miR-382 inhibits tumor progression by targeting SETD8 in non-small cell lung cancer

Biomedicine & Pharmacotherapy 86 (2017) 248–253

Available online at

ScienceDirect www.sciencedirect.com

miR-382 inhibits tumor progression by targeting SETD8 in non-small cell lung cancer Tianjun Chen, Hui Ren, Asmitanand Thakur, Tian Yang, Yang Li, Shuo Zhang, Ting Wang, Mingwei Chen* Department of Respiratory, The First Affiliated Hospital, Xi’an Jiaotong University, Xi’an, Shaanxi 710061, PR China

A R T I C L E I N F O

Article history: Received 22 September 2016 Received in revised form 4 December 2016 Accepted 4 December 2016 Keywords: miR-382 SETD8 Non-small cell lung cancer Proliferation Migration Invasion

A B S T R A C T

Previous studies showed that miR-382 plays important roles in several types of cancers. Nevertheless, its expression and function in non-small cell lung cancer (NSCLC) remains largely unknown. In this study, we found that miR-382 expression was evidently downregulated in NSCLC tissue and cell lines in comparison with the adjacent normal tissues and human bronchial epithelial cell line (16HBE). Moreover, the expression levels of miR-382 were significantly associated with last-stage and tumor metastasis in NSCLC patients. In addition, exogenous miR-382 evidently inhibited NSCLC cell proliferation, migration and invasion in vitro. We also revealed SETD8 as a direct target of miR-382 in NSCLC, and restored SETD8 partially reversed the negative effects miR-382 on NSCLC cells. In total, our study demonstrated that miR382 dysregulated in NSCLC and involved in NSCLC tumorigenesis and metastasis by suppressing SETD8 expression, which may help to identify effective therapies for NSCLC treatment. © 2016 Elsevier Masson SAS. All rights reserved.

1. Introduction Lung cancer, as one of the most common malignant malignancies, was the leading cause of cancer-related mortality worldwide [1,2]. Despite recent advances of diagnosis and treatment strategies in clinical and experimental oncology, the substantial proportion of lung cancer patients with localized or locally advanced disease will eventually die, with the 5-year overall survival rate of
11%, threatening human health [3]. Thus, it is urgent to elucidate the molecular mechanisms underlying lung cancer development and identify novel prognostic markers and molecular therapeutic targets for improving the diagnosis, prevention and treatment of human lung cancer. MicroRNAs (miRNAs), a class of small non-coding RNAs (20–23 nucleotides in length), can regulate gene expression at posttranscriptional levels by binding to the 30 untranslated regions (UTRs) of their target messenger RNAs (mRNAs) mRNAs. A large number of studies revealed that dysregulated miRNAs were involved in various biological and pathological processes, including cell proliferation, differentiation, apoptosis and tumorigenesis

* Corresponding author. E-mail addresses: [email protected] (T. Chen), [email protected] (H. Ren), [email protected] (A. Thakur), [email protected] (T. Yang), [email protected] (Y. Li), [email protected] (S. Zhang), [email protected] (T. Wang), [email protected] (M. Chen). http://dx.doi.org/10.1016/j.biopha.2016.12.007 0753-3322/© 2016 Elsevier Masson SAS. All rights reserved.

[4–6]. Although the biological functions of miRNAs are not fully understood, emerging studies indicate that dysregulated miRNAs involves tumorigenesis by functioning as tumor suppressors or oncogenes [7,8]. For example, Shan et al. showed that miR-153 expression was decreased in clinical NSCLC tissues and cell lines, which was correlated with lymph node status [9]. miR-497 expression levels were significantly decreased and involved in the cell proliferation in NSCLC [10]. miR-32 was downregulated in NSCLC tissue and significantly associated with lymph node metastasis, advanced tumor/nodes/metastasis (TNM) classification stages and shorter overall survival [11]. In 2014, Ho et al. revealed eleven differentially expressed miRNAs as potential candidate metastatic markers during the classification of NSCLCs using microarray analyses [12] These studies suggest that dysregulated miRNAs were involved in progression of NSCLC. Recently, miR-382 function as tumor suppressor and involved cell proliferation and metastasis in colorectal cancer [13], osteosarcoma [14], ovarian cancer [15] and ductal carcinoma in situ (DCIS) of breast [16]. However, the expression and function of miR-382 in NSCLC remains unclear. In the present study, we investigated the role of miR-382 in NSCLC and verified that miRNA-382 was downregulated in NSCLC tissues and cell lines. Exogenous miR-382 could lead to suppressing of NSCLC cell proliferation, migration and invasion, which was attenuated by SETD8 overexpression. Therefore, our results demonstrated that miR-382 targets SETD8 and suppressed the

T. Chen et al. / Biomedicine & Pharmacotherapy 86 (2017) 248–253

malignant biological behaviors of NSCLC, providing a potential therapy strategy for NSCLC patients. 2. Materials and methods 2.1. Tissue samples The 60 paired patient samples of primary lung cancer tissues and matched adjacent non-cancerous tissues were collected from the Respiratory Department, The First Affiliated Hospital of Xi’an Jiaotong University between 2011 and 2014. All patients did not process chemotherapy or radiotherapy prior to surgery. The specimens were immediately frozen in liquid nitrogen after surgery and then stored at 80  C. This study was approved by the Research Ethics Committee of The First Affiliated Hospital of Xi’an Jiaotong University, and written informed consent was obtained from each patient.

249

2.6. Invasion and migration assay The transwell invasion assay was used here to detected NSCLC cell invasion capability. Cells were transfer into upper chamber and incubated at 37  C containing 5% CO2. Then, we observed the procedures of cellular growth at 72 h. The transwell migration chambers were used to evaluate cell invasion. The wound healing assay was used to detect cell migration capability as previous work [17]. 2.7. Statistical analysis All data were shown as mean  standard deviation. Statistical significance was assessed by T-test for two-group comparison. Differences with p value < 0.05 were considered statistically significant. All data were analyzed with SPSS 17.0 (SPSS Inc., Chicago, IL, USA) to confirm the statistical significance.

2.2. Cell culture and transfection

3. Results

A normal human bronchial epithelial cell line (16HBE) and Human NSCLC cell lines, SPC-A-1, A549, H1299, H460 and H358 were cultured at 37  C in a humidified air atmosphere containing 5% CO2 in DMEM supplemented with containing 10% fetal bovine serum (FBS), 100 units/mL of penicillin G sodium, and 100 mg/mL streptomycin sulfate. All the cell lines were cultured in at 37  C in a humidified atmosphere of 95% air and 5% CO2. Full length SETD8 cDNA was cloned into the pcDNA3.1 vector (Addgene, Cambridge, MA, USA). miR-382 mimic and miR-382 inhibitors were purchased from FulenGen company. miR-382 mimic, miR-382 inhibitors and pcDNA/SETD8 were transfected into NSCLC cells using Lipofectamine 2000 as the instruction of manufacturer (Invitrogen, Carlsbad, CA, USA). After 48 h, the cells were harvested for further assays.

3.1. miR-382 expression is suppressed in human NSCLC tissues and associated with with clinical features

2.3. RNA extraction and qRT-PCR Total RNA was extracted from the NSCLC tissues or cells with Trizol (Invitrogen, CA, USA) according to RNA extraction protocol. And then, we used 2 mg total RNA to synthesis cDNA using the TaqmanTM microRNA reverse transcription kit. Finally, TaqManTM MicroRNA Assay kit (Applied Biosystems, USA) was used to detect the expression levels of miRNA and then normalized to U6 snRNA. MicroRNA-382 primer sequence: 50 -TACTGAAGAGAGTTGTTCGTG30 , and the U6 primer sequence: “CGCTTCACGAATTTGCGTGTCAT”. 2.4. Western blot assay Total protein (60 mg) lysis by RIPA from NSCLC tissue or cells was separated by SDS-polyacrylamide gels for the detection of SETD8 and GAPDH. And then transfered the protein to nitrocellulose membranes, nitrocellulose membranes containing target protein was incubated with anti-SETD8 (SAB1103612, sigma) or anti-GAPDH (G9545, sigma) antibodies overnight at 4  C and incubated with HRP-conjugated secondary antibody for 1 h at room temperature. The target protein was quantified using Optiquant software. 2.5. Luciferase reporter assay The 30 -UTR of human SETD8 was amplified and subcloned into the pGL3-luciferase reporter plasmid (Promega). The miR-382 target of SETD8 30 -UTR was mutated to bulit pGL3-SETD8-mut vector. The NSCLC cells were transfected with the plasmids and miR-382 mimics and then assayed the luciferase activity using the Dual-Luciferase Reporter Assay System (Promega) 48 h later.

To clarify the biological role of miR-382 in NSCLC, we first verified miR-382 expressions using quantitative RT-PCR (qRT-PCR) in 60 pairs of human NSCLC tissue samples and their corresponding noncancerous lung tissue controls. MiR-382 expression was significantly downregulated in tumor tissue samples compared to the noncancerous tissue (Fig. 1A and B). Consistent with this results, the expression levels of miR-382 were also reduced in five NSCLC cell lines, relative to those in normal human bronchial epithelial cell line 16HBE (Fig. 1E). Additionally, we analyzed the relationship between the expression of miR-382 and the clinicopathologic factors of NSCLC patients. As shown in Table 1, the expression levels of miR-382 showed little association with age, gender and tumor size. However, we found that miR-382 levels were decreased in lung cancer with advanced (stage III and IV, n = 28) to early stages (stage I and II, n = 32) (Fig. 1C). Further, miR382 expression was downregulated in NSCLC that had lymph node or distal metastasis (n = 33) compared with no metastasis (n = 27) (Fig. 1D). 3.2. miR-382 prevents the proliferation, migration and invasion of NSCLC cells To better understand the biological functions of miR-382, we stably transfected A549 and H460 cells with miR-382 minics and inhibitors. And then MTT assay was used to examine the effect of miR-382 on cell proliferation. Compared with mimic-NC group and inhibitor-NC group, miR-382 mimics significantly increased miR382 expression, while miR-382 inhibitors evidently decreased miR-382 expression in both A549 and H460 cells (Fig. 2A). Overexpressed miR-382 decreased the proliferation rate of NSCLC cells, while silenced miR-382 evidently increased the proliferation rate of NSCLC cells (Fig. 2B). These findings suggested that miR-382 suppressed NSCLC cell growth. Given that the expression of miR-382 was highly associated with the metastatic properties of NSCLC, we wondered whether miR-382 might play an important role in migration and invasion in NSCLC. Wound healing assay and transwell invasion assays were used in this study to detect NSCLC cell migration and invasion capability. As shown in Fig. 2C and D, invasion and migration ability was increased in NSCLC cells infected with miR-382 inhibitors compared to control cells. On the other hand, invasion and migration abilities of NSCLC cells infected with miR-382 mimics were markedly decreased compared to control cells. Taken

250

T. Chen et al. / Biomedicine & Pharmacotherapy 86 (2017) 248–253

Fig. 1. Expression levels of miR-382 in NSCLC specimens and cell lines. A, The expression of miR-382 in 60 pairs of NSCLC tissues and compared normal tissues was detected by quantitative RT-PCR. Data are shown as log10 of relative ratio change of NSCLC tissues relative to adjacent normal tissues. B, Statistical analysis of relative miR-382 expression levels in NSCLC tissues and compared normal tissues. C, Statistical analysis of relative miR-382 expression levels in NSCLC tissues of stage I + II and stage III + IV. D, Statistical analysis of relative miR-382 expression levels in NSCLC tissues with or without metastasis. E, Using quantitative RT-PCR analysis, the expression of miR-382 in five NSCLC cell lines (SPC-A-1, A549, H1299, H460 and H358) was analyzed relative to normal human bronchial epithelial cell line 16HBE. The statistical analysis was performed using paired t-test in Fig. 1B. and Student’s t-test in Fig. 1C, D and E.

together, the above results indicate that miR-382 performed tumor suppressor role by suppressing cell migration and invasion in NSCLC. 3.3. SETD8 is the direct downstream target of miR-382 To explore the underlying molecular mechanism of miR-382mediated growth and metastasis suppression in NSCLC, we used

several bioinformatics methods, including TargetScan, miRWalk and miRanda, to found target gene of miR-382. Of these candidate genes, SETD8 was regarded as a tumor suppressor. And then dualluciferase reporter assay was used to targets role between miR-382 and SETD8. In this study, we cloned WT SETD8 30 -UTR and then mutated the target region sequence of the SETD8 30 -UTR (Fig. 3A), and detected the luciferase activities using Luciferase reporter assays. As shown in Fig. 3A, con-transfection of miR-382 mimics

Table 1 The relationship between miR-382 expression and their Clinicopathologic parameters in 60 of NSCLC Patients. Clinicopathologic parameters

Age <60 60 Gender Male Female Tumor size(cm) 3 >3 Degree of differentiation well and moderately Poorly Local invasion T1 + T2 T3 + T4 TNM stage Stage I + II Stage III + IV Metastasis No Yes

Number of cases

Median expression of miR-382 Mean  SD

P-value

23 37

0.726  8.6102 0.685  9.9960

0.215

31 29

0.713  0.348 0.6892  0.381

0.572

32 28

0.745  0.354 0.639  0.483

0.322

22 38

0.701  0.5407 0.644  0.4069

0.217

36 24

0.71  0.3067 0.63  0.419

0.123

32 28

0.8948 0.363 0.325  0.234

0.0392*

27 33

1.108  0.531 0.428  0.267

0.0254*

P value represents the probability from a student’s test for miR-382 expression between variable subgroups. *P < 0.05, ** P < 0.01, which was considered to have a significant difference.

T. Chen et al. / Biomedicine & Pharmacotherapy 86 (2017) 248–253

251

Fig. 2. miR-382 suppresses NSCLC cell proliferation, migration and invasion in vitro. A, RT-PCR was performed to detect the expression of miR-382 in NSCLC cell lines (A549 and H460) upon transfection with miR-382 mimic. B, MTT was performed to analyze the effect of miR-382 on cell proliferation of both cell lines. C, The effects of miR-382 on cell invasion were detected using transwell chamber assays. D, The effects of miR-382 on cell migration were detected using wound healing assays The data are representative of three independent experiments. Error bars represent SD. *P < 0.05; **P < 0.01 by Student’s t-test.

Fig. 3. miR-382 negatively regulates SETD8 expression in NSCLC cells. A, Sequence alignment of miR-382 and 30 UTR of SETD8 using mirco-RNA.org. Luciferase reporter assay. NSCLC cells were transiently cotransfected with Wt/Mut 30 UTR with miRNAs as indicated. The effects of miR-382 on the expression of SETD8 at both mRNA (B) and protein (C) level in NSCLC cells. Data are presented as means  SD from three independent experiments. *p < 0.01 vs. control group and mimics-NC group, *p < 0.01 vs. control group and inhibitors-NC group. D, SETD8 mRNA levels was examined by qRT-PCR in 60 cases of NSCLC tissues and adjacent nontumor tissues. *p < 0.01 vs. nontumor group. E, Correlation of miR-382 levels with SETD8 mRNA levels was examined by qRT-PCR in 60 cases of NSCLC tissues (Pearson's correlation coefficient, r = 0.7902). Statistically significant differences are indicated: *p < 0.01 versus paired non-tumorous tissues.

252

T. Chen et al. / Biomedicine & Pharmacotherapy 86 (2017) 248–253

evidently suppressed the luciferase activity in wild-type SETD8 30 UTR group, but failed to inhibit the luciferase activity of mutated SETD8. These data indicated SETD8 as a direct target of miR-382. Next, we detected the effects of miR-382 on the mRNA and protein expression levels of SETD8 in A549 and H460 cells. As shown in Fig. 3B and C, miR-382 mimics evidently suppressed the both mRNA and protein expression levels of SETD8 while miR-382 inhibitors increased the both mRNA and protein expression levels of SETD8 in both A549 and H460 cells at 24 h after transfection. To further confirm the relationship between SETD8 and miR382, we detected the expression levels of SETD8 in NSCLC tissues. We found that SETD8 levels in NSCLC tissues were greatly upregulated compared with adjacent non-tumor tissues (Fig. 3D). Then, we correlated SETD8 with miR-382 expression in the same NSCLC specimens. As shown in Fig. 3E, the mRNA levels of miR-382 and SETD8 observed a significant inverse correlation by using Spearman’s correlation analysis (R = 0.7902, p < 0.001). Taken together, these data strongly confirmed that SETD8 was a direct target of miR-382 in NSCLC. 3.4. SETD8 critically mediates miR-382 in NSCLC cells To determine the mechanism of miR-382-induced inhibition of cell proliferation, migration and invasion in NSCLC, gain-offunction assay was used by restoration of SETD8 expression. Specifically, we transfected a vector expressing SETD8, which resulted in constitutive expression of SETD8 without the potential for miR-382-mediated degradation in NSCLC cells (Fig. 4A). As shown in Fig. 4B, overexpression of SETD8 partially abrogated miR-

382-mediated suppression of proliferation in both A549 and H460 cells. Consistent with these results, wound healing assay and transwell invasion assays showed that SETD8 also partially abrogated miR-382-mediated suppression of NSCLC cell migration and invasion (Fig. 4C and D).These data further supported the result that SETD8 is a direct and functional target of miR-382 in NSCLC. 4. Discussion Although miR-382 function as a tumor suppressor in various cancers [14], its role and mechanism in NSCLC progression remains unclear. This study revealed the downregulation of miR-382 in NSCLC tissues, which was associated with last-stage and metastasis of NSCLC. Further functional assay identified that overexpressed miR-382 suppressed tumor proliferation and metastasis of NSCLC cells by targeting SETD8. Previous studies showed that miR-382 involves progression in several types of human malignancy [16,18–21]. Decreased miR-382 levels were reverse-correlated with poor outcomes in esophageal squamous cell carcinoma patients [18]. miR-382 was reported as an angiogenic oncogene in gastric cancer [19]. An inverse correlation existed between aggressive tumor behavior and the residual expression of miR-382 in osteosarcoma [22]. Our study revealed that the expression levels of miR-382 were evidently downregulated in NSCLC tissue and cell lines. miR-382 is major member of 14q32 miRNAs, Previsou studies showed that so miR544 and miR-134 were downregulated in various cancers including NSCLC [23–25]. So we detected the expression levels of other

Fig. 4. miR-382 inhibited NSCLC metastasis via inactivation of Akt signaling by targeting SETD8. A, pcDNA/SETD8 reversed the repression of miR-382 mimics on SETD8 expression. B, MTT assays revealed the relative invasion ability of NSCLC cell transfected with Control, miR-382 or cotransfected with miR-382 and pcDNA-SETD8. C, Transwell assays revealed the relative invasion ability of NSCLC cell transfected with Control, miR-382 or miR-382 + SETD8 (cotransfected with miR-382 and pcDNA-SETD8) group. D, In wound migration assay revealed the migration ability of NSCLC cell transfected with Control, miR-382 or miR-382 + SETD8 (cotransfected with miR-382 and pcDNA-SETD8) group. Data are the mean  SD of duplicates from a representative experiment of three independent experiments. *p < 0.01 vs. Control group. **p < 0.01 vs. miR-382 group by Student’s t-test.

T. Chen et al. / Biomedicine & Pharmacotherapy 86 (2017) 248–253

14q32 miRNAs (miR-369-3p, miR-544 and miR-134) in NSCLC tissue in Additional file (Fig. S1). We foud that miR-544 and miR134 also downregulated in NSCLC tissue, which was consistent with previous studies [23–25]. The downregulation of miR-382 was associated with last-stage and metastasis of NSCLC patient, indicating that miR-382 might involve in the metastasis of NSCLC Furthermore, the downregulation of miR-382 was closely correlated with advanced clinical stage and lymph node metastasis of NSCLC, and exogenous miR-382 suppressed NSCLC cells proliferation, invasion and migration, indicating tumor suppressor role of miR-382 in NSCLC. SETD8, as a histone methyltransferase, catalyzes the monomethylation of the histone H4 lysine 20 and involved a serious of biological processes, including DNA replication, the cell cycle and RNA polymerase II. Recently, accumulating studies showed that SETD8 may involve the carcinogenesis and progression of various tumors [26,27]. For example, SET8 was recently reported to promote androgen receptor-mediated transcription activation in prostate cancer [28]. SETD8 also participated in regulating invasion in breast cancer [29]. Besides, the activity of the stable SETD8 was reported to play critical role in the growth capability of U2OS [30]. However, little is known about the role of SETD8 in NSCLC. In this study, we studied the regulation mechanism of miRNA on SETD8 in NSCLC. Bioinformatics tool and dual-luciferase reporter assay were revealed the targets role between miR-382 and SETD8 in NSCLC. Furthermore, exogenous SETD8 partly reversed the effect of miR382. Hence, the SETD8 protein might have a part to play in the miR382 regulation of cell proliferation, migration and invasion. In conclusion, our findings revealed the tumor suppressor role of miR-382 which involved in NSCLC pathogenesis partially mediated by targeting SETD8. This finding indicates miR-382 as a potential diagnostic and therapeutic target for NSCLC. Conflicts of interest The authors declare no conflict of interest. Acknowledgment Financial support was provided by a grant from the Scientific and Technological Research Project of Shanxi Province (2015KW038). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. biopha.2016.12.007. References [1] A.H. Mokdad, J.S. Marks, D.F. Stroup, J.L. Gerberding, Actual causes of death in the United States, 2000, JAMA 291 (2004) 1238–1245. [2] A. Jemal, R. Siegel, E. Ward, Y. Hao, J. Xu, M.J. Thun, Cancer statistics, 2009, CA : Cancer J. Clin. 59 (2009) 225–249. [3] S. Gettinger, T. Lynch, A decade of advances in treatment for advanced nonsmall cell lung cancer, Clin. Chest Med. 32 (2011) 839–851. [4] Z. Li, H. Lei, M. Luo, et al., DNA methylation downregulated mir-10b acts as a tumor suppressor in gastric cancer, Gastric Cancer: Off. J. Int. Gastric Cancer Assoc. Japanese Gastric Cancer Assoc. 18 (2015) 43–54. [5] X. Xiao, C. Tang, S. Xiao, C. Fu, P. Yu, Enhancement of proliferation and invasion by MicroRNA-590-5p via targeting PBRM1 in clear cell renal carcinoma cells, Oncol. Res. 20 (2013) 537–544.

253

[6] X. Yang, W. Ni, K. Lei, miR-200b suppresses cell growth, migration and invasion by targeting Notch1 in nasopharyngeal carcinoma, Cell. Physiol. Biochem.: Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 32 (2013) 1288–1298. [7] Z. Liu, C. Mai, H. Yang, et al., Candidate tumour suppressor CCDC19 regulates miR-184 direct targeting of C-Myc thereby suppressing cell growth in nonsmall cell lung cancers, J. Cell. Mol. Med. 18 (2014) 1667–1679. [8] H.H. Zhang, M. Pang, W. Dong, et al., miR-511 induces the apoptosis of radioresistant lung adenocarcinoma cells by triggering BAX, Oncol. Rep. 31 (2014) 1473–1479. [9] N. Shan, L. Shen, J. Wang, D. He, C. Duan, MiR-153 inhibits migration and invasion of human non-small-cell lung cancer by targeting ADAM19, Biochem. Biophys. Res. Commun. 456 (2015) 385–391. [10] C. Huang, R. Ma, J. Yue, N. Li, Z. Li, D. Qi, MiR-497 suppresses YAP1 and inhibits tumor growth in non-Small cell lung cancer, Cell. Physiol. Biochem.: Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 37 (2015) 342–352. [11] D. Zhu, H. Chen, X. Yang, et al., miR-32 functions as a tumor suppressor and directly targets SOX9 in human non-small cell lung cancer, OncoTargets Ther. 8 (2015) 1773–1783. [12] C.S. Ho, S.H. Yap, N.H. Phuah, In LL and Hasima N. MicroRNAs associated with tumour migration, invasion and angiogenic properties in A549 and SK-Lu1 human lung adenocarcinoma cells, Lung Cancer 83 (2014) 154–162. [13] B. Zhou, J. Song, T. Han, et al., MiR-382 inhibits cell growth and invasion by targeting NR2F2 in colorectal cancer, Mol. Carcinog. (2016). [14] M. Xu, H. Jin, C.X. Xu, et al., miR-382 inhibits osteosarcoma metastasis and relapse by targeting Y box-binding protein 1, Mol. Ther.: J. Am. Soc. Gene Ther. 23 (2015) 89–98. [15] H. Tan, Q. He, G. Gong, et al., miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer, Int. J. Oncol. 48 (2016) 181–190. [16] S. Li, H. Meng, F. Zhou, et al., MicroRNA-132 is frequently down-regulated in ductal carcinoma in situ (DCIS) of breast and acts as a tumor suppressor by inhibiting cell proliferation, Pathol. Res. Pract. 209 (2013) 179–183. [17] C.C. Liang, A.Y. Park, J.L. Guan, In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro, Nat. Protoc. 2 (2007) 329–333. [18] B. Qi, J.G. Lu, W.J. Yao, et al., Downregulation of microRNA-382 is associated with poor outcome of esophageal squamous cell carcinoma, World J. Gastroenterol. 21 (2015) 6884–6891. [19] J.K. Seok, S.H. Lee, M.J. Kim, Y.M. Lee, MicroRNA-382 induced by HIF-1alpha is an angiogenic miR targeting the tumor suppressor phosphatase and tensin homolog, Nucleic Acids Res. 42 (2014) 8062–8072. [20] F. Mar-Aguilar, J.A. Mendoza-Ramirez, I. Malagon-Santiago, et al., Serum circulating microRNA profiling for identification of potential breast cancer biomarkers, Dis. Mark. 34 (2013) 163–169. [21] Z. Li, J. Lu, M.et al. Sun, Distinct microRNA expression profiles in acute myeloid leukemia with common translocations, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 15535–15540. [22] A.L. Sarver, V. Thayanithy, M.C. Scott, et al., MicroRNAs at the human 14q32 locus have prognostic significance in osteosarcoma, Orphanet J. Rare Dis. 8 (2013) 7. [23] J. Li, Y. Wang, J. Luo, et al., miR-134 inhibits epithelial to mesenchymal transition by targeting FOXM1 in non-small cell lung cancer cells, FEBS Lett. 586 (2012) 3761–3765. [24] Q. Qin, F. Wei, J. Zhang, X. Wang, B. Li, miR-134 inhibits non-small cell lung cancer growth by targeting the epidermal growth factor receptor, J. Cell. Mol. Med. 20 (2016) 1974–1983. [25] C.C. Sun, S.J. Li, D.J. Li, Hsa-miR-134 suppresses non-small cell lung cancer (NSCLC) development through down-regulation of CCND1, Oncotarget 7 (2016) 35960–35978. [26] J. Zhang, W. Hou, M. Chai, et al., MicroRNA-127-3p inhibits proliferation and invasion by targeting SETD8 in human osteosarcoma cells, Biochem. Biophys. Res. Commun. 469 (2016) 1006–1011. [27] M. Takawa, H.S. Cho, S. Hayami, et al., Histone lysine methyltransferase SETD8 promotes carcinogenesis by deregulating PCNA expression, Cancer Res. 72 (2012) 3217–3227. [28] L. Yao, Y. Li, F. Du, et al., Histone H4 Lys 20 methyltransferase SET8 promotes androgen receptor-mediated transcription activation in prostate cancer, Biochem. Biophys. Res. Commun. 450 (2014) 692–696. [29] N. Yu, P. Huangyang, X.et al. Yang, microRNA-7 suppresses the invasive potential of breast cancer cells and sensitizes cells to DNA damages by targeting histone methyltransferase SET8, J. Biol. Chem. 288 (2013) 19633– 19642. [30] T. Abbas, E. Shibata, J. Park, S. Jha, N. Karnani, A. Dutta, CRL4(Cdt2) regulates cell proliferation and histone gene expression by targeting PR-Set7/Set8 for degradation, Mol. Cell 40 (2010) 9–21.