miR-27a suppresses triglyceride accumulation and affects gene mRNA expression associated with fat metabolism in dairy goat mammary gland epithelial cells

Gene 521 (2013) 15–23

Contents lists available at SciVerse ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

miR-27a suppresses triglyceride accumulation and affects gene mRNA expression associated with fat metabolism in dairy goat mammary gland epithelial cells Xian-zi Lin, Jun Luo ⁎, Li-ping Zhang, Wei Wang, Heng-bo Shi, Jiang-jiang Zhu Shaanxi Key Laboratory of Molecular Biology for Agriculture, College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, China

a r t i c l e

i n f o

Article history: Accepted 15 March 2013 Available online 26 March 2013 Keywords: MicroRNA Milk triglyceride Fatty acid composition

a b s t r a c t MicroRNAs (miRNAs), a well-defined group of small RNAs containing about 22 nucleotides, participate in various biological metabolic processes. miR-27a is a miRNA that is known to regulate fat synthesis and differentiation in preadipocyte cells. However, little is known regarding the role that miR-27a plays in regulating goat milk fat synthesis. In this study, we determined the miR-27a expression profile in goat mammary gland and found that miR-27a expression was correlated with the lactation cycle. Additionally, prolactin promoted miR-27a expression in goat mammary gland epithelial cells. Further functional analysis showed that over-expression of miR-27a down-regulated triglyceride accumulation and decreased the ratio of unsaturated/saturated fatty acid in mammary gland epithelial cells. miR-27a also significantly affected mRNA expression related to milk fat metabolism. Specifically, over-expression of miR-27a reduced gene mRNA expression associated with triglyceride synthesis by suppressing PPARγ protein levels. This study provides the first experimental evidence that miR-27a regulates triglyceride synthesis in goat mammary gland epithelial cells and improves our understanding about the importance of miRNAs in milk fat synthesis. Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved.

1. Introduction Goat milk has unique biochemical qualities. Goat milk has higher protein, carbohydrate, and calcium content than cow milk (Hansen et al., 1984; Juarez and Ramos, 1987). Goat milk also contains greater amounts of short-chain fatty acids, medium-chain fatty acids, and unsaturated fatty acids than cow milk (Hansen et al., 1984; Juarez and Ramos, 1987). Some of unsaturated fatty acids (e.g., c9-C18:1, C18:3n-3 and c9,t11-C18:2) are considered good for human health

Abbreviations: miRNA, microRNA; RNA, messenger RNA; MOI, multiplicity of infection; Ad, adenoviral; Ad-miR-27a, recombinant adenoviral-miR-27a; nt, nucleotide; cDNA, DNA complementary to RNA; DMEM, Dulbecco's modified Eagle medium; EGF, epidermal growth factor; UTR, un-translated region(s); FBS, fetal bovine serum; PBS, phosphate buffered saline; RT-PCR, reverse transcription polymerase chain reaction; GC–MS, gas chromatography– mass spectrometry; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SCD, stearoylCoA desaturase (delta-1-desaturase); DGAT1, diacylglycerol acyltransferase 1; SREBP-1c, sterol regulatory element-binding protein-1c; FASN, fatty acid synthase; LPL, lipoprotein lipase; CD36, CD 36 molecule (thrombospondin receptor); ADFP, adipose differentiation related protein; TIP47, PAT-related proteins family, member 47; PPARγ2, peroxisome proliferator-activated receptor γ2; HSL, hormone-sensitive lipase; ATGL, adipose triglyceride lipase; AMPKα, AMP-activated protein kinase α; LEP, leptin protein gene; CPT1, carnitine palmitoyltransferase1; PPARα, peroxisome proliferator-activated receptor α; ACOX1, acyl-CoA oxidase 1; C/EBP, CCAAT/enhancer-binding protein; RXRα, retinoid X receptor α; LSD2, lipid storage droplet 2; S3-12, plasma membrane-associated protein S3-12; BTN1A1, butyrophilin subfamily1 member A1; CYP27A1, sterol 27-hydroxylase member A1. ⁎ Corresponding author at: College of Animal Science and Technology, Northwest A&F University, 22 Xi-Nong Road, Yangling, Shaanxi 712100, China. Tel.: +86 13709129218; fax: +86 29 87080055. E-mail address: [email protected] (J. Luo).

(Haenlein, 2004). And goat milk is sometimes used to treat human dyspepsia and gastrointestinal dysfunction (Haenlein, 2004). Milk triglycerides, which account for 99% of milk fat, are synthesized from diverse fatty acids in the epithelial cells of mammary gland. After their synthesis, milk triglycerides coalesce to form fat droplets (Bionaz and Loor, 2008; Hansen et al., 1984). The synthesis and transfer of triglycerides involve many processes (e.g., de novo synthesis of fatty acids, triglyceride synthesis, fat droplet formation, and fatty acid uptake and transport), indicating that a unique network of genes participates in milk fat synthesis. MicroRNAs (miRNAs) are endogenous, small, non-coding RNAs, around 22 nucleotides in length (Barte, 2004). By binding to target mRNA, miRNA can reduce mRNA translation in animals. The miRNA– mRNA base pairing is only 6–8 nucleotides long (Lewis et al., 2005). Therefore, it has been hypothesized that miRNAs have numerous target genes. MiRNAs regulate many metabolic processes, including tissue development (Tanaka et al., 2009), cell differentiation (Sun et al., 2011), and lipid metabolism (Sacco et al., 2012). miRNAs are key regulators of lipid synthesis, oxidation, and homeostasis in various cell lines (Bommer and MacDougald, 2011; Esau et al., 2006) and tissues (Lynn, 2009; Nakanishia et al., 2009). For example, miR-27a suppresses fat synthesis in preadipocyte cell lines (Qun et al., 2008), and miR-107 regulates triglyceride concentrations in fat tissue (Trajkovski et al., 2011). Recent studies indicate that miRNAs may be involved in milk fat metabolism in mammary gland during lactation. miRNAs (e.g., miR-27a and miR-107) in mammary gland of mouse and cow are expressed differently during different stages of lactation (Avril-Sassen et al., 2009; Chen et al., 2010). These miRNAs might be related to milk fat

0378-1119/$ – see front matter. Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.03.050

16

X. Lin et al. / Gene 521 (2013) 15–23

synthesis. Little is known about the biological role of miRNAs in goat mammary gland or the effect of miRNAs on milk fat metabolism. Furthermore no goat miRNA has been deposited in miRBase 17.0. Only a few miRNAs have accession numbers in GenBank. The sequence of goat miR-27a is published in GenBank. Therefore, in this experiment, we evaluated the potential ability of miR-27a to affect milk fat synthesis in goat mammary epithelial cells. To our knowledge, this is the first study to verify the ability of miR-27a to suppress milk triglyceride accumulation and to alter the fatty acid composition in goat mammary gland epithelial cells. We also determined the expression of goat miR-27a during different lactation stages and analyzed the sensitivity of miR-27a to prolactin. These results significantly advance our understanding about the role of miRNAs during lactation. 2. Materials and methods 2.1. Animals, tissue sampling, and RNA extraction Xinong Saanen Dairy Goat was bred in the experimental farm of Northwest Agricultural University since 1940 and recognized as a specialized dairy goat breed in 1958. Goats from the herd of the farm will be referred to as Xinong Saanen Dairy Goat in this paper. Three healthy, three-year-old goats of similar weight were selected from the herd for this study. The goats were in the second lactation. Mammary gland tissues were surgically collected from the same goats at mid-lactation (120 days after parturition) and at dry lactation (60 days before parturition), and immediately frozen in liquid nitrogen. Total RNA was extracted from the tissues and then pooled within each sampling date. Total RNA was extracted from mammary gland tissue and mammary gland epithelial cells using a mirVana miRNA Isolation Kit (Ambion, USA) according to the manufacturer's instructions. The quantity and quality of the RNA were measured using a NanoDrop ND-1000 spectrophotometer (Nanodrop, USA). The A260/A280 ratio was >2.1 and the A230/A260 ratio was >1.9 for all samples. The integrity of the RNA was assessed by electrophoretic analysis of the 28S and 18S rRNA subunits. Total RNAs were stored at −80 °C for analyses. 2.2. Primers, cDNA synthesis, and qRT-PCR for miRNAs and mRNAs For miRNA, first strand cDNA was synthesized using 100 ng total RNA and a cDNA First Strand Synthesis Kit (Kang Wei, Beijing). Briefly, the 25 μl Poly(A)-tailing reaction volume contained 100 ng total RNA, 2.5 U Escherichia coli Poly(A) Polymerase, 800 nM ATP, and 1× Poly(A) Polymerase Buffer. The mixture was incubated for 15 min at 37 °C and was immediately subjected to cDNA first strand synthesis. The 20 μl reverse-transcriptase reaction volume contained 4 μl Poly(A)-tailing liquid, 10 mM of each dNTP, 75 μM RT primer, 0.2 M DTT, 200 U SuperRT Reverse Transcriptase, and 1 × RT Buffer. The mixture was incubated for 50 min at 42 °C and 5 min at 85 °C. The cDNA was then diluted 1:10 with DNase/RNase free water. The qRT-PCR assay was carried out with a miRNA Real-Time PCR Assay Kit (Kang Wei, Beijing) on a Bio-Rad CFX96 real-time PCR detection system (Bio-Rad, USA). The qPCR was performed using 2 μl diluted cDNA combined with 48 μl of a mixture composed of 0.2 μM forward primer, 0.2 μM reverse primer, 1× miRNA qPCR premix, and RNase-Free Water. The primers 5′-TTCACAGTGGCTAAGTTCCG-3′ for miR-27a, 5′-CACTAT TGCGGGTCTGC-3′ for U6 snRNA, and 5′-CGCTTCTTCGGCTTATTAG-3′ for U2 snRNA were synthesized by Invitrogen Corp. (USA). The relative expression levels of the miR-27a were normalized with internal control (U6 or U2 snRNA) expression level, which was calculated using the 2 −ΔΔCt method. For mRNA, 1 μg of total RNA was synthesized into cDNA using a PrimeScript® RT Reagent Kit (Perfect Real Time, Takara, Japan). Briefly, the reaction volume contained 1 μg of total RNA, 50 pmol Oligo dT

Primer, 100 pmol Random 6 mers, 200 U PrimeScript® RT Enzyme Mix I, and 1× PrimeScript® Buffer. The 20 μl volume was incubated at 37 °C for 15 min and at 85 °C for 5 min. For Real-Time qPCR, a total of 20 μl mixture composed of 1 μl of RT reaction, 0.4 μM Forward Primer, 0.4 μM Reverse Primer, and 1× SYBR Premix Ex Taq™ was added according to the manufacturer's instruction (SYBR® Premix Ex Taq™ II (Perfect Real Time) (Takara, Japan). The reaction was performed on a Bio-Rad CFX96. Glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) was used as an internal control. Data were analyzed using the relative quantification (ΔΔCt) method. Primers for mRNA are listed in Table 1. In addition to the primers from published papers, other primers were designed using goat genes that were cloned in our laboratory. Additionally, primers for PPARγ were used to amplify sequences containing PPARγ1 and PPARγ2. 2.3. Cell culture and hormone treatments Mammary gland epithelial cells were cultured in DMEM/F12 medium (Invitrogen Corp., USA), containing 5 μg/ml insulin, 0.25 μmol/l hydrocortisone, 50 U/ml penicillin/ml streptomycin, 10 ng/ml epidermal growth factor 1 (EGF-1, Gibco), and 10% FBS at 37 °C in a humidified atmosphere with 5% CO2 (German and Barash, 2002). The medium was changed every day. Primary mammary gland epithelial cells were isolated under sterile conditions using a modification of the tissue explant method (Li et al., 2008). Mammary gland epithelium was surgically collected from goat mammary gland at mid-lactation (120 days after parturition) and then rinsed three times with D-Hanks buffer solution containing 1000 U penicillin/ml and 1000 U streptomycin/ ml. After removing the connective and adipose tissue surrounding the mammary epithelium, the mammary epithelium was minced into approximately 1 mm3 sections and then seeded in tissue culture dishes (35 mm diam.) with 0.5 ml DMEM/F12 medium. The medium was added dropwise between the tissue sections. After 90 min in a humidified atmosphere, the volume of DMEM/F12 medium was brought up to 2 ml and then the dishes were returned to the humidified atmosphere. At confluence, the mammary gland epithelial cells were dissociated using 1 ml Trypsin–EDTA Solution (0.25% Trypsin and 0.05% EDTA). The cells were identified as mammary gland epithelial cells in a previous study (Wang et al., 2010). Some of the passage 1 cells were seeded on DMEM/F12 medium in culture plates (Nunc, Denmark) at a density of 5 × 10 4 cells/cm 2 and then human prolactin (Sigma-Aldrich, L4021, USA) was added to the medium to obtain a final concentration of 0, 2, 6, 10, or 15 μg/ml. The cells were cultured at 37 °C in a humidified atmosphere with 5% CO2. After 48 h the cells were collected and the total RNA was extracted. The other passage 1 cells were seeded on DMEM/F12 medium to obtain passage 2 cells for adenovirus infection as described below. 2.4. Ad-miRNA generation and infection MiR-27a (GenBank: EF638022.1) stem-loop and flanking sequences on the 5′ and 3′ side of miR-27a (a total of 225 nucleotides) were amplified from normal Xinong Saanen Dairy Goat genomic DNA. The primers for the miR-27a were designed using Oligo software (version 6.0): forward primer 5′-GGTGCTTCCACGGTTGCTGCCTGTCA CAAATCAC-3′, reverse primer: 5′-CGCCTGCTGGGACTCCTGTTCCTGC TGAACTAGG-3′. To construct pAd-miR-27a, the miR-27a sequence was sub-cloned into a GFP-expressing shuttle vector, pAd-TrackCMV. The shuttle vector was then linearized and mixed with an adenoviral backbone plasmid (pAdEasy-1) followed by co-transformation into competent E. coli BJ5183 cells (AdEasy, Stratagene). pAd-miR-27a was obtained through homologous recombination in the E. coli BJ 5181 cells. pAd, which did not contain an inserted sequence, was used as a control. The adenovirus vectors pAd and pAd-miR-27a were packed in HEK 293 cells using a commercial system (AdEasy, Stratagene).

X. Lin et al. / Gene 521 (2013) 15–23

17

Table 1 Primer for qRT-PCR. Gene symbol

Primers (5′–3′)

Primer source

NCBI accession no.

PPARγ

Forward: TCCGTGTGATGTGGAAGACCACTC Reverse: CCCTTGTGCATCCTTCACAAGC Forward: CCATCGCCTGTGGAGTCAC Reverse: GTCGGATAAATCTAGCGTAGCA Forward: CCACTGGGACCTGAGGTGTC Reverse: GCATCACCACACACCAATTCA Forward: CCAGCTGACAGCTCCATTGTGA Reverse: TGCGCGCCACAAGGA Forward: GTCGTTGTCTACAGCACAGCCT Reverse: ATGGCGAGGTTCCACTCAAAC Forward: GCCAAAAGAAGCAGCAAGATG Reverse: CCGAGCGAAGTAGAAAGGAGTATGT Forward: GTACAGATGCAGCCTCATTTCC Reverse: TGGACCTGCAAATATCAGAGGA Forward: CCCCAGAAGCCGAGTTACTATGTT Reverse: CACGCAGCCAGGACAGATAGAG Forward: GGTGGAGGGTCAGGAGAAA Reverse: TCACGGAACATGGCGAGT Forward: GGGAGCACTACAAACGCAACG Reverse: TGAATGATCCGCTCAAACTCG Forward: GGAGCTTATCCAGGCCAATG Reverse: GCGGGCAGATGTCACTCT Forward: AAGGACCTCTACGCCAACACG Reverse: TTTGCGGTGGACGATGGAG Forward: TACTCTCGGCAGACTTCCTAC Reverse: CCTCCTCACATCTGTCATACAC Forward: CGAGTTCATTCTCAACAGTCCT Reverse: GCATCTTCAAGTAGCCATTATCC Forward: AGGGTCACTGGCTTGGACTTCATC Reverse: CGTGGATCTGTTGGTAGATTGCC Forward: GGAGCTTATCCAGGCCAATG Reverse: TGCGGGCAGATGTCACTC Forward: GCAAGTTCCACGGCACAG Reverse: GGTTCACGCCCATCACAA

This manuscript

HQ589347a

This manuscript

GU947654a

Bionaz and Loor (2011)

NM_174693.2a

This manuscript

HM443643.1a

This manuscript

DQ915966a

This manuscript

DQ997818a

Bionaz and Loor (2011)

NM_174010.2b

This manuscript

HQ846826a

This manuscript

HQ846827a

This manuscript

EU273879a

This manuscript

GQ918145a

Zhang et al. (2011)

FJ415874.1b

This manuscript

HM600811.1a

This manuscript

NM_001035289.2b

This manuscript

JQ739233.1a

Zhang et al. (2011)

NM_001109802.2b

This manuscript

AJ431207.1

SCD DGAT1 SREBP-1c FASN LPL CD36 ADFP TIP47 HSL ATGL CPT1 PPARα ACOX1 LEP AMPKα GAPDH a b

The accession number of goat genes. The accession number of cow genes.

Mammary gland epithelial cells were infected with Ad or Ad-miR-27a at a MOI of 10, 50, 100, 150, or 200. Infection efficiency was determined by observation of green fluorescence under inverted/phase contrast microscopy (Leica CMF-500, Germany). The highest infection efficiency (about 70%) in the epithelial cells was obtained at an MOI of 150. Based on this result, mammary gland epithelial cells at a density of 8 × 10 4 cells/cm 2 were infected with Ad-miRNAs or Ad at an MOI of 150. The infected cells were cultured at 37 °C for 72 h and then used for the tests described below (Oil red O staining, triglyceride assay, fatty acid extraction, and western blotting). The total RNA of the infected cells was extracted at 0, 24, 48, 72 h post-infection and subjected to cDNA synthesis as described above.

2.7. Fatty acid extraction and analysis

The Ad (control)- and Ad-miRNA-27a-infected epithelial cells were rinsed three times in phosphate-buffered saline (PBS), fixed in 10% (v/v) paraformaldehyde for 40 min, and then rinsed again with PBS. The fat droplets in the cells were stained with 5% oil red O in isopropanol for 15 min and then examined microscopically. Uninfected cells were also stained for comparison.

The Ad-(control) and Ad-miR-27a-infected cells were harvested and collected in sealable glass tubes. A 2 ml aliquot of 2.5% (v/v) trichloroacetic acid–methanol solution was added to each tube. The tubes were incubated overnight at 90 °C. On the following day, the tubes were cooled to room temperature and then 2 ml saturated KCL solution was added to the tubes followed by 1 ml methyl nonadecanoate (C19:0) (Sigma, no. 74208) as the internal control. The organic compounds in the mixture were extracted twice with 2 ml pure n-hexane. The n-hexane containing fatty acids was transferred to new glass tubes, evaporated to a volume of 500 μl using a nitrogen concentrator HP-5016GD (Ji Cheng Company, Shanghai), and then stored at −20 °C. The fatty acid content of the samples was determined using gas chromatography–mass spectrometry (GC–MS) (Agilent 5975, USA) at the Analysis Center of Northwest A&F University. The following conditions were employed: column: HP-5 (60 m × 0.25 mm. i.d. × 0.25 μm d.f.); detector temperature: 280 °C; split ratio: 1:10; carrier gas flow: He 0.8 ml/min; injector temperature 250 °C; and temperature program: starting from 40 °C for 2 min, isothermal for 30 min, increasing by 8 °C/min to 240 °C, then 240 °C for 15 min.

2.6. Triglyceride assay

2.8. Western blotting

The Ad-(control) and Ad-miR-27a-infected cells were harvested in lysis buffer (50 mmol/l Tris–HCl, pH 7.4, 150 mmol/NaCL, 1% Triton X-100) and sonicated to homogenize the cell suspension. Uninfected cells were also used as a control. Triglyceride content was measured using a Serum Triglyceride Determination Kit according to the manufacturer's instructions (Loogen, Beijing) and an XD 811G Biochemistry Analyzer (Shanghai Odin Science & Technology Company, Shanghai).

The cultured epithelial cells were harvested and lysed in lysis buffer (50 mM Tris–HCl [pH 7.5], 2 mM EDTA, 150 mM NaCL, 0.5% Triton X-100, and 1 mM PMSF) with a protease inhibitor mixture. The samples were boiled for 4 min and subsequently centrifuged at 13,500 g for 15 min at 4 °C. The extracted protein (50 μg) was separated on a 12% SDS-PAGE gel under reducing conditions and then electroblotted onto nitrocellulose membranes (Millipore, Bedford, MA, USA). After blocking

2.5. Oil red O staining

18

X. Lin et al. / Gene 521 (2013) 15–23

in 5% skim cow milk, the membranes were incubated with the first antibody (Abcam, Cambridge, MA) overnight at 4 °C and anti-β-actin antibody (Abcam, Cambridge, MA) for 1.5 h at room temperature. Subsequently, the membranes were hybridized with secondary antibody conjugated with peroxidase (Santa Cruz Biotechnology). The protein levels were quantitated on a Bio-Rad ChemiDoc system. 2.9. Statistical analysis All infection experiments were repeated six times. The qRT-PCR assays were performed in triplicate and each experiment was repeated at least three times. Data are presented as means ± SD of three or more independent experiments. Differences were considered statistically significant at P b 0.05 using Student's t-test. 3. Results 3.1. miR-27a expression correlates with lactation The mammary gland undergoes extensive changes in tissue structure and milk production between the dry period and lactation. To investigate whether miR-27a expression correlates with lactation, we assessed miR-27a expression in goat mammary gland. We sampled the mammary gland tissues of three random dairy goats during mid-lactation (120 days after parturition) and during the dry period (60 days before parturition). The total RNA was extracted from the mammary gland tissue and then pooled within each sampling date. We compared miR-27a expression at these two stages using qRT-PCR and found that the expression level of miR-27a was 1.25-fold higher (P b 0.05) during mid-lactation than during the dry period (Fig. 1A). This indicated that miR-27a may be involved in regulating lactation or mammary gland development. To address this question, we investigated the interaction between miR-27a and prolactin, one of the main hormones regulating lactation in mammals (Hennighausen et al., 1997). Prolactin can activate the STAT5/JAK2 pathway to increase milk fat synthesis in mammary gland (Hennighausen et al., 1997). We used cultured goat mammary gland epithelial cells as a model system and measured the miR-27a expression level in cells treated with different amounts of prolactin (Fig. 1B). As expected, prolactin up-regulated miR-27a expression. miR-27a expression increased as prolactin concentrations increased from 0 to 10 μg/ml. This finding suggests that miR-27a may be downstream of prolactin in goat and supports the idea that miR-27a expression is correlated with lactation. 3.2. Over-expression of miR-27a suppresses triglyceride accumulation in epithelial cells To verify the ability of miR-27a to affect milk triglyceride during lactation, we infected goat mammary gland epithelial cells using a recombinant adenovirus (Ad-miR-27a, MOI = 150 [Fig. 2A]). When miR-27a was over-expressed in cells, we used three indices to analyze triglyceride accumulation: appearance of fat droplets, triglyceride content, and fatty acid content (Fig. 2). In mammary gland epithelial cells, milk fat exists as milk fat droplets (Hansen et al., 1984). The milk fat droplet is exclusively composed of triglycerides (Bionaz and Loor, 2008; Hansen et al., 1984). To investigate the role of miR-27a in milk fat droplet formation and triglyceride accumulation, we compared these two indices between cells over-expressing miR-27a (Ad-miR-27a-infected cells) and controls that included cells infected by adenovirus without any insert (Ad-infected cells) and cells that were uninfected. Fat droplet (Fig. 2B) and triglyceride accumulation (Fig. 2C) were both suppressed in Ad-miR-27a-infected cells. The triglyceride content of Ad-miR-27a-infected cells was reduced by 15% compared with Ad-infected cells (P b 0.05, Fig. 2C). These results indicate an important role of miR-27a in triglyceride synthesis during

Fig. 1. MiR-27a expression correlates with lactation stage and prolactin concentration. A: miR-27a is differentially regulated during mid-lactation (120 days after parturition) and dry period (60 days before parturition). The relative expression levels of miR-27a were calculated using the 2−ΔΔCt method and normalized with U6 snRNA expression. Data are expressed as mean ± SD (n = 3); and B: miR-27a positively responds to prolactin concentration. X-axis indicates the final concentration of prolactin (μg/ml) in medium of epithelial cells. miR-27a expression was assessed by qRT-PCR, normalized to U6 internal control and plotted relative to the expression at concentration of 0 μg/ml. Data are expressed as mean ± SD (n = 9). Asterisks indicate significant differences at P b 0.05 versus the respective control.

lactation. Comparison of the two control groups showed that fat droplet accumulation and triglyceride content were slightly lower in Ad-infected cells than in uninfected cells (Figs. 2B, C), suggesting that adenovirus may affect fat droplet and triglyceride synthesis.

3.3. Over-expression of miR-27a decreases the ratio of unsaturated/saturated fatty acid in epithelial cells Fatty acids are stored in the form of triglycerides in epithelial cells (Hansen et al., 1984). These fatty acids can be categorized as saturated and unsaturated fatty acids, or cis- and trans-fatty acids (Alonso et al., 1999; Juarez and Ramos, 1987). We harvested Ad- and Ad-miR-27ainfected cells at 72 h post-infection. Cells were methyl-esterified, and then their fatty acid content and composition were determined by gas chromatography–mass spectrometry (GC–MS). Ad-miR-27a-infected cells contained less fatty acid than the Ad-infected cells (0.93-fold, P b 0.05) (Fig. 2D). Furthermore, over-expression of miR-27a decreased the unsaturated fatty acid content, but increased the saturated fatty acid content in mammary gland epithelial cells (Fig. 2E). Specifically, the c9, C18:1 and c9,t11-C18:2 contents of the epithelial cells were significantly lower (0.64-fold, P b 0.05; 0.55-fold, P b 0.05) (Fig. 2E), but the C16:0 and C18:0 contents were significantly higher (1.19-fold, P b 0.05; 2.02-fold, P b 0.01) (Fig. 2E). Previous studies have shown that unsaturated fatty acids (e.g., c9,t11-C18:2) are healthier than saturated fatty acids (e.g., C16:0, C18:0) (Haenlein, 2004). The changes in their

X. Lin et al. / Gene 521 (2013) 15–23

19

Fig. 2. Elevated miR-27a expression suppresses triglyceride accumulation and decreases the ratio of unsaturated/saturated fatty acid in goat mammary gland epithelial cells. A: The optimal MOI (150) of Ad-miR-27a. Ad-infected cells were used as a control. The relative miR-27a expression level at MOI of 150 was 1.28-fold higher (P b 0.05) in Ad-miR-27a-infected cells than in Ad-infected cells at 72 h post-infection. MiR-27a expression levels were measured using RT-PCR, normalized with internal control (U6 or U2), and plotted relative to level of Ad-control. Data are expressed as mean ± SD (n = 6); and B: Over-expression of miR-27a suppresses fat droplet formation in epithelial cells. Cells in the left column were stained by Oil Red at 72 h post-infection. The fluorescence of the cells was in the right column. Uninfected (first row) and Ad-infected cells (second row) were both used as controls; and C: over-expression of miR-27a down-regulates triglyceride accumulation. Triglyceride content was determined by using a Serum Triglyceride Determination Kit in un-, Ad- and Ad-miR-27a-infected cells at 72 h post-infection. Data are expressed as mean ± SD (n = 9); and D: elevated miR-27a expression decreases the total fatty acid content. The fatty acid content was calculated in Ad- and Ad-miR-27a-infected cells at 72 h post-infection, and normalized with the fatty acid C19:0 as an internal control. Data are expressed as mean ± SD (n = 6); and E: over-expression of miR-27a alters the composition of major types of fatty acids in goat mammary gland epithelial cells. Elevated miR-27a expression promoted the content of saturated fatty acids C16:0 and C18:0, whereas decreased the content of unsaturated fatty acids c9-C16:1, c9-C18:1, c9, t11-C18:2, and c9,t12-C18:2. The fatty acid content was calculated and normalized with the fatty acid C19:0 as an internal control. Data are expressed as mean ± SD (n = 6). Asterisk, P b 0.05, double asterisks, P b 0.01.

composition indicated that miR-27a has a significant effect on milk fatty acid composition in goat mammary gland epithelial cells. 3.4. miR-27a strongly affects gene expression associated with fat metabolism Milk fat synthesis in mammary gland epithelial cell involves many metabolic processes (Bionaz and Loor, 2008, 2011; Hansen et al., 1984). Briefly, fatty acids can be de novo synthesized by fatty acid synthase (FASN) (Bauman and Davis, 1974). The fatty acids are then desaturated by stearoyl-CoA desaturase (SCD) and converted into triglyceride by diacylglycerol acyltransferase1 (DGAT1) in the endoplasmic reticulum (Coleman and Lee, 2004; Ntambi, 1995). Fatty acids from outside the cell are hydrolyzed by lipoprotein lipase (LPL) and

transported into cells by thrombospondin receptor (CD36) (Endemann et al., 1993; Fielding and Frayn, 1998). These fatty acids are also incorporated into triglycerides in the endoplasmic reticulum. All triglycerides coalesce to form fat droplets by adipose differentiation related protein (ADRP) and PAT-related protein family member 47 (TIP47) (McManaman et al., 2007). Furthermore, some of these genes were controlled by transcriptional factors (i.e., SREBP-1c targeting FASN [Damiano et al., 2010]; peroxisome proliferator-activated receptor γ (PPARγ) targeting SCD and DGAT1 [Kadegowda et al., 2009]). We assessed the expression of key genes related to these processes at 0, 24, 48, and 72 h after infecting mammary gland epithelial cells with Ad-miR-27a. Over-expression of miR-27a strongly down-regulated mRNA expression associated with triglyceride synthesis (Fig. 3A), and up-regulated mRNA levels related to fat droplet formation throughout

20

X. Lin et al. / Gene 521 (2013) 15–23

Fig. 3. mR-27a regulates gene expression associated with fat metabolism in goat mammary gland epithelial cells. Over-expression of miR-27a suppressed the mRNA expression levels of PPARγ, SCD, and DGAT1 (A) and increased the mRNA expression of ADRP and TIP47 (B), LPL (D), PPARγ2 (F), HSL and ATGL (G), LEP and AMPKα (H), and CPT1, PPARα, and ACOX1 (I). These genes are all important regulators involved in milk fat metabolism. Elevated miR-27a expression had no significant effect on the mRNA levels of SREBP-1c and FASN (C). SCD and DGAT1 are downstream targets of PPARγ (A). FASN is a downstream target of SREBP-1c (C). Gene mRNA expression was assessed at 0, 24, 48, and 72 h in Ad- or Ad-miR-27a-infected cells. The mRNA levels were measured by qRT-PCR and normalized with GAPDH. All data are expressed relative to the mRNA amounts of Ad-infected cells. Data are expressed as mean ± SD (n = 12); and E: over-expression of miR-27a suppresses the protein level of PPARγ in goat mammary gland epithelial cells. PPARγ has two isoforms, PPARγ1 (about 52 kDa) and PPARγ2 (about 56 kDa). Western blotting of PPARγ was performed at 0, 24, 48, and 72 h post-infection in mammary gland epithelial cells infected with Ad-miR-27a or Ad. The blot was reprobed with β-actin, which was the loading control. Western blot was quantified by using a Bio-Rad ChemiDoc system. PPARγ protein expression levels were normalized to those of the β-actin. Protein amounts (in histogram) in Ad-miR-27a were plotted relative to its Ad-infected cells. Date are expressed as mean ± SD (n = 4). An asterisk indicates significance at P b 0.05.

the observation period (Fig. 3B). For triglyceride synthesis, PPARγ, SCD, and DGAT1 expression in Ad-miR-27a-infected cells were all lowest at 24 h (Fig. 3A). For fat droplet formation, ADRP and TIP47 expressions were both highest at 24 h (Fig. 3B). In addition, miR-27a had little effect on mRNA expression associated with de novo fatty acid synthesis (SREBP-1c and FASN, Fig. 3C) and fatty acid transport (CD36, Fig. 3D). Previous studies showed that PPARγ participates in the transcriptional activation of lipogenic genes important for lipid accumulation in adipose tissue, such as SCD, DGAT1, and sterol 27-hydroxylase (CYP27A1) (Quinn et al., 2005; Qun et al., 2008; Schoonjans et al., 1996). PPARγ is also a target of miR-27a (Qun et al., 2008). We measured the protein levels of PPARγ at 0, 24, 48, and 72 h after infecting mammary gland epithelial cells with Ad-miR-27a or Ad (control). As expected, over-expression of miR-27a suppressed PPARγ protein levels throughout the observation period (Fig. 3E). The PPARγ protein level was lowest at 24 h and then gradually increased. This expression pattern of PPARγ protein was not only consistent with the mRNA levels of PPARγ but also with the downstream genes of PPARγ (SCD and DGAT1, Fig. 3A). These results suggest that miR-27a may regulate mRNA expression of SCD and DGAT1 by controlling PPARγ protein levels. SCD and

DGAT1 are two key enzymes for milk fat triglyceride synthesis (Kadegowda et al., 2009; Ntambi, 1995). Therefore, miR-27a is important for milk triglyceride synthesis in lactating goats. In addition, the expression pattern of PPARγ protein was an inverse to the expression of PPARγ2 mRNA (Fig. 3F). PPARγ2 is one of two PPARγ isoforms. Therefore, it is possible that the increased PPARγ2 mRNA expression (Fig. 3F) might be a redundant pathway to compensate for the suppressed PPARγ protein level. Suppression of lipolysis or β-oxidation can accelerate triglyceride accumulation in adipose tissue (Arner and Langin, 2007; Wakil and Abu-Elheiga, 2008). For lipolysis, two enzymes (i.e., HSL and ATGL) catabolize triglycerides stored within lipid droplets to release fatty acids and glycerol (Arner and Langin, 2007). Fatty acids produced from lipolysis can be used for β-oxidation (Wakil and Abu-Elheiga, 2008). Carnitine palmitoyltransferase 1 (CPT1), peroxisome proliferator-activated receptor α (PPARα), and acyl-CoA oxidase 1 (ACOX1) are important enzymes for β-oxidation (Wakil and Abu-Elheiga, 2008). Furthermore, the AMP-activated protein kinase α (AMPKα) and leptin (LEP) pathways can reduce triglyceride contents by activating enzymes related to β-oxidation and lipolysis (McFadden and Corl, 2009; Ramsay, 2003).

X. Lin et al. / Gene 521 (2013) 15–23

Elevated miR-27a expression in goat mammary gland epithelial cells increased the mRNA expression of HSL, ATGL, AMPKα, and LEP during the 72 h observation period (Figs. 3G, H). The mRNA expression levels of PPARα and ACOX1 also increased (Fig. 3I). The mRNA expression of CPT1 decreased at 24 h, then increased afterwards in response to miR-27a over-expression (Fig. 3I). The increase of mRNA expression involved in lipolysis and β-oxidation suggests that miR-27a may play an important role in fatty acid catabolism in epithelial cells. In summary, our data demonstrated that miR-27a significantly affected fatty acid synthesis and mRNA expression associated with fat metabolism in epithelial cells. Most importantly, over-expression of miR-27a caused a strong reduction in triglyceride accumulation. By regulating PPARγ protein levels, miR-27a can control mRNA expression related to triglyceride synthesis (i.e., SCD, DGAT1) downstream of PPARγ. 4. Discussion 4.1. miR-27a decreased triglyceride accumulation Mammary gland epithelial cells undergo periodic cycles of growth and development, differentiation, and apoptosis corresponding to the physiological states of pregnancy, lactation, and involution (Flint and Gardner, 1994; Folley, 1949). These processes are controlled by a variety of hormones, including insulin and prolactin (Topper and Freeman, 1980). Prolactin plays important role in mammary gland development during the pregnancy (Hennighausen et al., 1997). During lactation, prolactin can activate the STAT5/JAK2 pathway to increase milk fat synthesis (Dentelli et al., 2009). It has been reported that prolactin serum concentration is higher during peak lactation than during the dry period and that changes in prolactin concentrations parallel changes in milk yield throughout lactation (Hart et al., 1978; Koprowsk and Tucker, 1973). In our study, miR-27a expression in goat mammary gland was greater during lactation than during the dry period (Fig. 1A). Changes in miR-27a expression were consistent with changes in prolactin concentrations (Fig. 1B). We hypothesized that miR-27a may be related to lactation. In addition, miRNAs are involved in the post-transcriptional suppression of target genes (Barte, 2004; Lewis et al., 2005). Three genes related to lipid metabolism, PPARγ, CCAAT/enhancer-binding protein gene (C/EBP), and retinoid X receptor α gene (RXRα), are known targets of miR-27 in mouse adipose tissue (Qun et al., 2008). However, the targets of miR-27a in goat are unknown. The miRNA prediction databases have the 3′ UTR sequence of mouse but not of goat. We therefore analyzed the 3′ UTR sequences of PPARγ, C/EBP, and RXRα in goat and compared them to those in mouse (Table 2). The miR-27a binding sites on PPARγ, C/EBP, and RXRα 3′ UTR were highly conserved between these two species, which suggested that miR-27a may target PPARγ, C/EBP, and RXRα in goat. Moreover, we found that other predicted genes were associated with fat metabolism, including FASN and LPL (Bionaz and Loor, 2008, 2011). These findings suggested that miR-27a is correlated with fat metabolism. We then investigated the effect of miR-27a on fat accumulation in mammary gland epithelial cells. The fat triglyceride content of mammary gland epithelial cells decreased when miR-27a was over-expressed with recombinant adenoviralmiR-27a (Fig. 2C), thus supporting our hypothesis that miR-27a regulates fat metabolism in goat.

21

Previous studies have shown that FASN, PPARγ and C/EBP can be activated by prolactin (Hogan and Stephens, 2005; Nanbu-Wakao et al., 2000; Shipley and Waxman, 2004), indicating that these genes may be downstream of prolactin. Interestingly, miR-27a is also regulated by prolactin, and its expression is consistent with prolactin concentration (Fig. 1B). This suggests that miR-27a may also be downstream of prolactin. However,miR-27a may weaken the effect of prolactin by targeting FASN, PPARγ and C/EBP. Thus, the genetic interaction between miR-27a and prolactin is complicated and needs further characterization. miR-27a targets PPARγ to modulate adipocyte differentiation and lipid metabolism in many tissues and cell lines, including mice adipose tissue (Qun et al., 2008), 3T3-L1 cell lines (Kim et al., 2010), and rat hepatic stellate cell lines (Ji et al., 2009). However, the regulation of miR-27a in PPARγ in goat is unclear. Our study found that over-expression of miR-27a suppressed triglyceride accumulation in Ad-miR-27a-infected epithelial cells (Fig. 2C). To search for the underlying causes of decreased triglyceride accumulation, we must know if the effect of miR-27a on triglyceride content was mediated by PPARγ, a key regulator of lipid accumulation (Qun et al., 2008). We measured the protein level of PPARγ and found that over-expression of miR-27a decreased PPARγ protein level (Fig. 3E) and the mRNA expression of its downstream gene DGAT1 (Fig. 3A). DGAT1 is responsible for triglyceride synthesis (Coleman and Lee, 2004). Therefore, we conclude that miR-27a regulates triglyceride content via PPARγ. Furthermore, PPARγ has many downstream genes. Most of these genes are unclear in goat. We cannot exclude the possibility that other genes downstream of PPARγ can also affect triglyceride synthesis. Therefore, suppressed DGAT1 expression can only partially explain the reduced triglyceride content of Ad-miR-27a-infected epithelial cells. Furthermore, we cannot explain the other effects of miR-27a, such as decreased total fatty acid content (Fig. 2D) and increased mRNA expression related lipolysis and β-oxidation (Figs. 3G, I). MiRNAs can target various mRNAs. We concluded that miR-27a may regulate milk fat metabolism through unknown target genes in goat. To validate miR-27a targets, we constructed ten miR-27a-sensors (including FASN and LPL); however, we have not obtained direct proof that one of these genes is a target of miR-27a. In addition, elevated miR-27a expression induced gene expression related to lipolysis and β-oxidation (Figs. 3G, I), as well as to the AMPKα and LEP (Fig. 3H), which suggested that the decline in triglyceride content may be induced by a compound effect, not only the suppression of PPARγ protein. Additional validation experiments are ongoing in our laboratory. 4.2. miR-27a down-regulated the ratio of unsaturated/saturated fatty acid Elevated miR-27a expression changed the fatty acid composition of mammary gland epithelial cells (Fig. 2E). Specifically, the saturated fatty acid content in epithelial cells increased, but the unsaturated fatty acid content decreased, as miR-27a expression increased. This is the first report that miRNA affected fatty acid composition in mammary gland epithelial cells. One possible mechanism is that miR-27a suppressed the expression of SCD, which not only is a target of PPARγ but also is responsible for producing unsaturated fatty acids (Miller and Ntambi, 1996; Ntambi, 1995). Elevated miR-27a expression reduced PPARγ protein expression (Fig. 3E), resulting in a decline in

Table 2 Homologous binding site of miR-27a in goat and mouse. Target

Description

Percent homologous with 3′ UTR

Homology of 150 bp (binding site and flanking)

Homology of targets

NCBI reference no. of mouse

PPARγ C/EBP RXRα

Peroxisome proliferator-activated receptor CCAAT/enhancer-binding protein Retinoid-X receptor α

98% Unknown Unknown

100% 98% 100%

100% 100% 100%

NM_005037 NM_004364 NM_002957

22

X. Lin et al. / Gene 521 (2013) 15–23

SCD expression (Fig. 3A). Our idea is also supported by previous reports that over-expression of SCD increased the total unsaturated fatty acid content of mouse lymphoid cells and bovine mammary cells (Shorten et al., 2004; Tebbey and Buttke, 1992). This information is important because the ability to alter the composition of milk fat from dairy animals has been a significant research topic for many years (Nagpal et al., 2012). Unsaturated fatty acids (e.g., c9-C18:1, t11-C18:1) in milk are much healthier than saturated fatty acids (e.g., C16:0, C18:0) (Haenlein, 2004). Our investigation suggested that the unsaturated fatty acid content of goat milk could potentially be increased by downregulating miR-27a expression in mammary gland. Furthermore, the transgenesis of miR-27a to dairy goat could be used to up-regulate unsaturated fatty acid production.

secretion of lipid droplets (Ducharme and Bickel, 2008; Ogg et al., 2004). The expression of LSD2 and S-13 was undetectable, whereas the expression of BTN1A1 was nearly the same as that of the control, but the mechanisms of lipid distribution related with those genes need the further investigation. 5. Conclusion In conclusion, the data suggest a role for miR-27a as a regulator of milk triglyceride accumulation and composition in epithelial cells of goat mammary gland. Additional study is needed about the specific regulation of miR-27a on milk triglyceride synthesis of lactating goats. Such information could potentially be used to improve milk nutrient composition of dairy animals.

4.3. PPARγ1 and PPARγ2 Acknowledgments PPARγ, transcriptionally regulates its downstream genes (i.e., SCD, DGAT, SREBP, FASN, LPL, CD36, and ADRP) associated with lipid metabolism in white adipose tissue, is a target of miR-27a (Qun et al., 2008). PPARγ has two isoforms, PPARγ1 (about 52 kDa) and PPARγ2 (about 56 kDa), which are generated from the same gene by alternative splicing. Although both genes regulate lipogenesis and lipid accumulation (Bionaz and Loor, 2008), these two isoforms have many differences. In white adipose tissue, the expression of PPARγ2 is much higher than that of PPARγ1 (Fajas et al., 1997). Suppressed PPARγ expression down-regulated the expression of its only two targets (SCD and DGAT1) in bovine mammary epithelial cells (Kadegowda et al., 2009), whereas elevated PPARγ2 expression selectively up-regulates downstream lipogenic gene LPL and FASN expression in steatotic hepatocytes (Schadinger et al., 2005). Our results showed that the predominant PPARγ isoform in goat mammary gland epithelial cells is PPARγ2 (Fig. 3E). The suppression of PPARγ protein level (Fig. 3E) downregulated two PPARγ targets, SCD and DGAT1 (Fig. 3A). Furthermore, the mRNA expression patterns of PPARγ, SCD, and DGAT1 were similar (Fig. 3A), but very different from the mRNA expression of PPARγ2 (Fig. 3F), and the mRNA expression patterns of ADRP, CD36, and PPARγ2 were similar (Figs. 3B, D, F). Therefore, in regard to the different expression patterns of PPARγ1, PPARγ2 and their targets in goat, we suggest that the two PPARγ isoforms may differ in the regulation of their expression and in their downstream mRNA expression. Previous studies have shown that PPARγ has strong effects on the expression of its downstream genes in liver tissue and in adipocyte cells (Fajas et al., 1997; Kadegowda et al., 2009; Medina-Gomez et al., 2007); however, our results indicated that PPARγ has a much weaker effect on the expression of its downstream genes in mammary gland epithelial cells. Thus, PPARγ regulation may be specific for tissue type. The expression of many of PPARγ targets (SREBP-1c, FASN, and CD36; Figs. 3C, D) was nearly unchanged when PPARγ protein expression was down-regulated. FASN and CD36 are targets not only of PPARγ but also of SREBP-1c (Nanbu-Wakao et al., 2000). Previous studies have shown that the effect of upstream transcription factors (e.g., PPARγ and SREBP-1c) on downstream genes varies among species and tissue types (Jump, 2004). We speculate that PPARγ is not the major factor controlling the initiation of its downstream transcription targets in goat mammary gland. 4.4. Appearance of lipid droplets The fat droplets in Ad-miR-27a-infected cells were more compact and located nearer to the cell nucleus than fat droplets in the Ad-infected cells (Fig. 2B). The fat droplets in Ad-miR-27a-infected cells nearly obscured the cell nucleus. Because of these differences in lipid distribution, we compared the expression of three genes (i.e., lipid storage droplet 2 [LSD2], plasma membrane-associated protein S3-12 [S3-12], and butyrophilin subfamily1 member A1 [BTN1A1]) associated with the formation and

We are grateful to Dr. William Gale for his critical comments and language editing of the manuscript and to Prof. Li Changan for biopsy sampling. This work was co-supported by the Special Fund for Agroscientific Research in the Public Interest of China (no. 201103038) and the National Natural Science Foundation of China (31072013). References Alonso, L., Fontecha, J., Lozada, L., Fraga, M.J., Juárez, M., 1999. Fatty acid composition of caprine milk: major, branched-chain, and trans fatty acids. J. Dairy Sci. 82, 878–884. Arner, P., Langin, D., 2007. The role of neutral lipases in human adipose tissue lipolysis. Lipid Metab. 18, 246–250. Avril-Sassen, S., et al., 2009. Characterisation of microRNA expression in post-natal mouse mammary gland development. BMC Genomics 10, 548. Barte, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281–297. Bauman, D.E., Davis, C.L., 1974. Biosynthesis of milk fat. In: Larson, B.L., Smith, V.R. (Eds.), In Lactation: a Comprehensive Treatise. Acad. Press, New York, pp. 31–75. Bionaz, M., Loor, J.J., 2008. Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genomics 9, 366–387. Bionaz, M., Loor, J.J., 2011. Gene networks driving bovine mammary protein synthesis during the lactation cycle. Bioinf. Biol. Insights 5, 83–89. Bommer, G.T., MacDougald, O.A., 2011. Regulation of lipid homeostasis by the bifunctional SREBF2-miR33a. Cell Metab. 13, 241–247. Chen, X., et al., 2010. Identification and characterization of microRNAs in raw milk during different periods of lactation, commercial fluid, and powdered milk products. Cell Res. 20, 1128–1137. Coleman, R.A., Lee, D.P., 2004. Enzymes of triacylglycerol synthesis and their regulation. Prog. Lipid Res. 43, 134–176. Damiano, F., Alemanno, S., Gnoni, G.V., Siculella, L., 2010. Translational control of the sterol-regulatory transcription factor SREBP-1 mRNA in response to serum starvation or ER stress is mediated by an internal ribosome entry site. Biochem. J. 429, 603–612. Dentelli, P., et al., 2009. Formation of STAT5/PPAR transcriptional complex modulates angiogenic cell bioavailability in diabetes. Vasc. Biol. 29, 114–120. Ducharme, N.A., Bickel, P.E., 2008. Minireview: lipid droplets in lipogenesis and lipolysis. Endocrinology 149, 942–949. Endemann, G., Stanton, L.W., Maden, K.S., Bryant, C.M., White, R.T., Protter, A.A., 1993. CD36 is a receptor for oxidized low density lipoprotein. JBC 268, 11811–11816. Esau, C., et al., 2006. miR-122 regulation of fat metabolism revealed by in vivo antisense targeting. Cell Metab. 3, 87–98. Fajas, L., et al., 1997. The organization, promoter analysis, and expression of the human PPAR gene. J. Biol. Chem. 272, 18779–18789. Fielding, B.A., Frayn, K.N., 1998. Lipoprotein lipase and the disposition of dietary fatty acids. Br. J. Nutr. 80, 495–502. Flint, D.J., Gardner, M., 1994. Evidence that growth hormone stimulates milk synthesis by direct action on the mammary gland and that prolactin exerts effects on milk secretion by maintenance of mammary deoxyribonucleic acid content and tight junction status. Endocrinology 135, 1119–1124. Folley, S.J., 1949. Biochemical aspects of mammary gland function. Biol. Rev. 24, 316–354. German, T., Barash, I., 2002. Characterization of an epithelial cell line from bovine mammary gland. In Vitro Cell. Dev. Biol. 38, 282–292. Haenlein, G.F.W., 2004. Goat milk in human nutrition. Small Rumin. Res. 51, 155–163. Hansen, H.O., Grunnet, I., Knudsen, J., 1984. Triacylglycerol synthesis in goat mammary gland: the effect of ATP, Mg2+ and glycerol 3-phosphate on the esterification of fatty acids synthesized de novo. Biochem. J. 220, 513–519. Hart, I.C., Bines, J.A., Morant, S.V., Ridley, J.L., 1978. Endocrine control of energy metabolism in the cow: comparison of the levels of hormones (prolactin, growth hormone, thyroxine, and insulin) and metabolites in the plasma of high and low-yielding cattle at various stages of lactation. J. Endocrinol. 77, 333–345.

X. Lin et al. / Gene 521 (2013) 15–23 Hennighausen, L., Robinson, G.W., Wagner, K.U., Liu, X.W., 1997. Prolactin signaling in mammary gland development. J. Biol. Chem. 272, 7567–7569. Hogan, J.C., Stephens, J.M., 2005. The regulation of fatty acid synthase by STAT5a. Diabetes 54, 1968–1975. Ji, J., Zhang, J., Huang, G., Qian, J., Wang, X., Mei, S., 2009. Over-expressed microRNA-27a and 27b influence fat accumulation and cell proliferation during rat hepatic stellate cell activation. FEBS Lett. 583, 759–766. Juarez, M., Ramos, M., 1987. Physico-chemical characteristics of goat's milk as distinct from those of cow's milk. Int. Dairy Fed. 202, 54–67. Jump, D.B., 2004. Fatty acid regulation of gene transcription. Crit. Rev. Clin. Lab. Sci. 41, 41–78. Kadegowda, A.K.G., Bionaz, M., Piperova, L.S., Erdman, R.A., Loor, J.J., 2009. Peroxisome proliferator-activated receptor-γ activation and long-chain fatty acids alter lipogenic gene networks in bovine mammary epithelial cells to various extents. J. Dairy Sci. 92, 4276–4289. Kim, S.Y., et al., 2010. miR-27a is a negative regulator of adipocyte differentiation via suppressing PPARγ expression. Biochem. Biophys. Res. Commun. 392, 323–328. Koprowsk, J.A., Tucker, H.A., 1973. Serum prolactin during various physiological states and its relationship to milk production in the bovine. Endocrinology 92, 1480–1487. Lewis, B.P., Burge, C.B., Barte, D.P., 2005. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120, 15–20. Li, H.X., Luo, X., Liu, R.X., Yang, Y.J., Yang, G.S., 2008. Roles of Wnt/β-catenin signaling in adipogenic differentiation potential of adipose-derived mesenchymal stem cells. Mol. Cell. Endocrinol. 291, 116–124. Lynn, F.C., 2009. Meta-regulation: microRNA regulation of glucose and fat metabolism. Cell 20, 452–459. McFadden, J.W., Corl, B.A., 2009. Activation of AMP-activated protein kinase (AMPK) inhibits fatty acid synthesis in bovine mammary epithelial cells. Biochem. Biophys. Res. Commun. 390, 388–393. McManaman, J.L., Russell, T.D., Schaack, J., Orlicky, D.J., Robenek, H., 2007. Molecular determinants of milk lipid secretion. J. Mammary Gland Biol. Neoplasia 12, 259–268. Medina-Gomez, G., et al., 2007. PPAR gamma 2 prevents lipotoxicity by controlling adipose tissue expandability and peripheral fat metabolism. PLoS Genet. 3, e64. Miller, C.W., Ntambi, J.M., 1996. Peroxisome proliferators induce mouse liver stearoylCoA desaturase 1 gene expression. PNAS 93, 9443–9448. Nagpal, R., et al., 2012. Milk, milk products, and disease free health: an updated overview. Crit. Rev. Food Sci. Nutr. 52, 321–333. Nakanishia, N., et al., 2009. The up-regulation of microRNA-335 is associated with fat metabolism in liver and white adipose tissue of genetically obese mice. Biochem. Biophys. Res. Commun. 385, 492–496. Nanbu-Wakao, R., Fujitani, Y., Masuho, Y., Muramatu, M., Wakao, H., 2000. Prolactin enhances CCAAT enhancer-binding protein-b (C/EBPb) and peroxisome proliferatoractivated receptor g (PPAR g) messenger RNA expression and stimulates adipogenic conversion of NIH-3T3 cells. Mol. Endocrinol. 14, 307–316.

23

Ntambi, J.M., 1995. The regulation of stearoyl-CoA desaturase (SCD). Prog. Lipid Res. 34, 139–150. Ogg, S.L., Weldon, A.K., Dobbie, L., Smith, A.J.H., Mather, I.H., 2004. Expression of butyrophilin (Btn1a1) in lactating mammary gland is essential for the regulated secretion of milk–lipid droplets. PNAS 101, 10084–10089. Quinn, C.M., Jessup, W., Wong, J., Kritharides, L., Brown, A.J., 2005. Expression and regulation of sterol 27-hydroxylase (CYP27A1) in human macrophages: a role for RXR and PPARγ ligands. Biochem. J. 385, 823–830. Qun, L., Zhan, G.G., Alarcon, R.M., Ye, J.P., Yun, Z., 2008. A role of miR-27 in the regulation of adipogenesis. FEBS J. 276, 2348–2358. Ramsay, T.G., 2003. Porcine leptin inhibits lipogenesis in porcine adipocytes. J. Anim. Sci. 81, 3008–3017. Sacco, J., Adeli, K., Jennifer, S., Khosrow, A., 2012. MicroRNAs: emerging roles in lipid and lipoprotein metabolism. Lipid Metab. 23, 220–225. Schadinger, S.E., Bucher, N.L.R., Schreiber, B.M., Farmer, S.R., 2005. PPAR2 regulates lipogenesis and lipid accumulation in steatotic hepatocytes. Am. J. Physiol. Endocrinol. Metab. 288, 1195–1205. Schoonjans, K., Staels, B., Auwerx, J., 1996. The peroxisome proliferator activated receptors (PPARS) and their effects on lipid metabolism and adipocyte differentiation. Biochim. Biophys. Acta 1302, 93–109. Shipley, J.M., Waxman, D.J., 2004. Simultaneous, bidirectional inhibitory crosstalk between PPARs and STAT5b. Toxicol. Appl. Pharmacol. 199, 275–284. Shorten, P.R., Pleasants, T.B., Upreti, G.C., 2004. A mathematical model for mammary fatty acid synthesis and triglyceride assembly: the role of stearoyl CoA desaturase (SCD). J. Dairy Res. 71, 385–397. Sun, L., et al., 2011. Mir193b–365 is essential for brown fat differentiation. Nat. Cell Biol. 13, 958–965. Tanaka, T., Haneda, S., Imakawa, K., Sakai, S., Nagaoka, K.A., 2009. A microRNA, miR101a, controls mammary gland development by regulating cyclooxygenase-2 expression. Differentiation 77, 181–187. Tebbey, P.W., Buttke, T.M., 1992. Arachidonic acid regulates unsaturated fatty acid synthesis in lymphocytes by inhibiting stearoyl-CoA desaturase gene expression. Biochim. Biophys. Acta 1171, 27–34. Topper, Y.J., Freeman, C.S., 1980. Multiple hormone interactions in the developmental biology of the mammary gland. Physiol. Rev. 60, 1049–1106. Trajkovski, M., et al., 2011. MicroRNAs 103 and 107 regulate insulin sensitivity. Nature 474, 649–654. Wakil, S.J., Abu-Elheiga, L.A., 2008. Fatty acid metabolism: target for metabolic syndrome. J. Lipid Res. 50, S138–S143. Wang, Z., Luo, J., Wang, W., Zhao, W.S., Lin, X.Z., 2010. Characterization and culture of isolated primary dairy goat mammary gland epithelial cells. Chin. J. Biotechnol. 26, 1123–1127. Zhang, N., Li, Q.Z., Gao, X.J., Yan, H.B., 2011. Potential role of adenosine monophosphateactivated protein kinase in regulation of energy metabolism in dairy goat mammary epithelial cells. J. Dairy Sci. 94, 218–222.