- Email: [email protected]
Mincle inhibits neutrophils and macrophages apoptosis in A. fumigatus keratitis
International Immunopharmacology 52 (2017) 101–109
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Mincle inhibits neutrophils and macrophages apoptosis in A. fumigatus keratitis
MARK
Jing Lina, Kun Hea,b, Guiqiu Zhaoa,⁎, Cui Lia, Liting Hua, Guoqiang Zhua, Yawen Niua, Guipei Haoa a b
The Affiliated Hospital of Qingdao University Medical College, PR China Ophthalmic Center of QuHua Hospital, QuHua 324004, PR China
A R T I C L E I N F O
A B S T R A C T
Keywords: Fungal keratitis Neutrophils Macrophages Apoptosis Mice
Purpose: To determine whether macrophage inducible C-type lectin (Mincle) regulates neutrophils and macrophages apoptosis in A. fumigatus keratitis. Materials and methods: A murine model (C57BL/6) of fungal keratitis (AF) was established by gently scraping corneal central epithelium, smearing A. fumigatus on the epithelium surface and covering the eye with contact lenses. AF cell model was established by extracting neutrophils (PMN) and macrophages, and then infecting cells with A. fumigatus. Animals and cells were randomly divided into control and A. fumigatus keratitis group, which were treated with Mincle ligand Trehalose-6,6-dibehenate (TDB), Mincle neutralizing antibody (MincleAb) or PBS before infection. The cornea infection was monitored using a slit lamp and further analyzed using H & E assay. PCR, Western blot, immunostaining, TUNEL staining and flow cytometry were used to examine the expression of Mincle and apoptosis factors, PMN infiltration and cell apoptosis, respectively. Results: Higher levels of Mincle mRNA and protein, as well as epithelial thickness and presence of inflammatory cells in the stroma, were observed in the AF group compared to control. In addition, higher Mincle mRNA levels were observed in normal and stimulated neutrophils and macrophages. Furthermore, Fas, FasL and CASP3 mRNA levels, neutrophils infiltration rate and TUNEL-positive cells were significantly increased in AF + MincleAb mice compared with the control. Similar results, as well as significantly higher neutrophils and macrophages apoptosis, were observed by treating cells with MincleAb in vitro. Most importantly, opposite results i.e. lower mRNA levels, neutrophils infiltration rate and TUNEL-positive cells, as well as lower cell apoptosis in vitro, were observed in mice and cells treated with TDB. Conclusion: Mincle-participated in inflammatory process which inhibits neutrophils and macrophages apoptosis induced by A. fumigatus involved in Fas-dependent apoptotic pathways.
1. Introduction Fungal keratitis is an inflammation caused by a variety of pathogenic fungi [1], among which A. fumigatus is considered the chief culprit [2,3]. Eye trauma, long-term addiction to antibiotic or corticosteroid, as well as wide use of contact lens, have shown to significantly increase the incidence rate of FK [3]. Being a serious infectious corneal disease, FK can cause severe corneal inflammation and induce blindness at higher rate compared to other corneal diseases. Without in-time detection and efficient treatment, the inflammation can damage the eye cornea quite seriously, including the destruction of stroma and already mentioned blindness. Neutrophils, the most abundant circulating leukocytes in the human body, represent the first line of immune cell defense against bacterial and fungal infections. Neutrophils are also a key component of the
⁎
Corresponding author. E-mail address: [email protected] (G. Zhao).
http://dx.doi.org/10.1016/j.intimp.2017.08.006 Received 4 January 2017; Received in revised form 30 June 2017; Accepted 9 August 2017 1567-5769/ © 2017 Published by Elsevier B.V.
inflammatory response [4,5]. Activated neutrophils leave the bloodstream and migrate to sites of infection or sterile insult. Neutrophils are also terminally differentiated, short-lived cells that are programmed to undergo apoptosis. During an inflammatory response neutrophils have an extended lifespan. According to existing research, the rapid progress of fungal keratitis and delayed healing, have shown to be linked with corneal infection in the development process of pathogenic fungi recognized by the cornea recognition receptor. Immune and inflammatory response are essential for removal of fungi, nevertheless inflammatory cells can also lead to corneal tissue damage. The final outcome of fungal keratitis (corneal perforation, loss of eye or healing) is strongly associated with the body's ability to cure the infection. The process of fungal keratitis infection is strongly associated with neutrophils and mononuclear macrophages infiltration. Neutrophils, also called PMN, are essential components of the inflammatory response and
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
surface anesthesia. The conjunctival sac was then cleaned using 0.1% entoiodine, and the central epithelium of cornea was gently scraped (3–4 mm in diameter), and then went on to scratch into stromal layer under microscope. The damaged region was then smeared with 5 μl aliquot containing 1 × 108 CFU/ml of A. fumigatus (strain 3.0772, General Microbiological Culture Collection Center, Beijing, China), prepared according the previously described method [12]. Fungus aliquot was topically applied to the corneal surface (3–4 mm in diameter), and then covered with contact lenses to prevent further loss/leaking of fungi. Consequently, all mice were examined on day 1 and 3 post-infection (p.i.) to ensure the successful cornea infection. Eye corneas were monitored daily by slit lamp examination (SLE) using digital camera.
are rapidly recruited into the corneal stroma to produce a variety of cytokines. PMNs eliminate fungal infection through phagocytosis, lysosomal degranulation and sterilization, which produce oxidative metabolism product and trigger a respiratory outbreak reaction. Since neutrophilic inflammation is tightly regulated, it limits the tissue damage and promotes repair. When neutrophilic inflammation gets dysregulated, these cells contribute to tissue damage resulting in disease. It is very important that neutrophils get cleared from the site of inflammation after exerting their pro-inflammatory effects. Cell apoptosis is a key control mechanism regulating the neutrophil cell numbers which guarantee the safe disposal of engulfed bacteria. Apoptosis is regarded as a non-inflammatory, immune-quiescent process in which the cells become functionally down-regulated, while toxic intracellular contents get initially contained within the plasma membrane and then taken up by surrounding phagocytes (especially macrophages) [6]. Uptake of apoptotic cells causes macrophages to change phenotype and to release anti-inflammatory and pro-resolution mediators rather than pro-inflammatory mediators. This promotes inflammation resolution and triggers tissue repair mechanisms, which in turn prevent the release of pro-inflammatory cell debris as a consequence of secondary necrosis, limiting host damage (Michlewska et al., Poon et al.) [7,8]. Macrophage-inducible C-type lectin (Mincle) is also called Clec4e and Clecsf9 which is a novel 219aa type II transmembrane protein with a highly kept C-type lectin domain [9,10]. Mincle is expressed on myeloid cells and neutrophils, and it especially concentrates on professional antigen presenting cells, such as macrophages, dendritic cells and B cells [9]. Some recent studies have shown that Mincle acts as a promoter in the response of macrophages to fungal infections [11–13]. Previous research has found that trehalose-6,6-dimycolate (TDM)bound Mincle has the function of initiating recruitment of Fc receptor g, and inducing the signaling of spleen tyrosine kinase, which leads to activation of Nuclear factor-κB (NF-κB) [14–16]. Finally, activated receptor signaling pathways and NF-κB converge with each other so as to further improve pro-inflammatory responses. In addition, Wevers et al. [17] have found that human Mincle can suppress antifungal defense. Above reported findings show that, having the functions of inflammation stimulation and resolution, Mincle is very relevant for balancing immune responses among different signaling pathways [14–18]. Nevertheless, the Mincle regulating mechanism with reference to the death of inflammatory cells still remains unclear. Therefore, we wanted to investigate whether Mincle could regulate neutrophils and macrophages apoptosis in A. fumigatus keratitis.
2.3. Neutrophils and macrophages extraction Peritoneal neutrophils (PMN) were harvested according to following method: mice were intraperitoneal injected with 1 ml sterile 9% casein (Sigma, China). After 24 h, the same injection procedure was repeated. 3 h later, mice were anesthetized using 8% chloral hydrate, and then 10 ml Dulbecco's modified Eagle's medium (DMEM; Gibco, San Diego, CA, USA) with 5% fetal bovine serum (FBS; Gibco) were injected into the abdominal cavity. Abdominal liquids were extracted by peritoneal lavage using syringe, and then centrifuged at 300g for 10 min at 4 °C. Finally, neutrophils were collected, purified using percoll, and stored for further analysis. For macrophages extraction, mice were first administrated by i.p. injection of 1 ml 3% Thioglycollate medium (Hope Bio-Technology Co., Ltd. Qingdao, China). 7 days post-injection mice were sacrificed by cervical dislocation. Abdominal skin of sacrificial mice was wiped by 75% alcohol and opened along the middle line. 5 ml DMEM was then injected into mice abdominal cavity and the macrophages were extracted by peritoneal lavage. 2.4. Cells culture and cell stimulation Neutrophils and macrophages were extracted from susceptible C57BL/6 mice. Cells were seeded in a DMEM medium supplemented with 5% FBS. Cells suspensions (1 × 106/ml) were seeded in 12-well culture plates, and then cultured in a humidified incubator containing 5% CO2/95% air at 37 °C. Cells were stimulated using 1 × 108/ml A. fumigatus (60 μl/ml), and then counted and analyzed on 0, 4, 8, 12, 16 h post-fungi injection.
2. Materials and methods 2.5. Mincle neutralization
2.1. Animals
Goat anti-mouse Mincle neutralizing antibody (5 μg/5 μl) or control goat IgG (5 μg/5 μl) was administrated to the mice' left eye by subconjunctival injection a day before infection. Consequently, corneas were infected with A. fumigatus 1 day post-injection. Neutrophils and macrophages were pretreated with Mincle neutralizing antibody (10 μg/ml) or IgG (10 μg/ml) for 2 h. Macrophages were incubated with A. fumigatus for 12 h, while the neutrophils were incubated with 1 × 108/ml A. fumigatus (60 μl/ml) for 8 h.
Female C57BL/6 mice, 8–10 weeks old, were purchased from the Chang Zhou Cavens Laboratory Animal Ltd. (Anhui, China). All animal studies (including the mice euthanasia procedure) were done in compliance with the regulations and guidelines of Qingdao University Institutional Animal Care and conducted according to the AAALAC and the IACUC guidelines. In addition, all experiments conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 2.2. Corneal infection
2.6. Mincle agitation
C57BL/6 mice were randomly divided into 2 groups: 6 for control group (normal corneas were collected without any scrape or other treatment) and 12 for A. fumigatus keratitis group. Each cornea was examined under a slit lamp microscope before each experiment. For each mouse, the right cornea was used for model establishing (treatment group), while the left one was used as control (untreated group). Mice were anesthetized by intraperitoneal injection of 10% chloral hydrate 3 ml/kg, and 0.4% oxybuprocaine hydrochloride eyedrops for
Mincle agonist TDB (2 μg/5 μl) or control 0.5% DMSO was administrated to the mice' left eye by subconjunctival injection the day before infection. Consequently, corneas were infected with A. fumigatus 1 day post-injection. Neutrophils and macrophages were pretreated with L Mincle agonist TDB (4 μg/ml) for 2 h. Macrophages were then incubated with A. fumigatus for 12 h, while the neutrophils were incubated with 1 × 108/ ml A. fumigatus (60 μl/ml) for 8 h. 102
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
nick end labeling (TUNEL) reagents according to the manufacturer instructions (Roche, Penzberg, Germany), and counterstained with DAPI. TUNEL-positive cells were detected and quantified by fluorescence microscopy (Leica, Germany).
2.7. Hematoxylin-Eosin staining Eyes were enucleated on the 3rd day p.i., cleaned using 0.01 M PBS, embedded in OCT (Tissue-Tek; Miles, Elkhart, IN), and then snap frozen in liquid nitrogen. 10 μm sections were then cut using Frozen Slicer (Leica, Germany). Briefly, sections were prepared orderly by fixing, staining and dehydration. The morphology of corneal cells was observed under the microscope (Leica, Germany).
2.11. Western blot Neutrophils or macrophages were washed with ice-cold PBS. Cells were lysed by adding 100 μl RIPA buffer (1% Triton X-100, 1% deoxycholate, 0.1% SDS, 150 mM NaCl, 50 mM TriseHCl pH 7.4, 10 mM EDTA pH 8.0 dissolved in PBS) and briefly sonicated for 2 h on ice. The cell centrifuged for 3 times at 14000 rpm for 15 min at 4 °C. Total protein was detected via bicinchoninic acid assay, and denatured with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample loading buffer at 95 °C for 5 min. Proteins (60 μg/well) were separated by 12% SDS-PAGE in Tris/glycine/SDS buffer and electroblotted onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). After blocking in PBS-T (0.05%) and 5% milk for 1 h at room temperature, the blots were incubated with a rabbit monoclonal antibody (1:1000) against mouse cleaved caspase-3 (Cell Signaling Technology, Beverly, MA) at 4 °C overnight. The blots were washed 5 min in PBS-T and then incubated with a 1:5000 dilution of horseradish peroxidase-conjugated secondary antibody (Boster, China) for 1 h at 37 °C. Blots of cells lysates were measured with BeyoECL Plus (Beyotime, Shanghai, China). Band intensity was assessed using Quantity One Software (Bio-Rad, CA, USA).
2.8. RNA isolation and real time RT-PCR assay Normal and infected corneas were collected at 0, 0.5, 1, 3 and 5 day p.i., while neutrophils and macrophages were collected at 0, 4, 8, 12, 16 h post-infection. Corneas administrated with Mincle neutralizing antibody or IgG, were collected 1 day p.i., while neutrophils or macrophages were collected after 8 h or 12 h post-stimulation. RNA was separated from suspension by RNAiso plus reagent (TaKaRa, Dalian, Liaoning Province, China), and then quantified using spectrophotometry. RNA (1 μg) was used for first-strand cDNA synthesis according to the reverse transcription system (TaKaRa, Dalian, Liaoning Province, China). Complementary DNA was generated by reverse transcription of 2 μg of total RNA and then used in the following quantitative polymerase chain reaction reactions with SYBR Green using specific primers: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and a final stage of 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. The oligonucleotide primers of β-actin, Fas, FasL, and CASP3 are shown in Table 1. Reverse transcription followed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using the housekeeping gene β-actin as an internal control and quantified using the 2 −ΔΔCt method. Each experiment was run in triplicate.
2.12. Apoptosis detection using flow cytometry assay Cells were washed with cold PBS and resuspended in 300 μl of Annexin V Binding Buffer (BD). Consequently, 5 μl of Annexin V-FITC (BD Biosciences) and 5 μl of PI Solution (BD Biosciences) were added to the cell suspension which was incubated in a dark for 15 min at room temperature. Data were acquired within 1 h, using FACSAria or FACScan (BD Biosciences) and analyzed with FlowJo (Tree Star. Inc.).
2.9. PMN immunostaining Slides were fixed for 10 min in acetone, washed with 0.01 M PBS and blocked using blocking solution (0.01 M PBS, 2.5% BSA and Donkey IgG (1:100)) for 30 min at room temperature. Following steps were incubated with a primary rabbit anti-PMN antibody NIMP-R14 (1:100) at 4 °C overnight. Subsequently, the sections were incubated with the corresponding secondary antibody, Donkey anti-rabbit antibody-FITC (1:150) for 1 h at 37 °C. Sections were then incubated with DAPI for additional 10 min. The control groups were analyzed using the same above protocol, except the primary antibodies which was replaced with the host IgG. Finally, sections were visualized by fluorescence microscopy (Leica, Germany).
2.13. Statistical analysis The results were indicated as mean ± standard deviation. One-way analysis of variance followed by Student-Newman-Keuls test was analyzed by GraphPad 5.0 software. The Kruskal-Wallis test was used to compare apoptotic index scores. p < 0.05 was considered significantly different. 3. Results
2.10. TUNEL assay
3.1. Mincle expression and neutrophil infiltration in mice cornea
Normal uninfected and infected C57BL/6 mouse eyes (n = 3/ group/time) were enucleated the 3rd day p.i. The corneal sections were incubated with terminal deoxynucleotidyltransferase–mediated dUTP
Images taken by a slit lamp on day 3 p.i. (Fig. 1A) confirmed the presence of disease in mice corneas infected with A. fumigatus (AF) compared to uninfected (normal) group. Significant corneal edema and
Table 1 Nucleotide sequences of mouse primers for real-time RT-PCR. Gene
GenBank no.
Primer sequence (5′–3′)
Size (bp)
β-Actin
NM_007393.3
147
Fas
NM_007987.2
FasL
NM_010177
Caspase-3
NM_009810.2
Mincle
XM_017321688
F - GAT TAC TGC TCT GGC TCC TAG C R - GAC TCA TCG TAC TCC TGC TTG C F - ACCCTGAATCTAGAACCTCCAGTC R - CCTGGATTGTCATGTCTTCAGC F - GAACTGGCAGAACTCCGTGA R - TAAATGGGCCACACTCCTCG F - TGGGCCTGAAATACCAAGTC R - AAATGACCCCTTCATCACCA F - ACTGACAGACCAGGTGGTGGAG R - TCACAAATCCAAGGCATACTGTAGA
103
105 120 147 198
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
Fig. 1. Mincle expression and neutrophil infiltration in mice corneas infected with A. fumigatus. (A) Images taken by a slit lamp on day 3 p.i. confirmed the presence of the disease in mice corneas infected with A. fumigatus (AF) compared to uninfected (Normal) mice. (B) H & E staining images (100×; 200 ×) of mice corneas in Normal and AF group. (C–F) Immunofluorescence images (× 400) showing expression of Mincle (C, D) and PMN (E, F) in the corneas of Normal, DMSO, AF, TDB, AF + TDB, AF + IgG and AF + MincleAb on day 3 p.i.; Blue: nuclear staining (DAPI); red: Mincle staining; green: PMN (NIMP-R14) staining. Magnification: 40 ×. (G) Relative mRNA levels of Mincle in mice corneas infected with A. fumigatus were significantly increased on 0.5, 1 day p.i. (H) Relative mRNA levels of Mincle in cornea of different mice groups 1 day p.i. treated with neutralizing antibody or TDB. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
+ TDB group compared with PBS control before or after infection; however, they were significantly reduced after Mincle neutralizing antibody treatment compared with IgG treatment (Fig. 1D and E).
an irregular whitish mass even ulceration were observed on day 3 postfungal infection. Furthermore, epithelial thickness (Fig. 1B) and presence of inflammatory cells in the stroma, were observed in AF group compared to the control (Fig. 1B). In addition, in order to explore the expression of Mincle in the corneas p.i., mRNA and protein levels were examined in uninfected and infected mice by real-time RT-PCR and immunostaining approach. Briefly, our results indicated that the Mincle mRNA levels were significantly higher in infected mice compared to control at 0.5 and 1 day p.i. (Fig. 1G, p < 0.01, p < 0.05); while the Mincle protein was examined by immunostaining at 3 days p.i. (Fig. 1C). Additionally, increased number of neutrophils was found after fungal infection. Moreover, in order to investigate whether Mincle can participate in the corneal infection, mice corneas were pretreated with Mincle neutralizing antibody or IgG and Mincle agonist TDB or PBS before infection. Our data showed that the mRNA levels of Mincle (Fig. 1H, p < 0.01, p < 0.01) were significantly increased in the AF + TDB group compared to PBS control, before or after infection; nevertheless mRNA levels were significantly decreased (Fig. 1H, p < 0.01) after Mincle neutralizing antibody treatment compared to IgG treatment. Moreover, as shown in Fig. 1, protein levels of Mincle and neutrophil infiltration were significantly increased (Fig. 1C and F) in the AF
3.2. Effect of Mincle on cell apoptosis in A. fumigatus-induced corneal inflammation mice model To investigate whether Mincle can induce the cell apoptosis, mice corneas of different groups were pretreated with Mincle neutralizing antibody (AF + MincleAb) and agonist TDB (AF + TDB) or IgG and DMSO before infection, and then infected with A. fumigatus. The mRNA levels of Fas, FasL, and CASP3 were examined by PCR, while the corneal cell apoptosis were verified by TUNEL (terminal deoxinucleotidyl transferase-mediated dUTP-fluorescein nick end labeling) staining. Briefly, the data indicated that the mRNA levels of Fas (Fig. 2A, p < 0.05, p < 0.01), FasL (Fig. 2B, p < 0.01, p < 0.001), and Caspase3 (Fig. 2C, p < 0.01, p < 0.001) were significantly increased in the AF + TDB mice compared to DMSO group (without infection), as well as in AF group compared with normal mice. Furthermore, significant decreased mRNA levels of Fas (Fig. 2A, p < 0.001), FasL (Fig. 2B, p < 0.02), and Caspase3 (Fig. 2C, p < 0.05), were observed in AF + TDB group compared with FA group; while significant 104
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
Fig. 2. Effects of Mincle on cell apoptosis in A. fumigatus-induced corneal inflammation mice model. Relative mRNA levels of Fas (A), FasL (B), and Caspase3 (C) in corneas of different mice groups 1 day p.i. treated with neutralizing antibody or TDB. (D, E) TUNEL images showing cell death in cornea of Normal, DMSO, AF, TDB, AF + TDB, AF + IgG and AF + MincleAb mice on days 3 p.i.; Blue: nuclear staining (DAPI); green: TUNEL staining. Magnification: 40×. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
mRNA levels of Fas (Fig. 3C, p < 0.01, p < 0.001), FasL (Fig. 3D, p < 0.001, p < 0.001), and Caspase3 (Fig. 3F, ns, p < 0.001) were significantly increased after TDB treatment compared to DMSO group (without infection), as well as in AF group compared with normal mice. Furthermore, significantly decreased mRNA levels of Fas (Fig. 3C, p < 0.05), FasL (Fig. 3D, p < 0.001), and Caspase3 (Fig. 3F, p < 0.01), were observed in the AF + TDB compared to AF group; while significantly increased mRNA levels of Fas (Fig. 3C, p < 0.01), FasL (Fig. 3D, p < 0.05), and Caspase3 (Fig. 3F, p < 0.001) were observed in the AF + MincleAb compared to control IgG group. We also observed caspase-3 activation presenting in caspase-3 (cleaved) was greatly inhibited by Mincle agonist TDB, but was greatly promoted by neutralizing antibody (Fig. 3F). Additionally, neutrophils apoptosis was analyzed using flow cytometry. Obvious (p < 0.001) increase in the late apoptotic (Annexin V +/PI+) were overserved after A. fumigatus stimulated neutrophils compared to unstimulated group (Fig. 3G, J and N). Furthermore, compared with control stimulation, late apoptosis (Annexin V +/PI+) decreased after TDB treatment (p < 0.01) (Fig. 3J, K and N); while it increased after Mincle neutralizing antibody treatment compared with IgG treatment (Fig. 3L, M and O).
increased mRNA levels of Fas (Fig. 2A, p < 0.001), FasL (Fig. 2B, p < 0.001), and Caspase3 (Fig. 2C, p < 0.01) were found in Af + MincleAb group compared with control IgG group. Furthermore, fewer TUNEL-positive cells were found in the AF + TDB compared to AF (Fig. 2D). Contrary, a high number of TUNELpositive cells were found in AF + MincleAb compared to IgG group (Fig. 2F). These observations indicated that Mincle may inhibit the corneal apoptosis in A. fumigatus keratitis. 3.3. Effects of Mincle on mice neutrophils In order to investigate the expression of Mincle on mice neutrophils post- A. fumigatus infection, the mRNA levels of Mincle were tested by PCR. Compared with untreated Neutrophils, Mincle mRNA levels (Fig. 3A, p < 0.01, p < 0.01, p < 0.01, p < 0.01) were significantly increased at 4, 8, 12, 16 h post-stimulation. Furthermore, to investigate the effect of Mincle on cell apoptosis, neutrophils were pretreated with Mincle neutralizing antibody and agonist TDB or IgG and DMSO for 2 h, followed by stimulation of A. fumigatus for additional 8 h. Briefly, our data indicated that the mRNA levels of Mincle (Fig. 3B, p < 0.001, p < 0.03) were significantly increased in AF + TDB group compared to untreated group (before or after infection); while they were significantly decreased (Fig. 3B, p < 0.01) in AF + MincleAb mice compared to IgG treatment group. In addition, the 105
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
Fig. 3. The effects of Mincle on neutrophils apoptosis post-infection with A. fumigatus (A) mRNA expression of Mincle were significantly increased during 4, 8, 12, 16 h post-stimulation compared to uninfected group (N). (B–F) Effect of Mincle on cell apoptosis, neutrophils were pretreated with Mincle neutralizing antibody and agonist TDB or IgG and DMSO for 2 h, followed by stimulation of A. fumigatus for additional 8 h. The mRNA expression of Mincle (B), Fas (C), FasL (D), Caspase3 (E) and Cleaved Caspase3 (F) in different mice groups. (G–O) Inflammatory neutrophils were co-cultured with A. fumigatus, and 8 h later were labeled with Annexin V and PI and consequently analyzed by FACS. (G) Representative pseudocolor plots of Annexin V+/PI+ neutrophils (Normal); Representative pseudocolor plots of Annexin V+/PI+ neutrophils by TDB (H) or DMSO (I) treated; Representative pseudocolor plots of Annexin V+/PI+ neutrophils (AF) (J) by A. fumigatus stimulation for 8 h; Representative pseudocolor plots of Annexin V+/PI+ neutrophils pretreated with Mincle agonist TDB (AF + TDB) (K) for 2 h and followed by A. fumigatus stimulation for 8 h; Percentage(N) of Annexin V+/PI− neutrophils alone (PMN), neutrophils treated with TDB or DMSO for 2 h, neutrophils stimulated with A. fumigatus or neutrophils pretreated with Mincle agonist TDB (AF + TDB) and stimulated with A. fumigatus for 8 h, data shown (mean ± SEM) are pooled from three independent repeats. Representative pseudocolor plots of Annexin V+/PI+ neutrophils pretreated with IgG(AF + IgG) (L) or Mincle neutralizing antibody (AF + MincleAb) (M) for 2 h and followed by A. fumigatus stimulation for 8 h, Percentage (O) of Annexin V+/PI − neutrophils pretreated with IgG(AF + IgG) or Mincle neutralizing antibody (AF + MincleAb) and stimulated with A. fumigatus, data shown (mean ± SEM) are pooled from three independent repeats.
group (without infection), as well as in AF group compared with normal mice. Alos, mRNA levels of Fas (Fig. 4C, p < 0.05), FasL (Fig. 4D, p < 0.001), and Caspase3 (Fig. 4E, p < 0.01) were significantly decreased in AF + TDB group compared to untreated group; while it significantly increased mRNA levels of Fas (Fig. 4C, p < 0.001), FasL (Fig. 4D, p < 0.01), and Caspase3 (Fig. 4E, p < 0.01) in AF + MincleAb mice compared to IgG treatment group. Additionally, macrophages apoptosis was analyzed using flow cytometry. Obvious (p < 0.001) increased in the late apoptotic (Annexin V +/PI+) were overserved after A. fumigatus stimulated macrophages compared to unstimulated group (Fig. 4F, I and M). Furthermore, compared with control stimulation, late apoptotic (Annexin V +/PI+) decreased with TDB treatment (p < 0.001) (Fig. 4I, J and M), while it significantly increased after Mincle neutralizing antibody treatment compared with IgG treatment (p < 0.01) (Fig. 4K, L and N). We also observed caspase-3 activation presenting in caspase-3 (cleaved) was greatly inhibited by Mincle agonist TDB, but was greatly promoted by neutralizing antibody (Fig. 4O).
3.4. Effects of Mincle on macrophages of C57BL/6 Mice To investigate the expression of Mincle on mice macrophages postA. fumigatus infection, the mRNA levels of Mincle were tested by PCR. The mRNA levels of Mincle were tested by PCR. Compared with untreated Macrophages, Mincle mRNA levels (Fig. 4A, p < 0.05, p < 0.01, p < 0.01, p < 0.01) were significantly increased at 4, 8, 12, 16 h post-stimulation. Furthermore, to investigate the effect of Mincle on macrophages apoptosis, cells were pretreated with Mincle neutralizing antibody and agonist TDB or IgG and DMSO, followed by stimulation of A. fumigatus. Data indicated that the mRNA levels of Mincle (Fig. 4B, p < 0.01, p < 0.01) was significantly increased in the AF + TDB group compared to untreated group (before or after infection); while it was significantly decreased (Fig. 4B, p < 0.05) after Mincle neutralizing antibody treatment compared with IgG treatment. In addition, the mRNA levels of Fas (Fig. 4C, p < 0.05, p < 0.001), FasL (Fig. 4D, ns, p < 0.01), and Caspase3 (Fig. 4E, ns, p < 0.01) were significantly increased after TDB treatment compared to DMSO 106
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
Fig. 4. The effects of Mincle on macrophages apoptosis in cultured macrophages infected by A. fumigatus. (A) Higher mRNA expression of Mincle was observed in infected group compared to uninfected macrophages (N). (B–E) Mincle neutralizing antibody and TDB compared with IgG or DMSO. The mRNA expression of Mincle (B), Fas (C), FasL (D), and Caspase3 (E) were significantly different. (F–L) Macrophages were co-cultured with A. fumigatus. After 8 h, macrophages were labeled with Annexin V and PI and analyzed by FACS. Representative pseudocolor plots of Annexin V+/PI+ Macrophages (Normal) (F); Representative pseudocolor plots of Annexin V+/PI+ Macrophages by TDB (G) or DMSO (H) treated; Representative pseudocolor plots of Annexin V+/PI+ Macrophages (AF) (I) by A. fumigatus stimulation for 8 h; Representative pseudocolor plots of Annexin V +/PI+ Macrophages pretreated with Mincle agonist TDB (AF + TDB) (J) for 2 h and followed by A. fumigatus stimulation for 8 h; Percentage (M) of Annexin V +/PI− neutrophils alone (PMN), Macrophages treated with TDB or DMSO, neutrophils stimulated with A. fumigatus or Macrophages pretreated with Mincle agonist TDB (AF + TDB) and stimulated with A. fumigatus, data shown (mean ± SEM) are pooled from three independent repeats. Representative pseudocolor plots of Annexin V+/PI+ Macrophages pretreated with IgG(AF + IgG) (K) or Mincle neutralizing antibody (AF + MincleAb) (L) for 2 h and followed by A. fumigatus stimulation for 8 h, Percentage (N) of Annexin V +/PI− Macrophages pretreated with IgG(AF + IgG) or Mincle neutralizing antibody (AF + MincleAb) and stimulated with A. fumigatus, data shown (mean ± SEM) are pooled from three independent repeats.
4. Discussion
inflammatory effects. Understanding how and when neutrophils die is crucial. Results presented in this study revealed that Mincle expression was higher in infected cornea compared to control (uninfected group). Furthermore, TDB treatment decreased apoptotic gene levels, caspase-3 activation, neutrophils infiltration, TUNEL-positive cells and neutrophils and macrophages apoptosis compared with control, which were all increased in Mincle neutralizing antibody treatment compared with IgG control. These results indicated that Mincle promoted neutrophil infiltration in C57BL/6 mice's cornea infected with A. fumigatus. Furthermore, Mincle participated in the inflammatory infection, and the number of neutrophils and apoptotic cells increased in C57BL/6 mice's cornea infected with A. fumigatus. FK, an infectious corneal ulcer disease leading to serious corneal inflammation, is common in many developing countries [22–24]. Unless detected early which allows for effective treatment, the inflammatory response following infection results in a significant injury of the cornea, e.g. stromal destruction and potential loss of vision. Therapeutic interventions are required to accelerate fungal clearance while reducing tissue damage. Sustained and deep infiltration of
Neutrophils and macrophages are the first immune cells recruited to the site of injury or infection. They ingest and destroy microbes through the action of oxidants, proteases, and antimicrobial proteins. These toxic weapons do not discriminate self from non-self, thus causing bystander injury in the course of various pathologic conditions. While these degradative enzymes contribute to beneficial antimicrobial response inside phagosomes, they can also cause tissue damage if released extracellularly [19]. In order to avoid damage to the host, the inflammatory activity of neutrophils is tightly regulated in vivo. Apoptosis is the predominant cell death pathway in the neutrophils, and represents one of the most important mechanisms responsible for cells functional shutdown and the resolution of inflammation [20]. Neutrophil apoptosis can be modulated by a variety of biological agents including cytokines, chemokines, lipid mediators, pathogen-associated molecular patterns (PAMPs), and danger-associated molecular patterns (DAMPs) [20,21]. It is of crucial importance that neutrophils are cleared from the site of inflammation after exerting their pro107
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
signaling of spleen tyrosine kinase (Syk) [34,35], and induces NF-κB activation [36]. The activation of NF-κB causes modulation of expression of many genes, such as caspase-3 and bcl-2, which was confirmed in this study. Our present work demonstrated that Mincle can inhibit promote inflammation, and inhibit neutrophils and macrophages apoptosis, thus suggesting it might recruit innate immune cells to the site of infection and eliminate the pathogens. In conclusion, Mincle participates in the innate immune system against fungal infection in mice. Moreover, Mincle can reduce leukocytes' apoptosis in C57BL/6 mouse cornea following infection. During the process of inflammation, infected or injured tissue recruits leukocytes. Nevertheless, their fine-tuned regulation at the inflammatory point is necessary because of the potential tissue-damaging effects of PMN. This means that inflammation can effectively resolve spontaneously or in a pharmacological-induced way by controlling leukocyte infiltration in the tissue [37]. Inflammation resolution is mainly mediated by the innate immune system. The effect of inflammation resolution is usually reflected in the increase of anti-inflammatory actions and a paradigm shift from immune cell function to restore homeostasis [38]. The present study provided detailed investigation of the function and mechanism of Mincle induced leukocytes apoptosis and signaling, which can in turn inspire new approaches toward adjusting the immune system. However, leukocytes apoptosis in A. fumigatus keratitis can also be regulated by Mincle, as this is one of the Mincle's functions. Further studies of Mincle could provide better understanding of Mincle modulation in A. fumigatus keratitis, thus advancing the infectious diseases studies. Besides, further investigations and understanding, would provide new therapeutic options for A. fumigatus keratitis.
inflammatory cells following fungus infection may lead to the tissue damage. Leukocytes, neutrophils and macrophages, are vital for prevention of fungus infection since they have the ability to release inflammatory mediators and to remove the inflammatory agent/stimuli by acting as cell effector and phagocytes, thus elucidating the pathogenesis [25]. Neutrophils are abundant, short-lived leukocytes that play a key role in immune defense against microbial infections. Neutrophils cell death is regulated by apoptosis, which regulates the neutrophil cell numbers and guaranties the safe disposal of engulfed bacteria. Therefore, apoptosis is essential for the removal of neutrophils from inflamed tissues and for the timely resolution of neutrophilic inflammation. Mincle is a kind of C-type lectin expressed on myeloid cells, neutrophils and professional antigen presenting cells such as macrophages, dendritic cells and B cells [5]. Some recent related studies found that Mincle was associated with immune responses caused by fungus; the recruitment of Fc receptor g can be activated and the signaling of spleen tyrosine kinase (Syk) can be induced by 1TDM-bound Mincle, thus causing strong activation of NFkB [14–16]. After Mincle gets bound by pathogen—associated molecular patterns (PAMPs), ROS is triggered leading to cell apoptosis by oxidative stress reaction, thus having an important role in inflammatory pathways, such as NF-κB. However, Wevers et al. [26] have found that human Mincle can suppress antifungal defense by activating E3 ubiquitin-protein ligase Mdm2 which then suppress IL12A transcription and finally degrade interferon regulatory factor. According to our study, significantly higher Mincle expression was observed in C57BL/6 mice' infected cornea compared to uninfected (control) group. These data, that were consistent with our previous study [27], suggested that Mincle plays an important role in the inflammatory infection. As an important physiological response, inflammation is essential for maintaining tissue homeostasis and preventing the host from intruding microorganisms, foreign substances, or host self-disturbers. Important microcirculatory events will appear in response to local release of pro-inflammatory mediators after the host was incited, which can increase vascular permeability and leukocyte recruitment [28]. Additionally, Mincle participates in the activation process of inhibiting late-stage NLRP3-inflammasome, and in reducing excessive inflammation [29]. The signaling of TDM-induced Mincle can improve the p38- and eIF5A-dependent translational regulation of certain genes, such as iNOS, which in turn can relieve the inflammation through inhibition of IL-1b production [30]. Mincle is vital for the transition from inflammation to NO-mediated cytotoxicity and necroptosis, which is the key to eradicate mycobacteria [18]. This suggests that Mincle might be crucial for the immune response balance. Neutrophil apoptosis is usually initiated by one of two signaling cascades: the intrinsic or extrinsic apoptotic pathway. The intrinsic pathway relies on the loss of mitochondrial membrane integrity caused by the imbalance of pro- and anti-apoptotic factors in the cell, and subsequent release of cytochrome c from the mitochondria. Cytochrome c facilitates caspase-9-dependent assembly of the Apaf-1-containing apoptosome and eventual activation of executioner caspase-3. On the other hand, the extrinsic pathway responds to extracellular signaling through death receptors to drive caspase-8-dependent activation of caspase-3. Fas-L, TNF-α, and TRAIL are all examples of soluble proteins that mediate extrinsic apoptosis through engagement of their cognate receptors expressed on the surface of neutrophils [31,32]. The two pathways converge at caspase-3 activation [33], thus caspase-3 is considered as a key enzyme in the pathogenesis of cell apoptosis. When the full length pro-caspase-3 (32kD) is activated, it is cleaved to form two mature subunits, p17 (17kD) and p12 (12kD). The level of the cleaved caspase-3 represents the level of the activated caspase-3. Our study showed that Mincle neutralizing antibody pre-treatment increased Fas, FasL, and caspase-3 expression, caspase-3 activation. These findings imply that Mincle restrains apoptosis by preventing the activation of caspase-3. Numerous studies have shown that Mincle mediates ROS production through activation of NADPH oxidase, which in turn leads to the
References [1] E. Nielsen, S. Heegaard, J.U. Prause, A. Ivarsen, K.L. Mortensen, J. Hjortdal, Fungal keratitis – improving diagnostics by confocal microscopy, Case Rep. Ophthalmol. 4 (3) (2013) 303–310. [2] L. Xie, X. Dong, W. Shi, Treatment of fungal keratitis by penetrating keratoplasty, Br. J. Ophthalmol. 85 (9) (2001) 1070–1074. [3] L. Xie, W. Zhong, W. Shi, S. Sun, Spectrum of fungal keratitis in north China, Ophthalmology 113 (11) (2006) 1943–1948. [4] C. Nathan, Neutrophils and immunity: challenges and opportunities, Nat. Rev. Immunol. 6 (2006) 173–182. [5] W.M. Nauseef, N. Borregaard, Neutrophils at work, Nat. Immunol. 15 (2014) 602–611. [6] R. Duffin, A.E. Leitch, S. Fox, C. Haslett, A.G. Rossi, Targeting granulocyte apoptosis: mechanisms, models, and therapies, Immunol. Rev. 236 (2010) 28–40. [7] S. Michlewska, A. McColl, A.G. Rossi, I.L. Megson, I. Dransfield, Clearance of dying cells and autoimmunity, Autoimmunity 40 (2007) 267–273. [8] I.K. Poon, C.D. Lucas, A.G. Rossi, K.S. Ravichandran, Apoptotic cell clearance: basic biology and therapeutic potential, Nat. Rev. Immunol. 14 (2014) 166–180. [9] M. Matsumoto, T. Tanaka, T. Kaisho, H. Sanjo, N.G. Copeland, D.J. Gilbert, et al., A novel LPSinducible C-type lectin is a transcriptional target of NF-IL6 in macrophages, J. Immunol. 163 (1999) 5039–5048. [10] A.N. Zelensky, J.E. Gready, The C-type lectin-like domain superfamily, FEBS J. 272 (2005) 6179–6217. [11] A. Bugarcic, K. Hitchens, A.G. Beckhouse, C.A. Wells, R.B. Ashman, H. Blanchard, Human and mouse macrophage-inducible C-type lectin (Mincle) bind Candida albicans, Glycobiology 18 (2008) 679–685. [12] C.A. Wells, J.A. Salvage-Jones, X. Li, K. Hitchens, S. Butcher, R.Z. Murray, et al., The macrophage inducible C-type lectin, mincle, is an essential component of the innate immune response to Candida albicans, J. Immunol. 180 (2008) 7404–7413. [13] S. Yamasaki, M. Matsumoto, O. Takeuchi, T. Matsuzawa, E. Ishikawa, M. Sakuma, et al., C-type lectin Mincle is an activating receptor for pathogenic fungus, Malassezia, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 1897–1902. [14] E. Ishikawa, et al., Direct recognition of the mycobacterial glycolipid, trehalose dimycolate, by C-type lectin Mincle, J. Exp. Med. 206 (2009) 2879–2888. [15] R. Lang, Recognition of the mycobacterial cord factor by Mincle: relevance for granuloma formation and resistance to tuberculosis, Front. Immunol. 24 (4) (2013) 5. [16] S. Yamasaki, et al., Mincle is an ITAM-coupled activating receptor that senses damaged cells, Nat. Immunol. 9 (2008) 1179–1188. [17] B.A. Wevers, et al., Fungal engagement of the C-type lectin mincle suppresses dectin-1-induced antifungal immunity, Cell Host Microbe 15 (2014) 494–505. [18] Wook-Bin Lee, et al., Mincle-mediated translational regulation is required for strong nitric oxide production and inflammation resolution, Nat. Commun. 7 (2016) 11322. [19] M.C. Greenlee-Wacker, Clearance of apoptotic neutrophils and resolution of
108
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
(2013) 664–673. [30] C. Desel, K. Werninghaus, M. Ritter, K. Jozefowski, J. Wenzel, N. Russkamp, U. Schleicher, D. Christensen, S. Wirtz, C. Kirschning, E.M. Agger, C. Prazeres da Costa, R. Lang, The Mincle-activating adjuvant TDB induces MyD88-dependent Th1 and Th17 responses through IL-1R signaling, PLoS One 8 (1) (2013) e53531. [31] M.L. Gabelloni, A.S. Trevani, J. Sabatte, J. Geffner, Mechanisms regulating neutrophil survival and cell death, Semin. Immunopathol. 35 (2013) 423–437. [32] B. Geering, H.U. Simon, Peculiarities of cell death mechanisms in neutrophils, Cell Death Differ. 18 (2011) 1457–1469. [33] T. Sugawara, M. Fujimura, N. Noshita, G.W. Kim, A. Saito, T. Hayashi, P. Narasimhan, C.M. Maier, P.H. Chan, Neuronal death/survival signaling pathways in cerebral ischemia, Neuro Rx. 1 (2004) 17–25. [34] M. Ushio-Fukai, R.W. Alexander, M. Akers, K.K. Griendling, p38 mitogenactivated protein kinase is a critical component of the redox-sensitive signaling pathways activated by angiotensin. II. Role in vascular smooth muscle cell hypertrophy, J. Biol. Chem. 273 (1998) 15022–15029. [35] Z. Wang, M.R. Castresana, W.H. Newman, Reactive oxygen species sensitive p38 MAPK controls thrombin-induced migration of vascular smooth muscle cells, J. Mol. Cell. Cardiol. 36 (2004) 49–56. [36] H.C. Ou, T.Y. Song, Y.C. Yeh, EGCG protects against oxidized LDL-induced endothelial dysfunction by inhibiting LOX-1-mediated signaling, J. Appl. Physiol. 108 (2010) 1745–1756. [37] C. Nathan, Neutrophils and immunity: challenges and opportunities, Nat. Rev. Immunol. 6 (3) (2006) 173–182. [38] Amanda Croasdell, et al., PPARγ and the innate immune system mediate the resolution of inflammation, PPAR Res. 2015 (2015) 549691.
inflammation, Immunol. Rev. 273 (1) (2016) 357–370. [20] V. Witko-Sarsat, M. Pederzoli-Ribeil, E. Hirsch, S. Sozzani, M.A. Cassatella, Regulating neutrophil apoptosis: new players enter the game, Trends Immunol. 32 (2011) 117–124. [21] R. Duffin, A.E. Leitch, S. Fox, C. Haslett, A.G. Rossi, Targeting granulocyte apoptosis: mechanisms, models, and therapies, Immunol. Rev. 236 (2010) 28–40. [22] T.S. Zaidi, T. Zaidi, G.B. Pier, G.P. Priebe, Topical neutralization of interleukin-17 during experimental Pseudomonas aeruginosa corneal infection promotes bacterial clearance and reduces pathology, Infect. Immun. 80 (2012) 3706–3712. [23] L. Xia, S. Zhang, Z. Cao, Y. Hu, H. Yang, D. Wang, Interleukin-17 enhanced immunoinflammatory lesions in a mouse model of recurrent herpetic keratitis, Microbes Infect. 15 (2013) 126–139. [24] H. Zhang, H. Li, Y. Li, et al., IL-17 plays a central role in initiating experimental Candida albicans infection in mouse corneas, Eur. J. Immunol. 43 (2013) 2671–2682. [25] M.T. Silva, M. Correia-Neves, Neutrophils and macrophages: the main partners of phagocyte cell systems, Front. Immunol. 4 (3) (2012) 174. [26] B.A. Wevers, et al., Fungal engagement of the C-type lectin mincle suppresses dectin-1-induced antifungal immunity, Cell Host Microbe 15 (2014) 494–505. [27] Ying Liu, Guiqiu Zhao, Jing Lin, Cui Li, Qing Li, Chengye Che, Qian Wang, Hu. Liting, The role of Syk signaling in antifungal innate immunity of human corneal epithelial cells, BMC Ophthalmol. 15 (2015) 55. [28] R. Medzhitov, Inflammation 2010: new adventures of an old flame, Cell 140 (2010) 771–776. [29] K. Schweneker, O. Gorka, M. Schweneker, H. Poeck, J. Tschopp, C. Peschel, J. Ruland, O. Gross, The mycobacterial cord factor adjuvant analogue trehalose6,6′-dibehenate (TDB) activates the Nlrp3 inflammasome, Immunobiology 218 (4)
109
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Mincle inhibits neutrophils and macrophages apoptosis in A. fumigatus keratitis
MARK
Jing Lina, Kun Hea,b, Guiqiu Zhaoa,⁎, Cui Lia, Liting Hua, Guoqiang Zhua, Yawen Niua, Guipei Haoa a b
The Affiliated Hospital of Qingdao University Medical College, PR China Ophthalmic Center of QuHua Hospital, QuHua 324004, PR China
A R T I C L E I N F O
A B S T R A C T
Keywords: Fungal keratitis Neutrophils Macrophages Apoptosis Mice
Purpose: To determine whether macrophage inducible C-type lectin (Mincle) regulates neutrophils and macrophages apoptosis in A. fumigatus keratitis. Materials and methods: A murine model (C57BL/6) of fungal keratitis (AF) was established by gently scraping corneal central epithelium, smearing A. fumigatus on the epithelium surface and covering the eye with contact lenses. AF cell model was established by extracting neutrophils (PMN) and macrophages, and then infecting cells with A. fumigatus. Animals and cells were randomly divided into control and A. fumigatus keratitis group, which were treated with Mincle ligand Trehalose-6,6-dibehenate (TDB), Mincle neutralizing antibody (MincleAb) or PBS before infection. The cornea infection was monitored using a slit lamp and further analyzed using H & E assay. PCR, Western blot, immunostaining, TUNEL staining and flow cytometry were used to examine the expression of Mincle and apoptosis factors, PMN infiltration and cell apoptosis, respectively. Results: Higher levels of Mincle mRNA and protein, as well as epithelial thickness and presence of inflammatory cells in the stroma, were observed in the AF group compared to control. In addition, higher Mincle mRNA levels were observed in normal and stimulated neutrophils and macrophages. Furthermore, Fas, FasL and CASP3 mRNA levels, neutrophils infiltration rate and TUNEL-positive cells were significantly increased in AF + MincleAb mice compared with the control. Similar results, as well as significantly higher neutrophils and macrophages apoptosis, were observed by treating cells with MincleAb in vitro. Most importantly, opposite results i.e. lower mRNA levels, neutrophils infiltration rate and TUNEL-positive cells, as well as lower cell apoptosis in vitro, were observed in mice and cells treated with TDB. Conclusion: Mincle-participated in inflammatory process which inhibits neutrophils and macrophages apoptosis induced by A. fumigatus involved in Fas-dependent apoptotic pathways.
1. Introduction Fungal keratitis is an inflammation caused by a variety of pathogenic fungi [1], among which A. fumigatus is considered the chief culprit [2,3]. Eye trauma, long-term addiction to antibiotic or corticosteroid, as well as wide use of contact lens, have shown to significantly increase the incidence rate of FK [3]. Being a serious infectious corneal disease, FK can cause severe corneal inflammation and induce blindness at higher rate compared to other corneal diseases. Without in-time detection and efficient treatment, the inflammation can damage the eye cornea quite seriously, including the destruction of stroma and already mentioned blindness. Neutrophils, the most abundant circulating leukocytes in the human body, represent the first line of immune cell defense against bacterial and fungal infections. Neutrophils are also a key component of the
⁎
Corresponding author. E-mail address: [email protected] (G. Zhao).
http://dx.doi.org/10.1016/j.intimp.2017.08.006 Received 4 January 2017; Received in revised form 30 June 2017; Accepted 9 August 2017 1567-5769/ © 2017 Published by Elsevier B.V.
inflammatory response [4,5]. Activated neutrophils leave the bloodstream and migrate to sites of infection or sterile insult. Neutrophils are also terminally differentiated, short-lived cells that are programmed to undergo apoptosis. During an inflammatory response neutrophils have an extended lifespan. According to existing research, the rapid progress of fungal keratitis and delayed healing, have shown to be linked with corneal infection in the development process of pathogenic fungi recognized by the cornea recognition receptor. Immune and inflammatory response are essential for removal of fungi, nevertheless inflammatory cells can also lead to corneal tissue damage. The final outcome of fungal keratitis (corneal perforation, loss of eye or healing) is strongly associated with the body's ability to cure the infection. The process of fungal keratitis infection is strongly associated with neutrophils and mononuclear macrophages infiltration. Neutrophils, also called PMN, are essential components of the inflammatory response and
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
surface anesthesia. The conjunctival sac was then cleaned using 0.1% entoiodine, and the central epithelium of cornea was gently scraped (3–4 mm in diameter), and then went on to scratch into stromal layer under microscope. The damaged region was then smeared with 5 μl aliquot containing 1 × 108 CFU/ml of A. fumigatus (strain 3.0772, General Microbiological Culture Collection Center, Beijing, China), prepared according the previously described method [12]. Fungus aliquot was topically applied to the corneal surface (3–4 mm in diameter), and then covered with contact lenses to prevent further loss/leaking of fungi. Consequently, all mice were examined on day 1 and 3 post-infection (p.i.) to ensure the successful cornea infection. Eye corneas were monitored daily by slit lamp examination (SLE) using digital camera.
are rapidly recruited into the corneal stroma to produce a variety of cytokines. PMNs eliminate fungal infection through phagocytosis, lysosomal degranulation and sterilization, which produce oxidative metabolism product and trigger a respiratory outbreak reaction. Since neutrophilic inflammation is tightly regulated, it limits the tissue damage and promotes repair. When neutrophilic inflammation gets dysregulated, these cells contribute to tissue damage resulting in disease. It is very important that neutrophils get cleared from the site of inflammation after exerting their pro-inflammatory effects. Cell apoptosis is a key control mechanism regulating the neutrophil cell numbers which guarantee the safe disposal of engulfed bacteria. Apoptosis is regarded as a non-inflammatory, immune-quiescent process in which the cells become functionally down-regulated, while toxic intracellular contents get initially contained within the plasma membrane and then taken up by surrounding phagocytes (especially macrophages) [6]. Uptake of apoptotic cells causes macrophages to change phenotype and to release anti-inflammatory and pro-resolution mediators rather than pro-inflammatory mediators. This promotes inflammation resolution and triggers tissue repair mechanisms, which in turn prevent the release of pro-inflammatory cell debris as a consequence of secondary necrosis, limiting host damage (Michlewska et al., Poon et al.) [7,8]. Macrophage-inducible C-type lectin (Mincle) is also called Clec4e and Clecsf9 which is a novel 219aa type II transmembrane protein with a highly kept C-type lectin domain [9,10]. Mincle is expressed on myeloid cells and neutrophils, and it especially concentrates on professional antigen presenting cells, such as macrophages, dendritic cells and B cells [9]. Some recent studies have shown that Mincle acts as a promoter in the response of macrophages to fungal infections [11–13]. Previous research has found that trehalose-6,6-dimycolate (TDM)bound Mincle has the function of initiating recruitment of Fc receptor g, and inducing the signaling of spleen tyrosine kinase, which leads to activation of Nuclear factor-κB (NF-κB) [14–16]. Finally, activated receptor signaling pathways and NF-κB converge with each other so as to further improve pro-inflammatory responses. In addition, Wevers et al. [17] have found that human Mincle can suppress antifungal defense. Above reported findings show that, having the functions of inflammation stimulation and resolution, Mincle is very relevant for balancing immune responses among different signaling pathways [14–18]. Nevertheless, the Mincle regulating mechanism with reference to the death of inflammatory cells still remains unclear. Therefore, we wanted to investigate whether Mincle could regulate neutrophils and macrophages apoptosis in A. fumigatus keratitis.
2.3. Neutrophils and macrophages extraction Peritoneal neutrophils (PMN) were harvested according to following method: mice were intraperitoneal injected with 1 ml sterile 9% casein (Sigma, China). After 24 h, the same injection procedure was repeated. 3 h later, mice were anesthetized using 8% chloral hydrate, and then 10 ml Dulbecco's modified Eagle's medium (DMEM; Gibco, San Diego, CA, USA) with 5% fetal bovine serum (FBS; Gibco) were injected into the abdominal cavity. Abdominal liquids were extracted by peritoneal lavage using syringe, and then centrifuged at 300g for 10 min at 4 °C. Finally, neutrophils were collected, purified using percoll, and stored for further analysis. For macrophages extraction, mice were first administrated by i.p. injection of 1 ml 3% Thioglycollate medium (Hope Bio-Technology Co., Ltd. Qingdao, China). 7 days post-injection mice were sacrificed by cervical dislocation. Abdominal skin of sacrificial mice was wiped by 75% alcohol and opened along the middle line. 5 ml DMEM was then injected into mice abdominal cavity and the macrophages were extracted by peritoneal lavage. 2.4. Cells culture and cell stimulation Neutrophils and macrophages were extracted from susceptible C57BL/6 mice. Cells were seeded in a DMEM medium supplemented with 5% FBS. Cells suspensions (1 × 106/ml) were seeded in 12-well culture plates, and then cultured in a humidified incubator containing 5% CO2/95% air at 37 °C. Cells were stimulated using 1 × 108/ml A. fumigatus (60 μl/ml), and then counted and analyzed on 0, 4, 8, 12, 16 h post-fungi injection.
2. Materials and methods 2.5. Mincle neutralization
2.1. Animals
Goat anti-mouse Mincle neutralizing antibody (5 μg/5 μl) or control goat IgG (5 μg/5 μl) was administrated to the mice' left eye by subconjunctival injection a day before infection. Consequently, corneas were infected with A. fumigatus 1 day post-injection. Neutrophils and macrophages were pretreated with Mincle neutralizing antibody (10 μg/ml) or IgG (10 μg/ml) for 2 h. Macrophages were incubated with A. fumigatus for 12 h, while the neutrophils were incubated with 1 × 108/ml A. fumigatus (60 μl/ml) for 8 h.
Female C57BL/6 mice, 8–10 weeks old, were purchased from the Chang Zhou Cavens Laboratory Animal Ltd. (Anhui, China). All animal studies (including the mice euthanasia procedure) were done in compliance with the regulations and guidelines of Qingdao University Institutional Animal Care and conducted according to the AAALAC and the IACUC guidelines. In addition, all experiments conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. 2.2. Corneal infection
2.6. Mincle agitation
C57BL/6 mice were randomly divided into 2 groups: 6 for control group (normal corneas were collected without any scrape or other treatment) and 12 for A. fumigatus keratitis group. Each cornea was examined under a slit lamp microscope before each experiment. For each mouse, the right cornea was used for model establishing (treatment group), while the left one was used as control (untreated group). Mice were anesthetized by intraperitoneal injection of 10% chloral hydrate 3 ml/kg, and 0.4% oxybuprocaine hydrochloride eyedrops for
Mincle agonist TDB (2 μg/5 μl) or control 0.5% DMSO was administrated to the mice' left eye by subconjunctival injection the day before infection. Consequently, corneas were infected with A. fumigatus 1 day post-injection. Neutrophils and macrophages were pretreated with L Mincle agonist TDB (4 μg/ml) for 2 h. Macrophages were then incubated with A. fumigatus for 12 h, while the neutrophils were incubated with 1 × 108/ ml A. fumigatus (60 μl/ml) for 8 h. 102
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
nick end labeling (TUNEL) reagents according to the manufacturer instructions (Roche, Penzberg, Germany), and counterstained with DAPI. TUNEL-positive cells were detected and quantified by fluorescence microscopy (Leica, Germany).
2.7. Hematoxylin-Eosin staining Eyes were enucleated on the 3rd day p.i., cleaned using 0.01 M PBS, embedded in OCT (Tissue-Tek; Miles, Elkhart, IN), and then snap frozen in liquid nitrogen. 10 μm sections were then cut using Frozen Slicer (Leica, Germany). Briefly, sections were prepared orderly by fixing, staining and dehydration. The morphology of corneal cells was observed under the microscope (Leica, Germany).
2.11. Western blot Neutrophils or macrophages were washed with ice-cold PBS. Cells were lysed by adding 100 μl RIPA buffer (1% Triton X-100, 1% deoxycholate, 0.1% SDS, 150 mM NaCl, 50 mM TriseHCl pH 7.4, 10 mM EDTA pH 8.0 dissolved in PBS) and briefly sonicated for 2 h on ice. The cell centrifuged for 3 times at 14000 rpm for 15 min at 4 °C. Total protein was detected via bicinchoninic acid assay, and denatured with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample loading buffer at 95 °C for 5 min. Proteins (60 μg/well) were separated by 12% SDS-PAGE in Tris/glycine/SDS buffer and electroblotted onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). After blocking in PBS-T (0.05%) and 5% milk for 1 h at room temperature, the blots were incubated with a rabbit monoclonal antibody (1:1000) against mouse cleaved caspase-3 (Cell Signaling Technology, Beverly, MA) at 4 °C overnight. The blots were washed 5 min in PBS-T and then incubated with a 1:5000 dilution of horseradish peroxidase-conjugated secondary antibody (Boster, China) for 1 h at 37 °C. Blots of cells lysates were measured with BeyoECL Plus (Beyotime, Shanghai, China). Band intensity was assessed using Quantity One Software (Bio-Rad, CA, USA).
2.8. RNA isolation and real time RT-PCR assay Normal and infected corneas were collected at 0, 0.5, 1, 3 and 5 day p.i., while neutrophils and macrophages were collected at 0, 4, 8, 12, 16 h post-infection. Corneas administrated with Mincle neutralizing antibody or IgG, were collected 1 day p.i., while neutrophils or macrophages were collected after 8 h or 12 h post-stimulation. RNA was separated from suspension by RNAiso plus reagent (TaKaRa, Dalian, Liaoning Province, China), and then quantified using spectrophotometry. RNA (1 μg) was used for first-strand cDNA synthesis according to the reverse transcription system (TaKaRa, Dalian, Liaoning Province, China). Complementary DNA was generated by reverse transcription of 2 μg of total RNA and then used in the following quantitative polymerase chain reaction reactions with SYBR Green using specific primers: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and a final stage of 95 °C for 15 s, 60 °C for 30 s, and 95 °C for 15 s. The oligonucleotide primers of β-actin, Fas, FasL, and CASP3 are shown in Table 1. Reverse transcription followed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using the housekeeping gene β-actin as an internal control and quantified using the 2 −ΔΔCt method. Each experiment was run in triplicate.
2.12. Apoptosis detection using flow cytometry assay Cells were washed with cold PBS and resuspended in 300 μl of Annexin V Binding Buffer (BD). Consequently, 5 μl of Annexin V-FITC (BD Biosciences) and 5 μl of PI Solution (BD Biosciences) were added to the cell suspension which was incubated in a dark for 15 min at room temperature. Data were acquired within 1 h, using FACSAria or FACScan (BD Biosciences) and analyzed with FlowJo (Tree Star. Inc.).
2.9. PMN immunostaining Slides were fixed for 10 min in acetone, washed with 0.01 M PBS and blocked using blocking solution (0.01 M PBS, 2.5% BSA and Donkey IgG (1:100)) for 30 min at room temperature. Following steps were incubated with a primary rabbit anti-PMN antibody NIMP-R14 (1:100) at 4 °C overnight. Subsequently, the sections were incubated with the corresponding secondary antibody, Donkey anti-rabbit antibody-FITC (1:150) for 1 h at 37 °C. Sections were then incubated with DAPI for additional 10 min. The control groups were analyzed using the same above protocol, except the primary antibodies which was replaced with the host IgG. Finally, sections were visualized by fluorescence microscopy (Leica, Germany).
2.13. Statistical analysis The results were indicated as mean ± standard deviation. One-way analysis of variance followed by Student-Newman-Keuls test was analyzed by GraphPad 5.0 software. The Kruskal-Wallis test was used to compare apoptotic index scores. p < 0.05 was considered significantly different. 3. Results
2.10. TUNEL assay
3.1. Mincle expression and neutrophil infiltration in mice cornea
Normal uninfected and infected C57BL/6 mouse eyes (n = 3/ group/time) were enucleated the 3rd day p.i. The corneal sections were incubated with terminal deoxynucleotidyltransferase–mediated dUTP
Images taken by a slit lamp on day 3 p.i. (Fig. 1A) confirmed the presence of disease in mice corneas infected with A. fumigatus (AF) compared to uninfected (normal) group. Significant corneal edema and
Table 1 Nucleotide sequences of mouse primers for real-time RT-PCR. Gene
GenBank no.
Primer sequence (5′–3′)
Size (bp)
β-Actin
NM_007393.3
147
Fas
NM_007987.2
FasL
NM_010177
Caspase-3
NM_009810.2
Mincle
XM_017321688
F - GAT TAC TGC TCT GGC TCC TAG C R - GAC TCA TCG TAC TCC TGC TTG C F - ACCCTGAATCTAGAACCTCCAGTC R - CCTGGATTGTCATGTCTTCAGC F - GAACTGGCAGAACTCCGTGA R - TAAATGGGCCACACTCCTCG F - TGGGCCTGAAATACCAAGTC R - AAATGACCCCTTCATCACCA F - ACTGACAGACCAGGTGGTGGAG R - TCACAAATCCAAGGCATACTGTAGA
103
105 120 147 198
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
Fig. 1. Mincle expression and neutrophil infiltration in mice corneas infected with A. fumigatus. (A) Images taken by a slit lamp on day 3 p.i. confirmed the presence of the disease in mice corneas infected with A. fumigatus (AF) compared to uninfected (Normal) mice. (B) H & E staining images (100×; 200 ×) of mice corneas in Normal and AF group. (C–F) Immunofluorescence images (× 400) showing expression of Mincle (C, D) and PMN (E, F) in the corneas of Normal, DMSO, AF, TDB, AF + TDB, AF + IgG and AF + MincleAb on day 3 p.i.; Blue: nuclear staining (DAPI); red: Mincle staining; green: PMN (NIMP-R14) staining. Magnification: 40 ×. (G) Relative mRNA levels of Mincle in mice corneas infected with A. fumigatus were significantly increased on 0.5, 1 day p.i. (H) Relative mRNA levels of Mincle in cornea of different mice groups 1 day p.i. treated with neutralizing antibody or TDB. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
+ TDB group compared with PBS control before or after infection; however, they were significantly reduced after Mincle neutralizing antibody treatment compared with IgG treatment (Fig. 1D and E).
an irregular whitish mass even ulceration were observed on day 3 postfungal infection. Furthermore, epithelial thickness (Fig. 1B) and presence of inflammatory cells in the stroma, were observed in AF group compared to the control (Fig. 1B). In addition, in order to explore the expression of Mincle in the corneas p.i., mRNA and protein levels were examined in uninfected and infected mice by real-time RT-PCR and immunostaining approach. Briefly, our results indicated that the Mincle mRNA levels were significantly higher in infected mice compared to control at 0.5 and 1 day p.i. (Fig. 1G, p < 0.01, p < 0.05); while the Mincle protein was examined by immunostaining at 3 days p.i. (Fig. 1C). Additionally, increased number of neutrophils was found after fungal infection. Moreover, in order to investigate whether Mincle can participate in the corneal infection, mice corneas were pretreated with Mincle neutralizing antibody or IgG and Mincle agonist TDB or PBS before infection. Our data showed that the mRNA levels of Mincle (Fig. 1H, p < 0.01, p < 0.01) were significantly increased in the AF + TDB group compared to PBS control, before or after infection; nevertheless mRNA levels were significantly decreased (Fig. 1H, p < 0.01) after Mincle neutralizing antibody treatment compared to IgG treatment. Moreover, as shown in Fig. 1, protein levels of Mincle and neutrophil infiltration were significantly increased (Fig. 1C and F) in the AF
3.2. Effect of Mincle on cell apoptosis in A. fumigatus-induced corneal inflammation mice model To investigate whether Mincle can induce the cell apoptosis, mice corneas of different groups were pretreated with Mincle neutralizing antibody (AF + MincleAb) and agonist TDB (AF + TDB) or IgG and DMSO before infection, and then infected with A. fumigatus. The mRNA levels of Fas, FasL, and CASP3 were examined by PCR, while the corneal cell apoptosis were verified by TUNEL (terminal deoxinucleotidyl transferase-mediated dUTP-fluorescein nick end labeling) staining. Briefly, the data indicated that the mRNA levels of Fas (Fig. 2A, p < 0.05, p < 0.01), FasL (Fig. 2B, p < 0.01, p < 0.001), and Caspase3 (Fig. 2C, p < 0.01, p < 0.001) were significantly increased in the AF + TDB mice compared to DMSO group (without infection), as well as in AF group compared with normal mice. Furthermore, significant decreased mRNA levels of Fas (Fig. 2A, p < 0.001), FasL (Fig. 2B, p < 0.02), and Caspase3 (Fig. 2C, p < 0.05), were observed in AF + TDB group compared with FA group; while significant 104
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
Fig. 2. Effects of Mincle on cell apoptosis in A. fumigatus-induced corneal inflammation mice model. Relative mRNA levels of Fas (A), FasL (B), and Caspase3 (C) in corneas of different mice groups 1 day p.i. treated with neutralizing antibody or TDB. (D, E) TUNEL images showing cell death in cornea of Normal, DMSO, AF, TDB, AF + TDB, AF + IgG and AF + MincleAb mice on days 3 p.i.; Blue: nuclear staining (DAPI); green: TUNEL staining. Magnification: 40×. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
mRNA levels of Fas (Fig. 3C, p < 0.01, p < 0.001), FasL (Fig. 3D, p < 0.001, p < 0.001), and Caspase3 (Fig. 3F, ns, p < 0.001) were significantly increased after TDB treatment compared to DMSO group (without infection), as well as in AF group compared with normal mice. Furthermore, significantly decreased mRNA levels of Fas (Fig. 3C, p < 0.05), FasL (Fig. 3D, p < 0.001), and Caspase3 (Fig. 3F, p < 0.01), were observed in the AF + TDB compared to AF group; while significantly increased mRNA levels of Fas (Fig. 3C, p < 0.01), FasL (Fig. 3D, p < 0.05), and Caspase3 (Fig. 3F, p < 0.001) were observed in the AF + MincleAb compared to control IgG group. We also observed caspase-3 activation presenting in caspase-3 (cleaved) was greatly inhibited by Mincle agonist TDB, but was greatly promoted by neutralizing antibody (Fig. 3F). Additionally, neutrophils apoptosis was analyzed using flow cytometry. Obvious (p < 0.001) increase in the late apoptotic (Annexin V +/PI+) were overserved after A. fumigatus stimulated neutrophils compared to unstimulated group (Fig. 3G, J and N). Furthermore, compared with control stimulation, late apoptosis (Annexin V +/PI+) decreased after TDB treatment (p < 0.01) (Fig. 3J, K and N); while it increased after Mincle neutralizing antibody treatment compared with IgG treatment (Fig. 3L, M and O).
increased mRNA levels of Fas (Fig. 2A, p < 0.001), FasL (Fig. 2B, p < 0.001), and Caspase3 (Fig. 2C, p < 0.01) were found in Af + MincleAb group compared with control IgG group. Furthermore, fewer TUNEL-positive cells were found in the AF + TDB compared to AF (Fig. 2D). Contrary, a high number of TUNELpositive cells were found in AF + MincleAb compared to IgG group (Fig. 2F). These observations indicated that Mincle may inhibit the corneal apoptosis in A. fumigatus keratitis. 3.3. Effects of Mincle on mice neutrophils In order to investigate the expression of Mincle on mice neutrophils post- A. fumigatus infection, the mRNA levels of Mincle were tested by PCR. Compared with untreated Neutrophils, Mincle mRNA levels (Fig. 3A, p < 0.01, p < 0.01, p < 0.01, p < 0.01) were significantly increased at 4, 8, 12, 16 h post-stimulation. Furthermore, to investigate the effect of Mincle on cell apoptosis, neutrophils were pretreated with Mincle neutralizing antibody and agonist TDB or IgG and DMSO for 2 h, followed by stimulation of A. fumigatus for additional 8 h. Briefly, our data indicated that the mRNA levels of Mincle (Fig. 3B, p < 0.001, p < 0.03) were significantly increased in AF + TDB group compared to untreated group (before or after infection); while they were significantly decreased (Fig. 3B, p < 0.01) in AF + MincleAb mice compared to IgG treatment group. In addition, the 105
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
Fig. 3. The effects of Mincle on neutrophils apoptosis post-infection with A. fumigatus (A) mRNA expression of Mincle were significantly increased during 4, 8, 12, 16 h post-stimulation compared to uninfected group (N). (B–F) Effect of Mincle on cell apoptosis, neutrophils were pretreated with Mincle neutralizing antibody and agonist TDB or IgG and DMSO for 2 h, followed by stimulation of A. fumigatus for additional 8 h. The mRNA expression of Mincle (B), Fas (C), FasL (D), Caspase3 (E) and Cleaved Caspase3 (F) in different mice groups. (G–O) Inflammatory neutrophils were co-cultured with A. fumigatus, and 8 h later were labeled with Annexin V and PI and consequently analyzed by FACS. (G) Representative pseudocolor plots of Annexin V+/PI+ neutrophils (Normal); Representative pseudocolor plots of Annexin V+/PI+ neutrophils by TDB (H) or DMSO (I) treated; Representative pseudocolor plots of Annexin V+/PI+ neutrophils (AF) (J) by A. fumigatus stimulation for 8 h; Representative pseudocolor plots of Annexin V+/PI+ neutrophils pretreated with Mincle agonist TDB (AF + TDB) (K) for 2 h and followed by A. fumigatus stimulation for 8 h; Percentage(N) of Annexin V+/PI− neutrophils alone (PMN), neutrophils treated with TDB or DMSO for 2 h, neutrophils stimulated with A. fumigatus or neutrophils pretreated with Mincle agonist TDB (AF + TDB) and stimulated with A. fumigatus for 8 h, data shown (mean ± SEM) are pooled from three independent repeats. Representative pseudocolor plots of Annexin V+/PI+ neutrophils pretreated with IgG(AF + IgG) (L) or Mincle neutralizing antibody (AF + MincleAb) (M) for 2 h and followed by A. fumigatus stimulation for 8 h, Percentage (O) of Annexin V+/PI − neutrophils pretreated with IgG(AF + IgG) or Mincle neutralizing antibody (AF + MincleAb) and stimulated with A. fumigatus, data shown (mean ± SEM) are pooled from three independent repeats.
group (without infection), as well as in AF group compared with normal mice. Alos, mRNA levels of Fas (Fig. 4C, p < 0.05), FasL (Fig. 4D, p < 0.001), and Caspase3 (Fig. 4E, p < 0.01) were significantly decreased in AF + TDB group compared to untreated group; while it significantly increased mRNA levels of Fas (Fig. 4C, p < 0.001), FasL (Fig. 4D, p < 0.01), and Caspase3 (Fig. 4E, p < 0.01) in AF + MincleAb mice compared to IgG treatment group. Additionally, macrophages apoptosis was analyzed using flow cytometry. Obvious (p < 0.001) increased in the late apoptotic (Annexin V +/PI+) were overserved after A. fumigatus stimulated macrophages compared to unstimulated group (Fig. 4F, I and M). Furthermore, compared with control stimulation, late apoptotic (Annexin V +/PI+) decreased with TDB treatment (p < 0.001) (Fig. 4I, J and M), while it significantly increased after Mincle neutralizing antibody treatment compared with IgG treatment (p < 0.01) (Fig. 4K, L and N). We also observed caspase-3 activation presenting in caspase-3 (cleaved) was greatly inhibited by Mincle agonist TDB, but was greatly promoted by neutralizing antibody (Fig. 4O).
3.4. Effects of Mincle on macrophages of C57BL/6 Mice To investigate the expression of Mincle on mice macrophages postA. fumigatus infection, the mRNA levels of Mincle were tested by PCR. The mRNA levels of Mincle were tested by PCR. Compared with untreated Macrophages, Mincle mRNA levels (Fig. 4A, p < 0.05, p < 0.01, p < 0.01, p < 0.01) were significantly increased at 4, 8, 12, 16 h post-stimulation. Furthermore, to investigate the effect of Mincle on macrophages apoptosis, cells were pretreated with Mincle neutralizing antibody and agonist TDB or IgG and DMSO, followed by stimulation of A. fumigatus. Data indicated that the mRNA levels of Mincle (Fig. 4B, p < 0.01, p < 0.01) was significantly increased in the AF + TDB group compared to untreated group (before or after infection); while it was significantly decreased (Fig. 4B, p < 0.05) after Mincle neutralizing antibody treatment compared with IgG treatment. In addition, the mRNA levels of Fas (Fig. 4C, p < 0.05, p < 0.001), FasL (Fig. 4D, ns, p < 0.01), and Caspase3 (Fig. 4E, ns, p < 0.01) were significantly increased after TDB treatment compared to DMSO 106
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
Fig. 4. The effects of Mincle on macrophages apoptosis in cultured macrophages infected by A. fumigatus. (A) Higher mRNA expression of Mincle was observed in infected group compared to uninfected macrophages (N). (B–E) Mincle neutralizing antibody and TDB compared with IgG or DMSO. The mRNA expression of Mincle (B), Fas (C), FasL (D), and Caspase3 (E) were significantly different. (F–L) Macrophages were co-cultured with A. fumigatus. After 8 h, macrophages were labeled with Annexin V and PI and analyzed by FACS. Representative pseudocolor plots of Annexin V+/PI+ Macrophages (Normal) (F); Representative pseudocolor plots of Annexin V+/PI+ Macrophages by TDB (G) or DMSO (H) treated; Representative pseudocolor plots of Annexin V+/PI+ Macrophages (AF) (I) by A. fumigatus stimulation for 8 h; Representative pseudocolor plots of Annexin V +/PI+ Macrophages pretreated with Mincle agonist TDB (AF + TDB) (J) for 2 h and followed by A. fumigatus stimulation for 8 h; Percentage (M) of Annexin V +/PI− neutrophils alone (PMN), Macrophages treated with TDB or DMSO, neutrophils stimulated with A. fumigatus or Macrophages pretreated with Mincle agonist TDB (AF + TDB) and stimulated with A. fumigatus, data shown (mean ± SEM) are pooled from three independent repeats. Representative pseudocolor plots of Annexin V+/PI+ Macrophages pretreated with IgG(AF + IgG) (K) or Mincle neutralizing antibody (AF + MincleAb) (L) for 2 h and followed by A. fumigatus stimulation for 8 h, Percentage (N) of Annexin V +/PI− Macrophages pretreated with IgG(AF + IgG) or Mincle neutralizing antibody (AF + MincleAb) and stimulated with A. fumigatus, data shown (mean ± SEM) are pooled from three independent repeats.
4. Discussion
inflammatory effects. Understanding how and when neutrophils die is crucial. Results presented in this study revealed that Mincle expression was higher in infected cornea compared to control (uninfected group). Furthermore, TDB treatment decreased apoptotic gene levels, caspase-3 activation, neutrophils infiltration, TUNEL-positive cells and neutrophils and macrophages apoptosis compared with control, which were all increased in Mincle neutralizing antibody treatment compared with IgG control. These results indicated that Mincle promoted neutrophil infiltration in C57BL/6 mice's cornea infected with A. fumigatus. Furthermore, Mincle participated in the inflammatory infection, and the number of neutrophils and apoptotic cells increased in C57BL/6 mice's cornea infected with A. fumigatus. FK, an infectious corneal ulcer disease leading to serious corneal inflammation, is common in many developing countries [22–24]. Unless detected early which allows for effective treatment, the inflammatory response following infection results in a significant injury of the cornea, e.g. stromal destruction and potential loss of vision. Therapeutic interventions are required to accelerate fungal clearance while reducing tissue damage. Sustained and deep infiltration of
Neutrophils and macrophages are the first immune cells recruited to the site of injury or infection. They ingest and destroy microbes through the action of oxidants, proteases, and antimicrobial proteins. These toxic weapons do not discriminate self from non-self, thus causing bystander injury in the course of various pathologic conditions. While these degradative enzymes contribute to beneficial antimicrobial response inside phagosomes, they can also cause tissue damage if released extracellularly [19]. In order to avoid damage to the host, the inflammatory activity of neutrophils is tightly regulated in vivo. Apoptosis is the predominant cell death pathway in the neutrophils, and represents one of the most important mechanisms responsible for cells functional shutdown and the resolution of inflammation [20]. Neutrophil apoptosis can be modulated by a variety of biological agents including cytokines, chemokines, lipid mediators, pathogen-associated molecular patterns (PAMPs), and danger-associated molecular patterns (DAMPs) [20,21]. It is of crucial importance that neutrophils are cleared from the site of inflammation after exerting their pro107
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
signaling of spleen tyrosine kinase (Syk) [34,35], and induces NF-κB activation [36]. The activation of NF-κB causes modulation of expression of many genes, such as caspase-3 and bcl-2, which was confirmed in this study. Our present work demonstrated that Mincle can inhibit promote inflammation, and inhibit neutrophils and macrophages apoptosis, thus suggesting it might recruit innate immune cells to the site of infection and eliminate the pathogens. In conclusion, Mincle participates in the innate immune system against fungal infection in mice. Moreover, Mincle can reduce leukocytes' apoptosis in C57BL/6 mouse cornea following infection. During the process of inflammation, infected or injured tissue recruits leukocytes. Nevertheless, their fine-tuned regulation at the inflammatory point is necessary because of the potential tissue-damaging effects of PMN. This means that inflammation can effectively resolve spontaneously or in a pharmacological-induced way by controlling leukocyte infiltration in the tissue [37]. Inflammation resolution is mainly mediated by the innate immune system. The effect of inflammation resolution is usually reflected in the increase of anti-inflammatory actions and a paradigm shift from immune cell function to restore homeostasis [38]. The present study provided detailed investigation of the function and mechanism of Mincle induced leukocytes apoptosis and signaling, which can in turn inspire new approaches toward adjusting the immune system. However, leukocytes apoptosis in A. fumigatus keratitis can also be regulated by Mincle, as this is one of the Mincle's functions. Further studies of Mincle could provide better understanding of Mincle modulation in A. fumigatus keratitis, thus advancing the infectious diseases studies. Besides, further investigations and understanding, would provide new therapeutic options for A. fumigatus keratitis.
inflammatory cells following fungus infection may lead to the tissue damage. Leukocytes, neutrophils and macrophages, are vital for prevention of fungus infection since they have the ability to release inflammatory mediators and to remove the inflammatory agent/stimuli by acting as cell effector and phagocytes, thus elucidating the pathogenesis [25]. Neutrophils are abundant, short-lived leukocytes that play a key role in immune defense against microbial infections. Neutrophils cell death is regulated by apoptosis, which regulates the neutrophil cell numbers and guaranties the safe disposal of engulfed bacteria. Therefore, apoptosis is essential for the removal of neutrophils from inflamed tissues and for the timely resolution of neutrophilic inflammation. Mincle is a kind of C-type lectin expressed on myeloid cells, neutrophils and professional antigen presenting cells such as macrophages, dendritic cells and B cells [5]. Some recent related studies found that Mincle was associated with immune responses caused by fungus; the recruitment of Fc receptor g can be activated and the signaling of spleen tyrosine kinase (Syk) can be induced by 1TDM-bound Mincle, thus causing strong activation of NFkB [14–16]. After Mincle gets bound by pathogen—associated molecular patterns (PAMPs), ROS is triggered leading to cell apoptosis by oxidative stress reaction, thus having an important role in inflammatory pathways, such as NF-κB. However, Wevers et al. [26] have found that human Mincle can suppress antifungal defense by activating E3 ubiquitin-protein ligase Mdm2 which then suppress IL12A transcription and finally degrade interferon regulatory factor. According to our study, significantly higher Mincle expression was observed in C57BL/6 mice' infected cornea compared to uninfected (control) group. These data, that were consistent with our previous study [27], suggested that Mincle plays an important role in the inflammatory infection. As an important physiological response, inflammation is essential for maintaining tissue homeostasis and preventing the host from intruding microorganisms, foreign substances, or host self-disturbers. Important microcirculatory events will appear in response to local release of pro-inflammatory mediators after the host was incited, which can increase vascular permeability and leukocyte recruitment [28]. Additionally, Mincle participates in the activation process of inhibiting late-stage NLRP3-inflammasome, and in reducing excessive inflammation [29]. The signaling of TDM-induced Mincle can improve the p38- and eIF5A-dependent translational regulation of certain genes, such as iNOS, which in turn can relieve the inflammation through inhibition of IL-1b production [30]. Mincle is vital for the transition from inflammation to NO-mediated cytotoxicity and necroptosis, which is the key to eradicate mycobacteria [18]. This suggests that Mincle might be crucial for the immune response balance. Neutrophil apoptosis is usually initiated by one of two signaling cascades: the intrinsic or extrinsic apoptotic pathway. The intrinsic pathway relies on the loss of mitochondrial membrane integrity caused by the imbalance of pro- and anti-apoptotic factors in the cell, and subsequent release of cytochrome c from the mitochondria. Cytochrome c facilitates caspase-9-dependent assembly of the Apaf-1-containing apoptosome and eventual activation of executioner caspase-3. On the other hand, the extrinsic pathway responds to extracellular signaling through death receptors to drive caspase-8-dependent activation of caspase-3. Fas-L, TNF-α, and TRAIL are all examples of soluble proteins that mediate extrinsic apoptosis through engagement of their cognate receptors expressed on the surface of neutrophils [31,32]. The two pathways converge at caspase-3 activation [33], thus caspase-3 is considered as a key enzyme in the pathogenesis of cell apoptosis. When the full length pro-caspase-3 (32kD) is activated, it is cleaved to form two mature subunits, p17 (17kD) and p12 (12kD). The level of the cleaved caspase-3 represents the level of the activated caspase-3. Our study showed that Mincle neutralizing antibody pre-treatment increased Fas, FasL, and caspase-3 expression, caspase-3 activation. These findings imply that Mincle restrains apoptosis by preventing the activation of caspase-3. Numerous studies have shown that Mincle mediates ROS production through activation of NADPH oxidase, which in turn leads to the
References [1] E. Nielsen, S. Heegaard, J.U. Prause, A. Ivarsen, K.L. Mortensen, J. Hjortdal, Fungal keratitis – improving diagnostics by confocal microscopy, Case Rep. Ophthalmol. 4 (3) (2013) 303–310. [2] L. Xie, X. Dong, W. Shi, Treatment of fungal keratitis by penetrating keratoplasty, Br. J. Ophthalmol. 85 (9) (2001) 1070–1074. [3] L. Xie, W. Zhong, W. Shi, S. Sun, Spectrum of fungal keratitis in north China, Ophthalmology 113 (11) (2006) 1943–1948. [4] C. Nathan, Neutrophils and immunity: challenges and opportunities, Nat. Rev. Immunol. 6 (2006) 173–182. [5] W.M. Nauseef, N. Borregaard, Neutrophils at work, Nat. Immunol. 15 (2014) 602–611. [6] R. Duffin, A.E. Leitch, S. Fox, C. Haslett, A.G. Rossi, Targeting granulocyte apoptosis: mechanisms, models, and therapies, Immunol. Rev. 236 (2010) 28–40. [7] S. Michlewska, A. McColl, A.G. Rossi, I.L. Megson, I. Dransfield, Clearance of dying cells and autoimmunity, Autoimmunity 40 (2007) 267–273. [8] I.K. Poon, C.D. Lucas, A.G. Rossi, K.S. Ravichandran, Apoptotic cell clearance: basic biology and therapeutic potential, Nat. Rev. Immunol. 14 (2014) 166–180. [9] M. Matsumoto, T. Tanaka, T. Kaisho, H. Sanjo, N.G. Copeland, D.J. Gilbert, et al., A novel LPSinducible C-type lectin is a transcriptional target of NF-IL6 in macrophages, J. Immunol. 163 (1999) 5039–5048. [10] A.N. Zelensky, J.E. Gready, The C-type lectin-like domain superfamily, FEBS J. 272 (2005) 6179–6217. [11] A. Bugarcic, K. Hitchens, A.G. Beckhouse, C.A. Wells, R.B. Ashman, H. Blanchard, Human and mouse macrophage-inducible C-type lectin (Mincle) bind Candida albicans, Glycobiology 18 (2008) 679–685. [12] C.A. Wells, J.A. Salvage-Jones, X. Li, K. Hitchens, S. Butcher, R.Z. Murray, et al., The macrophage inducible C-type lectin, mincle, is an essential component of the innate immune response to Candida albicans, J. Immunol. 180 (2008) 7404–7413. [13] S. Yamasaki, M. Matsumoto, O. Takeuchi, T. Matsuzawa, E. Ishikawa, M. Sakuma, et al., C-type lectin Mincle is an activating receptor for pathogenic fungus, Malassezia, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 1897–1902. [14] E. Ishikawa, et al., Direct recognition of the mycobacterial glycolipid, trehalose dimycolate, by C-type lectin Mincle, J. Exp. Med. 206 (2009) 2879–2888. [15] R. Lang, Recognition of the mycobacterial cord factor by Mincle: relevance for granuloma formation and resistance to tuberculosis, Front. Immunol. 24 (4) (2013) 5. [16] S. Yamasaki, et al., Mincle is an ITAM-coupled activating receptor that senses damaged cells, Nat. Immunol. 9 (2008) 1179–1188. [17] B.A. Wevers, et al., Fungal engagement of the C-type lectin mincle suppresses dectin-1-induced antifungal immunity, Cell Host Microbe 15 (2014) 494–505. [18] Wook-Bin Lee, et al., Mincle-mediated translational regulation is required for strong nitric oxide production and inflammation resolution, Nat. Commun. 7 (2016) 11322. [19] M.C. Greenlee-Wacker, Clearance of apoptotic neutrophils and resolution of
108
International Immunopharmacology 52 (2017) 101–109
J. Lin et al.
(2013) 664–673. [30] C. Desel, K. Werninghaus, M. Ritter, K. Jozefowski, J. Wenzel, N. Russkamp, U. Schleicher, D. Christensen, S. Wirtz, C. Kirschning, E.M. Agger, C. Prazeres da Costa, R. Lang, The Mincle-activating adjuvant TDB induces MyD88-dependent Th1 and Th17 responses through IL-1R signaling, PLoS One 8 (1) (2013) e53531. [31] M.L. Gabelloni, A.S. Trevani, J. Sabatte, J. Geffner, Mechanisms regulating neutrophil survival and cell death, Semin. Immunopathol. 35 (2013) 423–437. [32] B. Geering, H.U. Simon, Peculiarities of cell death mechanisms in neutrophils, Cell Death Differ. 18 (2011) 1457–1469. [33] T. Sugawara, M. Fujimura, N. Noshita, G.W. Kim, A. Saito, T. Hayashi, P. Narasimhan, C.M. Maier, P.H. Chan, Neuronal death/survival signaling pathways in cerebral ischemia, Neuro Rx. 1 (2004) 17–25. [34] M. Ushio-Fukai, R.W. Alexander, M. Akers, K.K. Griendling, p38 mitogenactivated protein kinase is a critical component of the redox-sensitive signaling pathways activated by angiotensin. II. Role in vascular smooth muscle cell hypertrophy, J. Biol. Chem. 273 (1998) 15022–15029. [35] Z. Wang, M.R. Castresana, W.H. Newman, Reactive oxygen species sensitive p38 MAPK controls thrombin-induced migration of vascular smooth muscle cells, J. Mol. Cell. Cardiol. 36 (2004) 49–56. [36] H.C. Ou, T.Y. Song, Y.C. Yeh, EGCG protects against oxidized LDL-induced endothelial dysfunction by inhibiting LOX-1-mediated signaling, J. Appl. Physiol. 108 (2010) 1745–1756. [37] C. Nathan, Neutrophils and immunity: challenges and opportunities, Nat. Rev. Immunol. 6 (3) (2006) 173–182. [38] Amanda Croasdell, et al., PPARγ and the innate immune system mediate the resolution of inflammation, PPAR Res. 2015 (2015) 549691.
inflammation, Immunol. Rev. 273 (1) (2016) 357–370. [20] V. Witko-Sarsat, M. Pederzoli-Ribeil, E. Hirsch, S. Sozzani, M.A. Cassatella, Regulating neutrophil apoptosis: new players enter the game, Trends Immunol. 32 (2011) 117–124. [21] R. Duffin, A.E. Leitch, S. Fox, C. Haslett, A.G. Rossi, Targeting granulocyte apoptosis: mechanisms, models, and therapies, Immunol. Rev. 236 (2010) 28–40. [22] T.S. Zaidi, T. Zaidi, G.B. Pier, G.P. Priebe, Topical neutralization of interleukin-17 during experimental Pseudomonas aeruginosa corneal infection promotes bacterial clearance and reduces pathology, Infect. Immun. 80 (2012) 3706–3712. [23] L. Xia, S. Zhang, Z. Cao, Y. Hu, H. Yang, D. Wang, Interleukin-17 enhanced immunoinflammatory lesions in a mouse model of recurrent herpetic keratitis, Microbes Infect. 15 (2013) 126–139. [24] H. Zhang, H. Li, Y. Li, et al., IL-17 plays a central role in initiating experimental Candida albicans infection in mouse corneas, Eur. J. Immunol. 43 (2013) 2671–2682. [25] M.T. Silva, M. Correia-Neves, Neutrophils and macrophages: the main partners of phagocyte cell systems, Front. Immunol. 4 (3) (2012) 174. [26] B.A. Wevers, et al., Fungal engagement of the C-type lectin mincle suppresses dectin-1-induced antifungal immunity, Cell Host Microbe 15 (2014) 494–505. [27] Ying Liu, Guiqiu Zhao, Jing Lin, Cui Li, Qing Li, Chengye Che, Qian Wang, Hu. Liting, The role of Syk signaling in antifungal innate immunity of human corneal epithelial cells, BMC Ophthalmol. 15 (2015) 55. [28] R. Medzhitov, Inflammation 2010: new adventures of an old flame, Cell 140 (2010) 771–776. [29] K. Schweneker, O. Gorka, M. Schweneker, H. Poeck, J. Tschopp, C. Peschel, J. Ruland, O. Gross, The mycobacterial cord factor adjuvant analogue trehalose6,6′-dibehenate (TDB) activates the Nlrp3 inflammasome, Immunobiology 218 (4)
109