miR-155 contributes to Df1-induced asthma by increasing the proliferative response of Th cells via CTLA-4 downregulation

Accepted Manuscript Research paper miR-155 contributes to Df1-induced asthma by increasing the proliferative response of Th cells via CTLA-4 downregulation Yingying Zhang, Entao Sun, Xueqin Li, Mengying Zhang, Zongsheng Tang, Ling He, Kun Lv PII: DOI: Reference:

S0008-8749(17)30005-9 http://dx.doi.org/10.1016/j.cellimm.2017.01.005 YCIMM 3622

To appear in:

Cellular Immunology

Received Date: Revised Date: Accepted Date:

10 October 2016 27 December 2016 5 January 2017

Please cite this article as: Y. Zhang, E. Sun, X. Li, M. Zhang, Z. Tang, L. He, K. Lv, miR-155 contributes to Df1induced asthma by increasing the proliferative response of Th cells via CTLA-4 downregulation, Cellular Immunology (2017), doi: http://dx.doi.org/10.1016/j.cellimm.2017.01.005

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

miR-155 contributes to Df1-induced asthma by increasing the proliferative response of Th cells via CTLA-4 downregulation Yingying Zhanga,+, Entao Sunb,+, Xueqin Lic,+, Mengying Zhangc, Zongsheng Tangc, Ling Hec, and Kun Lvc,* a

Laboratory Medicine of Yijishan Hospital, Wannan Medical College, Wuhu, 241001, PR China;

[email protected] (Z.Y.Y.) b

Department of Medical Parasitology, Wannan Medical College, Wuhu 241002, PR China;

[email protected] (S.E.T.) c

Central Laboratory of Yijishan Hospital, Wannan Medical College, Wuhu, 241001, PR China;

[email protected]

(L.X.Q.);

[email protected]

(Z.M.Y.);

[email protected] (T.Z.S.); [email protected] (H.L.); [email protected] (L.K.) *

Corresponding author: Kun Lv, Central Laboratory of Yijishan Hospital, Wannan Medical College,

Wuhu, 241001, PR China Postal address: The Yijishan hospital, Wannan Medical College, 2 western Zheshan Road, Wuhu, 241001, P.R.China E-mail: [email protected]; Tel.: +86-553-573-9912 +

These authors contributed equally to this work.

Abbreviations:

miRNA:

microRNA;

miR:

mature

microRNA;

CTLA-4:

cytotoxic

T

lymphocyte-associated antigen-4; AHR: airway hyperresponsiveness; Df1: Dermatophagoides farinae; qPCR: quantitative RT-PCR; RBC: red blood cell; FBS: fetal bovine serum; PBS: phosphate buffer saline; H&E: hematoxylin-eosin; HPF: high power field; FACS: fluorescence-activated cell sorting; BALF: Bronchoalveolar lavage fluid

Abstract Allergen-induced

airway inflammation is characterized by Th2-mediated eosinophilic

inflammation in the lungs. While the molecular mechanisms leading to this abnormal Th2 response remain unclear. Recent studies have demonstrated that MicroRNAs (miRNAs) modulate allergic airway inflammation. In this study, the role of miRNAs in allergic asthma pathogenesis was examined. Differentially expressed miRNAs were identified via miRNA microarray, with miR-155 being among the most highly expressed in asthma mice lungs. Examination of miR-155 overexpression resulted in enhanced inflammation and mucus hypersecretion in the lungs of allergen-challenged mice compared with control animals. Furthermore, CTLA-4, an important negative regulator of T-cell activation, was identified as a direct miR-155 target. Moreover, miR-155 overexpression in CD4+ T cells resulted in decreased CTLA-4 levels and a subsequent increased proliferative response. Collectively, these findings suggest that miR-155 might contribute to allergic asthma by increasing the proliferative response of Th cells via CTLA-4 downregulation and thus may be a potential therapeutic target for allergic asthma. Keywords: miR-155; asthma; CTLA-4

1. Introduction Allergen-induced airway inflammation is characterized by T-helper type 2 (Th2)-mediated eosinophilic inflammation of the lungs. Th2 cells play a key role in the pathogenesis of allergic asthma via cytokine secretions consisting of IL-4, IL-5 and IL-13 [1-5]. Furthermore, these Th2 cytokines, also including IL-9, have been associated with the hallmark features of allergic asthma, such as elevated serum IgE, airway eosinophil infiltration, mucus hypersecretion and airway hyperresponsiveness (AHR) [6,7]. However, while Th2 cells are known to function in allergic asthma pathogenesis, the molecular mechanisms leading to this abnormal Th2 response remain largely unclear. MicroRNAs (miRNAs) are short (21 – 23 base pairs) single stranded RNA molecules that mediate posttranscriptional gene silencing mainly by binding to the 3’-untranslated region (UTR) of a target messenger RNA (mRNA), thus leading to its degradation or translational inhibition [8-10]. Emerging evidence suggests that miRNAs are important regulators of immune system gene expression [11], with this role also noted in recent studies examining miRNAs in allergic airway inflammation. In allergic airway inflammation models, miR-21 has a role in Th2 cell polarization through the negative regulation of IL-12p35 [12], while miR-126 links innate and adaptive immune responses in a house dust mite mouse model. Furthermore, miR-126 antagonism significantly suppresses Th2 cells effector functions and the development of eosinophilic airway inflammation [13]. Likewise, miR-145 antagonism in the same model demonstrated a suppressed eosinophilic airway inflammation, Th2 cytokine production, mucus hypersecretion and AHR [14]. Moreover, miR-155-deficient mice have been reported to be partially protected against allergic airway inflammation via the regulation of Th2 priming by dendritic cells or Th2-mediated eosinophilic infiltration [15,16]. Thus, miRNAs represent important potential targets for therapeutics and diagnostics. The aim of the present study was to explore the role of miRNAs in the pathogenesis of allergic asthma, thus building on our previous investigation [17]. Herein, miR-155, a miRNA that functions in modulating immune homeostasis [18-20], was identified as one of the most highly expressed miRNAs in the lungs of asthmatic mice. Furthermore, the present study showed that miR-155 is modulated by a major dust mite allergen, Dermatophagoides farinae (Df1), and increases CD4+ T cell proliferation through the downregulation of cytotoxic T lymphocyte–associated antigen 4 (CTLA-4) expression.

2. Materials and Methods 2.1. Mice

BALB/c (H-2d ) mice (age 6 – 8 weeks, 25 – 30 g) were purchased from the Experimental Animal Center of Qinglongshan (Nanjing, P. R. China) and housed in pathogen-free mouse colonies. All animal experiments were performed according to the guidelines for the Care and Use of Laboratory Animals (Ministry of Health, PR China, 1998) and the guidelines of the Laboratory Animal Ethical Commission of Wannan Medical College. All experimental protocols were evaluated and approved by the Animal Ethical Committee of Wannan Medical College (Permit Number.20130138). 2.2. Asthma and treatment To induce allergic asthma, mice were intraperitoneally sensitized with 50 µg Df1 extract absorbed onto 2 mg alum on days 0, 7 and 14. Sensitized mice were then challenged with a Df1 aerosol (25 µg Df1 extract delivered in 1 ml PBS) delivered via nebulizer for 5 min every day on days 21 – 28. For miR-155 treatment, 100 µg miR-155 agomir/100 µL PBS (GenePharma) was administered daily via tail intravenous injection starting at day 20 (24 h before the first Df1 re-challenge) until the mice were sacrificed. 2.3. miRNA microarray analysis The miRNA microarray analysis was performed by Shanghai Biotechnology Corporation. Total RNA was extracted from lung tissue homogenates using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions, with 2.5 µg labeled with Cy5 fluorescent dye using a miRNA ULSTM Labeling Kit (Kreatech Diagnostics). Labelled miRNA targets were enriched using a NanoSep 100K (Pall Corporation) and hybridized overnight at 37°C to the MRmiOA-mmu-r1-3.0 array, which contains 1111 unique mouse miRNA probes in triplicate (miRBase Release 17.0). Following hybridization, the arrays were washed to remove non-specific binding, dried by centrifugation and scanned using a Axon4000B scanner (Molecular Devices). The Cy5 fluorescent intensities were

imaged and analyzed using the GenePix 4.1 software (Molecular Devices). Spot intensities were further analyzed using the R program (version 2.12.1). The signals (flag=0) were normalized using log2 transformation and quantile normalization, with differences identified using an ANOVA test. 2.4. Real-time PCR Total RNA was extracted using TRIzol reagent (Invitrogen) and 0.4 µg RNA was used to synthesize cDNA using a first strand cDNA synthesis kit (Applied Biosystems). qPCR was performed using a Lightcycler 480 system (Roche), with primers shown in Table 1. For the miRNA, a commercial Hairpin-it TM miRNAs qPCR Quantification Kit (GenePharma) was used. Briefly, 2 µg RNA was used as template and then reverse-transcribed using a miR-155 specific RT-primer. The resulting cDNA was further amplified using a universal reverse primer and a specific forward primer according to the following PCR procedure: pre-denaturation at 95°C for 2 min, followed by 40 cycles at 94°C for 10 s, 58°C for 15 s and 72°C for 20 s, followed by a melting curve analysis. Both mRNA or miRNA expression levels were determined using the comparative CT (△△CT) method and normalized against either GAPDH or U6 snRNA levels. All reactions were completed in triplicate. 2.5. AHR Measurement AHR was invasively examined in separate groups of anesthetized mice by measuring total lung resistance and dynamic compliance [21], with the percentage increase over baseline (water) in response to nebulized methacholine calculated. 2.6. Bronchoalveolar lavage and lung histopathologic examination Bronchoalveolar lavage was performed using three instillations of 0.5 ml PBS. RBCs were lysed with ACK buffer for 2 min at 4°C and the cells were resuspended in 0.3 ml RPMI 1640 containing 10% FBS. Total cells were counted using a hemocytometer, with Diff-Quik stained cytospin slides (Siemens

Healthcare Diagnostics) used for differential cell counts. For histopathologic examination, lung samples were formalin-fixed, paraffin-embedded, sectioned at a thickness of 3 µm and stained with H&E or periodic acid–Schiff (PAS, Sigma Aldrich). Images were acquired on a Ti-U Nikon microscope, with mucus-producing cells identified by morphological criteria and quantitated by counting 10 HPFs per each slide [21]. The mucus-producing cell quantifications were performed by an investigator blinded to the identity of the animals. 2.7. Total IgE and Df1-specific IgG measurements Sera were collected by cardiac puncture 2 d after the last intranasal injection, with total IgE quantified using an ELISA kit (R&D Systems) and Df1-specific IgG measured as previously described [22]. Briefly, 96-well plates were coated with a 5 mg/ml solution of Df1 and incubated with diluted serum. Samples were then incubated with alkaline phosphatase-conjugated anti-mouse IgG1/IgG2a (BD Pharmingen), followed by p-nitrophenyl phosphate substrate (Sigma-Aldrich) and measured at an absorbance of 450 nm. 2.8. Cytokines examined via ELISA Cytokine levels, including IFN-γ, IL-4, IL-5, IL-13 and IL-17A, were quantified in homogenized lung tissues using respective cytokine ELISA kits (R&D Systems) according to the manufacturer’s instructions. 2.9. FACS analysis Individual lung cell suspensions were pooled and stained with mAbs (eBioscience Inc.) diluted in 1% FBS in PBS, to include CD4, CD62L and CD25. For intracellular staining, cells were fixed and permeabilized using fixation buffer and permeabilization solution or anti-mouse IL-4/IFN-γ/IL-17A (BD Biosciences). Cell fluorescence was measured using FACS (Beckman Coulter, Inc.) and the data

analyzed using FlowJo software (Tree Star). 2.10. Western blot Cells were lysed in RIPA extraction solution [15 mM Tris (pH 7.5) 120 mM NaCl, 25 mM KCl, 2 mM EGTA, 2 mM EDTA, 0.1 mM dithiothreitol, 0.5% Triton X-100 and protease inhibitor cocktail (Sigma-Aldrich)] and protein concentrations were assessed using a BCA assay. Total protein lysates (25 µg/lane) were subjected to SDS-PAGE and transferred onto an Immobilon polyvinylidene difluoride (PVDF) membrane (Millipore Corp.). The anti-CTLA-4 (Abcam) was detected, with an anti-GAPDH antibody used as a control (Abcam), and quantified using Quantity One Analysis software (Bio-Rad). 2.11. Transient transfections and dual-luciferase reporter assay Transient transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocols. For the luciferase assay, HEK293 cells were cultured in 24-well plates and co-transfected with an indicated reporter plasmid (0.1 µg/well) and a miRNA expression vector (0.4 µg/well) or miRNA agomir (60 nM; GenePharma) or antagomir (100 nM; GenePharma). Luciferase activity was analyzed 48 h later using a dual luciferase reporter assay (Promega), with the Renilla luciferase activity in the lysates used to normalize the firefly luciferase activity. 2.12. Statistical analysis Statistical analysis was performed using a two-tailed independent Student’s t test and ANOVA analysis using GraphPad Prism v5.0 (GraphPad Software, Inc.). Data are shown as a mean ± SD, with P < 0.05 considered statistically significant.

3. Results 3.1. miR-155 upregulation is associated with Df1-induced asthma To explore the potential involvement of miRNAs in the pathogenesis of allergic asthma, differentially expressed lung miRNAs were identified in healthy and Df1-induced asthma mice using

miRNA arrays. To identify differentially expressed miRNAs, unsupervised hierarchical clustering was performed and showed asthma and normal lung samples (Fig. 1A). One of the most highly upregulated miRNAs in the asthmatic lung relative to the normal lung was miR-155 (5.2-fold upregulation), an miRNA with key roles in the organization of an adaptive immune response [19,20]. This finding was further confirmed following real-time PCR (Fig. 1B) Due to the fact that CD4+ T cells are key mediators in asthma pathogenesis, miR-155 expression levels were examined in lung-infiltrating mononuclear cells. The results showed that miR-155 expression was elevated in CD4+ T cells compared with total mononuclear cells (Fig. 1C). To investigate whether miR-155 is modulated by allergen exposure, sorted spleen CD4+ T cells from Df1-sensitizated mice were stimulated with Df1 allergen and miR-155 expression was analyzed by RT-PCR. These results showed a significant increase in miR-155 levels 3 days after allergen exposure (Fig. 1D). 3.2. miR-155 overexpression promotes the induction of lung inflammation in Df1-induced asthma To examine the role of miR-155 in the development of characteristic allergic asthma features, miR-155 overexpression was induced with agomirs. Df1-sensitized mice were treated via tail intravenous injection with miR-155 agomirs or scrambled agomirs as a control. Agomirs were administered 24 h before the first Df1 re-challenge and then given daily, with disease severity determined 24 h after the last Df1 allergen exposure. The overexpression of miR-155 increased Df1-induced AHR to methacholine (Fig. 2A). Histopathologic examination of lung sections showed enhanced airway inflammation and mucus hypersecretion in the asthma mice that received the miR-155 agomirs, but not in those that received the control (Fig. 2B and 2C). Additionally, the miR-155 agomirs increased the total number of BALF inflammatory cells in asthma mice relative to the control mice (Fig. 2D). Furthermore, the numbers of BALF eosinophils and lymphocytes were significantly increased in the asthma mice that received the miR-155 agomirs (Fig. 2E). Due to miR-155 agomirs being administered prior to the Df1 challenge, total serum IgE levels

were measured and Df1-specific antibodies were utilized to assess whether the ability of miR-155 to enhance lung inflammation in Df1-induced asthma was a consequence of the allergic-sensitization process. While miR-155 administration increased total serum IgE levels, Df-specific IgG1 and IgG2a levels were unaltered (Fig. 3). These findings suggest that the mechanism by which miR-155 promotes lung inflammation in asthma might involve enhanced allergic sensitization to the Df1 allergen.

3.3. miR-155 overexpression increases lung Th2 and Th17 cytokine expression in Df1-induced asthma It is well known that Th2 cells and their effector cytokines, IL-4, IL-5 and IL-13, play important roles in the pathophysiology of allergic inflammation [23]. IL-4 promotes Th2 cell differentiation and proliferation and IgE production, whereas IL-13 is an effector cytokine that mediates mucin production and AHR in asthma [24]. Furthermore, IL-17A, a product of Th17 cells, is required during the induction of allergic asthma and can also mediate neutrophil-mediated inflammation [23,25]. To further elucidate the role of miR-155 in regulating allergen-induced Th2 responses in the lung, we next investigated any possible correlations between miR-155 and these cytokines. These results showed that IL-4, IL-5, IL-13 and IL-17A levels were increased in lung homogenates from asthma mice that had been treated with the miR-155 agomirs (Fig. 4) relative to the control, while IFN-γ levels were unaltered. These findings are consistent with the conclusion that the miR-155 contributes to the induction of Th2 and Th17 cytokine mediated inflammatory responses Df1-induced asthma. 3.4. miR-155 overexpression enhances CD4+ T-cell activation and Th2 responses in Df1-induced asthma lungs Previous studies have shown that miR-155 plays a role in immune system homeostasis. Moreover, one study showed that T cells from miR-155 KO mice preferentially differentiate toward a Th2 lineage in vitro [19]. Thus, CD4+ T cell subtypes quantities and activation levels were examined in the lungs of miR-155 treated asthma mice. Flow cytometric analysis revealed an increased CD4+ T cell activation in

miR-155 treated asthma mice, as determined by increased proportions of CD4+ T cells expressing low levels of CD62L compared to control mice (Fig. 5A), while no significant difference in the relative numbers of Th1 cells was noted (Fig. 5B). However, miR-155 overexpression resulted in increased numbers of Th2, Th17 and Treg cells relative to the control mice (Fig. 5B). These data indicate a possible role for miR-155 in T cell commitment to the lineages of Th2, Th17 and Treg, which may impact allergic inflammation.

3.5. CTLA-4 is a functional target of miR-155 miRNAs exert their regulatory functions via the posttranscriptional targeting protein-coding mRNAs. To predict possible miR-155 targets, computational algorithms (PicTar [26], miRanda [27], and TargetScan [28]) based on a systematic analysis of the structural requirements for target site binding were employed and identified CTLA-4, an important negative regulator of T-cell function. Additionally, the 3’-UTR of the CTLA-4 transcript contains an evolutionarily conserved miR-155 binding site (Fig. 6A). To validate this predicted binding, a 3’UTR reporter construct having a 7-bp substitution in the CTLA-4 binding site was generated and termed pLUC-CTLA-4 3’UTR point mutation (Fig. 6A). When miR-155 was cotransfected with the reporter construct that harbored the wild type (WT) CTLA-4 3’UTR, the expression of the renilla-luciferase construct was reduced to less than 50% of its activity. When the putative sites for miR-155 binding were mutated, the mutant failed to be regulated by miR-155 (Fig. 6B). When the miR-155 antagomirs were co-transfected with these constructs, the miR-155 antagomirs were observed to enhance the luciferase activity of the reporter with a WT 3’UTR when compared to treatment with scrambled control (Fig. 6C). Thus these experimental results confirmed the prediction that the miR-155 response element was located in the 3’UTR of CTLA-4.

Upon further examination in CD4+ T cells, miR-155 antagomirs were found to upregulate CTLA-4 mRNA expression and endogenous protein levels (Fig. 6D). Due to the fact that CTLA-4 engagement ultimately results in cell-cycle arrest [29,30], proliferation levels were examined. Naive CD4+ T cells were transfected with either miR-155 agonists, antagonists or the scrambled control and cells were stimulated with anti-CD3/CD28 antibody. At 3 days post-stimulation, transfection with the miR-155 agomirs increased proliferation, while the miR-155 antagomirs decreased proliferation (Fig. 6E), which was consistent with the significantly enhanced CTLA-4 levels seen in these cells (Fig. 6D).

4. Discussion In this study, miR-155 was identified as one of the most significantly upregulated miRNAs in Df1-induced allergic asthma via miRNA array, with this finding confirmed by RT-PCR and by means of an allergen stimulation. In accordance with previous findings [15,16], miR-155 contributes to allergen-induced lung inflammation and mucus hypersecretion, both of which are dependent on Th2 cytokines (IL-4, IL-5, and IL-13). Additionally, we identified CTLA-4, a major inhibitory molecule of T cell responses, as a novel miR-155 target in CD4+ T cells and demonstrated that miR-155 regulates the proliferation of CD4+ T cells. Among immune system-related miRNAs, miR-155 is one of the most intensively studied miRNAs. The human miR-155 gene has been mapped to chromosomal region 21q21 and has been associated with asthma, pollen sensitivity and atopic dermatitis susceptibility [31-33]. Furthermore, miR-155 is highly expressed on activated B cells, T cells, DCs and macrophages and is required for their cellular modulation of innate and adaptive immune responses [19]. In accordance with the importance of miR-155 in modulating immunity, this study found that miR-155 was mainly overexpressed in CD4+ T cells in the lungs of asthma mice. It is worth mentioning that, our previous work have showed an

decreased expression of miR-155 in the peripheral blood CD4+ T cells of patients with allergic asthma compared to normal controls [17]. This discrepancy may be due to differences in the source of the detected cells. So we propose that lung-infiltrating CD4+ T cells but not peripheral blood CD4+ T cells could better reflect the actual immune response of asthma. Of course, the exact cause remains to be elucidated. While previous studies have shown an increased miR-155 expression in activated T cells both in human and animal disease models [19,34-38], this study also found that miR-155 overexpression increases the numbers of activated CD4+ T cells (i.e. Th2 and Th17 cells), as confirmed via elevated lung Th2 cytokine (ie, IL-4, IL-5, and IL-13) levels relative to the control. There was also a trend towards increased IL-17 levels, a Th17-derived cytokine, without the IFN-γ levels being affected. Similarly, miR-155 overexpression increased Th2 and Th17 cell numbers in the lungs without significantly impacting Th1 cell numbers. Interestingly, previous studies have demonstrated that miR-155 KO T cells are prone to Th2 differentiation due to a miR-155 deficiency and produce more IL-4, IL-5 and IL-13 and less IFN-γ [19]. This phenomenon was speculated to occur due to an increased expression of c-Maf, an IL-4–specific transcription factor, in miR-155 KO–polarized Th2 cells. However, in a previous study, they were unable to detect an increased c-Maf expression in PBLN tissue from allergen-exposed miR-155 KO mice [16]. Additionally, the current study found that a reduced number of Th2 effector cells was accompanied by a significant increase in Th17 and Treg cells in miR-155 treated asthma mice lungs. This is in agreement with previous studies that demonstrated that miR-155 modulates Th17 and Treg cell differentiation in vitro [36,37]. Moreover, miR-155 promotes autoimmune inflammation in miR-155 KO mice that are resistant to experimental autoimmune encephalomyelitis by reducing Th17

cell numbers [39]. With regard to Treg cells, a previous study showed reduced Treg cell numbers in miR-155 KO mice during asthma [16]. Herein, Treg cell numbers increased in miR-155 treated asthma mice, which is in agreement with the previous study. For further insight into the function of miR-155 during T-cell activation, a mRNA target, CTLA-4, was predicted to contain a miR-155 3’-UTR binding site and experimentally validated. CTLA-4 acts a major inhibitory molecule of T-cell responses and is targeted by miR-155 in CD4+ T cells. CTLA-4 is a critical costimulatory receptor of the T-cell receptor and is required to counter balance the proliferative nature of an immune response. CTLA-4 is preferentially expressed on activated and regulatory T cells and becomes triggered upon binding to costimulatory B7 molecules (i.e. CD80 and CD86). The central function of CTLA-4 is to act as a potent negative regulator of T-cell immune responses as is evidenced by CTLA-4 KO mice, which die prematurely from multiorgan inflammation [39,40]. Furthermore, CTLA-4 inhibition in animal models has been shown to maintain or increase allergic responses and inflammation [41], with increased eosinophil numbers, IgE levels and allergen-induced IL-13 levels noted, while increased CTLA-4 expression inhibits allergic pulmonary inflammation [42]. Additionally, CTLA-4 can efficiently inhibit inflammatory responses in human subjects in vivo, as evidenced by the successful treatment of chronic inflammatory diseases by administering the CTLA-4–immunoglobulin fusion protein abatacept [43,44]. The CTLA-4 3’-UTR contains an evolutionarily conserved miR-155 binding site, with a mutation of this site found to abolish miR-155–mediated CTLA-4 suppression, as demonstrated by luciferase reporter assays. Moreover, CTLA-4 mRNA and protein expression was upregulated following miR-155 inhibition. Altogether, these results indicate that CTLA-4 is suppressed by miR-155 in T cells and suggests a role for miR-155 as a temporal filter that regulates the onset of the inhibitory phase of

inflammation by delaying CTLA-4 expression. In line with the known antiproliferative functions of CTLA-4 in activated T cells, miR-155 overexpression was found to enhance the activation and proliferation of CD4+ T cells in allergic asthma. Moreover, this observed miR-155 modulation of CD4+ T cell proliferation provides new insight into immune malfunctions that occur during a Th cell–dependent allergen response. Altogether, our findings suggest that the miR-155–mediated suppression of CTLA-4 is an important regulatory mechanism in the pathogenesis of allergic asthma. Furthermore, these findings indicate that miR-155 may serve as a potential therapeutic target in the treatment of allergic asthma and other inflammatory diseases.

Acknowledgements This work was supported by National Natural Science Foundation of China (NO.81300172, 81301497 and 81472017); Natural Science Foundation of Anhui Province (1408085QH148); Key projects of Natural Science Research of universities in Anhui Province (KJ2016A721)；Programme Foundation for the Talents by the universities in Anhui Province. We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript. Competing financial interests: The authors declare no conflict of interest.

References [1] H. Bowen, A. Kelly, T. Lee, P. Lavender, Control of cytokine gene transcription in Th1 and Th2 cells, Clin. Exp. Allergy 38 (2008) 1422-1431. [2] S.T. Holgate, Innate and adaptive immune responses in asthma, Nat. Med. 18 (2012) 673-683. [3] J. Das, C.H. Chen, L. Yang, L. Cohn, P. Ray, A. Ray, A critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammation, Nat. Immunol. 2 (2001) 45-50. [4] R.F. Lemanske, Jr., W.W. Busse, Asthma: clinical expression and molecular mechanisms, J. Allergy Clin. Immunol. 125 (2010) S95-102. [5] D.A. Kuperman, X. Huang, L.L. Koth, G.H. Chang, G.M. Dolganov, Z. Zhu, J.A. Elias, D. Sheppard, D.J. Erle, Direct effects of interleukin-13 on epithelial cells cause airway hyperreactivity and mucus overproduction in asthma, Nat. Med. 8 (2002) 885-889. [6] M. Wills-Karp, Immunologic basis of antigen-induced airway hyperresponsiveness, Annu. Rev. Immunol. 17 (1999) 255-281. [7] D. Robinson, Q. Hamid, A. Bentley, S. Ying, A.B. Kay, S.R. Durham, Activation of CD4+ T cells, increased TH2-type cytokine mRNA expression, and eosinophil recruitment in bronchoalveolar lavage after allergen inhalation challenge in patients with atopic asthma, J. Allergy Clin. Immunol. 92 (1993) 313-324. [8] S. Djuranovic, A. Nahvi, R. Green, A parsimonious model for gene regulation by miRNAs, Science 331 (2011) 550-553. [9] E.V. Makeyev, T. Maniatis, Multilevel regulation of gene expression by microRNAs, Science 319 (2008) 1789-1790. [10] L. He, G.J. Hannon, MicroRNAs: small RNAs with a big role in gene regulation, Nat. Rev. Genet.

5 (2004) 522-531. [11] C. Xiao, K. Rajewsky, MicroRNA control in the immune system: basic principles, Cell 136 (2009) 26-36. [12] T.X. Lu, A. Munitz, M.E. Rothenberg, MicroRNA-21 is up-regulated in allergic airway inflammation and regulates IL-12p35 expression, J. Immunol. 182 (2009) 4994-5002. [13] J. Mattes, A. Collison, M. Plank, S. Phipps, P.S. Foster, Antagonism of microRNA-126 suppresses the effector function of TH2 cells and the development of allergic airways disease, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 18704-18709. [14] A. Collison, J. Mattes, M. Plank, P.S. Foster, Inhibition of house dust mite-induced allergic airways disease by antagonism of microRNA-145 is comparable to glucocorticoid treatment, J. Allergy Clin. Immunol. 128 (2011) 160-167 e4. [15] A. Zech, C.K. Ayata, F. Pankratz, A. Meyer, K. Baudiss, S. Cicko, G.G. Yegutkin, S. Grundmann, M. Idzko, MicroRNA-155 modulates P2R signaling and Th2 priming of dendritic cells during allergic airway inflammation in mice, Allergy 70 (2015) 1121-1129. [16] C. Malmhall, S. Alawieh, Y. Lu, M. Sjostrand, A. Bossios, M. Eldh, M. Radinger, MicroRNA-155 is essential for T(H)2-mediated allergen-induced eosinophilic inflammation in the lung, J. Allergy Clin. Immunol. 133 (2014) 1429-1438, 38 e1-7. [17] Y.Y. Zhang, M. Zhong, M.Y. Zhang, K. Lv, [Expression and clinical significance of miR-155 in peripheral blood CD4(+);T cells of patients with allergic asthma], Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi, 28 (2012) 540-543. [18] E. Sonkoly, A. Pivarcsi, Advances in microRNAs: implications for immunity and inflammatory diseases, J. Cell Mol. Med. 13 (2009) 24-38.

[19] A. Rodriguez, E. Vigorito, S. Clare, M.V. Warren, P. Couttet, D.R. Soond, S. van Dongen, R.J. Grocock, P.P. Das, E.A. Miska, D. Vetrie, K. Okkenhaug, A.J. Enright, G. Dougan, M. Turner, A. Bradley, Requirement of bic/microRNA-155 for normal immune function, Science 316 (2007) 608-611. [20] T.H. Thai, D.P. Calado, S. Casola, K.M. Ansel, C. Xiao, Y. Xue, A. Murphy, D. Frendewey, D. Valenzuela, J.L. Kutok, M. Schmidt-Supprian, N. Rajewsky, G. Yancopoulos, A. Rao, K. Rajewsky, Regulation of the germinal center response by microRNA-155, Science 316 (2007) 604-608. [21] M. Weckmann, A. Collison, J.L. Simpson, M.V. Kopp, P.A. Wark, M.J. Smyth, H. Yagita, K.I. Matthaei, N. Hansbro, B. Whitehead, P.G. Gibson, P.S. Foster, J. Mattes, Critical link between TRAIL and CCL20 for the activation of TH2 cells and the expression of allergic airway disease, Nat. Med. 13 (2007) 1308-1315. [22] E.C. Cates, R. Fattouh, J. Wattie, M.D. Inman, S. Goncharova, A.J. Coyle, J.C. Gutierrez-Ramos, M. Jordana, Intranasal exposure of mice to house dust mite elicits allergic airway inflammation via a GM-CSF-mediated mechanism, J. Immunol. 173 (2004) 6384-6392. [23] P.J. Barnes, Regulation of the germinal center response by microRNA-155, J. Clin. Invest. 118 (2008) 3546-3556. [24] M. Wills-Karp, F.D. Finkelman, Untangling the complex web of IL-4- and IL-13-mediated signaling pathways, Sci. Signal 1 (2008) pe55. [25] S. Schnyder-Candrian, D. Togbe, I. Couillin, I. Mercier, F. Brombacher, V. Quesniaux, F. Fossiez, B. Ryffel, B. Schnyder, Interleukin-17 is a negative regulator of established allergic asthma, J. Exp. Med. 203 (2006) 2715-2725. [26] A. Krek, D. Grün, M.N. Poy, R. Wolf, L. Rosenberg, E.J. Epstein, P. MacMenamin, I. da

Piedade, K.C. Gunsalus, M. Stoffel, N. Rajewsky, Combinatorial microRNA target predictions, Nat. Genet. 37 (2005) 495-500. [27] B. John, A.J. Enright, A. Aravin, T. Tuschl, C. Sander, D.S. Marks, Human MicroRNA targets, PLoS Biol. 2 (2004) e363. [28] A. Grimson, K.K. Farh, W.K. Johnston, P. Garrett-Engele, L.P. Lim, D.P. Bartel, MicroRNA targeting specificity in mammals: determinants seed pairing, Mol. Cell 27 (2007) 91-105. [29] M.F. Krummel, J.P. Allison, CTLA-4 engagement inhibits IL-2 accumulation and cell cycle progression upon activation of resting T cells, J. Exp. Med. 183 (1996) 2533-2540. [30] T.L. Walunas, C.Y. Bakker, J.A. Bluestone, CTLA-4 ligation blocks CD28-dependent T cell activation, J. Exp. Med. 183 (1996) 2541-2550. [31] C. Ober, N.J. Cox, M. Abney, A. Di Rienzo, E.S. Lander, B. Changyaleket, H. Gidley, B. Kurtz, J. Lee, M. Nance, A. Pettersson, J. Prescott, A. Richardson, E. Schlenker, E. Summerhill, S. Willadsen, R. Parry, Genome-wide search for asthma susceptibility loci in a founder population. The Collaborative Study on the Genetics of Asthma, Hum. Mol. Genet. 7 (1998) 1393-1398. [32] M.N. Blumenthal, C.D. Langefeld, K.C. Barnes, C. Ober, D.A. Meyers, R.A. King, T.H. Beaty, S.R. Beck, E.R. Bleecker, S.S. Rich, A genome-wide search for quantitative trait loci contributing to variation in seasonal pollen reactivity, J. Allergy Clin. Immunol. 117 (2006) 79-85. [33] L.M. Bu, M. Bradley, C. Soderhall, C.F. Wahlgren, I. Kockum, M. Nordenskjold, Susceptibility loci for atopic dermatitis on chromosome 21 in a Swedish population, Allergy 61 (2006) 617-621. [34] L.F. Lu, T.H. Thai, D.P. Calado, A. Chaudhry, M. Kubo, K. Tanaka, G.B. Loeb, H. Lee, A. Yoshimura, K. Rajewsky, A.Y. Rudensky, Foxp3-dependent microRNA155 confers competitive fitness to regulatory T cells by targeting SOCS1 protein, Immunity 30 (2009) 80-91.

[35] E. Sonkoly, P. Janson, M.L. Majuri, T. Savinko, N. Fyhrquist, L. Eidsmo, N. Xu, F. Meisgen, T. Wei, M. Bradley, J. Stenvang, S. Kauppinen, H. Alenius, A. Lauerma, B. Homey, O. Winqvist, M. Stahle, A. Pivarcsi, MiR-155 is overexpressed in patients with atopic dermatitis and modulates T-cell proliferative responses by targeting cytotoxic T lymphocyte-associated antigen 4, J. Allergy Clin. Immunol. 126 (2010) 581-589 e1-20. [36] R. Yao, Y.L. Ma, W. Liang, H.H. Li, Z.J. Ma, X. Yu, Y.H. Liao, MicroRNA-155 modulates Treg and Th17 cells differentiation and Th17 cell function by targeting SOCS1, PLoS One 7 (2012) e46082. [37] R.M. O'Connell, D. Kahn, W.S. Gibson, J.L. Round, R.L. Scholz, A.A. Chaudhuri, M.E. Kahn, D.S. Rao, D. Baltimore, MicroRNA-155 promotes autoimmune inflammation by enhancing inflammatory T cell development, Immunity 33 (2010) 607-619. [38] Y. Zhang, M. Zhang, X. Li, Z. Tang, X. Wang, M. Zhong, Q. Suo, Y. Zhang, K. Lv, Silencing MicroRNA-155 Attenuates Cardiac Injury and Dysfunction in Viral Myocarditis via Promotion of M2 Phenotype Polarization of Macrophages, Sci. Rep. 6 (2016) 22613. [39] P. Waterhouse, J.M. Penninger, E. Timms, A. Wakeham, A. Shahinian, K.P. Lee, C.B. Thompson, H. Griesser, T.W. Mak, Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4, Science 270 (1995) 985-988. [40] E.A. Tivol, F. Borriello, A.N. Schweitzer, W.P. Lynch, J.A. Bluestone, A.H. Sharpe, Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4, Immunity 3 (1995) 541-547. [41] P.W. Hellings, P. Vandenberghe, A. Kasran, L. Coorevits, L. Overbergh, C. Mathieu, J.L. Ceuppens, Blockade of CTLA-4 enhances allergic sensitization and eosinophilic airway

inflammation in genetically predisposed mice, Eur. J. Immunol. 32 (2002) 585-594. [42] K.Y. Jen, M. Campo, H. He, S.S. Makani, G. Velasco, D.M. Rothstein, D.L. Perkins, P.W. Finn, CD45RB ligation inhibits allergic pulmonary inflammation by inducing CTLA4 transcription, J. Immunol. 179 (2007) 4212-4218. [43] J.R. Abrams, M.G. Lebwohl, C.A. Guzzo, B.V. Jegasothy, M.T. Goldfarb, B.S. Goffe, A. Menter, N.J. Lowe, G. Krueger, M.J. Brown, R.S. Weiner, M.J. Birkhofer, G.L. Warner, K.K. Berry, P.S. Linsley, J.G. Krueger, H.D. Ochs, S.L. Kelley, S. Kang, CTLA4Ig-mediated blockade of T-cell costimulation in patients with psoriasis vulgaris, J. Clin. Invest. 103 (1999) 1243-1252. [44] I. Goya, R. Villares, A. Zaballos, J. Gutierrez, L. Kremer, J.A. Gonzalo, R. Varona, L. Carramolino, A. Serrano, P. Pallares, L.M. Criado, R. Kolbeck, M. Torres, A.J. Coyle, J.C. Gutierrez-Ramos, A.C. Martinez, G. Marquez, Absence of CCR8 does not impair the response to ovalbumin-induced allergic airway disease, J. Immunol. 170 (2003) 2138-2146.

Figure Legends Fig. 1. Expression and regulation of miR-155 in Df1-induced asthma. (A) Heat map of miRNA array data from control and asthma mice lungs. (B) RT-PCR analysis of miR-155 expression in control and asthma mice lungs. (C) miR-155 expression in lung infiltrating cells from asthma mice. (D) miR-155 expression in splenic CD4+ T cells isolated from asthma mice treated with Df1 (25 µg/ml) for 3 or 6 days. Representative results are derived from three independent experiments and bar graph data depicts a mean ± SD (n = 6 – 10 mice/group); *P < 0.05 and **P < 0.01 relative to the control. Fig. 2. miR-155 overexpression promotes the induction of lung inflammation in Df1-induced asthma. (A) Total lung resistance as a percentage change of the baseline measurement (water) in response to inhaled methacholine in Df1-induced asthma mice treated with miR-155 agomirs or a scrambled miRNAs (control). Results are displayed as a mean ± SD (n = 6 – 10 mice/group). (B) Representative images of histologic lung sections stained with H&E or PAS stains. Scale bars: 100 µm for H&E (original magnification ×200) and 50 µm for PAS (original magnification ×400). (C) Number of mucus-producing cells per HPF. (D-E) Number of total cells and inflammatory cell types in BALF. Representative results are derived from three independent experiments and bar graph data depicts a mean ± SD (n = 6 – 10 mice/group); *P < 0.05 relative to the control. Fig. 3. miR-155 overexpression increases serum total IgE levels. (A) Serum total IgE and (B) Df1-specific IgG1/IgG2a in control and miR-155 treated mice. Results are displayed as a mean ± SD (n = 6 – 10 mice/group) and representative results are derived from three independent experiments. Bar graph data depicts a mean ± SD; **P < 0.01 relative to the control. Fig. 4. miR-155 overexpression increases Th2 and Th17 cytokine expression in Df1-induced asthma lungs. (A-E) Quantification of IFN-γ, IL-4, IL-5, IL-13 and IL-17A by ELISA (n = 6

mice/group) in homogenized lung samples. Representative results are derived from three independent experiments and bar graph data depicts a mean ± SD; *P < 0.05 relative to the control. Fig. 5. miR-155 overexpression enhances CD4+ T-cell activation and Th2 responses in the lung of Df1-induced asthma. Fresh lung tissue was collected from control and miR-155 treated mice. (A) Activated CD4+ T cells were determined by surface CD62Llow expression. (B) The proportion of CD4+IFN-γ+, CD4+IL-4+, CD4+CD25high, CD4+IL-17+ T cells was analyzed by FACS. A representative result are derived from three independent experiments. Bar graph data depicts a mean ± SD (n = 6-10 mice/group); *P < 0.05 as compared with control. Fig. 6. CTLA-4 is a functional target of miR-155. (A) Mutations in the CTLA-4 3′ UTR. (B) Luciferase activity of reporter carrying the mutated (Mut) or wild-type (WT) CTLA-4 3′ UTR cotransfected into HEK293T cells with miR-155. (C) Luciferase activity of reporter carrying the mutated (Mut) or wild-type (WT) CTLA-4 3′ UTR cotransfected into HEK293T cells with miR-155 antagonists or scrambled control. (D) Expression of CTLA-4 in CD4+ T cells transfected with miR-155 antagonists or scrambled control. (E) CD4+ T-cell proliferation measured by means of incorporation of tritiated thymidine after transfection of naive CD4+ T cells with either miR-155 agonists, antagonists, or their scrambled control. Proliferation was measured at day 3 after stimulation with anti-CD3/CD28 antibody. A representative result are derived from three independent experiments.. Bar graph data depicts a mean ± SD; *P < 0.05, **P < 0.01, and ***P < 0.001 as compared with control.

Table 1. Primer sequences used in real-time PCR are written in 5’- 3’ direction. Genes CTLA-4 GAPDH

Primer (5’- 3’) AACCTTCAGTGGTGTTGGCTA GTCATTTGGTCATTTGTCTGC GGTTGTCTCCTGCGACTTCA TGGTCCAGGGTTTCTTACTCC

Highlights miR-155

overexpression

resulted

in

enhanced

inflammation

and

mucus

hypersecretion in the lungs of allergen-challenged mice compared with control animals. miR-155 overexpression in CD4 + T cells resulted in decreased CTLA-4 levels and a subsequent increased proliferative response. These findings may be a potential therapeutic target for allergic asthma.