- Email: [email protected]
Mimecan in pituitary corticotroph cells may regulate ACTH secretion and the HPAA
Molecular and Cellular Endocrinology 341 (2011) 71–77
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce
Mimecan in pituitary corticotroph cells may regulate ACTH secretion and the HPAA Qin-Yun Ma 1, Xiao-Na Zhang 1, He Jiang 1, Zhi-Quan Wang, Hui-Jie Zhang, Li-Qiong Xue, Ming-Dao Chen, Huai-Dong Song ⇑ Shanghai Institute of Endocrine and Metabolic Diseases, Department of Endocrine and Metabolic Diseases, Shanghai Clinical Center for Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200025, China
a r t i c l e
i n f o
Article history: Received 18 December 2010 Received in revised form 15 April 2011 Accepted 12 May 2011 Available online 1 June 2011 Keywords: Mimecan Pituitary corticotroph cells Proopiomelanocortin (POMC) Adrenocorticotrophic hormone (ACTH) Hypothalamo-pituitary–adrenal axis (HPAA)
a b s t r a c t Mimecan is a protein of unknown function that is expressed in the pituitary tissues of mouse and human. In this study, we observed the function of mimecan on the proopiomelanocortin (POMC) gene in the pituitary and the hypothalamo-pituitary–adrenal axis (HPAA). Incubating pituitary corticotroph AtT-20 cells with recombinant mimecan protein stimulated adrenocorticotrophic hormone (ACTH) secretion without significantly up-regulating POMC gene expression. In addition, pituitary corticotroph AtT-20 cell corticotropin-releasing hormone receptor 1 (CRHR1) gene expression was induced by mimecan. Interestingly, long-term mimecan overexpression in corticotroph cells increased CRHR1 mRNA levels while slightly decreasing POMC mRNA expression and ACTH secretion. Using mimecan knockout mice, we found that, although the serum ACTH concentration was not significantly different between wild type and mimecan knockout mice under basal conditions, the serum ACTH level was relatively lower in mimecan knockout mice after treatment with corticotropin-releasing hormone (CRH). Meanwhile, we observed that POMC and CRHR1 gene expression decreased in primary cultured knockout mouse pituitary cells compared with wild type cells. Taken together, these data suggest that mimecan expressed in pituitary corticotroph cells mainly regulates ACTH secretion in the pituitary and coordinates the HPAA. Ó 2011 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Mimecan/osteoglycin is a member of the small leucine-rich proteoglycans (SLRPs) family (Madisen et al., 1990). Increasing evidence has shown that mimecan probably plays a role in the cardiovascular system. Mimecan is a new marker of differentiated vascular smooth muscle cells (VSMCs) and may be an essential component of normal vascular matrix (Fernandez et al., 2003; Shanahan et al., 1997). Meanwhile, the observation that mimecan mRNA is down-regulated in the media and up-regulated in the activated endothelium and thick neointima, whereas the protein accumulates in the front edge of migrating smooth muscle cells in rabbit atherosclerotic lesions, indicated that mimecan is involved in atherosclerosis (Tasheva et al., 2002). More recently, it was reported that mimecan presents in the adventitia of collateral arteries, where it is mainly produced by smooth muscle cells (SMCs) and perivascular fibroblasts in rabbits (Kampmann et al., 2009). Recent data showing that increases in mimecan protein expression are associated with the elevated left ventricular mass (LVM) in rats and humans implicates mimecan as a major putative regulator of LVM (Petretto et al., 2008). On the other hand, other ⇑ Corresponding author. 1
E-mail address: [email protected] (H.-D. Song). These authors contributed equally to this work.
0303-7207/$ - see front matter Ó 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2011.05.028
studies have focused on the cellular proliferation and differentiation effects of mimecan. It has been reported that growth factors and cytokines modulate mimecan mRNA expression (Long et al., 2000; Shanahan et al., 1997; Tasheva, 2002; Tasheva et al., 2001, 2002) and that tumour suppressor protein p53 activates transcription of the bovine and human mimecan genes (Tasheva, 2002; Tasheva et al., 2001, 2002), indicating that mimecan may regulate cellular growth and differentiation. A more recent study showed that mimecan is down-regulated in tissues derived from colorectal adenomas and cancers compared to normal mucosa, indicating that the absence of mimecan may promote the development of colorectal cancer (Wang et al., 2007). In our previous studies, we have shown that the mimecan gene is expressed in mouse and human pituitary tissues, but the role of mimecan in the pituitary is unclear. The mimecan gene is co-expressed with the proopiomelanocortin (POMC) gene, which encodes the precursor of ACTH protein, in pituitary corticotroph cells and the AtT-20 cell line. In contrast to the POMC gene, mimecan gene expression in pituitary corticotroph cells is up-regulated by glucocorticoid (GC) in a time- and dose-dependent manner, but it is not affected by corticotrophin releasing hormone (CRH) (Ma et al., 2010). Thus, we hypothesise that as an intrapituitary factor, mimecan plays a role in pituitary corticotroph cells and the hypothalamo-pituitary–adrenal axis (HPAA). By increasing or decreasing mimecan expression in pituitary corticotroph cells, we found
72
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
that mimecan regulates adrenocorticotrophic hormone (ACTH) secretion in the pituitary and coordinates the HPAA. 2. Methods 2.1. Cell culture and primary mouse pituitary cell culture The mouse AtT-20 cell line was obtained from American Tissue Type Collection (ATCC, VA, USA). The cell line was maintained in Dulbecco’s modified Eagle’s medium containing 10% foetal calf serum (FCS) and 2 mM L-glutamine, streptomycin, and penicillin (GIBCO, MD, USA) in a 5% CO2-humidified atmosphere at 37 °C. All cell cultures were routinely passaged at 90–95% confluency. Before the experiment, cells were preincubated with serum-free DMEM for 12 h. Then treated with recombinant mimecan (R&D, MN, USA) for the indicated time with or without CRH (Sigma, St. Louis, MO). Medium samples were collected and stored at 80 °C at the end of the experiments for hormone content analyses. Cells in the culture plates were processed for RNA extraction as indicated below. As for pituitary primary cell culture, pituitary tissues were pooled, and the cells were dissociated with collagenase II (0.2% wt/vol) as described previously (Ma et al., 2010). Briefly, pituitary glands were obtained from 10 adult male wild type or mimecan KO mice after decapitation. Tissues were washed with HBSS. Pieced sliced fragments were dispersed in preparation buffer containing 2 g/l collagenase (Sigma). Dispersed cells were centrifuged and resuspended in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal calf serum and 2 mM L-glutamine, streptomycin, and penicillin. Then, cells were distributed in 12well plates and incubated at 37 °C under 5% CO2 for 12 h until they were used. 2.2. Quantitative RT-PCR Two microgram of RNA was reverse-transcribed to cDNA using the anchor primer oligonucleotide (dT) 15 and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Gene expression was analysed by relative quantification with the 2DDCt method using realtime PCR with an ABI Prism 7300 instrument (Applied Biosystems, CA, USA) as previously described (Ma et al., 2010). Quantifications were performed in quadruplicate, and the experiments were repeated independently three times. Primer sequences were as follows: mimecan forward primer, 50 -TCCAGTTCTTCCTCCAAAGCTTAC-30 ; mimecan reverse primer, 50 -GGTCGTTATGGTCCAAATAGAGAAA-30 ; GAPDH forward primer, 50 -TTCACCACCATGGAGAAGGC-30 ; GAPDH reverse primer, 50 -CACACCCATCACAAACATGGG-30 ; CRH receptor1 (CRHR1) forward primer, 50 -CGCATCCTCATGACCAAACTC-30 , CRHR1 reverse primer, 50 -AACATGTAGGTGATGCCCAGG-30 ; POMC forward primer, 50 -CACTGAACATCTTTGTCCCCAGA-30 ; and POMC reverse primer, 50 CCTGAGCGACTGTAGCAGAATCTC-30 . The levels of relative genes were normalised to GAPDH, and the results were expressed as fold changes of threshold cycle (Ct) value relative to controls. All the primer sets were designed to span at least one intron to avoid genomic DNA-derived amplification. 2.3. Generation of mimecan KO mice Genomic DNA was extracted from mouse 129/Sv embryonic stem (ES) cells. A DNA fragment of the mouse mimecan gene (3.7 to 0.7 kb upstream of the exon 5 of the mimecan gene) was amplified by PCR and ligated to the KpnI–BamHI site of the upstream region of the neo cassette of the TK-neo/ppnt vector. A 5.0-kb DNA sequence (from 1.3 kb upstream to +2.0 kb downstream of the exon 7) encoding the C-terminus of the mimecan domain and 30 untrans-
lated region was also amplified by PCR and ligated to the SalI–NotI site downstream of the neo cassette of the same TK-neo/ppnt vector (Fig. 4A). The linearised mimecan targeting vector was introduced into CJ7 ES cells by electroporation. Transfectants were selected with neomycin (G418) (Invitrogen, Carlsbad, CA). Two sets of primers were used to select for targeted clones from these CJ7 ES cells by PCR. The sequences of the primers were as follows: F1 primer, which annealed upstream of the mimecan short arm of the TK-neo/ppnt vector, 50 -GAGTGGTTTGGAGTGATTGCT-30 ; R1 primer, located in the neo region of the TK-neo/ppnt vector, 50 -GTACGTCACGGGT GGTGTT-30 ; F2 primer, which annealed in the neo region of the TKneo/ppnt vector, 50 -TCCTTGCCAGCTTTCTAGATTCC-30 ; and R2 primer, located downstream of the mimecan long arm of the TK-neo/ ppnt vector, 50 -AAACCTCCAAGGCCACCCTG-30 (Fig. 4A). Cells that were expanded from targeted ES clones were injected into C57BL6 blastocysts, and germline transmitting chimeric animals were obtained and mated with C57BL6 mice. The resulting heterozygous offspring were crossed to generate wild type, heterozygous, and homozygous study subjects. Mimecan KO mice were backcrossed with C57BL/6J mice for five generations before they were used in this study. The mouse genotypes were determined by Southern blot analysis. The probe for the Southern blot was synthesised by PCR. The sequences of the primers were as follows: forward primer, 50 GCTGAAACTGACTGGGATGAGG-30 and reverse primer, 50 -GCACAGATTTGGACACAGAGAATG-30 (Fig. 4A). Mice that were homozygous null for mimecan were obtained by interbreeding heterozygous mice. Animals were housed in a temperature-controlled room (23 °C) with a 12 h light/dark cycle, and they had ad libitum access to chow and water. Adult male (8–10 week of age) mimecan KO mice and their wild type littermates were used for experiments. 2.4. Blood collection and hormone assays Whole blood was obtained after decapitation or from the retroorbital space using capillary tubes, and plasma was separated and stored at 80 °C. ACTH concentrations of the mouse plasma and AtT-20 cell culture media were measured by ELISA (Phoenix, CA, USA). The sensitivity of ACTH was 0–25 ng/ml. 2.5. Construction of retroviral vectors and transduction To construct AtT-20 cells stably expressing 3FLAG-tagged mouse mimecan, a retrovirus-mediated infection system was used. For expression of mouse mimecan, DNA encoding 3FLAG-tagged mouse mimecan was inserted into the multi-cloning site of the pMSCV PIG (Puromycin IRES GFP) vector (Clontech, Palo Alto, CA). The sequences of the primers were as follows: forward primer, 50 -ACGCAGATCTATGGAGACTGTGCACTCTACATTTCTCCTGCTACTCTTCGTGCCT CTGACACAGCAAGCACCACAGTCGCAGC-30 and reverse primer, 50 GCGTCTCGAGTTA CTTGTCGTCATCGTCTTTGTAGTCGATGTCATGGTC TTTGTAGTCTCCGTCATGGTCTTTGTAGTCGAAGTATGACCC TATG-30 . Retroviruses were subsequently produced by transiently co-transfecting HEK-293 cells with a retroviral vector and VSV-G, a gag-pol plasmid, using Lipofectamine 2000 (Invitrogen). At 48 h after transfection, media containing retroviruses were collected, filtered with 0.45-lm filters and used to infect cells in the presence of 8 lg/ml polybrene (Sigma) (Kim et al., 2009). Infected cells were selected using 1 lg/ml puromycin (Sigma) and further maintained in growth medium. Overexpression of 3FLAG-tagged mouse mimecan was confirmed by realtime PCR and Western blot analysis. 2.6. Western blot Infected cells were grown to 90% confluence in 6-well plates. Then, the cells were washed with ice-cold phosphate-buffered saline and lysed in RIPA and PMSF. After sonication, the lysates were
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
centrifuged to remove insoluble materials. The supernatants (10 lg/lane) were separated by SDS–PAGE and transferred onto a nitrocellulose membrane. They were then incubated with flag primary antibodies (Sigma) and subsequently with horseradish peroxidase-linked secondary antibodies. The signal was detected using enhanced chemiluminescence (PerkinElmer, MA, USA). Densitometric analysis was conducted directly on the blotted membrane using a CCD camera system (LAS-4000, Fujifilm, Tokyo, Japan). 2.7. Statistics All data were expressed as mean ± SD. When statistical analyses were performed, data were compared by one-way ANOVA with Student’s t-test. A p < 0.05 was considered to be statistically significant. 3. Results 3.1. Short treatment of mimecan promotes ACTH secretion but does not change POMC gene expression Mimecan is co-expressed with the POMC gene in pituitary corticotroph cells and in the AtT-20 cell line. In addition, the expression of mimecan in pituitary corticotroph cells is up-regulated by GC in a time- and dose-dependent manner and is not affected by CRH. Thus, we examined the effects of mimecan on POMC gene expression and ACTH secretion in AtT-20 cells. We found that treatment with recombinant mimecan protein for 24 h did not increase the expression of the POMC gene as shown by realtime PCR (Fig. 1A) and Northern blot analysis (data not shown); however, mimecan can stimulate ACTH secretion. After incubation with 10 lg of mimecan for 4 h, ACTH in the medium increased slightly (from 6.85 ± 0.25 to 7.85 ± 0.22 ng/ml; p < 0.05) (Fig. 1B), and stimulation was maintained for 24 h (from 22.43 ± 1.77 to 28.70 ± 1.2 ng/ml; p < 0.05) (Fig. 1C), while a 1 lg mimecan treatment resulted in an ACTH secretion increase at 24 h (from 22.43 ± 1.77 to 32.65 ± 1.86 ng/ml; p < 0.05) (Fig. 1C). 3.2. Mimecan slightly promotes CRHR1 expression but has no synergistic effect on POMC gene expression and ACTH secretion with CRH CRH, a major regulator of ACTH, stimulates ACTH synthesis/ secretion by binding with CRHR1 in pituitary corticotroph cells. We further examined the combined effects of mimecan and CRH. First, we observed the effect of mimecan on CRHR1 expression. We found that after treatment with 10 lg mimecan for 24 h, CRHR1 expression in the AtT-20 cell line slightly increased by
73
approximately 1.3-fold compared with controls (Fig. 2A). Although CRH or mimecan alone exhibited stimulatory effects on ACTH secretion, when they were simultaneously used, no obvious additive (i.e., synergistic) effects were observed after 4 or 24 h (Fig. 2C and D). Using realtime PCR, it was shown that the combination of mimecan protein and CRH did not increase the POMC gene expression (Fig. 2B). In summary, these results suggest that CRH does not enhance the effect of mimecan on ACTH secretion. 3.3. Long-term mimecan overexpression in AtT-20 cells inhibits POMC gene expression and ACTH secretion and slightly promotes CRHR1 expression According to the above results, it is clear that ACTH secretion increases following treatment with mimecan for a short time period in pituitary corticotroph cells. In order to assess long-term effects of mimecan on POMC gene expression and ACTH secretion, mimecan was constitutively overexpressed in AtT-20 cells using a retrovirus-mediated infection system. After overexpression in AtT-20 cells, mimecan expression was upregulated by approximately 90fold according to realtime PCR readouts (Fig. 3A). Meanwhile, upregulation of mimecan protein was also confirmed by Western blot analysis (Fig. 3B). CRHR1 expression was upregulated by approximately 1.6-fold in mimecan-overexpressing AtT-20 cells (Fig. 3C), similar to the effects of recombinant mimecan. Interestingly, the POMC gene was slightly downregulated by nearly 15% in mimecan-overexpressing AtT-20 cells, which was different from the results of the short-term incubation with mimecan (Fig. 3D), In parallel, mimecan-overexpressing AtT-20 cell ACTH secretion also decreased to 46.1 ± 3.8 ng/ml compared with MSCV-PIG AtT-20 cells (57.9 ± 2.4 ng/ml) (Fig. 3E). 3.4. The response of plasma ACTH level to CRH stimulation is attenuated in mimecan KO mice We further clarified the effect of mimecan in the pituitary using a mimecan KO mouse that was generated at the Shanghai Research Center for Model Organisms (Fig. 4). Consistent with a previous report by Tasheva ES (Tasheva et al., 2002), mimecan KO mice appeared to develop normally, remain viable, and grow to normal size. In the basal condition, the plasma concentrations of ACTH did not reveal obvious differences between mimecan KO mice and wild type mice (2.62 ± 1.28 vs. 3.06 ± 1.53 ng/ml, p > 0.05) (Fig. 5A). Therefore, we analysed the ACTH response to exogenously administered 50 lg/kg CRH in mimecan KO mice and wild type littermates. After treatment with CRH for 30 min, the plasma ACTH levels were obviously lower in the mimecan KO mice than the wild type mice (4.99 ± 1.53 vs. 10.40 ± 2.37 ng/ml, p < 0.001) (Fig. 5A). CRH (50 lg/kg) stimulated ACTH secretion by approximately
Fig. 1. Recombinant mimecan does not affect POMC gene expression while stimulating ACTH secretion. (A) After treatment with 1 and 10 lg recombinant mimecan for 24 h, the levels of POMC mRNA were unchanged in AtT-20 cells as detected by qRT-PCR (p > 0.05). Typical data from three to four replicate experiments. (B and C) After treatment with 1 and 10 lg recombinant mimecan for 4 h (B) and 24 h (C), the levels of ACTH in culture media of AtT-20 cells were detected by ELISA. ⁄p < 0.05, ⁄⁄p < 0.01.
74
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
Fig. 2. Combined effects of CRH and mimecan on POMC gene expression and ACTH secretion. (A) Mimecan promoted CRHR1 expression. After treatment with 1 and 10 lg recombinant mimecan for 24 h, levels of CRHR1 were detected in AtT-20 cells by qRT-PCR. ⁄p < 0.05. (B) Mimecan combined with CRH did not obviously affect POMC gene expression. After treatment with 1 and 10 lg recombinant mimecan for 21 h, AtT-20 cells were further treated with 100 nM CRH for 3 h; the levels of POMC were detected in AtT-20 cells by qRT-PCR. ⁄p < 0.05. (C and D) CRH did not further enhance ACTH secretion induced by mimecan. After incubation with recombinant mimecan for 1 h (C) and 21 h (D), AtT-20 cells were further treated with 100 nM CRH for 3 h. Compared with control, ⁄p < 0.05, ⁄⁄p < 0.01.
Fig. 3. Mimecan overexpression in AtT-20 cells and its affect on POMC and CRHR1 gene expression and ACTH secretion. (A and B) Mimecan was constitutively overexpressed in AtT-20 cells. Mimecan overexpression in AtT-20 cell was quantitated by qRT-PCR (A), and upregulation of mimecan protein was confirmed by Western blot analysis (B). (C) CRHR1 expression in mimecan-overexpressing AtT-20 cells increased as detected by qRT-PCR. (D) POMC gene expression in mimecan-overexpressing AtT-20 cells slightly decreased as detected by qRT-PCR. (E) The level of ACTH in culture medium of AtT-20 cells decreased as detected by ELISA. Compared with MSCV-PIG, ⁄p < 0.05, ⁄⁄p < 0.01.
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
75
Fig. 4. Mimecan gene targeting strategy and generation of mimecan KO mice. (A) The targeting strategy for the mimecan gene. Structure of the mouse mimecan gene with the relevant restriction sites (top), the structure of the targeting vector (middle), and the structure of the targeted gene (bottom). The wild type allele (Wt) gives a 16 kb DNA fragment, whereas the mutated allele gives a 6.8 kb fragment after digestion with BamHI. Negative (HSV-TK) and positive (PGK-NEO) selection markers are indicated by boxes without background colours. The boxes with numbers represent the exons of the mouse mimecan gene. The locations of the primers for the PCR to screen the positive ES cells and probe for Southern blot analysis to genotype the KO mice are indicated. TK, thymidine kinase; NEO, neomycin. (B) The mice were genotyped by Southern blot analysis of BamHI-digested mouse genomic DNA isolated from wild type (+/+), heterozygous (+/), and mimecan knockout (/) mice. (C) Mimecan gene expression in lung tissues of mimecan / and mimecan +/+ mice was detected by Northern blot analysis.
Fig. 5. Stress reaction is attenuated in mimecan KO mice. (A) There was no difference in ACTH levels in basal conditions, whereas mimecan KO mice had lower ACTH than wild type littermates after stimulation with CRH. CRH (50 lg/kg) was injected through the tail vein. Retro orbital plasma was collected at 0 and 30 min. The serum ACTH levels of the mimecan KO mice and wild type littermates were valued by ELISA (11 WT mice and 13 mimecan KO mice). ⁄⁄p < 0.01. (B and C) Under basal culture conditions (B) or after incubating with 100 nM CRH for 24 h (C), POMC and CRHR1 gene expression in primary cultured pituitary cells from mimecan KO mice and wild type littermates were quantitated by the qRT-PCR.
3.5-fold in wide type mice but by only 1.9-fold in mimecan KO mice. This result showed that mimecan null mice exhibited an attenuated plasma ACTH level to CRH stimulation and attenuated HPAA response to stress.
The in vitro result further confirmed that the responses to stress were attenuated in mimecan KO mice.
3.5. The expression levels of the POMC and CRHR1 decreased in primary pituitary cultures of mimecan KO mice with CRH
The present study used genetic pharmacological approaches to examine the role of mimecan in the pituitary. Our results provide important, novel evidence to suggest that mimecan in the pituitary is functionally important for ACTH secretion and HPAA balance. ACTH, an important hormone that is secreted by pituitary corticotroph cells, is a vital component of the HPAA that mediates the response to stress (Lovejoy and Balment, 1999). ACTH was not only positively regulated by CRH and vasopressin (AVP) from the hypothalamus but also negatively regulated by GC from the cortex of the adrenal gland (Engler et al., 1999; Papadimitriou and Priftis, 2009). Moreover, locally produced pituitary proteins or extracellular matrix factors also directly regulate POMC gene expression and ACTH secretion. Among the factors secreted from the pituitary, it is
We cultured primary pituitary cells from mimecan KO mice and wild type littermates in order to assess cellular activity in the absence of confounding in vivo effects. In accordance with the in vivo results, the basal POMC gene and CRHR1 expression showed no significant difference between mimecan KO mice and wild type littermates (Fig. 5B). However, after incubation with 100 nM CRH for 24 h, POMC and CRHR1 gene expression in mimecan KO mice primary pituitary cells significantly decreased compared with wild type cells. CRHR1 expression decreased by 30%, and POMC expression decreased by approximately 70% by quantitative PCR (Fig. 5C).
4. Discussion
76
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
known that IL-1, IL-6, IL-2, EGF, and LIF enhance POMC gene expression and ACTH secretion in the pituitary, while activin suppresses POMC expression (Katahira et al., 1998; Ray and Melmed, 1997). Previous studies have confirmed that the extracellular matrix (ECM) regulates ACTH secretion. ACTH in AtT-20 cells was inhibited by fibronectin, laminin and collagen I (Kuchenbauer et al., 2001). Therefore, these intrapituitary signalling networks provide an additional level of control and integrate with central and peripheral signals to modulate pituitary ACTH hormone secretion and the HPAA reaction to stress. We originally identified mimecan gene expression in human and mouse pituitary tissues and demonstrated that mimecan immunoreactivity was predominantly associated with corticotroph cells (Ma et al., 2010), while the function of mimecan in the pituitary is unclear. Mimecan is constitutively expressed in pituitary corticotroph cells and murine AtT-20 cells, which respond to GC, but not to CRH. Pituitary corticotroph cells, by expressing and secreting ACTH, are located in the centre of the HPAA. We hypothesised that mimecan may play a role in the anterior pituitary corticotroph cells and in the HPAA. To confirm this, AtT-20 cells were treated with different doses of recombinant mimecan protein for different times. Mimecan stimulates ACTH secretion but does not induce POMC gene expression. Mimecan stimulates ACTH secretion after incubation for 4 h and maintains induction for hours. In a previous study, it was reported that ACTH production in AtT-20 cells is inhibited by ECM fibronectin, laminin and collagen I. A reporter construct with the POMC promoter showed similar results. In contrast, ACTH production was not significantly altered in normal pituitary cells (Kuchenbauer et al., 2001). Mimecan belongs to a family of proteoglycans (PGs) in the ECM. In contrast to fibronectin, laminin and collagen I, mimecan stimulates ACTH secretion but does not influence POMC gene expression. Moreover, mimecan not only induces ACTH secretion but also slightly induces CRHR1 expression. However, they do not synergise with CRH to further stimulate POMC gene expression and ACTH secretion. This result indicates that the instant treatment of mimecan induces ACTH secretion. Interestingly, mimecan overexpressing AtT-20 cells, which express mimecan at a high level for a long time, also show increased CRHR1 expression but slightly decreased POMC expression and ACTH secretion. Combined with the previous result that GC can induce mimecan while inhibiting POMC and ACTH, this result suggests that mimecan may take part in GC slow feedback on ACTH secretion (Ma et al., 2010). In contrast to lipocortin1, which is also regulated by the GC-mediated inhibitory action of GC on the release of ACTH in the pituitary (Taylor et al., 1997; Tierney et al., 2003), mimecan is upregulated by GC and in turn further stimulates ACTH production to prevent GC excessive negative feedback for a short time. In contrast, long-term mimecan over-expression inhibits POMC expression and ACTH secretion to enhance GC negative feedback for long time (Fig. 6). These results indicate that the functions of mimecan in the pituitary are complicated. Mimecan KO mice were generated. Like other SLRPs, mimecan is important in the regulation of collagen fibrillogenesis and cellular growth, differentiation, and migration (Ameye and Young, 2002; Iozzo, 1999; Kresse and Schonherr, 2001). It is well known that other ECMs modulate pituitary cell proliferation. AtT-20 cell proliferation was stimulated by collagen IV and fibronectin and inhibited by collagen I and laminin. In parallel, the cell morphology was also modified by the ECM (Kuchenbauer et al., 2001). The morphologic and histologic observations show that the POMC-expressing cells are similar between wild type and mimecan KO mice by in situ hybridisation, although mimecan KO mice show a more profuse blood supply (data not shown), which is in accordance with other reports about mimecan function on vascular vessels. In addition, short-term mimecan incubation or long-term mimecan over-
Fig. 6. Schematic illustration of the role of mimecan in pituitary corticotroph cells. Mimecan keeps the HPAA in balance during stress.
expression did not show any morphologic changes. Although the plasma ACTH showed no significant difference between mimecan KO mice and their wild type littermates in basal conditions, the serum ACTH concentration was lower in mimecan KO mice after stimulation by CRH. These results show that the reaction to stress is blunted in mimecan KO mice. Moreover, the attenuation to stress was further confirmed by the primary mimecan KO mouse pituitary cells in vitro. Although the basal POMC and CRHR1 gene expression levels did not differ between primary culture pituitary cells from mimecan KO mice and wild type littermates, after being incubated with 100 nM CRH, POMC and CRHR1 gene expression in mimecan KO mice significantly decreased compared with wild type mice. These results indicate that the sensitivity of the pituitary corticotroph cells to CRH stimulation was attenuated in the mimecan gene KO mice. According to our results, mimecan expressed in the pituitary corticotroph cells mainly keeps the HPAA active under stress. On the one hand, pituitary mimecan keeps the HPAA active, that is, mimecan warrants the corticotroph cells being activated by CRH, stimulating ACTH secretion. On the other hand, mimecans were upregulated by GC, further stimulating ACTH secretion to prevent pituitary corticotroph cells from excessive feedback by GC (Fig. 6). In conclusion, we explored the function of mimecan in the pituitary for the first time. We found that mimecan may regulate ACTH and HPAA as an autocrine factor. Although the mimecan receptor has not been found yet, the function of mimecan in pituitary corticotroph cells will provide a clue to finding the mimecan receptor. This will allow for the mechanism of mimecan function to be clarified in the future. Acknowledgements This work was supported in part by the National Natural Science Foundation of China (30871206) and the Doctor’s Innovation Found of Shang Hai Jiao Tong University School of Medicine (BXJ201012). References Ameye, L., Young, M.F., 2002. Mice deficient in small leucine-rich proteoglycans: novel in vivo models for osteoporosis, osteoarthritis, Ehlers–Danlos syndrome, muscular dystrophy, and corneal diseases. Glycobiology 12, 107R–116R. Engler, D., Redei, E., Kola, I., 1999. The corticotropin-release inhibitory factor hypothesis: a review of the evidence for the existence of inhibitory as well as stimulatory hypophysiotropic regulation of adrenocorticotropin secretion and biosynthesis. Endocr. Rev. 20, 460–500. Fernandez, B., Kampmann, A., Pipp, F., Zimmermann, R., Schaper, W., 2003. Osteoglycin expression and localization in rabbit tissues and atherosclerotic plaques. Mol. Cell. Biochem. 246, 3–11. Iozzo, R.V., 1999. The biology of the small leucine-rich proteoglycans. Functional network of interactive proteins. J. Biol. Chem. 274, 18843–18846. Kampmann, A., Fernández, B., Deindl, E., Kubin, T., Pipp, F., Eitenmüller, I., Hoefer, I.E., Schaper, W., Zimmermann, R., 2009. The proteoglycan osteoglycin/ mimecan is correlated with arteriogenesis. Mol. Cell. Biochem. 322, 15–23.
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77 Katahira, M., Iwasaki, Y., Aoki, Y., Oiso, Y., Saito, H., 1998. Cytokine regulation of the rat proopiomelanocortin gene expression in AtT-20 cells. Endocrinology 139, 2414–2422. Kim, W.K., Jung, H., Kim, D.H., Kim, E.Y., Chung, J.W., Cho, Y.S., Park, S.G., Park, B.C., Ko, Y., Bae, K.H., Lee, S.C., 2009. Regulation of adipogenic differentiation by LAR tyrosine phosphatase in human mesenchymal stem cells and 3T3-L1 preadipocytes. J. Cell Sci. 122, 4160–4167. Kresse, H., Schonherr, E., 2001. Proteoglycans of the extracellular matrix and growth control. J. Cell. Physiol. 189, 266–274. Kuchenbauer, F., Hopfner, U., Stalla, J., Arzt, E., Stalla, G.K., Paez-Pereda, M., 2001. Extracellular matrix components regulate ACTH production and proliferation in corticotroph tumor cells. Mol. Cell. Endocrinol. 175, 141–148. Long, C.J., Roth, M.R., Tashevam, E.S., Funderburgh, M., Smit, R., Conrad, G.W., Funderburgh, J.L., 2000. Fibroblast growth factor-2 promotes keratan sulfate proteoglycan expression by keratocytes in vitro. J. Biol. Chem. 275, 13918– 13923. Lovejoy, D.A., Balment, R.J., 1999. Evolution and physiology of the corticotropinreleasing factor (CRF) family of neuropeptides in vertebrates. Gen. Comp. Endocrinol. 115, 1–22. Ma, Q.Y., Zuo, C.L., Ma, J.H., Zhang, X.N., Ru, Y., Li, P., Pan, C.M., Liu, Z., Cao, H.M., Chen, M.D., Song, H.D., 2010. Glucocorticoid up-regulates mimecan expression in corticotroph cells. Mol. Cell. Endocrinol. 321, 239–244. Madisen, L., Neubauer, M., Plowman, G., Rosen, D., Segarini, P., Dasch, J., Thompson, A., Ziman, J., Bentz, H., Purchio, A.F., 1990. Molecular cloning of a novel boneforming compound: osteoinductive factor. DNA Cell Biol. 9, 303–309. Papadimitriou, A., Priftis, K.N., 2009. Regulation of the hypothalamic–pituitary– adrenal axis. Neuroimmunomodulation 16, 265–271. Petretto, E., Sarwar, R., Grieve, I., Lu, H., Kumaran, M.K., Muckett, P.J., Mangion, J., Schroen, B., Benson, M., Punjabi, P.P., Prasad, S.K., Pennell, D.J., Kiesewetter, C.,
77
Tasheva, E.S., Corpuz, L.M., Webb, M.D., Conrad, G.W., Kurtz, T.W., Kren, V., Fischer, J., Hubner, N., Pinto, Y.M., Pravenec, M., Aitman, T.J., Cook, S.A., 2008. Integrated genomic approaches implicate osteoglycin (Ogn) in the regulation of left ventricular mass. Nat. Genet. 40, 546–552. Ray, D., Melmed, S., 1997. Pituitary cytokine and growth factor expression and action. Endocr. Rev. 18, 206–228. Shanahan, C.M., Cary, N.R., Osbourn, J.K., Weissberg, P.L., 1997. Identification of osteoglycin as a component of the vascular matrix. Differential expression by vascular smooth muscle cells during neointima formation and in atherosclerotic plaques. Arterioscler. Thromb. Vasc. Biol. 17, 2437–2447. Tasheva, E.S., 2002. Analysis of the promoter region of human mimecan gene. Biochim. Biophys. Acta 1575, 123–129. Tasheva, E.S., Maki, C.G., Conrad, A.H., Conrad, G.W., 2001. Transcriptional activation of bovine mimecan by p53 through an intronic DNA-binding site. Biochim. Biophys. Acta 1517, 333–338. Tasheva, E.S., Koester, A., Paulsen, A.Q., Garrett, A.S., Boyle, D.L., Davidson, H.J., Song, M., Fox, N., Conrad, G.W., 2002. Mimecan/osteoglycin-deficient mice have collagen fibril abnormalities. Mol. Vis. 8, 407–415. Taylor, A.D., Christian, H.C., Morris, J.F., Flower, R.J., Buckingham, J.C., 1997. An antisense oligodeoxynucleotide to lipocortin 1 reverses the inhibitory actions of dexamethasone on the release of adrenocorticotropin from rat pituitary tissue in vitro. Endocrinology 138, 2909–2918. Tierney, T., Christian, H.C., Morris, J.F., Solito, E., Buckingham, J.C., 2003. Evidence from studies on co-cultures of TtT/GF and AtT20 cells that Annexin 1 acts as a paracrine or juxtacrine mediator of the early inhibitory effects of glucocorticoids on ACTH release. J. Neuroendocrinol. 15, 1134–1143. Wang, Y., Ma, Y., Lu, B., Xu, E., Huang, Q., Lai, M., 2007. Differential expression of mimecan and thioredoxin domain-containing protein 5 in colorectal adenoma and cancer: a proteomic study. Exp. Biol. Med. (Maywood) 232, 1152–1159.
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce
Mimecan in pituitary corticotroph cells may regulate ACTH secretion and the HPAA Qin-Yun Ma 1, Xiao-Na Zhang 1, He Jiang 1, Zhi-Quan Wang, Hui-Jie Zhang, Li-Qiong Xue, Ming-Dao Chen, Huai-Dong Song ⇑ Shanghai Institute of Endocrine and Metabolic Diseases, Department of Endocrine and Metabolic Diseases, Shanghai Clinical Center for Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200025, China
a r t i c l e
i n f o
Article history: Received 18 December 2010 Received in revised form 15 April 2011 Accepted 12 May 2011 Available online 1 June 2011 Keywords: Mimecan Pituitary corticotroph cells Proopiomelanocortin (POMC) Adrenocorticotrophic hormone (ACTH) Hypothalamo-pituitary–adrenal axis (HPAA)
a b s t r a c t Mimecan is a protein of unknown function that is expressed in the pituitary tissues of mouse and human. In this study, we observed the function of mimecan on the proopiomelanocortin (POMC) gene in the pituitary and the hypothalamo-pituitary–adrenal axis (HPAA). Incubating pituitary corticotroph AtT-20 cells with recombinant mimecan protein stimulated adrenocorticotrophic hormone (ACTH) secretion without significantly up-regulating POMC gene expression. In addition, pituitary corticotroph AtT-20 cell corticotropin-releasing hormone receptor 1 (CRHR1) gene expression was induced by mimecan. Interestingly, long-term mimecan overexpression in corticotroph cells increased CRHR1 mRNA levels while slightly decreasing POMC mRNA expression and ACTH secretion. Using mimecan knockout mice, we found that, although the serum ACTH concentration was not significantly different between wild type and mimecan knockout mice under basal conditions, the serum ACTH level was relatively lower in mimecan knockout mice after treatment with corticotropin-releasing hormone (CRH). Meanwhile, we observed that POMC and CRHR1 gene expression decreased in primary cultured knockout mouse pituitary cells compared with wild type cells. Taken together, these data suggest that mimecan expressed in pituitary corticotroph cells mainly regulates ACTH secretion in the pituitary and coordinates the HPAA. Ó 2011 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Mimecan/osteoglycin is a member of the small leucine-rich proteoglycans (SLRPs) family (Madisen et al., 1990). Increasing evidence has shown that mimecan probably plays a role in the cardiovascular system. Mimecan is a new marker of differentiated vascular smooth muscle cells (VSMCs) and may be an essential component of normal vascular matrix (Fernandez et al., 2003; Shanahan et al., 1997). Meanwhile, the observation that mimecan mRNA is down-regulated in the media and up-regulated in the activated endothelium and thick neointima, whereas the protein accumulates in the front edge of migrating smooth muscle cells in rabbit atherosclerotic lesions, indicated that mimecan is involved in atherosclerosis (Tasheva et al., 2002). More recently, it was reported that mimecan presents in the adventitia of collateral arteries, where it is mainly produced by smooth muscle cells (SMCs) and perivascular fibroblasts in rabbits (Kampmann et al., 2009). Recent data showing that increases in mimecan protein expression are associated with the elevated left ventricular mass (LVM) in rats and humans implicates mimecan as a major putative regulator of LVM (Petretto et al., 2008). On the other hand, other ⇑ Corresponding author. 1
E-mail address: [email protected] (H.-D. Song). These authors contributed equally to this work.
0303-7207/$ - see front matter Ó 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2011.05.028
studies have focused on the cellular proliferation and differentiation effects of mimecan. It has been reported that growth factors and cytokines modulate mimecan mRNA expression (Long et al., 2000; Shanahan et al., 1997; Tasheva, 2002; Tasheva et al., 2001, 2002) and that tumour suppressor protein p53 activates transcription of the bovine and human mimecan genes (Tasheva, 2002; Tasheva et al., 2001, 2002), indicating that mimecan may regulate cellular growth and differentiation. A more recent study showed that mimecan is down-regulated in tissues derived from colorectal adenomas and cancers compared to normal mucosa, indicating that the absence of mimecan may promote the development of colorectal cancer (Wang et al., 2007). In our previous studies, we have shown that the mimecan gene is expressed in mouse and human pituitary tissues, but the role of mimecan in the pituitary is unclear. The mimecan gene is co-expressed with the proopiomelanocortin (POMC) gene, which encodes the precursor of ACTH protein, in pituitary corticotroph cells and the AtT-20 cell line. In contrast to the POMC gene, mimecan gene expression in pituitary corticotroph cells is up-regulated by glucocorticoid (GC) in a time- and dose-dependent manner, but it is not affected by corticotrophin releasing hormone (CRH) (Ma et al., 2010). Thus, we hypothesise that as an intrapituitary factor, mimecan plays a role in pituitary corticotroph cells and the hypothalamo-pituitary–adrenal axis (HPAA). By increasing or decreasing mimecan expression in pituitary corticotroph cells, we found
72
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
that mimecan regulates adrenocorticotrophic hormone (ACTH) secretion in the pituitary and coordinates the HPAA. 2. Methods 2.1. Cell culture and primary mouse pituitary cell culture The mouse AtT-20 cell line was obtained from American Tissue Type Collection (ATCC, VA, USA). The cell line was maintained in Dulbecco’s modified Eagle’s medium containing 10% foetal calf serum (FCS) and 2 mM L-glutamine, streptomycin, and penicillin (GIBCO, MD, USA) in a 5% CO2-humidified atmosphere at 37 °C. All cell cultures were routinely passaged at 90–95% confluency. Before the experiment, cells were preincubated with serum-free DMEM for 12 h. Then treated with recombinant mimecan (R&D, MN, USA) for the indicated time with or without CRH (Sigma, St. Louis, MO). Medium samples were collected and stored at 80 °C at the end of the experiments for hormone content analyses. Cells in the culture plates were processed for RNA extraction as indicated below. As for pituitary primary cell culture, pituitary tissues were pooled, and the cells were dissociated with collagenase II (0.2% wt/vol) as described previously (Ma et al., 2010). Briefly, pituitary glands were obtained from 10 adult male wild type or mimecan KO mice after decapitation. Tissues were washed with HBSS. Pieced sliced fragments were dispersed in preparation buffer containing 2 g/l collagenase (Sigma). Dispersed cells were centrifuged and resuspended in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal calf serum and 2 mM L-glutamine, streptomycin, and penicillin. Then, cells were distributed in 12well plates and incubated at 37 °C under 5% CO2 for 12 h until they were used. 2.2. Quantitative RT-PCR Two microgram of RNA was reverse-transcribed to cDNA using the anchor primer oligonucleotide (dT) 15 and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Gene expression was analysed by relative quantification with the 2DDCt method using realtime PCR with an ABI Prism 7300 instrument (Applied Biosystems, CA, USA) as previously described (Ma et al., 2010). Quantifications were performed in quadruplicate, and the experiments were repeated independently three times. Primer sequences were as follows: mimecan forward primer, 50 -TCCAGTTCTTCCTCCAAAGCTTAC-30 ; mimecan reverse primer, 50 -GGTCGTTATGGTCCAAATAGAGAAA-30 ; GAPDH forward primer, 50 -TTCACCACCATGGAGAAGGC-30 ; GAPDH reverse primer, 50 -CACACCCATCACAAACATGGG-30 ; CRH receptor1 (CRHR1) forward primer, 50 -CGCATCCTCATGACCAAACTC-30 , CRHR1 reverse primer, 50 -AACATGTAGGTGATGCCCAGG-30 ; POMC forward primer, 50 -CACTGAACATCTTTGTCCCCAGA-30 ; and POMC reverse primer, 50 CCTGAGCGACTGTAGCAGAATCTC-30 . The levels of relative genes were normalised to GAPDH, and the results were expressed as fold changes of threshold cycle (Ct) value relative to controls. All the primer sets were designed to span at least one intron to avoid genomic DNA-derived amplification. 2.3. Generation of mimecan KO mice Genomic DNA was extracted from mouse 129/Sv embryonic stem (ES) cells. A DNA fragment of the mouse mimecan gene (3.7 to 0.7 kb upstream of the exon 5 of the mimecan gene) was amplified by PCR and ligated to the KpnI–BamHI site of the upstream region of the neo cassette of the TK-neo/ppnt vector. A 5.0-kb DNA sequence (from 1.3 kb upstream to +2.0 kb downstream of the exon 7) encoding the C-terminus of the mimecan domain and 30 untrans-
lated region was also amplified by PCR and ligated to the SalI–NotI site downstream of the neo cassette of the same TK-neo/ppnt vector (Fig. 4A). The linearised mimecan targeting vector was introduced into CJ7 ES cells by electroporation. Transfectants were selected with neomycin (G418) (Invitrogen, Carlsbad, CA). Two sets of primers were used to select for targeted clones from these CJ7 ES cells by PCR. The sequences of the primers were as follows: F1 primer, which annealed upstream of the mimecan short arm of the TK-neo/ppnt vector, 50 -GAGTGGTTTGGAGTGATTGCT-30 ; R1 primer, located in the neo region of the TK-neo/ppnt vector, 50 -GTACGTCACGGGT GGTGTT-30 ; F2 primer, which annealed in the neo region of the TKneo/ppnt vector, 50 -TCCTTGCCAGCTTTCTAGATTCC-30 ; and R2 primer, located downstream of the mimecan long arm of the TK-neo/ ppnt vector, 50 -AAACCTCCAAGGCCACCCTG-30 (Fig. 4A). Cells that were expanded from targeted ES clones were injected into C57BL6 blastocysts, and germline transmitting chimeric animals were obtained and mated with C57BL6 mice. The resulting heterozygous offspring were crossed to generate wild type, heterozygous, and homozygous study subjects. Mimecan KO mice were backcrossed with C57BL/6J mice for five generations before they were used in this study. The mouse genotypes were determined by Southern blot analysis. The probe for the Southern blot was synthesised by PCR. The sequences of the primers were as follows: forward primer, 50 GCTGAAACTGACTGGGATGAGG-30 and reverse primer, 50 -GCACAGATTTGGACACAGAGAATG-30 (Fig. 4A). Mice that were homozygous null for mimecan were obtained by interbreeding heterozygous mice. Animals were housed in a temperature-controlled room (23 °C) with a 12 h light/dark cycle, and they had ad libitum access to chow and water. Adult male (8–10 week of age) mimecan KO mice and their wild type littermates were used for experiments. 2.4. Blood collection and hormone assays Whole blood was obtained after decapitation or from the retroorbital space using capillary tubes, and plasma was separated and stored at 80 °C. ACTH concentrations of the mouse plasma and AtT-20 cell culture media were measured by ELISA (Phoenix, CA, USA). The sensitivity of ACTH was 0–25 ng/ml. 2.5. Construction of retroviral vectors and transduction To construct AtT-20 cells stably expressing 3FLAG-tagged mouse mimecan, a retrovirus-mediated infection system was used. For expression of mouse mimecan, DNA encoding 3FLAG-tagged mouse mimecan was inserted into the multi-cloning site of the pMSCV PIG (Puromycin IRES GFP) vector (Clontech, Palo Alto, CA). The sequences of the primers were as follows: forward primer, 50 -ACGCAGATCTATGGAGACTGTGCACTCTACATTTCTCCTGCTACTCTTCGTGCCT CTGACACAGCAAGCACCACAGTCGCAGC-30 and reverse primer, 50 GCGTCTCGAGTTA CTTGTCGTCATCGTCTTTGTAGTCGATGTCATGGTC TTTGTAGTCTCCGTCATGGTCTTTGTAGTCGAAGTATGACCC TATG-30 . Retroviruses were subsequently produced by transiently co-transfecting HEK-293 cells with a retroviral vector and VSV-G, a gag-pol plasmid, using Lipofectamine 2000 (Invitrogen). At 48 h after transfection, media containing retroviruses were collected, filtered with 0.45-lm filters and used to infect cells in the presence of 8 lg/ml polybrene (Sigma) (Kim et al., 2009). Infected cells were selected using 1 lg/ml puromycin (Sigma) and further maintained in growth medium. Overexpression of 3FLAG-tagged mouse mimecan was confirmed by realtime PCR and Western blot analysis. 2.6. Western blot Infected cells were grown to 90% confluence in 6-well plates. Then, the cells were washed with ice-cold phosphate-buffered saline and lysed in RIPA and PMSF. After sonication, the lysates were
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
centrifuged to remove insoluble materials. The supernatants (10 lg/lane) were separated by SDS–PAGE and transferred onto a nitrocellulose membrane. They were then incubated with flag primary antibodies (Sigma) and subsequently with horseradish peroxidase-linked secondary antibodies. The signal was detected using enhanced chemiluminescence (PerkinElmer, MA, USA). Densitometric analysis was conducted directly on the blotted membrane using a CCD camera system (LAS-4000, Fujifilm, Tokyo, Japan). 2.7. Statistics All data were expressed as mean ± SD. When statistical analyses were performed, data were compared by one-way ANOVA with Student’s t-test. A p < 0.05 was considered to be statistically significant. 3. Results 3.1. Short treatment of mimecan promotes ACTH secretion but does not change POMC gene expression Mimecan is co-expressed with the POMC gene in pituitary corticotroph cells and in the AtT-20 cell line. In addition, the expression of mimecan in pituitary corticotroph cells is up-regulated by GC in a time- and dose-dependent manner and is not affected by CRH. Thus, we examined the effects of mimecan on POMC gene expression and ACTH secretion in AtT-20 cells. We found that treatment with recombinant mimecan protein for 24 h did not increase the expression of the POMC gene as shown by realtime PCR (Fig. 1A) and Northern blot analysis (data not shown); however, mimecan can stimulate ACTH secretion. After incubation with 10 lg of mimecan for 4 h, ACTH in the medium increased slightly (from 6.85 ± 0.25 to 7.85 ± 0.22 ng/ml; p < 0.05) (Fig. 1B), and stimulation was maintained for 24 h (from 22.43 ± 1.77 to 28.70 ± 1.2 ng/ml; p < 0.05) (Fig. 1C), while a 1 lg mimecan treatment resulted in an ACTH secretion increase at 24 h (from 22.43 ± 1.77 to 32.65 ± 1.86 ng/ml; p < 0.05) (Fig. 1C). 3.2. Mimecan slightly promotes CRHR1 expression but has no synergistic effect on POMC gene expression and ACTH secretion with CRH CRH, a major regulator of ACTH, stimulates ACTH synthesis/ secretion by binding with CRHR1 in pituitary corticotroph cells. We further examined the combined effects of mimecan and CRH. First, we observed the effect of mimecan on CRHR1 expression. We found that after treatment with 10 lg mimecan for 24 h, CRHR1 expression in the AtT-20 cell line slightly increased by
73
approximately 1.3-fold compared with controls (Fig. 2A). Although CRH or mimecan alone exhibited stimulatory effects on ACTH secretion, when they were simultaneously used, no obvious additive (i.e., synergistic) effects were observed after 4 or 24 h (Fig. 2C and D). Using realtime PCR, it was shown that the combination of mimecan protein and CRH did not increase the POMC gene expression (Fig. 2B). In summary, these results suggest that CRH does not enhance the effect of mimecan on ACTH secretion. 3.3. Long-term mimecan overexpression in AtT-20 cells inhibits POMC gene expression and ACTH secretion and slightly promotes CRHR1 expression According to the above results, it is clear that ACTH secretion increases following treatment with mimecan for a short time period in pituitary corticotroph cells. In order to assess long-term effects of mimecan on POMC gene expression and ACTH secretion, mimecan was constitutively overexpressed in AtT-20 cells using a retrovirus-mediated infection system. After overexpression in AtT-20 cells, mimecan expression was upregulated by approximately 90fold according to realtime PCR readouts (Fig. 3A). Meanwhile, upregulation of mimecan protein was also confirmed by Western blot analysis (Fig. 3B). CRHR1 expression was upregulated by approximately 1.6-fold in mimecan-overexpressing AtT-20 cells (Fig. 3C), similar to the effects of recombinant mimecan. Interestingly, the POMC gene was slightly downregulated by nearly 15% in mimecan-overexpressing AtT-20 cells, which was different from the results of the short-term incubation with mimecan (Fig. 3D), In parallel, mimecan-overexpressing AtT-20 cell ACTH secretion also decreased to 46.1 ± 3.8 ng/ml compared with MSCV-PIG AtT-20 cells (57.9 ± 2.4 ng/ml) (Fig. 3E). 3.4. The response of plasma ACTH level to CRH stimulation is attenuated in mimecan KO mice We further clarified the effect of mimecan in the pituitary using a mimecan KO mouse that was generated at the Shanghai Research Center for Model Organisms (Fig. 4). Consistent with a previous report by Tasheva ES (Tasheva et al., 2002), mimecan KO mice appeared to develop normally, remain viable, and grow to normal size. In the basal condition, the plasma concentrations of ACTH did not reveal obvious differences between mimecan KO mice and wild type mice (2.62 ± 1.28 vs. 3.06 ± 1.53 ng/ml, p > 0.05) (Fig. 5A). Therefore, we analysed the ACTH response to exogenously administered 50 lg/kg CRH in mimecan KO mice and wild type littermates. After treatment with CRH for 30 min, the plasma ACTH levels were obviously lower in the mimecan KO mice than the wild type mice (4.99 ± 1.53 vs. 10.40 ± 2.37 ng/ml, p < 0.001) (Fig. 5A). CRH (50 lg/kg) stimulated ACTH secretion by approximately
Fig. 1. Recombinant mimecan does not affect POMC gene expression while stimulating ACTH secretion. (A) After treatment with 1 and 10 lg recombinant mimecan for 24 h, the levels of POMC mRNA were unchanged in AtT-20 cells as detected by qRT-PCR (p > 0.05). Typical data from three to four replicate experiments. (B and C) After treatment with 1 and 10 lg recombinant mimecan for 4 h (B) and 24 h (C), the levels of ACTH in culture media of AtT-20 cells were detected by ELISA. ⁄p < 0.05, ⁄⁄p < 0.01.
74
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
Fig. 2. Combined effects of CRH and mimecan on POMC gene expression and ACTH secretion. (A) Mimecan promoted CRHR1 expression. After treatment with 1 and 10 lg recombinant mimecan for 24 h, levels of CRHR1 were detected in AtT-20 cells by qRT-PCR. ⁄p < 0.05. (B) Mimecan combined with CRH did not obviously affect POMC gene expression. After treatment with 1 and 10 lg recombinant mimecan for 21 h, AtT-20 cells were further treated with 100 nM CRH for 3 h; the levels of POMC were detected in AtT-20 cells by qRT-PCR. ⁄p < 0.05. (C and D) CRH did not further enhance ACTH secretion induced by mimecan. After incubation with recombinant mimecan for 1 h (C) and 21 h (D), AtT-20 cells were further treated with 100 nM CRH for 3 h. Compared with control, ⁄p < 0.05, ⁄⁄p < 0.01.
Fig. 3. Mimecan overexpression in AtT-20 cells and its affect on POMC and CRHR1 gene expression and ACTH secretion. (A and B) Mimecan was constitutively overexpressed in AtT-20 cells. Mimecan overexpression in AtT-20 cell was quantitated by qRT-PCR (A), and upregulation of mimecan protein was confirmed by Western blot analysis (B). (C) CRHR1 expression in mimecan-overexpressing AtT-20 cells increased as detected by qRT-PCR. (D) POMC gene expression in mimecan-overexpressing AtT-20 cells slightly decreased as detected by qRT-PCR. (E) The level of ACTH in culture medium of AtT-20 cells decreased as detected by ELISA. Compared with MSCV-PIG, ⁄p < 0.05, ⁄⁄p < 0.01.
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
75
Fig. 4. Mimecan gene targeting strategy and generation of mimecan KO mice. (A) The targeting strategy for the mimecan gene. Structure of the mouse mimecan gene with the relevant restriction sites (top), the structure of the targeting vector (middle), and the structure of the targeted gene (bottom). The wild type allele (Wt) gives a 16 kb DNA fragment, whereas the mutated allele gives a 6.8 kb fragment after digestion with BamHI. Negative (HSV-TK) and positive (PGK-NEO) selection markers are indicated by boxes without background colours. The boxes with numbers represent the exons of the mouse mimecan gene. The locations of the primers for the PCR to screen the positive ES cells and probe for Southern blot analysis to genotype the KO mice are indicated. TK, thymidine kinase; NEO, neomycin. (B) The mice were genotyped by Southern blot analysis of BamHI-digested mouse genomic DNA isolated from wild type (+/+), heterozygous (+/), and mimecan knockout (/) mice. (C) Mimecan gene expression in lung tissues of mimecan / and mimecan +/+ mice was detected by Northern blot analysis.
Fig. 5. Stress reaction is attenuated in mimecan KO mice. (A) There was no difference in ACTH levels in basal conditions, whereas mimecan KO mice had lower ACTH than wild type littermates after stimulation with CRH. CRH (50 lg/kg) was injected through the tail vein. Retro orbital plasma was collected at 0 and 30 min. The serum ACTH levels of the mimecan KO mice and wild type littermates were valued by ELISA (11 WT mice and 13 mimecan KO mice). ⁄⁄p < 0.01. (B and C) Under basal culture conditions (B) or after incubating with 100 nM CRH for 24 h (C), POMC and CRHR1 gene expression in primary cultured pituitary cells from mimecan KO mice and wild type littermates were quantitated by the qRT-PCR.
3.5-fold in wide type mice but by only 1.9-fold in mimecan KO mice. This result showed that mimecan null mice exhibited an attenuated plasma ACTH level to CRH stimulation and attenuated HPAA response to stress.
The in vitro result further confirmed that the responses to stress were attenuated in mimecan KO mice.
3.5. The expression levels of the POMC and CRHR1 decreased in primary pituitary cultures of mimecan KO mice with CRH
The present study used genetic pharmacological approaches to examine the role of mimecan in the pituitary. Our results provide important, novel evidence to suggest that mimecan in the pituitary is functionally important for ACTH secretion and HPAA balance. ACTH, an important hormone that is secreted by pituitary corticotroph cells, is a vital component of the HPAA that mediates the response to stress (Lovejoy and Balment, 1999). ACTH was not only positively regulated by CRH and vasopressin (AVP) from the hypothalamus but also negatively regulated by GC from the cortex of the adrenal gland (Engler et al., 1999; Papadimitriou and Priftis, 2009). Moreover, locally produced pituitary proteins or extracellular matrix factors also directly regulate POMC gene expression and ACTH secretion. Among the factors secreted from the pituitary, it is
We cultured primary pituitary cells from mimecan KO mice and wild type littermates in order to assess cellular activity in the absence of confounding in vivo effects. In accordance with the in vivo results, the basal POMC gene and CRHR1 expression showed no significant difference between mimecan KO mice and wild type littermates (Fig. 5B). However, after incubation with 100 nM CRH for 24 h, POMC and CRHR1 gene expression in mimecan KO mice primary pituitary cells significantly decreased compared with wild type cells. CRHR1 expression decreased by 30%, and POMC expression decreased by approximately 70% by quantitative PCR (Fig. 5C).
4. Discussion
76
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77
known that IL-1, IL-6, IL-2, EGF, and LIF enhance POMC gene expression and ACTH secretion in the pituitary, while activin suppresses POMC expression (Katahira et al., 1998; Ray and Melmed, 1997). Previous studies have confirmed that the extracellular matrix (ECM) regulates ACTH secretion. ACTH in AtT-20 cells was inhibited by fibronectin, laminin and collagen I (Kuchenbauer et al., 2001). Therefore, these intrapituitary signalling networks provide an additional level of control and integrate with central and peripheral signals to modulate pituitary ACTH hormone secretion and the HPAA reaction to stress. We originally identified mimecan gene expression in human and mouse pituitary tissues and demonstrated that mimecan immunoreactivity was predominantly associated with corticotroph cells (Ma et al., 2010), while the function of mimecan in the pituitary is unclear. Mimecan is constitutively expressed in pituitary corticotroph cells and murine AtT-20 cells, which respond to GC, but not to CRH. Pituitary corticotroph cells, by expressing and secreting ACTH, are located in the centre of the HPAA. We hypothesised that mimecan may play a role in the anterior pituitary corticotroph cells and in the HPAA. To confirm this, AtT-20 cells were treated with different doses of recombinant mimecan protein for different times. Mimecan stimulates ACTH secretion but does not induce POMC gene expression. Mimecan stimulates ACTH secretion after incubation for 4 h and maintains induction for hours. In a previous study, it was reported that ACTH production in AtT-20 cells is inhibited by ECM fibronectin, laminin and collagen I. A reporter construct with the POMC promoter showed similar results. In contrast, ACTH production was not significantly altered in normal pituitary cells (Kuchenbauer et al., 2001). Mimecan belongs to a family of proteoglycans (PGs) in the ECM. In contrast to fibronectin, laminin and collagen I, mimecan stimulates ACTH secretion but does not influence POMC gene expression. Moreover, mimecan not only induces ACTH secretion but also slightly induces CRHR1 expression. However, they do not synergise with CRH to further stimulate POMC gene expression and ACTH secretion. This result indicates that the instant treatment of mimecan induces ACTH secretion. Interestingly, mimecan overexpressing AtT-20 cells, which express mimecan at a high level for a long time, also show increased CRHR1 expression but slightly decreased POMC expression and ACTH secretion. Combined with the previous result that GC can induce mimecan while inhibiting POMC and ACTH, this result suggests that mimecan may take part in GC slow feedback on ACTH secretion (Ma et al., 2010). In contrast to lipocortin1, which is also regulated by the GC-mediated inhibitory action of GC on the release of ACTH in the pituitary (Taylor et al., 1997; Tierney et al., 2003), mimecan is upregulated by GC and in turn further stimulates ACTH production to prevent GC excessive negative feedback for a short time. In contrast, long-term mimecan over-expression inhibits POMC expression and ACTH secretion to enhance GC negative feedback for long time (Fig. 6). These results indicate that the functions of mimecan in the pituitary are complicated. Mimecan KO mice were generated. Like other SLRPs, mimecan is important in the regulation of collagen fibrillogenesis and cellular growth, differentiation, and migration (Ameye and Young, 2002; Iozzo, 1999; Kresse and Schonherr, 2001). It is well known that other ECMs modulate pituitary cell proliferation. AtT-20 cell proliferation was stimulated by collagen IV and fibronectin and inhibited by collagen I and laminin. In parallel, the cell morphology was also modified by the ECM (Kuchenbauer et al., 2001). The morphologic and histologic observations show that the POMC-expressing cells are similar between wild type and mimecan KO mice by in situ hybridisation, although mimecan KO mice show a more profuse blood supply (data not shown), which is in accordance with other reports about mimecan function on vascular vessels. In addition, short-term mimecan incubation or long-term mimecan over-
Fig. 6. Schematic illustration of the role of mimecan in pituitary corticotroph cells. Mimecan keeps the HPAA in balance during stress.
expression did not show any morphologic changes. Although the plasma ACTH showed no significant difference between mimecan KO mice and their wild type littermates in basal conditions, the serum ACTH concentration was lower in mimecan KO mice after stimulation by CRH. These results show that the reaction to stress is blunted in mimecan KO mice. Moreover, the attenuation to stress was further confirmed by the primary mimecan KO mouse pituitary cells in vitro. Although the basal POMC and CRHR1 gene expression levels did not differ between primary culture pituitary cells from mimecan KO mice and wild type littermates, after being incubated with 100 nM CRH, POMC and CRHR1 gene expression in mimecan KO mice significantly decreased compared with wild type mice. These results indicate that the sensitivity of the pituitary corticotroph cells to CRH stimulation was attenuated in the mimecan gene KO mice. According to our results, mimecan expressed in the pituitary corticotroph cells mainly keeps the HPAA active under stress. On the one hand, pituitary mimecan keeps the HPAA active, that is, mimecan warrants the corticotroph cells being activated by CRH, stimulating ACTH secretion. On the other hand, mimecans were upregulated by GC, further stimulating ACTH secretion to prevent pituitary corticotroph cells from excessive feedback by GC (Fig. 6). In conclusion, we explored the function of mimecan in the pituitary for the first time. We found that mimecan may regulate ACTH and HPAA as an autocrine factor. Although the mimecan receptor has not been found yet, the function of mimecan in pituitary corticotroph cells will provide a clue to finding the mimecan receptor. This will allow for the mechanism of mimecan function to be clarified in the future. Acknowledgements This work was supported in part by the National Natural Science Foundation of China (30871206) and the Doctor’s Innovation Found of Shang Hai Jiao Tong University School of Medicine (BXJ201012). References Ameye, L., Young, M.F., 2002. Mice deficient in small leucine-rich proteoglycans: novel in vivo models for osteoporosis, osteoarthritis, Ehlers–Danlos syndrome, muscular dystrophy, and corneal diseases. Glycobiology 12, 107R–116R. Engler, D., Redei, E., Kola, I., 1999. The corticotropin-release inhibitory factor hypothesis: a review of the evidence for the existence of inhibitory as well as stimulatory hypophysiotropic regulation of adrenocorticotropin secretion and biosynthesis. Endocr. Rev. 20, 460–500. Fernandez, B., Kampmann, A., Pipp, F., Zimmermann, R., Schaper, W., 2003. Osteoglycin expression and localization in rabbit tissues and atherosclerotic plaques. Mol. Cell. Biochem. 246, 3–11. Iozzo, R.V., 1999. The biology of the small leucine-rich proteoglycans. Functional network of interactive proteins. J. Biol. Chem. 274, 18843–18846. Kampmann, A., Fernández, B., Deindl, E., Kubin, T., Pipp, F., Eitenmüller, I., Hoefer, I.E., Schaper, W., Zimmermann, R., 2009. The proteoglycan osteoglycin/ mimecan is correlated with arteriogenesis. Mol. Cell. Biochem. 322, 15–23.
Q.-Y. Ma et al. / Molecular and Cellular Endocrinology 341 (2011) 71–77 Katahira, M., Iwasaki, Y., Aoki, Y., Oiso, Y., Saito, H., 1998. Cytokine regulation of the rat proopiomelanocortin gene expression in AtT-20 cells. Endocrinology 139, 2414–2422. Kim, W.K., Jung, H., Kim, D.H., Kim, E.Y., Chung, J.W., Cho, Y.S., Park, S.G., Park, B.C., Ko, Y., Bae, K.H., Lee, S.C., 2009. Regulation of adipogenic differentiation by LAR tyrosine phosphatase in human mesenchymal stem cells and 3T3-L1 preadipocytes. J. Cell Sci. 122, 4160–4167. Kresse, H., Schonherr, E., 2001. Proteoglycans of the extracellular matrix and growth control. J. Cell. Physiol. 189, 266–274. Kuchenbauer, F., Hopfner, U., Stalla, J., Arzt, E., Stalla, G.K., Paez-Pereda, M., 2001. Extracellular matrix components regulate ACTH production and proliferation in corticotroph tumor cells. Mol. Cell. Endocrinol. 175, 141–148. Long, C.J., Roth, M.R., Tashevam, E.S., Funderburgh, M., Smit, R., Conrad, G.W., Funderburgh, J.L., 2000. Fibroblast growth factor-2 promotes keratan sulfate proteoglycan expression by keratocytes in vitro. J. Biol. Chem. 275, 13918– 13923. Lovejoy, D.A., Balment, R.J., 1999. Evolution and physiology of the corticotropinreleasing factor (CRF) family of neuropeptides in vertebrates. Gen. Comp. Endocrinol. 115, 1–22. Ma, Q.Y., Zuo, C.L., Ma, J.H., Zhang, X.N., Ru, Y., Li, P., Pan, C.M., Liu, Z., Cao, H.M., Chen, M.D., Song, H.D., 2010. Glucocorticoid up-regulates mimecan expression in corticotroph cells. Mol. Cell. Endocrinol. 321, 239–244. Madisen, L., Neubauer, M., Plowman, G., Rosen, D., Segarini, P., Dasch, J., Thompson, A., Ziman, J., Bentz, H., Purchio, A.F., 1990. Molecular cloning of a novel boneforming compound: osteoinductive factor. DNA Cell Biol. 9, 303–309. Papadimitriou, A., Priftis, K.N., 2009. Regulation of the hypothalamic–pituitary– adrenal axis. Neuroimmunomodulation 16, 265–271. Petretto, E., Sarwar, R., Grieve, I., Lu, H., Kumaran, M.K., Muckett, P.J., Mangion, J., Schroen, B., Benson, M., Punjabi, P.P., Prasad, S.K., Pennell, D.J., Kiesewetter, C.,
77
Tasheva, E.S., Corpuz, L.M., Webb, M.D., Conrad, G.W., Kurtz, T.W., Kren, V., Fischer, J., Hubner, N., Pinto, Y.M., Pravenec, M., Aitman, T.J., Cook, S.A., 2008. Integrated genomic approaches implicate osteoglycin (Ogn) in the regulation of left ventricular mass. Nat. Genet. 40, 546–552. Ray, D., Melmed, S., 1997. Pituitary cytokine and growth factor expression and action. Endocr. Rev. 18, 206–228. Shanahan, C.M., Cary, N.R., Osbourn, J.K., Weissberg, P.L., 1997. Identification of osteoglycin as a component of the vascular matrix. Differential expression by vascular smooth muscle cells during neointima formation and in atherosclerotic plaques. Arterioscler. Thromb. Vasc. Biol. 17, 2437–2447. Tasheva, E.S., 2002. Analysis of the promoter region of human mimecan gene. Biochim. Biophys. Acta 1575, 123–129. Tasheva, E.S., Maki, C.G., Conrad, A.H., Conrad, G.W., 2001. Transcriptional activation of bovine mimecan by p53 through an intronic DNA-binding site. Biochim. Biophys. Acta 1517, 333–338. Tasheva, E.S., Koester, A., Paulsen, A.Q., Garrett, A.S., Boyle, D.L., Davidson, H.J., Song, M., Fox, N., Conrad, G.W., 2002. Mimecan/osteoglycin-deficient mice have collagen fibril abnormalities. Mol. Vis. 8, 407–415. Taylor, A.D., Christian, H.C., Morris, J.F., Flower, R.J., Buckingham, J.C., 1997. An antisense oligodeoxynucleotide to lipocortin 1 reverses the inhibitory actions of dexamethasone on the release of adrenocorticotropin from rat pituitary tissue in vitro. Endocrinology 138, 2909–2918. Tierney, T., Christian, H.C., Morris, J.F., Solito, E., Buckingham, J.C., 2003. Evidence from studies on co-cultures of TtT/GF and AtT20 cells that Annexin 1 acts as a paracrine or juxtacrine mediator of the early inhibitory effects of glucocorticoids on ACTH release. J. Neuroendocrinol. 15, 1134–1143. Wang, Y., Ma, Y., Lu, B., Xu, E., Huang, Q., Lai, M., 2007. Differential expression of mimecan and thioredoxin domain-containing protein 5 in colorectal adenoma and cancer: a proteomic study. Exp. Biol. Med. (Maywood) 232, 1152–1159.