAGAGCTTGCCTAGTGTCTT 3: TAAAAATGCGCTCAGGTCAA

Sp6 Forward: GTTTTTTGCGATCTGCCGTTTC Sp6 Reverse: GGCACTTTCATGTTATCTGAGG T7 Forward: TCGAGCTTGACATTGTAGGAC Sox10 H2BVenus T7 Reverse: AAGAGCAAGCCTTGGAACTG

35

Expected Product

94°C, 5 min; 35 cycles of: (94°C, 30 s; 55°C, 30s, ramp 0.5C/s to 72°C; 72°C, 30 s, ramp 0.5°C/s to 94°C); 72°C, 10 min

Wild type allele ~500bp

as above

227bp

as above

202bp

LacZ allele ~600bp

Internal Forward: CTGGTCGAGCTCGACGGCGACGTA Internal Reverse: AGTCGCGGCCGCTTTACTTG

94°C, 5 min; 35 cycles of: (94°C, 45 s; 55°C, 45s, ramp 0.5C/s to 72°C; 72°C, 45 s, ramp 0.5°C/s to 94°C); 72°C, 10 min

580bp

Table 2: Antibodies Used in Immunohistochemical Analysis Catalog No.; RRID

Dilution

N/A

1:1,000

7863504; N/A

1:4,000

Covance

PRB-435P; AB_291637

1:10,000

Human

Gift of V. Lennon

N/A

1:10,000

S100

Rabbit

Dako

Calponin

Rabbit

Abcam

Rat

Abcam

Antigen

Host

Supplier

BFABP

Rabbit

PGP9.5

Rabbit

Gift of T. Muller Biogen (antibody no longer sold)

Class III -tubulin (TuJ1)

Rabbit

HuC/D

PECAM1 (CD31)

Z0311; AB_10013383 ab46794; AB_2291941 ab28364; AB_726362

1:500 1:250 – 1:500 1:500

Abbreviations: N/A, not applicable; RRID, Research Resource Identifier

Table 3. Secondary Antibodies Used in Immunohistochemical Analysis Secondary Antibody Detection and Type

Supplier

Cy3 Donkey antirabbit Cy5 Donkey antihuman

Jackson ImmunoResearch Jackson ImmunoResearch Jackson Cy5 Donkey anti-rat ImmunoResearch Abbreviation: RRID, Research Resource Identifier 36

RRID

Dilution

AB_2307443

1:1,000

AB_2340539

1:200

AB_2340671

1:500

Highlights:     

Migrating sacral neural crest are labeled by Sox10-H2BVenus transgene expression Innervation of the developing LUT occurs in parallel with sacral NCPC immigration Emigration of NCPCs from pelvic ganglia into the LUT is temporally regulated Smooth muscle differentiation and vascularization of the bladder precede NCPC entry Sox10+ cells persist in adult bladder in association with nerves and vasculature

37

38

39

40

41

42

44

45

46