- Email: [email protected]
MiR-182 promotes glioma progression by targeting FBXW7
Journal of the Neurological Sciences 411 (2020) 116689
Contents lists available at ScienceDirect
Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns
MiR-182 promotes glioma progression by targeting FBXW7 Shiming Liu, Hanbo Liu, Min Deng, Haowen Wang
⁎
T
Department of Interventional Medicine, Zhejiang Provincial People's Hospital, People's Hospital of Hangzhou Medical College, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: miR-182 FBXW7 Glioma Proliferation Migration and invasion Apoptosis
Objective: MicroRNAs (miRNAs) are widely considered to play an important role in the tumor progression. In this study, we aimed to investigate the potential biological effects of miR-182 and its target FBXW7 on glioma development. Methods: Expression data of glioma were procured from TCGA database. Differential analysis was performed to identify the potential differentially expressed miRNA (DEmiRNA), and bioinformatics databases were utilized for target genes prediction. qRT-PCR was conducted to detect miR-182 and western blot was performed to test FBXW7 in protein level. Then the cells were processed for proliferation determination by CCK-8, migration test through wound healing assay, invasion detection via Transwell and apoptosis measurement by flow cytometry. In addition, dual-luciferase reporter gene assay was carried out for evaluation of the targeted relationship between the miR-182 and FBXW7. Results: MiR-182 was found to be up-regulated in glioma cells while FBXW7 was down-regulated. Besides, miR182 was predicted to targeted bind with FBXW7 on 3’UTR via bioinformatics methods, and their targeted relationship was further validated by dual-luciferase assay. MiR-182 mimic could significantly promote cell proliferation, migration, invasion and inhibit cell apoptosis, while miR-182 inhibitor had the negative effect. Moreover, FBXW7 knockdown could reverse the inhibitory effect of miR-182 inhibitor on glioma cells. Conclusion: MiR-182 promotes cell proliferation, migration, invasion and inhibits cell apoptosis in glioma by targeting FBXW7.
1. Introduction Glioma is the most frequent intrinsic tumor of the central nervous system encompassing two principle subgroups: diffuse glioma and glioma (non-diffuse glioma) [1]. Malignant glioma is regarded as one of the most lethal cancers, accounting for about 60% of all primary brain neoplasms [2]. Meanwhile, it is characterized by poor prognosis and survival, which severely threatens human health and life [3]. Therefore, in-depth study of the potential mechanism in glioma development is of great importance for glioma diagnosis and treatment. MicroRNAs (miRNAs) are highly conserved small non-coding RNAs (about 22 nucleotides in length) participating in the regulation of gene expression in a post-transcription level through degrading their target mRNAs or inhibiting protein translation [4]. The biogenesis of miRNAs is strictly mediated by multiple activities, such as the transcription, the process by Drosha and Dicer, and the transportation process of premiRNAs from the nucleus to cytoplasm by exportin-5 [5]. Notably, miRNAs are involved in > 60% of total human protein-coding genes [6]. Studies recently have shown that miRNAs activate in various
biological processes, such as cell proliferation and apoptosis, tissue homeostasis, organ development and human diseases [7]. MiR-182 is a member of miR-183/96/182 cluster and is present on human autosome 7q31–34. Increasing evidences have indicated that miR-182 participates in the tumorigenesis and development, and plays a promotive role in cell proliferation and invasion, angiogenesis and distant metastasis [8]. Meanwhile, miR-182 serving as an important regulator can target different downstream genes in various malignancies. In glioma, the role of miR-182 has not been illuminated at present, and there is no report on its target gene. Thus, it is worthy of further research on miR-182 for future cancer diagnosis and treatment. FBXW7, a member of F-box protein family, has three types in mammal cells: FBXW7α, FBXW7β and FBXW7γ [9]. FBXW7 is one of the most common mutant genes in human cancers [10], and it has been proved to play an anti-tumor role through inducing the ubiquitination and follow-up degradation of various oncoproteins [11,12]. Due to the frequent inactivation or deletion in human cancers, FBXW7 can be utilized as a promising therapeutic target for anticancer treatment [11]. In this study, we aimed to investigate the roles of miR-182 and its
⁎ Corresponding author at: Department of Interventional Medicine, Zhejiang Provincial People's Hospital, People's Hospital of Hangzhou Medical College, 158 Shangtang Road, Hangzhou 310000, Zhejiang, PR China. E-mail address: [email protected] (H. Wang).
https://doi.org/10.1016/j.jns.2020.116689 Received 29 October 2019; Received in revised form 24 December 2019; Accepted 15 January 2020 Available online 16 January 2020 0022-510X/ © 2020 Elsevier B.V. All rights reserved.
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
30s and 72 °C for 42 s. The primers used in PCR were listed in Table 1. Relative expression levels of miR-182 and FBXW7 were calculated by 2ΔΔCt . The experiment was repeated three times.
target FBXW7 in glioma progression, which may provide us with a novel therapeutic target in glioma treatment. 2. Materials and methods
2.5. Western blot 2.1. Bioinformatics analysis After 24 h of transfection, cells were rinsed with cold phosphatebuffered saline (PBS). Total proteins in cells were extracted by the Radio Immunoprecipitation Assay lysate buffer (RIPA; Thermo Fisher Scientific, MA, USA) containing 1 mM Phenylmethanesulfonyl fluoride (PMSF; Sigma-Aldrich, Shanghai, China), and quantitated by a bicinchoninic acid quantitation kit (BCA; Thermo Fisher Scientific, Rockford, IL, USA). Then the proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with 10 μl loading buffer, and transferred onto the nitrocellulose membrane (ZY160FP, Zeye Bio Co., Ltd., Shanghai, China), which was then blocked by 5% BSA/TBST for 2 h. Primary antibody rabbit polyclonal antibody FBXW7 (ab109617; 1:4000) was added into the membrane for incubation overnight at 4 °C, with GAPDH (ab181602; 1:10000) as a control. On the following day, the membrane was washed by 1 × TBST solution on a shaker for three times. Then, secondary antibody horseradish peroxidase (HRP)-labeled goat anti-rabbit (ab205718; 1:1000) was added onto the membrane and incubated at room temperature for 2 h. Protein bands were visualized by enhanced chemiluminescence reagents (ECL808–25, Biomiga Inc., San Diego, USA), and exposed by LAS-4000 CCD camera system. Relative intensity of the bands was analyzed by Image-Pro Plus 6.0 (Media Cybernetics, Maryland, USA). The experiment was repeated three times.
Expression profiles of glioma-associated genes were obtained from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer. gov/), including 5 normal samples and 530 glioma tissue samples. “edgeR” package of R language was used to perform differential analysis with the normal samples as control (|logFC| > 2 and adj.pvalue < 0.05). miRDB (http://mirdb.org/miRDB/index.html), miRTarBase (http://mirtarbase.mbc.nctu.edu.tw/php/index.php), and TargetScan (http://www.targetscan.org/vert_71/) three databases were applied to predict the target genes of the potential differentially expressed miRNA (DEmiRNA). Venn diagram was plotted to find the potential target gene, which was then analyzed in survival analysis. 2.2. Cell culture Human normal primary astrocyte NHA and glioma cell lines LN18, U87, U118 and T98 were purchased from the American Type Culture Collection (ATCC). All cells were cultured in the Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and maintained in 5% CO2 at 37 °C. 2.3. Cell transfection and vector construction
2.6. CCK-8
Glioma cells in the logarithmic phase were divided into seven groups: NC mimic, miR-182 mimic, NC inhibitor, miR-182 inhibitor, NC inhibitor+sh-NC, miR-182 inhibitor+sh-NC, miR-182 inhibitor+shFBXW7. After transfection under the serum-free condition using Lipofectamine®2000 (Invitrogen, Carlsbad, USA), cells were cultured in the corresponding mediums with 5% CO2 at 37 °C for 6 h, then continuously cultured with fresh mediums for another 48 h for follow-up experiments. MiR-182 mimic, miR-182 inhibitor and their NCs were purchased from GenePharma (Shanghai, China). Sequences were as follows: NC mimic: 5′-ACAUCUGCGUAAGAUUCGAGUCUA-3′; MiR-182 mimic: 5′-UUUGGCAAUGGUAGAACUCACACU-3′; NC inhibitor: 5’-GCGTAACTAATACATCGGATTCGT-3′; MiR-182 inhibitor: 5′-AGUGUGAGUUCUACCAUUGCCAAA-3′.
LN18 cells were seeded into 24-well plates at a density of 6 × 105cells/well. After transfection for 24, 48 and 72 h, respectively, 10 μl of reagent supplied by Cell Counting kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added into each well for 2 h of incubation at 37 °C. Then, optical density (OD)was determined at each time point using a Tecan Infinite F 200 enzyme-labeled instrument (Crailsheim, Germany). The experiment was repeated three times. 2.7. Flow cytometry Annexin V-FITC and Propidium iodide (PI) kit (HaiGene, Harbin, China) were used for apoptosis detection. Cells were firstly digested with trypsin, and resuspended into the binding buffer at a concentration of 1 × 10 [ 5]/ ml. Then, apoptotic cells were countered using the Guava® flow cytometer (Millipore, MA, USA) and analyzed by FlowJo software (FlowJo, LLC). The percentage of cells with positive Annexin V-FITC and negative PI was compared among various treatment groups. The experiment was repeated three times.
2.4. qRT-PCR Total RNA was extracted from cells using a Trizol kit (Invitrogen Life Technologies, Carlsbad, CA, USA), and then quantitated by DNase I (Sigma-Aldrich, St. Louis, MO, USA), following the manufacturer's instructions. A qScript microRNA cDNA synthesis kit (Quantabio, Beverly, MA) was employed to synthesize miRNA cDNA, and a cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) was utilized for cDNA synthesis from the 1 μg of total FBXW7 RNA. U6 and GAPDH were taken as the internal references. qRT-PCR was carried out using the miScript SYBR Green PCR Kit (Qiagen, Hilden, Germany) under the following thermocycler conditions: 40 cycles of 95 °C for 15 s, 58 °C for
2.8. Wound healing assay When cells grown to 70–80% in confluence, a scratch was made on the monolayer that through the hole center using a 200 μl pipette. Separated cells were washed off by mediums twice. Cells were grown
Table 1 Primer sequence. Gene
Forward
Reverse
miR-182 GAPDH FBXW7 U6
TTAGGAACCCTCCTCTCTC GGAGCGAGATCCCTCCAAAAT GGCCAAAATGATTCCCAGCAA GCTTCGGCAGCACATATACTAAAAT
CGGTGATGTGAAGAAGGA GGCTGTTGTCATACTTCTCATGG ACTGGAGTTCGTGACACTGTTA CGCTTCAGAATTTGCGTGTCAT
2
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
Fig. 1. MiR-182 expression was up-regulated in glioma tissues and cells. A: MiR-182 expression profile was obtained from TCGA database; B: qRT-PCR was performed to detect the expression of miR-182 in normal glia and glioma cell lines. Note: “*” refers to P < .05, “**” refers to P < .01.
Fig. 2. MiR-182 promoted the proliferation, migration and invasion of glioma cells and inhibited cell apoptosis in vitro. A: Cell proliferation was determined after transfection with NC mimic, miR-182 mimic, NC inhibitor and miR-182 inhibitor; B: Cell migration was detected by wound healing assay; C: Cell invasion was detected by Transwell assay; D: Cell apoptosis was detected by flow cytometry. Note: “#” means P < .05; “*” means P < .05; “**” means P < .01.
2.9. Invasion assay
for another 24 h with fresh mediums and the scratches were observed under the microscope. The width of the scrape was measured and the migration rate was formulated as: migration rate (%) = (As-Ab)/(AcAb) × 100%. Ab, Ac and As refer to the OD value of the blank control group, normal group and experimental group, respectively. The experiment was repeated three times.
24-well Transwell inserts (8 μm in aperture, BD Biosciences) were used in this experiment. Around 2 × 104 cells were plated into the Matrigel matrix-coated (Corning, NY) upper chamber, and DMEM containing 10% FBS was added into the lower chamber. After 24 h of incubation at 37 °C, non-invasive cells were removed by a cotton swab, and invasive cells were stained with crystal violet. Four regions were 3
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
Fig. 3. MiR-182 targeted down-regulated FBXW7 expression. A: Venn diagram was plotted to find the potential target genes; B: FBXW7 was down-regulated in tumor tissues; C: The correlation between miR-182 and FBXW7 protein levels; D: Survival analysis FBXW7 in TCGA dataset; E: Targeted binding sites of miR-182 on FBXW7; F: The luciferase activity in LN18 cells after the cotransfection of FBXW7-wt and FBXW7-mt constructs with miR-182 mimic or miR-182 inhibitor; G, H: The expression levels of FBXW7 mRNA and miR-182 in LN18 cells were detected by qRT-PCR after transfection with NC mimic, miR-182 mimic, NC inhibitor and miR-182 inhibitor; I: The protein level of FBXW7 in LN18 cells was analyzed by western blot after transfection with the four plasmids. Note: “#” means P < .05; “*” means P < .05; “**” means P < .01.
3. Results
randomly selected under the microscope and the relative invasion rate was calculated.
3.1. MiR-182 was up-regulated in glioma tissues and cells MiR-182 was found to be expressed in 530 glioma tissue samples and 5 normal samples included in TCGA database, and showed significant up-regulation in glioma tissues (Fig. 1A). qRT-PCR showed that compared to human normal astrocyte NHA, miR-182 expression was significantly up-regulated in human glioma cell lines LN18, U87, U118 and T98 (Fig. 1B). As the elevation in LN18 cell line was the most significant, thus LN18 cells were selected for subsequent experiments.
2.10. Dual-luciferase assay Sequence of FBXW7 3′UTR was amplified and inserted into the pmirGLO vector (Promega, WI, USA). Mutant sequence of FBXW7 3’UTR was formed by site-directed mutagenesis technique using Invitrogen (California, USA) according to the manufacturer's instructions. LN18 cells were seeded into the 24-well plates and incubated for 24 h. MiR-182 mimic, miR-182 inhibitor and their negative controls were respectively co-transfected with firefly luciferase constructions wild type FBXW7 3′UTR (FBXW7-wt) and mutant type FBXW7 3′UTR (FBXW7-mt) into LN18 cells. 48 h later, cells were collected and luciferase activities were assessed by a Dual-Luciferase Reporter Assay Kit (Promega, USA) according to the manufacturer's protocols. The experiment was repeated three times.
3.2. MiR-182 promoted proliferation, invasion and migration of glioma cells and inhibited cell apoptosis In order to investigate the role of miR-182 in glioma progression, NC mimic, NC inhibitor, miR-182 mimic and miR-182 inhibitor were transfected into LN18 cells for 24 h, respectively. CCK-8 was performed to detect cell proliferation. As shown in Fig. 2A, the up-regulation of miR-182 significantly promoted LN18 cell proliferation, while the down-regulation of miR-182 showed the negative result. Then, wound healing assay and Transwell assay were carried out to determine cell migration and invasion. As shown in Fig. 2B and C, cells transfected with miR-182 mimic had significantly high migration and invasion ability by comparison with those transfected with NC mimic. Meanwhile, cells transfected with miR-182 inhibitor had significantly low migration and invasion ability by comparison with those transfected with NC inhibitor. The effect of miR-182 on cell apoptosis was subsequently analyzed by flow cytometry. As shown in Fig. 2D, compared with the cells transfected with NC mimic, cells transfected with miR-
2.11. Statistical analysis All data were processed by SPSS 22.0 statistical software (IBM Corp. Armonk, NY, USA). Measurement data were presented in the form of mean ± standard deviation (M ± SD). Comparison between two groups was performed by t-test, and comparison among multiple groups was performed by one-way ANOVA. P < .05 was considered statistically significant.
4
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
Fig. 4. MiR-182 promoted the proliferation, migration and invasion of glioma cells and inhibited cell apoptosis by inhibiting FBXW7. A: MiR-182 inhibitor was co-transfected with sh-NC or sh-FBXW7 into LN18 cells for cell proliferation determination; B: Migration detection with wound healing assay; C: Invasion detection with Transwell; D: Apoptosis determination. Note: “*” refers to P < .05.
level exhibited the similar expression trend as indicated by western blot (Fig. 3I). Therefore, miR-182 could negatively regulate the expression of FBXW7.
182 mimic had a much lower apoptosis rate, while cells transfected with miR-182 inhibitor had a higher rate of apoptosis than cells transfected with NC inhibitor. Thus, it could be seen that the overexpression of miR-182 promoted the proliferation, migration and invasion of glioma cells and inhibited cell apoptosis.
3.4. MiR-182 promoted proliferation, invasion and migration of glioma cells and inhibited cell apoptosis through inhibiting FBXW7
3.3. FBXW7 was a direct target of miR-182 In order to evaluate the importance of miR-182/FBXW7 in glioma cell proliferation, migration, invasion and apoptosis, various experiments were performed. MiR-182 inhibitor was co-transfected with shNC and sh-FBXW7 into LN18 cells, respectively. As shown in Fig. 4A, miR-182 inhibitor inhibited cell proliferation, while FBXW7 knockdown could reverse such inhibitory effect. Wound healing assay and Transwell were performed to detect cell migration and invasion. As shown in Fig. 4B and C, cell migration and invasion were suppressed in cells transfected with miR-182 inhibitor and sh-NC, but such effect was then abrogated after sh-FBXW7 was simultaneously transfected. Similar, as shown in Fig. 4D, miR-182 inhibitor promoted the cell apoptosis, but FBXW7 knockdown abolished this promotive effect. In view of these findings, miR-182 was found to promote the proliferation, migration and invasion of glioma cells, and inhibit cell apoptosis by inhibiting FBXW7.
miRNA, miRTarBase, TargetScan three databases were used to predict target genes of miR-182. As shown in Fig. 3A, Venn diagram result showed that eventually 4 DEmiRNAs had binding sites with miR182, including NPTX1, FBXW7, STK17B and ATP8A2, among which FBXW7 was down-regulated in tumor tissues (Fig. 3B) and exhibited negative correlation with miR-182 expression (Fig. 3C). Survival analysis was performed and suggested that patients with low FBXW7 expression had poor survival relative to those with high expression (Fig. 3D). Then, miR-182 was predicted to targeted bind to FBXW73’UTR by TargetScan database (Fig. 3E). In order to verify their relationship, luciferase constructs FBXW7-wt and FBXW7-mt were constructed and co-transfected with miR-182 mimic or miR-182 inhibitor into LN18 cells. Dual-luciferase assay was then performed. As shown in Fig. 3F, the luciferase activity was decreased in the co-transfection group of miR-182 mimic and FBXW7-wt by comparison with that in the negative control group, while the luciferase activity was increased in the co-transfection group of miR-182 inhibitor and FBXW7-wt. The results confirmed that miR-182 targeted FBXW7 and decreased its expression. qRT-PCR and western blot were further performed to analyze the effect of miR-182 on FBXW7. Results showed that in miR-182 mimic-transfected cells (Fig. 3G), FBXW7 was significantly downregulated in mRNA level, but greatly up-regulated (Fig. 3H) in miR-182 inhibitor-transfected cells (Fig. 3G). Consistently, FBXW7 in the protein
4. Discussion MiRNAs are emerged as a promising diagnostic tool due to its role in tumorigenesis and stability in body fluids [13]. MiR-182, one of the oncogenic miRNAs most studied, is found to be dysregulated in various caner tissues and play a key role in tumorigenesis and development [14]. For example, miR-182 acting as an oncogene promotes the progression of prostate cancer by activating the Wnt / β-catenin signaling 5
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
Declaration of Competing Interest
pathway [15]. Besides, miR-182 can directly participate in cancer invasion through linking RET oncogene activated NF-κB to loss of the HES1 / Notch1 signaling pathway [16]. In gastric cancer, miR-182-5p promotes cell viability, mitosis, migration and invasion by down-regulating RAB27A [17]. In present study, miR-182 was found to be upregulated in glioma tissues and cells. In addition, miR-182 mimic and miR-182 inhibitor were transfected into LN18 cells, respectively, finding that miR-182 overexpression could significantly promote cell proliferation, migration, invasion and inhibit cell apoptosis, while miR182 inhibitor could significantly weaken such effects. The role of miR182 in glioma investigated in this study is consistent with that studied in prostatic cancer [15], breast cancer [7], non-small cell lung cancer [18] and malignant pleural mesothelioma [19]. FBXW7 is one of the crucial components of ubiquitin ligase and can aid in the degradation of various oncoproteins [20]. It is regarded as a typical tumor suppressor with loss-of-function mutations occurring in human cancers [21]. In this study, FBXW7 was confirmed to be downregulated in glioma tissues and cells, and exhibited negative correlation with miR-182 expression. In addition, we discovered that miR-182 regulated FBXW7 expression via targeted binding to the FBXW7 3’UTR, which was consistent with the studies of non-small cell lung cancer [18] and breast cancer [7]. However, the role of such targeted relationship in glioma has not been studied. Therefore, some relevant experiments were made and found that miR-182 could promote the proliferation, migration and invasion of glioma cells as well as inhibit cell apoptosis by targeted down-regulating FBXW7, thereby promoting glioma tumorigenesis and development. In conclusion, the regulatory effect of miR-182 on FBXW7 was identified in this study, and the role of this targeted relationship in the biological behaviors of glioma cells was studied as well. Our study helps us better understand the role of miR-182 in glioma cells and opens up new possibilities for more therapeutic strategies. Meanwhile, for subsequent experiments on the specific molecular mechanism of the targeted relationship in glioma progression, the results we found could be potent evidence.
The authors have no conflicts of interest to declare. Acknowledgement None. References [1] P. Wesseling, D. Capper, WHO 2016 classification of gliomas, Neuropathol. Appl. Neurobiol. 44 (2018) 139–150, https://doi.org/10.1111/nan.12432. [2] P. Cui, et al., Metabolic derangements of skeletal muscle from a murine model of glioma cachexia, Skelet. Muscle 9 (2019) 3, https://doi.org/10.1186/s13395-0180188-4. [3] X. Chen, et al., MiR-9 promotes tumorigenesis and angiogenesis and is activated by MYC and OCT4 in human glioma, J. Exp. Clin. Cancer Res. 38 (2019) 99, https:// doi.org/10.1186/s13046-019-1078-2. [4] P.Y. Hsu, et al., MicroRNA let-7g possesses a therapeutic potential for peripheral artery disease, J. Cell. Mol. Med. 21 (2017) 519–529, https://doi.org/10.1111/ jcmm.12997. [5] K. Wu, J. He, W. Pu, Y. Peng, The role of Exportin-5 in MicroRNA biogenesis and cancer, Genomics Proteome. Bioinforma. 16 (2018) 120–126, https://doi.org/10. 1016/j.gpb.2017.09.004. [6] J. Cui, B. Zhou, S.A. Ross, J. Zempleni, Nutrition, microRNAs, and human health, Adv. Nutr. 8 (2017) 105–112, https://doi.org/10.3945/an.116.013839. [7] C.H. Chiang, P.Y. Chu, M.F. Hou, W.C. Hung, MiR-182 promotes proliferation and invasion and elevates the HIF-1alpha-VEGF-A axis in breast cancer cells by targeting FBXW7, Am. J. Cancer Res. 6 (2016) 1785–1798. [8] Q. Wei, R. Lei, G. Hu, Roles of miR-182 in sensory organ development and cancer, Thorac. Cancer 6 (2015) 2–9, https://doi.org/10.1111/1759-7714.12164. [9] C.H. Yeh, M. Bellon, C. Nicot, FBXW7: a critical tumor suppressor of human cancers, Mol. Cancer 17 (2018) 115, https://doi.org/10.1186/s12943-018-0857-2. [10] R.J. Davis, M. Welcker, B.E. Clurman, Tumor suppression by the Fbw7 ubiquitin ligase: mechanisms and opportunities, Cancer Cell 26 (2014) 455–464, https://doi. org/10.1016/j.ccell.2014.09.013. [11] L. Wang, X. Ye, Y. Liu, W. Wei, Z. Wang, Aberrant regulation of FBW7 in cancer, Oncotarget 5 (2014) 2000–2015, https://doi.org/10.18632/oncotarget.1859. [12] Z. Wang, et al., Tumor suppressor functions of FBW7 in cancer development and progression, FEBS Lett. 586 (2012) 1409–1418, https://doi.org/10.1016/j.febslet. 2012.03.017. [13] N. Matamala, et al., Tumor microRNA expression profiling identifies circulating microRNAs for early breast cancer detection, Clin. Chem. 61 (2015) 1098–1106, https://doi.org/10.1373/clinchem.2015.238691. [14] Y. Li, et al., MiR-182 inhibits the epithelial to mesenchymal transition and metastasis of lung cancer cells by targeting the Met gene, Mol. Carcinog. 57 (2018) 125–136, https://doi.org/10.1002/mc.22741. [15] D. Wang, G. Lu, Y. Shao, D. Xu, MiR-182 promotes prostate cancer progression through activating Wnt/beta-catenin signal pathway, Biomed. Pharmacother. 99 (2018) 334–339, https://doi.org/10.1016/j.biopha.2018.01.082. [16] A. Spitschak, C. Meier, B. Kowtharapu, D. Engelmann, B.M. Putzer, MiR-182 promotes cancer invasion by linking RET oncogene activated NF-kappaB to loss of the HES1/Notch1 regulatory circuit, Mol. Cancer 16 (2017) 24, https://doi.org/10. 1186/s12943-016-0563-x. [17] Y. Li, et al., miR-182-5p improves the viability, mitosis, migration, and invasion ability of human gastric cancer cells by down-regulating RAB27A, Biosci. Rep. 37 (2017), https://doi.org/10.1042/BSR20170136. [18] H. Chang, et al., MiR-182 promotes cell proliferation by suppressing FBXW7 and FBXW11 in non-small cell lung cancer, Am. J. Transl. Res. 10 (2018) 1131–1142. [19] R. Suzuki, et al., miR-182 and miR-183 Promote cell proliferation and invasion by targeting FOXO1 in mesothelioma, Front. Oncol. 8 (2018) 446, https://doi.org/10. 3389/fonc.2018.00446. [20] B.L. Sailo, et al., FBXW7 in cancer: what has been unraveled thus far? Cancers (Basel) 11 (2019), https://doi.org/10.3390/cancers11020246. [21] Q. Zhang, et al., FBXW7 Facilitates Nonhomologous End-Joining via K63-Linked Polyubiquitylation of XRCC4, Mol. Cell 61 (2016) 419–433, https://doi.org/10. 1016/j.molcel.2015.12.010.
Statement of ethics The authors have no ethical conflicts to disclose. Funding sources None. Availability of data and material The data used to support the findings of this study are available from the corresponding author upon request. Consent for publication Not applicable.
6
Contents lists available at ScienceDirect
Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns
MiR-182 promotes glioma progression by targeting FBXW7 Shiming Liu, Hanbo Liu, Min Deng, Haowen Wang
⁎
T
Department of Interventional Medicine, Zhejiang Provincial People's Hospital, People's Hospital of Hangzhou Medical College, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: miR-182 FBXW7 Glioma Proliferation Migration and invasion Apoptosis
Objective: MicroRNAs (miRNAs) are widely considered to play an important role in the tumor progression. In this study, we aimed to investigate the potential biological effects of miR-182 and its target FBXW7 on glioma development. Methods: Expression data of glioma were procured from TCGA database. Differential analysis was performed to identify the potential differentially expressed miRNA (DEmiRNA), and bioinformatics databases were utilized for target genes prediction. qRT-PCR was conducted to detect miR-182 and western blot was performed to test FBXW7 in protein level. Then the cells were processed for proliferation determination by CCK-8, migration test through wound healing assay, invasion detection via Transwell and apoptosis measurement by flow cytometry. In addition, dual-luciferase reporter gene assay was carried out for evaluation of the targeted relationship between the miR-182 and FBXW7. Results: MiR-182 was found to be up-regulated in glioma cells while FBXW7 was down-regulated. Besides, miR182 was predicted to targeted bind with FBXW7 on 3’UTR via bioinformatics methods, and their targeted relationship was further validated by dual-luciferase assay. MiR-182 mimic could significantly promote cell proliferation, migration, invasion and inhibit cell apoptosis, while miR-182 inhibitor had the negative effect. Moreover, FBXW7 knockdown could reverse the inhibitory effect of miR-182 inhibitor on glioma cells. Conclusion: MiR-182 promotes cell proliferation, migration, invasion and inhibits cell apoptosis in glioma by targeting FBXW7.
1. Introduction Glioma is the most frequent intrinsic tumor of the central nervous system encompassing two principle subgroups: diffuse glioma and glioma (non-diffuse glioma) [1]. Malignant glioma is regarded as one of the most lethal cancers, accounting for about 60% of all primary brain neoplasms [2]. Meanwhile, it is characterized by poor prognosis and survival, which severely threatens human health and life [3]. Therefore, in-depth study of the potential mechanism in glioma development is of great importance for glioma diagnosis and treatment. MicroRNAs (miRNAs) are highly conserved small non-coding RNAs (about 22 nucleotides in length) participating in the regulation of gene expression in a post-transcription level through degrading their target mRNAs or inhibiting protein translation [4]. The biogenesis of miRNAs is strictly mediated by multiple activities, such as the transcription, the process by Drosha and Dicer, and the transportation process of premiRNAs from the nucleus to cytoplasm by exportin-5 [5]. Notably, miRNAs are involved in > 60% of total human protein-coding genes [6]. Studies recently have shown that miRNAs activate in various
biological processes, such as cell proliferation and apoptosis, tissue homeostasis, organ development and human diseases [7]. MiR-182 is a member of miR-183/96/182 cluster and is present on human autosome 7q31–34. Increasing evidences have indicated that miR-182 participates in the tumorigenesis and development, and plays a promotive role in cell proliferation and invasion, angiogenesis and distant metastasis [8]. Meanwhile, miR-182 serving as an important regulator can target different downstream genes in various malignancies. In glioma, the role of miR-182 has not been illuminated at present, and there is no report on its target gene. Thus, it is worthy of further research on miR-182 for future cancer diagnosis and treatment. FBXW7, a member of F-box protein family, has three types in mammal cells: FBXW7α, FBXW7β and FBXW7γ [9]. FBXW7 is one of the most common mutant genes in human cancers [10], and it has been proved to play an anti-tumor role through inducing the ubiquitination and follow-up degradation of various oncoproteins [11,12]. Due to the frequent inactivation or deletion in human cancers, FBXW7 can be utilized as a promising therapeutic target for anticancer treatment [11]. In this study, we aimed to investigate the roles of miR-182 and its
⁎ Corresponding author at: Department of Interventional Medicine, Zhejiang Provincial People's Hospital, People's Hospital of Hangzhou Medical College, 158 Shangtang Road, Hangzhou 310000, Zhejiang, PR China. E-mail address: [email protected] (H. Wang).
https://doi.org/10.1016/j.jns.2020.116689 Received 29 October 2019; Received in revised form 24 December 2019; Accepted 15 January 2020 Available online 16 January 2020 0022-510X/ © 2020 Elsevier B.V. All rights reserved.
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
30s and 72 °C for 42 s. The primers used in PCR were listed in Table 1. Relative expression levels of miR-182 and FBXW7 were calculated by 2ΔΔCt . The experiment was repeated three times.
target FBXW7 in glioma progression, which may provide us with a novel therapeutic target in glioma treatment. 2. Materials and methods
2.5. Western blot 2.1. Bioinformatics analysis After 24 h of transfection, cells were rinsed with cold phosphatebuffered saline (PBS). Total proteins in cells were extracted by the Radio Immunoprecipitation Assay lysate buffer (RIPA; Thermo Fisher Scientific, MA, USA) containing 1 mM Phenylmethanesulfonyl fluoride (PMSF; Sigma-Aldrich, Shanghai, China), and quantitated by a bicinchoninic acid quantitation kit (BCA; Thermo Fisher Scientific, Rockford, IL, USA). Then the proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with 10 μl loading buffer, and transferred onto the nitrocellulose membrane (ZY160FP, Zeye Bio Co., Ltd., Shanghai, China), which was then blocked by 5% BSA/TBST for 2 h. Primary antibody rabbit polyclonal antibody FBXW7 (ab109617; 1:4000) was added into the membrane for incubation overnight at 4 °C, with GAPDH (ab181602; 1:10000) as a control. On the following day, the membrane was washed by 1 × TBST solution on a shaker for three times. Then, secondary antibody horseradish peroxidase (HRP)-labeled goat anti-rabbit (ab205718; 1:1000) was added onto the membrane and incubated at room temperature for 2 h. Protein bands were visualized by enhanced chemiluminescence reagents (ECL808–25, Biomiga Inc., San Diego, USA), and exposed by LAS-4000 CCD camera system. Relative intensity of the bands was analyzed by Image-Pro Plus 6.0 (Media Cybernetics, Maryland, USA). The experiment was repeated three times.
Expression profiles of glioma-associated genes were obtained from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer. gov/), including 5 normal samples and 530 glioma tissue samples. “edgeR” package of R language was used to perform differential analysis with the normal samples as control (|logFC| > 2 and adj.pvalue < 0.05). miRDB (http://mirdb.org/miRDB/index.html), miRTarBase (http://mirtarbase.mbc.nctu.edu.tw/php/index.php), and TargetScan (http://www.targetscan.org/vert_71/) three databases were applied to predict the target genes of the potential differentially expressed miRNA (DEmiRNA). Venn diagram was plotted to find the potential target gene, which was then analyzed in survival analysis. 2.2. Cell culture Human normal primary astrocyte NHA and glioma cell lines LN18, U87, U118 and T98 were purchased from the American Type Culture Collection (ATCC). All cells were cultured in the Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and maintained in 5% CO2 at 37 °C. 2.3. Cell transfection and vector construction
2.6. CCK-8
Glioma cells in the logarithmic phase were divided into seven groups: NC mimic, miR-182 mimic, NC inhibitor, miR-182 inhibitor, NC inhibitor+sh-NC, miR-182 inhibitor+sh-NC, miR-182 inhibitor+shFBXW7. After transfection under the serum-free condition using Lipofectamine®2000 (Invitrogen, Carlsbad, USA), cells were cultured in the corresponding mediums with 5% CO2 at 37 °C for 6 h, then continuously cultured with fresh mediums for another 48 h for follow-up experiments. MiR-182 mimic, miR-182 inhibitor and their NCs were purchased from GenePharma (Shanghai, China). Sequences were as follows: NC mimic: 5′-ACAUCUGCGUAAGAUUCGAGUCUA-3′; MiR-182 mimic: 5′-UUUGGCAAUGGUAGAACUCACACU-3′; NC inhibitor: 5’-GCGTAACTAATACATCGGATTCGT-3′; MiR-182 inhibitor: 5′-AGUGUGAGUUCUACCAUUGCCAAA-3′.
LN18 cells were seeded into 24-well plates at a density of 6 × 105cells/well. After transfection for 24, 48 and 72 h, respectively, 10 μl of reagent supplied by Cell Counting kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added into each well for 2 h of incubation at 37 °C. Then, optical density (OD)was determined at each time point using a Tecan Infinite F 200 enzyme-labeled instrument (Crailsheim, Germany). The experiment was repeated three times. 2.7. Flow cytometry Annexin V-FITC and Propidium iodide (PI) kit (HaiGene, Harbin, China) were used for apoptosis detection. Cells were firstly digested with trypsin, and resuspended into the binding buffer at a concentration of 1 × 10 [ 5]/ ml. Then, apoptotic cells were countered using the Guava® flow cytometer (Millipore, MA, USA) and analyzed by FlowJo software (FlowJo, LLC). The percentage of cells with positive Annexin V-FITC and negative PI was compared among various treatment groups. The experiment was repeated three times.
2.4. qRT-PCR Total RNA was extracted from cells using a Trizol kit (Invitrogen Life Technologies, Carlsbad, CA, USA), and then quantitated by DNase I (Sigma-Aldrich, St. Louis, MO, USA), following the manufacturer's instructions. A qScript microRNA cDNA synthesis kit (Quantabio, Beverly, MA) was employed to synthesize miRNA cDNA, and a cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) was utilized for cDNA synthesis from the 1 μg of total FBXW7 RNA. U6 and GAPDH were taken as the internal references. qRT-PCR was carried out using the miScript SYBR Green PCR Kit (Qiagen, Hilden, Germany) under the following thermocycler conditions: 40 cycles of 95 °C for 15 s, 58 °C for
2.8. Wound healing assay When cells grown to 70–80% in confluence, a scratch was made on the monolayer that through the hole center using a 200 μl pipette. Separated cells were washed off by mediums twice. Cells were grown
Table 1 Primer sequence. Gene
Forward
Reverse
miR-182 GAPDH FBXW7 U6
TTAGGAACCCTCCTCTCTC GGAGCGAGATCCCTCCAAAAT GGCCAAAATGATTCCCAGCAA GCTTCGGCAGCACATATACTAAAAT
CGGTGATGTGAAGAAGGA GGCTGTTGTCATACTTCTCATGG ACTGGAGTTCGTGACACTGTTA CGCTTCAGAATTTGCGTGTCAT
2
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
Fig. 1. MiR-182 expression was up-regulated in glioma tissues and cells. A: MiR-182 expression profile was obtained from TCGA database; B: qRT-PCR was performed to detect the expression of miR-182 in normal glia and glioma cell lines. Note: “*” refers to P < .05, “**” refers to P < .01.
Fig. 2. MiR-182 promoted the proliferation, migration and invasion of glioma cells and inhibited cell apoptosis in vitro. A: Cell proliferation was determined after transfection with NC mimic, miR-182 mimic, NC inhibitor and miR-182 inhibitor; B: Cell migration was detected by wound healing assay; C: Cell invasion was detected by Transwell assay; D: Cell apoptosis was detected by flow cytometry. Note: “#” means P < .05; “*” means P < .05; “**” means P < .01.
2.9. Invasion assay
for another 24 h with fresh mediums and the scratches were observed under the microscope. The width of the scrape was measured and the migration rate was formulated as: migration rate (%) = (As-Ab)/(AcAb) × 100%. Ab, Ac and As refer to the OD value of the blank control group, normal group and experimental group, respectively. The experiment was repeated three times.
24-well Transwell inserts (8 μm in aperture, BD Biosciences) were used in this experiment. Around 2 × 104 cells were plated into the Matrigel matrix-coated (Corning, NY) upper chamber, and DMEM containing 10% FBS was added into the lower chamber. After 24 h of incubation at 37 °C, non-invasive cells were removed by a cotton swab, and invasive cells were stained with crystal violet. Four regions were 3
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
Fig. 3. MiR-182 targeted down-regulated FBXW7 expression. A: Venn diagram was plotted to find the potential target genes; B: FBXW7 was down-regulated in tumor tissues; C: The correlation between miR-182 and FBXW7 protein levels; D: Survival analysis FBXW7 in TCGA dataset; E: Targeted binding sites of miR-182 on FBXW7; F: The luciferase activity in LN18 cells after the cotransfection of FBXW7-wt and FBXW7-mt constructs with miR-182 mimic or miR-182 inhibitor; G, H: The expression levels of FBXW7 mRNA and miR-182 in LN18 cells were detected by qRT-PCR after transfection with NC mimic, miR-182 mimic, NC inhibitor and miR-182 inhibitor; I: The protein level of FBXW7 in LN18 cells was analyzed by western blot after transfection with the four plasmids. Note: “#” means P < .05; “*” means P < .05; “**” means P < .01.
3. Results
randomly selected under the microscope and the relative invasion rate was calculated.
3.1. MiR-182 was up-regulated in glioma tissues and cells MiR-182 was found to be expressed in 530 glioma tissue samples and 5 normal samples included in TCGA database, and showed significant up-regulation in glioma tissues (Fig. 1A). qRT-PCR showed that compared to human normal astrocyte NHA, miR-182 expression was significantly up-regulated in human glioma cell lines LN18, U87, U118 and T98 (Fig. 1B). As the elevation in LN18 cell line was the most significant, thus LN18 cells were selected for subsequent experiments.
2.10. Dual-luciferase assay Sequence of FBXW7 3′UTR was amplified and inserted into the pmirGLO vector (Promega, WI, USA). Mutant sequence of FBXW7 3’UTR was formed by site-directed mutagenesis technique using Invitrogen (California, USA) according to the manufacturer's instructions. LN18 cells were seeded into the 24-well plates and incubated for 24 h. MiR-182 mimic, miR-182 inhibitor and their negative controls were respectively co-transfected with firefly luciferase constructions wild type FBXW7 3′UTR (FBXW7-wt) and mutant type FBXW7 3′UTR (FBXW7-mt) into LN18 cells. 48 h later, cells were collected and luciferase activities were assessed by a Dual-Luciferase Reporter Assay Kit (Promega, USA) according to the manufacturer's protocols. The experiment was repeated three times.
3.2. MiR-182 promoted proliferation, invasion and migration of glioma cells and inhibited cell apoptosis In order to investigate the role of miR-182 in glioma progression, NC mimic, NC inhibitor, miR-182 mimic and miR-182 inhibitor were transfected into LN18 cells for 24 h, respectively. CCK-8 was performed to detect cell proliferation. As shown in Fig. 2A, the up-regulation of miR-182 significantly promoted LN18 cell proliferation, while the down-regulation of miR-182 showed the negative result. Then, wound healing assay and Transwell assay were carried out to determine cell migration and invasion. As shown in Fig. 2B and C, cells transfected with miR-182 mimic had significantly high migration and invasion ability by comparison with those transfected with NC mimic. Meanwhile, cells transfected with miR-182 inhibitor had significantly low migration and invasion ability by comparison with those transfected with NC inhibitor. The effect of miR-182 on cell apoptosis was subsequently analyzed by flow cytometry. As shown in Fig. 2D, compared with the cells transfected with NC mimic, cells transfected with miR-
2.11. Statistical analysis All data were processed by SPSS 22.0 statistical software (IBM Corp. Armonk, NY, USA). Measurement data were presented in the form of mean ± standard deviation (M ± SD). Comparison between two groups was performed by t-test, and comparison among multiple groups was performed by one-way ANOVA. P < .05 was considered statistically significant.
4
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
Fig. 4. MiR-182 promoted the proliferation, migration and invasion of glioma cells and inhibited cell apoptosis by inhibiting FBXW7. A: MiR-182 inhibitor was co-transfected with sh-NC or sh-FBXW7 into LN18 cells for cell proliferation determination; B: Migration detection with wound healing assay; C: Invasion detection with Transwell; D: Apoptosis determination. Note: “*” refers to P < .05.
level exhibited the similar expression trend as indicated by western blot (Fig. 3I). Therefore, miR-182 could negatively regulate the expression of FBXW7.
182 mimic had a much lower apoptosis rate, while cells transfected with miR-182 inhibitor had a higher rate of apoptosis than cells transfected with NC inhibitor. Thus, it could be seen that the overexpression of miR-182 promoted the proliferation, migration and invasion of glioma cells and inhibited cell apoptosis.
3.4. MiR-182 promoted proliferation, invasion and migration of glioma cells and inhibited cell apoptosis through inhibiting FBXW7
3.3. FBXW7 was a direct target of miR-182 In order to evaluate the importance of miR-182/FBXW7 in glioma cell proliferation, migration, invasion and apoptosis, various experiments were performed. MiR-182 inhibitor was co-transfected with shNC and sh-FBXW7 into LN18 cells, respectively. As shown in Fig. 4A, miR-182 inhibitor inhibited cell proliferation, while FBXW7 knockdown could reverse such inhibitory effect. Wound healing assay and Transwell were performed to detect cell migration and invasion. As shown in Fig. 4B and C, cell migration and invasion were suppressed in cells transfected with miR-182 inhibitor and sh-NC, but such effect was then abrogated after sh-FBXW7 was simultaneously transfected. Similar, as shown in Fig. 4D, miR-182 inhibitor promoted the cell apoptosis, but FBXW7 knockdown abolished this promotive effect. In view of these findings, miR-182 was found to promote the proliferation, migration and invasion of glioma cells, and inhibit cell apoptosis by inhibiting FBXW7.
miRNA, miRTarBase, TargetScan three databases were used to predict target genes of miR-182. As shown in Fig. 3A, Venn diagram result showed that eventually 4 DEmiRNAs had binding sites with miR182, including NPTX1, FBXW7, STK17B and ATP8A2, among which FBXW7 was down-regulated in tumor tissues (Fig. 3B) and exhibited negative correlation with miR-182 expression (Fig. 3C). Survival analysis was performed and suggested that patients with low FBXW7 expression had poor survival relative to those with high expression (Fig. 3D). Then, miR-182 was predicted to targeted bind to FBXW73’UTR by TargetScan database (Fig. 3E). In order to verify their relationship, luciferase constructs FBXW7-wt and FBXW7-mt were constructed and co-transfected with miR-182 mimic or miR-182 inhibitor into LN18 cells. Dual-luciferase assay was then performed. As shown in Fig. 3F, the luciferase activity was decreased in the co-transfection group of miR-182 mimic and FBXW7-wt by comparison with that in the negative control group, while the luciferase activity was increased in the co-transfection group of miR-182 inhibitor and FBXW7-wt. The results confirmed that miR-182 targeted FBXW7 and decreased its expression. qRT-PCR and western blot were further performed to analyze the effect of miR-182 on FBXW7. Results showed that in miR-182 mimic-transfected cells (Fig. 3G), FBXW7 was significantly downregulated in mRNA level, but greatly up-regulated (Fig. 3H) in miR-182 inhibitor-transfected cells (Fig. 3G). Consistently, FBXW7 in the protein
4. Discussion MiRNAs are emerged as a promising diagnostic tool due to its role in tumorigenesis and stability in body fluids [13]. MiR-182, one of the oncogenic miRNAs most studied, is found to be dysregulated in various caner tissues and play a key role in tumorigenesis and development [14]. For example, miR-182 acting as an oncogene promotes the progression of prostate cancer by activating the Wnt / β-catenin signaling 5
Journal of the Neurological Sciences 411 (2020) 116689
S. Liu, et al.
Declaration of Competing Interest
pathway [15]. Besides, miR-182 can directly participate in cancer invasion through linking RET oncogene activated NF-κB to loss of the HES1 / Notch1 signaling pathway [16]. In gastric cancer, miR-182-5p promotes cell viability, mitosis, migration and invasion by down-regulating RAB27A [17]. In present study, miR-182 was found to be upregulated in glioma tissues and cells. In addition, miR-182 mimic and miR-182 inhibitor were transfected into LN18 cells, respectively, finding that miR-182 overexpression could significantly promote cell proliferation, migration, invasion and inhibit cell apoptosis, while miR182 inhibitor could significantly weaken such effects. The role of miR182 in glioma investigated in this study is consistent with that studied in prostatic cancer [15], breast cancer [7], non-small cell lung cancer [18] and malignant pleural mesothelioma [19]. FBXW7 is one of the crucial components of ubiquitin ligase and can aid in the degradation of various oncoproteins [20]. It is regarded as a typical tumor suppressor with loss-of-function mutations occurring in human cancers [21]. In this study, FBXW7 was confirmed to be downregulated in glioma tissues and cells, and exhibited negative correlation with miR-182 expression. In addition, we discovered that miR-182 regulated FBXW7 expression via targeted binding to the FBXW7 3’UTR, which was consistent with the studies of non-small cell lung cancer [18] and breast cancer [7]. However, the role of such targeted relationship in glioma has not been studied. Therefore, some relevant experiments were made and found that miR-182 could promote the proliferation, migration and invasion of glioma cells as well as inhibit cell apoptosis by targeted down-regulating FBXW7, thereby promoting glioma tumorigenesis and development. In conclusion, the regulatory effect of miR-182 on FBXW7 was identified in this study, and the role of this targeted relationship in the biological behaviors of glioma cells was studied as well. Our study helps us better understand the role of miR-182 in glioma cells and opens up new possibilities for more therapeutic strategies. Meanwhile, for subsequent experiments on the specific molecular mechanism of the targeted relationship in glioma progression, the results we found could be potent evidence.
The authors have no conflicts of interest to declare. Acknowledgement None. References [1] P. Wesseling, D. Capper, WHO 2016 classification of gliomas, Neuropathol. Appl. Neurobiol. 44 (2018) 139–150, https://doi.org/10.1111/nan.12432. [2] P. Cui, et al., Metabolic derangements of skeletal muscle from a murine model of glioma cachexia, Skelet. Muscle 9 (2019) 3, https://doi.org/10.1186/s13395-0180188-4. [3] X. Chen, et al., MiR-9 promotes tumorigenesis and angiogenesis and is activated by MYC and OCT4 in human glioma, J. Exp. Clin. Cancer Res. 38 (2019) 99, https:// doi.org/10.1186/s13046-019-1078-2. [4] P.Y. Hsu, et al., MicroRNA let-7g possesses a therapeutic potential for peripheral artery disease, J. Cell. Mol. Med. 21 (2017) 519–529, https://doi.org/10.1111/ jcmm.12997. [5] K. Wu, J. He, W. Pu, Y. Peng, The role of Exportin-5 in MicroRNA biogenesis and cancer, Genomics Proteome. Bioinforma. 16 (2018) 120–126, https://doi.org/10. 1016/j.gpb.2017.09.004. [6] J. Cui, B. Zhou, S.A. Ross, J. Zempleni, Nutrition, microRNAs, and human health, Adv. Nutr. 8 (2017) 105–112, https://doi.org/10.3945/an.116.013839. [7] C.H. Chiang, P.Y. Chu, M.F. Hou, W.C. Hung, MiR-182 promotes proliferation and invasion and elevates the HIF-1alpha-VEGF-A axis in breast cancer cells by targeting FBXW7, Am. J. Cancer Res. 6 (2016) 1785–1798. [8] Q. Wei, R. Lei, G. Hu, Roles of miR-182 in sensory organ development and cancer, Thorac. Cancer 6 (2015) 2–9, https://doi.org/10.1111/1759-7714.12164. [9] C.H. Yeh, M. Bellon, C. Nicot, FBXW7: a critical tumor suppressor of human cancers, Mol. Cancer 17 (2018) 115, https://doi.org/10.1186/s12943-018-0857-2. [10] R.J. Davis, M. Welcker, B.E. Clurman, Tumor suppression by the Fbw7 ubiquitin ligase: mechanisms and opportunities, Cancer Cell 26 (2014) 455–464, https://doi. org/10.1016/j.ccell.2014.09.013. [11] L. Wang, X. Ye, Y. Liu, W. Wei, Z. Wang, Aberrant regulation of FBW7 in cancer, Oncotarget 5 (2014) 2000–2015, https://doi.org/10.18632/oncotarget.1859. [12] Z. Wang, et al., Tumor suppressor functions of FBW7 in cancer development and progression, FEBS Lett. 586 (2012) 1409–1418, https://doi.org/10.1016/j.febslet. 2012.03.017. [13] N. Matamala, et al., Tumor microRNA expression profiling identifies circulating microRNAs for early breast cancer detection, Clin. Chem. 61 (2015) 1098–1106, https://doi.org/10.1373/clinchem.2015.238691. [14] Y. Li, et al., MiR-182 inhibits the epithelial to mesenchymal transition and metastasis of lung cancer cells by targeting the Met gene, Mol. Carcinog. 57 (2018) 125–136, https://doi.org/10.1002/mc.22741. [15] D. Wang, G. Lu, Y. Shao, D. Xu, MiR-182 promotes prostate cancer progression through activating Wnt/beta-catenin signal pathway, Biomed. Pharmacother. 99 (2018) 334–339, https://doi.org/10.1016/j.biopha.2018.01.082. [16] A. Spitschak, C. Meier, B. Kowtharapu, D. Engelmann, B.M. Putzer, MiR-182 promotes cancer invasion by linking RET oncogene activated NF-kappaB to loss of the HES1/Notch1 regulatory circuit, Mol. Cancer 16 (2017) 24, https://doi.org/10. 1186/s12943-016-0563-x. [17] Y. Li, et al., miR-182-5p improves the viability, mitosis, migration, and invasion ability of human gastric cancer cells by down-regulating RAB27A, Biosci. Rep. 37 (2017), https://doi.org/10.1042/BSR20170136. [18] H. Chang, et al., MiR-182 promotes cell proliferation by suppressing FBXW7 and FBXW11 in non-small cell lung cancer, Am. J. Transl. Res. 10 (2018) 1131–1142. [19] R. Suzuki, et al., miR-182 and miR-183 Promote cell proliferation and invasion by targeting FOXO1 in mesothelioma, Front. Oncol. 8 (2018) 446, https://doi.org/10. 3389/fonc.2018.00446. [20] B.L. Sailo, et al., FBXW7 in cancer: what has been unraveled thus far? Cancers (Basel) 11 (2019), https://doi.org/10.3390/cancers11020246. [21] Q. Zhang, et al., FBXW7 Facilitates Nonhomologous End-Joining via K63-Linked Polyubiquitylation of XRCC4, Mol. Cell 61 (2016) 419–433, https://doi.org/10. 1016/j.molcel.2015.12.010.
Statement of ethics The authors have no ethical conflicts to disclose. Funding sources None. Availability of data and material The data used to support the findings of this study are available from the corresponding author upon request. Consent for publication Not applicable.
6