CCND1 signaling pathway

Accepted Manuscript MiR-429 regulates rat liver regeneration and hepatocyte proliferation by targeting JUN/MYC/BCL2/CCND1 signaling pathway

Chunyan Zhang, Cuifang Chang, Hang Gao, Qiwen Wang, Fuchun Zhang, Cunshuan Xu PII: DOI: Reference:

S0898-6568(18)30139-6 doi:10.1016/j.cellsig.2018.06.013 CLS 9135

To appear in:

Cellular Signalling

Received date: Revised date: Accepted date:

30 April 2018 22 June 2018 25 June 2018

Please cite this article as: Chunyan Zhang, Cuifang Chang, Hang Gao, Qiwen Wang, Fuchun Zhang, Cunshuan Xu , MiR-429 regulates rat liver regeneration and hepatocyte proliferation by targeting JUN/MYC/BCL2/CCND1 signaling pathway. Cls (2018), doi:10.1016/j.cellsig.2018.06.013

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT MiR-429 Regulates Rat Liver Regeneration and Hepatocyte

Proliferation

by

Targeting

JUN/MYC/BCL2/CCND1 Signaling Pathway 1,2

2

2

2*

1*

Chunyan Zhang , Cuifang Chang , Hang Gao , Qiwen Wang ,Fuchun Zhang , Cunshuan Xu

Xinjiang Key Laboratory of Biological Resources and Genetic Engineering, College of Life

PT

1

2*

2

RI

Science and Technology, Xinjiang University, Urumqi 830046, China,

State Key Laboratory Cultivation Base for Cell Differentiation Regulation and Henan

SC

Engineering Laboratory for Bioengineering and Drug Development, College of Life Science,

NU

Henan Normal University, Xinxiang 453007, Henan, China * Corresponding author

AC C

EP T

ED

MA

E-mail address: [email protected]

ACCEPTED MANUSCRIPT ABSTRACT Increasing evidence indicates that miR-429 is involved in tumor suppression in various human cancers. However, its role in liver regeneration remains unexplored. Liver regeneration is a highly orchestrated process that can be regulated by microRNAs (miRNAs), although the mechanisms are largely unclear. In this study, we aimed to identify the role of miR-429 in hepatocyte

PT

proliferation during liver regeneration. First, we performed microarray analysis and qRT-PCR. Results indicated that miR-429 level in rat liver markedly decreased 30 h after partial hepatectomy,

RI

and miR-429 overexpression disrupted BRL-3A proliferation and the transition of G1 to S phase in rat hepatocyte and promoted hepatocyte apoptosis. By contrast, miR-429 down-regulation had

SC

inverse effects. MiR-429 negatively regulated JUN expression in vitro and in vivo. After using JUN siRNA, we found that JUN inhibition mediates the effect of miR-429 in hepatocyte

NU

proliferation and growth and miR-429 negatively regulates JUN/MYC/BCL2/CCND1 signaling pathways. Our results also indicated that miR-429 inhibits hepatocyte proliferation and liver

MA

regeneration by targeting JUN/MYC/BCL2/CCND1.

AC C

EP T

ED

Keywords: MiR-429; JUN; Liver Regeneration; Hepatocyte; Proliferation

ACCEPTED MANUSCRIPT

1. INTRODUCTION The liver is involved in storage, metabolism, biotransformation, detoxification, hematopoiesis, bile pigment synthesis, secretion, and regeneration. When partial hepatectomy (PH) or when the

PT

liver is damaged by physical, chemical, and biological factors, residual liver compensates for damaged or lost liver tissues and restores the structure, weight, and volume of the liver through

RI

liver regeneration (LR) [ 1,2]. Two-thirds of PH-induced LR in rats is divided into three phases, namely, initial (2–6 h after PH), progress (12–72 h after PH), and termination (120–168 h after

SC

PH). LR involves a variety of physiological activities, such as cell activation, proliferation, apoptosis, and tissue remodeling. It is regulated by various factors, which include microRNAs

MA

medicine, and disease occurrence mechanism.

NU

(miRNAs) [3-5]. It is a hot spot in the research field of regenerative biology, regenerative

MiRNAs are small RNAs of 21–24 nt in length, which regulates various biological processes through their target genes; these processes include cell differentiation, proliferation, apoptosis, and

ED

metabolism [6-10]. Some studies demonstrated the important role of miRNAs in LR [4,5,10]. In particular, Yu et al [11] reported that miR-150 targets VEGF to regulate the hypoxia-induced

EP T

proliferation of hepatocytes. Yuan et al. [12] found that miR-221 targeting aromatic receptor nuclear translocation regulates hepatocyte proliferation and LR. Marquez et al. [13] demonstrated

AC C

that miR-21 targeting Peli1 regulates NF-KB signaling, hepatocyte proliferation, and LR. Further studies showed that the promoter of miR-21 is regulated by transcription factors, such as NF-kB and STAT3 [14, 15]. On the one hand, these transcription factors activate LR when they are activated by partial hepatic resection. On the other hand, these transcription factors up-regulate mir-21 expression, and the feedback inhibits LR [16]. Song et al. [10] demonstrated that miR-21 and miR-378 target Btg2 and Odc1 and regulate DNA synthesis in hepatocytes, respectively. However, other miRNAs that regulate hepatocyte proliferation during LR and the mechanisms mediating the regulatory effect of miRNAs requires further study. In this study, we found a marked reduction in miR-429 levels in the rat liver 30 h after PH and investigated the role of miR-429 in hepatocytes. Our results demonstrated that miR-429 inhibits

ACCEPTED MANUSCRIPT hepatocyte proliferation, the transition of the G1 phase of rat hepatocytes to the S phase by targeting JUN, and JUN/MYC/BCL2/CCND1 signaling pathways. Collectively, our founding identifies miR-429 as an inhibitor of hepatocyte proliferation and LR via targeting JUN/MYC/BCL2/CCND1 axis.

2. Materials and methods

PT

2.1 Rat model of partial hepatectomy (PH) The adult healthy male Sprague-Dawley (SD) rats, weighing 230±20g, were acquired from animal

RI

center of Henan Normal University and their conditions were recognized by the Animal Care and

SC

Use Committee of the Henan Normal University(Permit Number: SYXK2008-0105). Briefly, a total of 18 rats were randomly divided into 3 groups with six rats in each, including 1partial

NU

hepatectomy (PH) groups, 1 sham-operated (SO) groups and one normal control group. The rats in PH groups were subjected to 70% hepatectomy. SO group received the same procedure as for the

MA

PH group without liver removal. Rat were anaesthetized with intraperitoneal injection of 1% pentobarbital sodium (50 mg/kg), followed by abdominal median incis ion and hepatectomy of the

ED

median and left lobes of the liver. After the liver was resected, the abdominal incision was closed and rats were maintained in 37°C environment for anesthesia recovery. At 30 hrs after PH

EP T

(PH30h), rat were sacrificed and the livers were harvested and immediately kept into liquid azote. The liver tissues were then conserved at -80°C until RNA or protein extraction. The control mice received the same 70% PH but sacrifced at 0h after PH (PH-0h). The whole handling procedures

AC C

were carried out in accordance with the current Animal Protection Law of China. 2.2 miRNA microarray analysis Total RNAs were extracted from liver tissues and quantified by the NanoDrop ND-2100 (Thermo Scientifc). The control of RNA integrity was checked using Agilent 2100 (Agilent Technologies), total RNAs were tailed with Poly A, labeled with Biotin, and then hybridized for 16 hrs at 48°C on Affemetrix miRNA 3.0 Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 450. The arrays were scanned by the Affymetrix Scanner 3000 (Affymetrix) and the array images were analyzed using Affymetrix GeneChip Command Console 4.0 software (Affymetrix) to get raw data and then provide RMA normalization. Using Genespring 12.5 software (Agilent

ACCEPTED MANUSCRIPT Technologies), the probes that at least 75% of samples in any 1 condition out of 2 conditions have flags in “P” were chosen for further data analysis. According to the miRNAs readings, the control group 0h, experimental group 30h and surgical control group 30h and 0h expression values were normalized, the normalized values of the miRNAs detected at each time point in the experimental group and the surgical control group were compared to the normalized values of the control group.

PT

When the ratio of a miRNA is ≥ 1.2 times of the control or ≤ 0.8 times of the control, the miRNA is considered to have a significant change in expression. At the same time, the difference

RI

between the expression of miRNA in the experimental group and the corresponding value of the surgical control group was significantly different (p≥0.05) or extremely significant (p≤0.01) as

SC

the miRNAs of rat liver regeneration and proliferation. In order to reduce the experimental operation and the chip analysis error, the samples at each time point were detected three times

NU

repeatedly, and the average value of three independent assays was used as a valid experimental

MA

value for subsequent analysis. 2.3 Cell culture and treatment

ED

BRL-3A rat liver cells were obtained from cell bank of the School of Basic Medicine of Peking Union Medical College (Beijing, China). BRL-3A cells were cultured in Dulbecco’s modified

EP T

Eagle’s medium (DMEM, Life technologies, USA) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin at 37°C in a 5% CO2 incubator with saturated humidity. For overexpression or suppression of miR-429, cells were transfected with miR-429 mimics (100

AC C

nM, RiboBio, China), miR-429 inhibitor (100 nM, Ribobio, China), or their negative controls for 48 hrs, respectively. To further investigate the role of JUN in miR-429-associated hepatocyte proliferation and cell growth, cells were transfected with siRNA-JUN (sequence-01 or 02, 50 nM, Ribobio, China) or siRNA-negative control for 48 hrs, respectively. 2.4 MTT assay MTT assay was used to measure the cell viability of BRL-3A cells. BRL-3A cells were seeded in 96-well plates at 5×103 cells/well, and incubated at 37°C overnight. Cells were then transfected with miR-429 mimics (100 nM), miR-429 inhibitor (100 nM) or negative control (NC). At indicated time points (24 h and 48 h) after transfection, 100 μl of a methylthiazo-letetrazolium

ACCEPTED MANUSCRIPT (MTT) solution (0.5mg/mL) was added and the cells were incubated at 37°C for 4 h. Later, 100μl dimethyl sulfoxide (DMSO) was added and plates were gently shaken for 10 min at room temperature. The absorbance was measured at 490 nm by Biotek reader (ELx800, USA). All the treatments were done in three duplicates. 2.5 Edu incorporation assay

PT

Edu incorporation assay was carried out using Cell-Light Edu imaging detecting kit according to the manufacturer’s instructions (RiboBio). Edu is a thymidine analog whose incorporation can be

RI

used to label cells undergoing DNA replication. Briefly, the cells were firstly treated with 50

SC

μmol/L of Edu for 2 h at 37 °C. After being fixed with 4% paraformaldehyde for 30 min, the cells were treated with 0.5% Triton X-100 for 10 min and washed with PBS three times. Then, the cells

NU

were exposed to 100 μL of 1×Apollo® reaction cocktail for 30 min and incubated with 5 μg/mL of Hoechst 33342 to stain the cell nuclei for 30 min. Images were captured by a fluorescent

MA

microscope. 2.6 Flow cytometry for cell cycle analysis

ED

Cell cycle detection was conducted following procedures as follows. Cells were harvested at 48h post-transfection. After being harvested, cells were first washed in cold PBS for two times and

EP T

then fixed in 70% alcohol at -20°C for 12 h at least. The fixed cells were washed in cold PBS for two times and incubated in 1 mL of PBS solution with 20 μg of propidium iodide (PI, Sigma,

AC C

USA) and 50 μg of RNase A (Sigma, USA) for 30 min at 37°C. Samples were then analyzed for DNA content by FACSCan. 2.7 Flow cytometry for cell apoptosis Apoptosis rate was measured as the following procedures. At 48 h after transfection, cells were harvested using flow cytometry tube and centrifuged for 5 min at 1000 r/min at 4°C, followed by the removal of supernatant. Then the cells were washed in cold PBS for three times and centrifuged, with supernatant aspirated. In accordance with the instruction of Annexin V-FITC apoptosis detection kit (BD Pharmingen, USA), 100 μl binding buffer and 3.5 μl Annexin-V-FITC and 3.5 μl PI were added into each tube and well-mixed by shaking, followed by 30 min incubation in the dark. Finally, 400 µl 1 × binding buffer were added to the cells, which were

ACCEPTED MANUSCRIPT analyzed by flow cytometry. 2.8 Vector construction and luciferase reporter assay The 3’UTR of JUN containing the miR-429 recognition sequence was amplified by PCR, and the PCR product was then cloned into the psiCHECK-2 Luciferase vector (Promega). A mutant JUN 3’UTR was synthesized using primer-based overlapping PCR. 1×105 cells per well were seeded in

PT

a 24-well plate and transfected with reporter plasmid, Renilla luciferase control vector, and miR-429 mimic/miR-429 inhibitor. At 48 h after transfection, protein extracts were analyzed using

RI

the dual luciferase reporter assay system (Promega) according to manufacturer’s protocol.

SC

2.9 RNA extraction and qRT-PCRs

NU

Total RNA, including miRNA, was extracted with Trizol reagent (Invitrogen, Carlsbad, CA), and cDNA was obtained using the Reverse Transcription System Kit (Promega, USA). Quantitative

MA

real-time PCR (qRT-PCR) was operated using SYBR® Green I on a Rotor-Gene 3000 real-time analyzer (Corbett Robotics, Brisbane, Australia). The primers were listed in Table 1. Each sample was analyzed in triplicate. U6 and β-actin were used as the internal controls for the normalization

ED

of the amount of miRNA and total messenger RNA in each sample. The relative expression of

EP T

target genes was calculated with the 2-ΔΔCt method. 2.10 Western blot analysis

Cell samples were homogenized in RIPA lys is buffer (50 mM Tris, 150 mM NaCl, 1% Triton

AC C

X-100, 1% sodium deoxycholate, 0.1% SDS) containing proteinase inhibitors. Then, the lysates were incubated for 30 min on ice, and centrifuged at 12 000 g at 4℃ for 15 min. Equal amounts of protein were separated by SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane (GE Healthcare). The membrane was incubated with rabbit anti-JUN (Bioss, 1: 1,000), rabbit anti-MYC (Bioss, 1: 1,000), rabbit anti-BCL2 (Boster, 1: 1,000)rabbit anti-CCND1 (Boster, 1: 1,000) and rabbit anti-CASEPASE3 (Boster, 1: 1,000) overnight at 4℃. Then the membrane was further incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies goat anti-rabbit IgG (Sigma, 1:5,000). Finally, protein band was visualized with Amersham enhanced chemiluminescence (ECL) substrates (Western Lightning® Plus -ECL). The band density was measured using ImageQuant TL software. β-actin (sigma, 1:1,000) was

ACCEPTED MANUSCRIPT served as an internal reference. 2.11 Statistical analysis Data are presented as the mean ± standard error of mean (SEM). Statistical analysis was performed using independent student T-test or ANOVA with post hoc tests. P value of <0.05 was

PT

accepted as statistically significant. Statistical analysis was carried out with SPSS 18.0 software.

3. Results

RI

3.1 MiR-429 is associated with rat liver regeneration

SC

A peak in hepatocyte proliferation rate was observed 24 h after PH and was represented by the sharp increase in serum glutamic-oxaloacetate transaminase levels and amount of EdU positive

NU

cells [6]. We performed microarray analysis to evaluate miRNA profiles during the proliferative phase of LR (PH 30 h) and compared them with those in sham-operated groups. The heat map miR-320, miR-186, miR-301,

up-regulated,

miR-3585,

whereas

miR-125a,

MA

(Figure 1A) shows that miR-181b-2,

miR-145,

and

miR-23b,

and

miR-132 miR-429

were were

ED

down-regulated 30 h after PH. MiR-429 expression was verified through qRT-PCR. The result showed that miR-429 expression levels significantly decreased 30 h after PH (Figure 1B).

EP T

Moreover, we examined the expression of miR-429 in rat hepatocyte BRL-3A and found that miR-429 was down-regulated in hepatocytes after 3 and 4 days of culture (Figure 1C). In these periods, the logarithmic growth phase of BRL-3A cells was observed and further indicated by the

AC C

peak in PCNA expression levels (Figure 1D). Thus, we further investigated the role of miR-429 in rat hepatocyte proliferation and LR. 3.2 MiR-429 inhibits hepatocyte proliferation To investigate the effects of miR-429 on the cell growth and proliferation of rat hepatocytes, we transfected miR-429 mimics (50, 100, and 200 nM), inhibitors (50, 100, and 200 nM), or their negative controls to rat hepatocyte BRL-3A. The levels of the miR-429 mimics increased, and the miR-429 inhibitor reduced the miR-429 levels in rat hepatocyte BRL-3A. These results indicated that the mimics and inhibitors took effect (Figures 2A/B). Statistical analysis results also revealed that the miR-429 levels significantly increased or declined in BRL-3A cells transfected with a

ACCEPTED MANUSCRIPT mimic or an inhibitor (100 and 200 nM; p<0.01 vs. control) after 48 h, respectively. Therefore, we performed follow-up research with a 100 nM concentration of a mimic and an inhibitor. MTT assay and Edu cell proliferation assays showed that miR-429 mimics reduced, whereas the miR-429 inhibitor promoted the proliferation of BRL-3A liver cells (Figure 2C-2E). We further found that miR-429 overexpression was associated with an increased cell population in G1 phase

PT

and a reduced cell population in S phase using flow cytometry, which indicates that miR-429 inhibited the transition of BRL-3A cell population from the G1 phase to S phase of the cell cycle,

RI

whereas miR-429 down-regulation had an inverse effect (Figure 2F). Thus, miR-429 is validated

SC

as an inhibitor of the cell growth and proliferation of rat hepatocytes in vitro. 3.3 MiR-429 promotes hepatocyte apoptosis

NU

To investigate the potential function of miR-429 on the cell apoptosis of hepatocytes, we transfected miR-429 mimics, inhibitors, or their negative controls into rat hepatocyte BRL-3A.

MA

Cells transfected with miR-429 mimics increased apoptosis rate compared with cells transfected with control mimics (p < 0.05), whereas the miR-429 inhibitor had an inverse effect (Figure 3A/B).

ED

These results indicated that miR-429 induces apoptosis of rat hepatocytes. 3.4 MiR-429 negatively correlates with JUN protein level in vitro and in vivo

EP T

Functional clustering analys is was performed on the miR-429 target genes. As the results indicated that the N-terminal kinase (JNK) pathway is one of the most significant pathways, we selected

AC C

JUN as the target gene of miR-429. We demonstrated that miR-429 mimics reduced, whereas miR-429 inhibitor increased JUN expression at an mRNA and protein level in rat hepatocyte BRL-3A (Figure 4A and 4B). JUN expression was negatively correlated with miR-429 expression in the rat liver at PH-30 h compared with those at PH-0h (Figure 4C–4E). The data indicated a potential relationship between miR-429 expression and the JUN signaling pathway during the proliferative phase of LR. 3.5 JUN is a direct binding target of miR-429 We constructed two vectors by cloning WT and MUT 3′UTR into psiCHECK2 vectors and performed luciferase reporter assay to validate whether miR-429 physically interacts with JUN mRNA. We co-transfected BRL-3A cells with a scramble or miR-429 mimics or inhibitors and

ACCEPTED MANUSCRIPT WT/MUT-JUN-UTR and measured luciferase activity after 48 h. The results showed significant reduction and increase in the levels of miR-429 mimics and miR-429 inhibitor in luc iferase activity, respectively (Figure 5A), whereas no distinct change was noted in MUT 3′UTR vector and miR-429 mimic or inhibitor co-transfected cells with control. These results indicated that JUN is a direct binding target of miR-429.

PT

3.6 JUN suppression inhibits hepatocyte proliferation and reverses miR-429 inhibition-induced cell growth in vitro

RI

Three siRNAs were designed on the basis of the JUN sequence. We performed quantity RT-PCR

SC

and Western blot to determine the effects of different siRNAs on JUN expression level. The results showed that using siRNA-JUN (siR-JUN-3) significantly reduced JUN mRNA and protein levels

NU

in rat hepatocyte BRL-3A (Figure 6A/B). Therefore, siR-JUN-3 (siR-JUN) was used to perform follow-up research. MTT Assay, Edu cell proliferation assay, and cell cycle assay showed that rat

MA

hepatocyte BRL-3A proliferation, growth, and the G1 to S phase transition of the cell cycle were reduced by siR-JUN (Figure 6C/F). To further investigate the interaction of JUN and miR-429 on

ED

the proliferation, growth, and cell cycle of rat hepatocyte BRL-3A. MiR-429 mimic, inhibitor, and siR-JUN were co-transfected to rat hepatocyte BRL-3A. We found that co-transfection with

EP T

miR-429 inhibitor and siR-JUN abolished the proliferative effect of the miR-429 inhibitor on hepatocyte proliferation, cell growth, and the G1 to S phase transition of the cell cycle (Figure 6C/6F). Co-transfection with miR-429 mimics and siRNA-J UN did not further reduce the

AC C

proliferation of hepatocytes (Figure 6C/6F). The data suggest that the promotive effect of miR-429 on hepatocyte proliferation and cell growth is closely related to JUN inhibition. 3.7 MiR-429 inhibits proliferation in rat hepatocyte via the JUN/MYC/BCL2/CCND1 signaling pathway

Key signaling molecules associated with JUN was analyzed by qRT-PCR and Western blot in rat hepatocyte BRL-3A to further investigate the mechanism of miR-429 regulating rat hepatocyte BRL-3A proliferation. We observed that miR-429 mimics decreased the expression JUN, MYC, BCL2, and CCND1 and increased CASPASE3 expression in rat hepatocyte BRL-3A compared with relevant controls (Figure 7A), whereas miR-429 inhibitor had an inverse effect (Figure 7B).

ACCEPTED MANUSCRIPT The

data

indicate

that

miR-429

inhibits

proliferation

in

rat

hepatocyte

via

the

JUN/MYC/BCL2/CCND1 signaling pathway.

4. Discussion MiRNAs have become a key component in the regulation of post-transcriptional gene expression

PT

since their discovery in the 1990s [17, 18]. MiRNAs are small-molecule RNAs that are relatively conservative in evolution and widely exist in plants and animals. They have become popular in

RI

biology and medicine in recent years. They perform base pairing with complementary sequences in the 3' UTRs of their target mRNAs to degrade, destabilize, or inhibit the translation of the target

SC

mRNAs. A miRNA can have multiple target mRNAs, and one mRNA can be targeted by many miRNAs. These small single-stranded RNAs exert a broad pleiotropic effect on organism

NU

development and development [18]. The expression profiles of miRNAs in different stages of LR and their mechanism of action vary. Several studies showed that some miRNAs are abnormally

MA

expressed during LR and affect the course of LR [19-22]. The mechanism of regulating LR needs to be further studied. In the present study, we found that miR-429 exhibited a marked

ED

down-regulated tendency in the rat liver 30 h after 2/3 PH. MiR-429 overexpression inhibited hepatocyte proliferation and G1/S phase transition in vitro. Moreover, miR-429 negatively

EP T

regulated JUN in vitro and in vivo. We confirmed that JUN inhibition is required for miR-429 down-expression-induced hepatocyte proliferation and cell cycle progression. The following research

demonstrated

that

miR-429

inhibited

rat

hepatocytes

proliferation

via

the

AC C

JUN/MYC/BCL2/CCND1 signaling pathway. MiR-429 belongs to the miR-200 family. This family is divided into miR-429/200a/b clusters and miR-141/200c cluster based on its chromosome localization; the former is located on chromosome 1, and the latter is on chromosome 12 [23].

Studies have shown that miR-429 is down-regulated

in most tumors and acts as a tumor suppressor [24-33]. Meanwhile, miR-429 is hypoxia miRNA in human. Janaszak-Jasiecka et al. [34] revealed miR-429 regulates the transition between Hypoxia-Inducible Factor (HIF) 1A and HIF3A expression in human endothelial cells. The study of miR-429 is mostly concentrated on hepatocellular carcinoma in the liver. Xue et al. [29] identified that miR-429 regulates cell metastasis and EMT in HCC by targeting RAB23. Wang et

ACCEPTED MANUSCRIPT al. [35] found that up-regulated microRNA-429 inhibits HCC cell migration by targeting TRAF6 through the NF-KB pathway. Moreover, Tang et al. [36] found that miR-429 increases HCC metastasis by targeting the PTEN to regulate the classical Wnt-pathway rather than epithelial-mesenchymal transition. Gao et al. [37] found that miR-429 inhibits cell proliferation and induces apoptosis in HBV-associated HCC through a target function NOTC1. The above

PT

results indicate that miR-429 plays an important role in HCC tumorigenesis and development. To illuminate the mechanism of miR-429 in LR, we verified that miR-429 significantly

RI

down-regulated 30 h after liver resection by microarray and RT-PCR, which suggests that miR-429 may play an important role in the hepatocyte proliferation of LR. We artificially

SC

up-regulated and down-regulated miR-429 expression in rat hepatocyte BRL-3A and further found that the over-expression of miR-429 inhibited the proliferation of BRL-3A cells and promoted

NU

apoptosis. The down-regulation of miR-429 promoted BRL-3A cell proliferation and inhibition of apoptosis. These results lay a foundation for further study on the mechanism of

of miR-429 deserves further study.

MA

miR-429-regulating hepatocyte proliferation. In the proliferative phase of LR, the down-regulation

ED

Studies showed that miRNA proliferation in LR depends on their specific target genes [10, 19, 38, 39]. Marquez et al. [19] found that miR-21 is up-regulated during the proliferative phase of LR,

EP T

which targets Pellino-1 and inhibits NF-KB signaling to promote hepatocyte proliferation and LR. Moreover, Li et al. [38] and Chen et al. [39] found that miR-21 targets FASLG and PTEN to

AC C

promote hepatocyte proliferation. Song et al. [10] found that the direct target of miR-21 acts on Btg2 and promotes LR by regulating DNA synthesis in hepatocytes after 2/3 PH. Moreover, they found that miR-378 targets the ornithine decarboxylase (Odc1) directly and is known to promote DNA synthesis in hepatocytes after 2/3 PH. Therefore, to further study the mechanism of action of miR-429 regulating hepatocyte proliferation, we analyzed the pathways of miR-429 target genes involved in proliferation and apoptosis physiological activities by using GO annotation and KEGG pathway. We found that the JNK pathway is one of the most significant pathways. We also found that JUN expression has a trend opposite to that of miR-429 expression 30 h after liver resection. Dual luciferase reporter assay and Western blot analysis further confirmed JUN as a direct target of miR-429.

ACCEPTED MANUSCRIPT The human c-Jun gene is located on chromosome 1 and has a single exon. Thus, its genomic DNA has the same sequence as its cDNA. The full-length mRNA of c-Jun is 3254 nt, and its protein product consists of 331 amino acid residues. Its protein structure consists of three functional domains and two phosphorylation sites [40]. JUN is a member of the AP-1 family, which is a family of nuclear transcription factors based on leucine zippers. Its family members also include

PT

c-Fos, ATF, and MAF. They play important roles in cell growth, development, and apoptosis [41]. Jun is the most studied protein in the AP-1 family and is involved in regulating various gene

RI

expression and cell proliferation, transformation, differentiation, and apoptosis. The role of c-Jun in cellular responses depends on the cell type and other regulatory environments that the cell

SC

accepts [42]. Studies have shown that the overexpression of c-Jun induces the apoptosis of 3T3 fibroblasts [43] and triggers the apoptosis of vascular endothelial cells [44]. However, c-Jun acts

NU

as a positive regulator of cell growth in cultured fibroblasts and hepatocytes through the use of c-Jun knockout mice [45-47]. Our results indicated that miR-429 that target JUN inhibits the

MA

proliferation of BRL-3A cells and promotes the apoptosis of BRL-3A cells. Further studies have shown that the down-regulated expression of JUN reversed the pro-proliferative effect of the

ED

miR-429 inhibitor, whereas the down-regulated expression of JUN did not further enhance the pro-proliferative effect of miR-429 mimic.

EP T

Moreover, c-JUN is an early gene that normally functions as a third messenger in cells and whose activation is regulated by its JNK [48]. JNK belongs to the mitogen-activated protein kinase

AC C

family, which can integrate many extracellular signals to regulate the expression of its target genes [49]. At its C-terminus, JNK has a substrate binding site that interacts with MAP2Ks, phosphatases, and substrates [50]. Many known JNK substrates include c-jun, c-fos, P53, c-myc, Bcl-2, and ATF-2 [51]. These substrates also interact with each other to regulate cell proliferation and physiology biochemical processes. Elaine et al. [52] showed that the overexpression of cancer or testis genes in fibroblasts promotes the binding of c-Jun to cyclin D1 and E promoters, thereby up-regulating cyclin D1 and E expression and promoting cell cycle progression. Eitan et al. [53] certified that c-Jun deletion can increase the tumor suppressor gene p53 and its target gene p21 expression, which disrupts the cell into the S phase of the process. Liu et al. [54] demonstrated that the down-regulation of c-Jun in ESCC cells inhibited the expression of c -MYC, ErbB2,

ACCEPTED MANUSCRIPT CCND1, and Bcl2. Further studies have shown that the down-regulation of c-Jun inhibited c-MYC in ESCC cells. The luciferase activity of the promoter indicates that c -Jun regulates the expression of c-MYC at the transcriptional level. However, whether c-JUN/BCL2/MYC/CCND1 is regulated by miR-429 in hepatocytes is unknown. JUN was significantly up-regulated in the rat liver 30 h after PH. Moreover, we demonstrated that the overexpression of miR-429 in BRL-3A cells inhibits

PT

the expression of JUN, BCL2, CCND1, and MYC, and the down-regulation of miR-429 promotes the expression of JUN, BCL2, CCND1, and MYC. Thus, we speculate that miR-429 regulates rat

RI

hepatocyte proliferation by activating the JUN/BCL2/MYC/CCND1 pathway.

SC

5. Conclusions

MiR-429 expression is inhibited in the rat liver during the proliferative phase of LR, and miR-429

NU

inhibits hepatocyte proliferation by targeting the JUN/BCL2/MYC/CCND1 signaling pathways. Thus, miR-429 may be considered as a novel prospective target for the regulation of LR and liver

MA

cancer development. Nevertheless, the effect of miR-429 on other types of hepatocytes requires

Acknowledgments

ED

further investigation.

EP T

This work was supported by grants from Natural Science Foundation of China (No. 31572270), the Key Scientific Research Projects of Henan Higher Education (15A180007) and the National

AC C

Fostering Science Foundation Project of Henan Normal University (2016PL21).

ACCEPTED MANUSCRIPT

References [1] Mao SA, Glorioso JM, Nyberg SL. Liver regeneration [J]. Transl Res. 2014, 163(4):352-362. [2] Fausto N, Campbell JS, Riehle KJ. Liver regeneration. Hepatology. 2006; 43(2 Suppl 1):S45-53. [3] Tao Y, Wang M, Chen E, Tang H. Liver Regeneration: Analys is of the Main Relevant Signaling Molecules [J].Mediators Inflamm. 2017, 2017:4256352.

PT

[4] Yi PS, Zhang M, Xu MQ. Role of microRNA in liver regeneration [J].Hepatobiliary Pancreat Dis Int. 2016, 15(2):141-146.

RI

[5] Lauschke VM, Mkrtchian S, Ingelman-Sundberg M. The role of microRNAs in liver injury at

SC

the crossroad between hepatic cell death and regeneration [J]. Biochem Biophys Res Commun. 2017, 482(3):399-407. [6] Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Science.

MA

NU

2005; 310: 1817-1821. [7] Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005; 433: 769-773. [8] He L, Hannon GJ. MicroRNAs : small RNAs with a big role in gene regulation. Nat Rev Genet.

ED

2004; 5: 522-531. [9] Lynn FC. Meta-regulation: microRNA regulation of glucose and lipid metabolism. Trends Endocrinol Metab. 2009; 20:452-459. [10] Song G, Sharma AD, Roll GR, Ng R, Lee AY, Blelloch RH, Frandsen NM, Willenbring H.

EP T

MicroRNAs control hepatocyte proliferation during liver regeneration. Hepatology. 2010; 51: 1735-1743. [11] Yu ZY, Bai YN, Luo LX, et al. Expression of microRNA-150 targeting vascular endothelial growth factor-A is downregulated under hypoxia during liver regeneration[J]. Mol Med Rep.

AC C

2013, 8(1):287-93 [12] Yuan Q, Loya K, Rani B, et al. microRNA-221 overexpression accelerates hepatocyte proliferation during liver regeneration. Hepatology 2013; 57(1):299-310. [13] Marquez R T, Wendlandt E, Galle C S, et al. MicroRNA-21 is upregulated during the proliferative phase of liver regeneration, targets Pellino-1, and inhibits NF-κB signaling. AM J PHYSIOL-GASTR L 2010; 298(4): G535-G541. [14] Löffler D, Brocke-Heidrich K, Pfeifer G, et al. Interleukin-6–dependent survival of multiple myeloma cells involves the Stat3-mediated induction of microRNA-21 through a highly conserved enhancer. Blood 2007; 110(4): 1330-1333. [15] Zhou R, Hu G, Liu J, et al. NF-kappaB p65-dependent transactivation of miRNA genes following Cryptosporidium parvum infection stimulates epithelial cell immune responses. PLoS pathogens 2009; 5(12): e1000681. [16] Vinc iguerra M, Sgroi A, Veyrat-Durebex C, et al. Unsaturated fatty acids inhibit the expression of tumor suppressor phosphatase and tensin homolog (PTEN) via microRNA-21 up-regulation in hepatocytes. Hepatology 2009; 49(4): 1176-1184.

ACCEPTED MANUSCRIPT [17] Liu H , Lei C, He Q, Pan Z, Xiao D, Tao Y. Nuclear functions of mammalian MicroRNAs in gene regulation, immunity and cancer[J]. Mol Cancer. 2018,17(1):64. [18]Trümbach D, Prakash N. The conserved miR-8/miR-200 microRNA family and their role in invertebrate and vertebrate neurogenesis [J]. Cell Tissue Res. 2015, 359(1):161-1177. [19] Marquez RT , Wendlandt E, Galle CS, Keck K, McCaffrey AP. MicroRNA-21 is upregulated during the proliferative phase of liver regeneration, targets Pellino-1, and inhibits NF-kappaB signaling. Am J Physiol Gastrointest Liver Physiol. 2010; 298: G535-541. [20] Bei Y, Song Y, Wang F, Dimitrova-Shumkovska J, Xiang Y, Zhao Y, Liu J, Xiao J, Yang C. miR-382 targeting PTEN-Akt axis promotes liver regeneration. Oncotarget. 2016; 7:

PT

1584-1597. [21] Yuan B, Dong R, Shi D, Zhou Y, Zhao Y, Miao M, Jiao B. Down-regulation of miR-23b may

RI

contribute to activation of the TGF-β1/Smad3 signalling pathway during the termination

SC

stage of liver regeneration. FEBS Lett. 2011; 585: 927-934. [22] Wang XP, Zhou J, Han M, Chen CB, Zheng YT, He XS, Yuan XP. MicroRNA-34a regulates liver regeneration and the development of liver cancer in rats by targeting Notch signaling pathway. Oncotarget. 2017; 8: 13264-13276.

MA

NU

[23]Feng X, Wang Z, Fillmore R, Xi Y. MiR-200, a new star miRNA in human cancer [J]. Cancer Lett. 2014, 344(2):166-173. [24] Wu CL, Ho JY, Chou SC, Yu DS. MiR-429 reverses epithelial-mesenchymal transition by restoring E-cadherin expression in bladder cancer [J]. Oncotarget. 2016, 7(18):26593-26603. [25] Xue H, Tian GY. MiR-429 regulates the metastasis and EMT of HCC cells through targeting

ED

RAB23 [J]. Arch Biochem Biophys. 2018, 637:48-55. [26] Brozovic A, Duran GE, Wang YC, Francisco EB, Sikic BI. The miR-200 family differentially regulates sensitivity to paclitaxel and carboplatin in human ovarian carcinoma OVCAR-3 and MES-OV cells [J]. Mol Oncol. 2015, 9(8):1678-1693.

EP T

[27] Wang Y, Li M, Zang W, Ma Y, Wang N, Li P, Wang T, Zhao G. MiR-429 up-regulation induces apoptosis and suppresses invasion by targeting Bcl-2 and SP-1 in esophageal carcinoma[J]. Cell Oncol (Dordr). 2013, 36(5):385-94. [28] Wang L, Mezencev R, Švajdler M, Benigno BB, McDonald JF. Ectopic over-expression of

AC C

miR-429 induces mesenchymal-to-epithelial transition (MET) and increased drug sensitivity in metastasizing ovarian cancer cells [J]. Gynecol Oncol. 2014, 134(1):96-103. [29]Bendoraite A, Knouf EC, Garg KS, Parkin RK, Kroh EM, O'Briant KC, Ventura AP, Godwin AK, Karlan BY, Drescher CW, Urban N, Knudsen BS, Tewari M. Regulation of miR-200 family microRNAs and ZEB transcription factors in ovarian cancer: evidence supporting a mesothelialto-epithelial transition [J]. Gynecol Oncol. 2010; 116(1):117–125. [30] Chen J, Wang L, Matyunina LV, Hill CG, McDonald JF. Overexpression of miR-429 induces mesenchymal-to-epithelial transition (MET) in metastatic ovarian cancer cells. Gynecol Oncol. 2011, 121(1): 200–205. [31] Lei W, Liu YE, Zheng Y, Qu L. MiR-429 inhibits oral squamous cell carcinoma growth by targeting ZEB1 [J].Med Sci Monit. 2015, 21:383-389. [32] Yoshino H, Enokida H, Itesako T, Tatarano S, Kinoshita T, Fuse M, Kojima S, Nakagawa M, Seki N. Epithelial-mesenchymal transition-related microRNA-200s regulate molecular targets and pathways in renal cell carcinoma[J]. J Hum Genet. 2013, 58(8):508-516. [33] Mlcochova H, Machackova T, Rabien A, Radova L, Fabian P, Iliev R, Slaba K, Poprach A,

ACCEPTED MANUSCRIPT Kilic E, Stanik M, Redova-Lojova M, Svoboda M, Dolezel J, Vyzula R, Jung K, Slaby O. Epithelial-mesenchymal transition-associated microRNA/mRNA signature is linked to metastasis and prognosis in clear-cell renal cell carcinoma[J]. Sci Rep. 2016, 6:31852. [34] Janaszak-Jasiecka A, Bartoszewska S, Kochan K, Piotrowski A, Kalinowski L, Kamysz W, Ochocka RJ, Bartoszewski R, Collawn JF. MiR-429 regulates the transition between Hypoxia-Inducible Factor (HIF) 1A and HIF3A expression in human endothelial cells [J]. Sci Rep. 2016, 6:22775. [35]Wang P, Cao J, Liu S, Pan H, Liu X, Sui A, Wang L, Yao R, Liu Z, Liang J. Upregulated microRNA-429 inhibits the migration of HCC cells by targeting TRAF6 through the NF-κB

PT

pathway[J]. Oncol Rep. 2017, 37(5):2883-2890. [36] Tang J, Li L, Huang W, Sui C, Yang Y, Lin X, Hou G, Chen X, Fu J, Yuan S, Li S, Wen W, rather

than

epithelial-mesenchymal

SC

HCC via regulating classic Wnt pathway transition[J].Cancer Lett. 2015, 364(1):33-43.

RI

Tang S, Cao D, Wu M, Chen L, Wang H. MiR-429 increases the metastatic capability of

[37] Gao H, Liu C. miR-429 represses cell proliferation and induces apoptosis in HBV-related HCC [J]. Biomed Pharmacother. 2014, 68(8): 943–949.

Med Sci Monit. 2016; 22: 83-91.

MA

NU

[38] Li JJ, Chan WH, Leung WY, Wang Y, Xu CS. MicroRNA-21 promotes proliferation of rat hepatocyte BRL-3A by targeting FASLG [J]. Genet Mol Res. 2015; 14(2): 4150-4160. [39] Chen X, Song M, Chen W, Dimitrova-Shumkovska J, Zhao Y, Cao Y, Song Y, Yang W, Wang F, Xiang Y, Yang C. MicroRNA-21 Contributes to Liver Regeneration by Targeting PTEN.

ED

[40] Guo G, Wang M. c-JUN and c-FOS and Their Relationship with Human Tumors [J].Foreign Medical Genetics. 2005, 28 (4): 207-211. [41] Vesely PW, Staber PB, Hoefler G, Kenner L. Translational regulation mechanisms of AP -1 proteins[J]. Mutat Res. 2009, 682(1):7-12.

EP T

[42] Leppä S, Bohmann D. Diverse functions of JNK signaling and c -Jun in stress response and apoptosis [J].Oncogene. 1999,18(45):6158-6162. [43] Bossy-Wetzel E, Bakiri L, Yaniv M. Induction of apoptosis by the transcription factor c -Jun [J]. EMBO J. 1997, 16(7):1695-709.

AC C

[44] Wang N, Verna L, Hardy S, Zhu Y, Ma KS, Birrer MJ, Stemerman MB. c-Jun triggers apoptosis in human vascular endothelial cells[J]. Circ Res. 1999, 85(5):387-393. [45] Johnson RS, van Lingen B, Papaioannou VE, Spiegelman BM. A null mutation at the c-jun locus causes embryonic lethality and retarded cell growth in culture [J]. Genes Dev. 1993, 7(7B):1309-1317. [46] Hilberg F, Aguzzi A, Howells N, Wagner EF. c -jun is essential for normal mouse development and hepatogenesis[J]. Nature. 1993, 365(6442):179-81. [47] Eferl R, Sibilia M, Hilberg F, Fuchsbichler A, Kufferath I, Guertl B, Zenz R, Wagner EF, Zatloukal K. Functions of c-Jun in liver and heart development[J]. J Cell Biol. 1999, 145(5):1049-1061. [48] Bogoyevitch MA, Ngoei KR, Zhao TT, Yeap YY, Ng DC. c-Jun N-terminal kinase (JNK) signaling:

recent

advances

and

challenges[J].

Biochim

Biophys

Acta.

2010,

1804(3):463-475. [49]Wagner EF, Nebreda AR. Signal integration by JNK and p38 MAPK pathways in cancer development [J]. Nat Rev Cancer. 2009, 9(8):537-549.

ACCEPTED MANUSCRIPT [50] Haeusgen W, Herdegen T, Waetzig V. The bottleneck of JNK signaling: molecular and functional characteristics of MKK4 and MKK7 [J]. Eur J Cell Biol. 2011, 90(6-7):536-544. [51] Bogoyevitch MA, Kobe B. Uses for JNK: the many and varied substrates of the c -Jun N-terminal kinases [J]. Microbiol Mol Biol Rev. 2006, 70(4):1061-1095. [52] Por E, Byun HJ, Lee EJ, Lim JH, Jung SY, Park I, Kim YM, Jeoung DI, Lee H. The cancer/testis antigen CAGE with oncogenic potential stimulates cell proliferation by up-regulating cyclins D1 and E in an AP-1- and E2F-dependent manner [J]. J Biol Chem. 2010, 285(19):14475-14485. [53] Shaulian E, Schreiber M, Piu F, Beeche M, Wagner EF, Karin M. The mammalian UV

PT

response: c-Jun induction is required for exit from p53-imposed growth arrest [J]. Cell. 2000, 103(6):897-907

RI

[54]Liu ZC, Cao K, Xiao ZH, Qiao L, Wang XQ, Shang B, Jia Y, Wang Z. VRK1 promotes

SC

cisplatin resistance by up-regulating c-MYC via c-Jun activation and serves as a therapeutic target in esophageal squamous cell carcinoma[J]. Oncotarget. 2017, 8(39):65642-65658.

Figure. 1. miR-429 is downregulated in the rat liver at 30 h after PH compared to those at

NU

SO-30h and rat hepatocyte BRL-3A. A. Heat map demonstrated the aberrantly expressed microRNAs in the rat liver at PH 30h vs. those in the control liver at SO-30h. B. qRT-PCRs

MA

showed that miR-429 was downregulated in the rat liver at PH 30h. C. Analys is of relative miR-429 expression levels in rat hepatocyte BRL-3A. D. Relative PCNA expression levels in rat

ED

hepatocyte BRL-3A. All data are represented as the mean ±SD, *p < 0.05, **p < 0.01. Figure 2: miR-429 inhibits the proliferation of rat hepatocytes BRL-3A. A/B. qRT-PCR

EP T

analys is for miR-429 level in rat hepatocytes BRL-3A transfected with miR-429 mimics (miR-429-m), miR-429 inhibitor (miR-429-i), or their respective negative controls (NC-m or NC-i). C. MTT assay. D. Edu (red) cell proliferation assay. E. The percentage of Edu-positive

AC C

cells was quantified. F. Flow cytometry showed that miR-429 mimics inhibited a G1 to S phase transition of the cell cycle of rat hepatocytes BRL-3A, while miR-429 inhibitor had inverse effect. All data are represented as the mean ±SD, *p < 0.05, **p < 0.01. Figure 3: miR-429 induces rat hepatocytes apoptosis. A. rat hepatocytes BRL-3A apoptos is level after miR-429 mimics, inhibitors or theirs NC treatment was determined by flow cytometry; B. histogram analysis of the cell apoptosis rate in each group. All data are represented as the mean ±SD, *p < 0.05, **p < 0.01 Figure 4: miR-429 negatively correlates with JUN expression at protein level both in vitro and in vivo. A. qRT-PCR analysis for JUN expression in rat hepatocytes BRL-3A transfected with miR-429 mimics (miR-429-m), miR-429 inhibitor (miR-429-i) or theirs negative control (NC-m,

ACCEPTED MANUSCRIPT NC-i). B. Western blot analys is for JUN expression in rat hepatocytes BRL-3A transfected with miR-429 mimics (miR-429-m), miR-429 inhibitor (miR-429-i) or theirs negative control (NC-m, NC-i). C/D. qRT-PCR analysis for miR-429 and JUN expression in the rat liver at 30 hrs after PH (PH 30h) compared with control rat liver. E. Western blot analys is for JUN expression in the rat liver at 30 hrs after PH (PH-30h) compared with control rat liver. β-actin/U6 were used as loading

PT

control. All data are represented as the mean ±SD, *p < 0.05, **p < 0.01. Figure 5: JUN is a direct target of miR-429. A. The luciferase report shows the change of the

RI

relative fluorescence level after co-transfection of JUN wild-type and mutant 3'UTR with miR-429 mimic/inhibitor in BRL-3A cells. B. The miR-429 binding s ite in the 3' UTR of JUN and

SC

the corresponding mutation site. All data are represented as the mean ±SD, *p < 0.05. Figure 6: siRNA-JUN reverses miR-429 inhibition-induced rat hepatocyte BRL-3A growth.

NU

A/B. siRNA-JUN (sequence-1,-2 or -3) inhibit JUN mRNA and protein levels in rat hepatocyte BRL-3A as measured by qRT-PCR and Western blot analysis. C. MTT assay. D. Flow cytometry

MA

assay. E. Edu (red) cell proliferation assay. F. The percentage of Edu-positive cells was quantified. The results demonstrated that siRNA-JUN reversed the proliferative effect of miR-429 inhibitor

ED

(miR-429-i) on the proliferation and abolished miR-429 inhibitor-induced S phase arrest of rat hepatocyte BRL-3A. However, co-transfection with miR-429 mimics and siRNA-JUN did not

EP T

further reduce the proliferation or cell growth of hepatocytes. All data are represented as the mean ±SD, *p < 0.05, **p < 0.01.

Figure 7: miR-429 inhibits proliferation in rat hepatocytes via the JUN/MYC/BCL2/CCND1

AC C

signaling pathway. A. qRT-PCR analysis for JUN, MYC, BCL2 ,CCND1and CASPASE3 in rat hepatocyte BRL-3A transfected with miR-429 mimics (miR-429-m), miR-429 inhibitor (miR-429-i) or theirs negative control (NC-m, NC-i). B. Western blot analysis for JUN, MYC, BCL2, CCND1and CASPASE3 in rat hepatocyte BRL-3A transfected with miR-429 mimics (miR-429-m), miR-429 inhibitor (miR-429-i) or theirs negative control (NC-m, NC-i). All data are represented as the mean ±SD.*p < 0.05, **p < 0.01.

ACCEPTED MANUSCRIPT Table 1. Primers used in reverse transcription and quantitative real-time PCR

GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACACGGCA

mi R-429 FP

ACGGGCTAATACTGTCTGGT

mi R-429 RP

GTGCAGGGTCCGAGGT GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACTCACAG

mi R-125a FP

TCCCTGAGACCCTTTAACCT

mi R-125a RP

GTGCAGGGTCCGAGGT

mi R-145 RT

GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACAGGGAT

mi R-145 FP

GCCGAGGTCCAGTTTTCCCAG

mi R-145 RP

GTGCAGGGTCCGAGGT

GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACATGAAA

NU

mi R-3585 RT

GTTCACAAGAAGGTGTCTTTC

mi R-3585 RP

GTGCAGGGTCCGAGGT

U6 FP

CTCGCTTCGGCAGCACA

U6 RP

AACGCTTCACGAATTTGCGT

JUN FP

GGCTGTTCATCTGTTTGTCTTCAT

JUN RP

CCCTTTTCTTTACGGTCTCGGT

CASPASE3 FP

GAGCTGGACTGCGGTATTGAG

CASPASE3 RP

AACCATGACCCGTCCCTTGA

CCND1 FP

AAAATGCCAGAGGCGGATGA

CCND1 RP

GAAAGTGCGTTGTGCGGTAG CGACCTCTGTTTGATTTCTCCTG

BCL2 RP

CTTTTCATATTTGTTTGGGGCA ACCCAACATCAGCGGTCG CGTGACTGTCGGGTTTTCCA

AC C

MYC FP MYC RP

EP T

BCL2 FP

ED

MA

mi R-3585 FP

β-a cti n FP

ACATCCGTAAAGACCTCTATGCCAACA

β-a cti n RP

GTGCTAGGAGCCAGGGCAGTAATCT

PT

mi R-125a RT

RI

mi R-429 RT

Pimers sequences (5'→3')

SC

miRNA and genes

ACCEPTED MANUSCRIPT Highlights • It was first discovered that miR-429 inhibits hepatocyte proliferation by targeting

JUN. • The interaction between JUN signaling and miR-429 further extends the understanding of gap junction and miRNAs in the proliferation of rat hepatocytes. • MiR-429 could serve as an inhibitor for hepatocyte proliferation and liver

PT

regeneration via targeting JUN/MYC/BCL2/CCND1 axis and may have the potential to

AC C

EP T

ED

MA

NU

SC

RI

inhibit liver cancer progression.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9