- Email: [email protected]
miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression
Biochemical and Biophysical Research Communications xxx (2015) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression Chao Yan a, Jianchun Yu a, *, Weiming Kang a, Yuqin Liu b, Zhiqiang Ma a, Li Zhou a a
Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730, China b Cell Culture Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100005, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 October 2015 Accepted 26 December 2015 Available online xxx
Gastric signet ring cell carcinoma (GSRCC) is a unique pathological type of gastric carcinoma that is extremely invasive and has a poor prognosis. Expression of microRNAs (miRNAs) has been closely linked to the carcinogenesis of gastric cancer and has been considered as a powerful prognostic marker. The function of miR-935 has never been reported in cancer before. We found, using microRNA array, that expression of miR-935 in GSRCC cell lines is lower than in non-GSRCC cell lines, and enhanced expression of miR-935 in GSRCC cell-lines inhibit cell proliferation, migration and invasion. We also identified Notch1 as a direct target of miR-935. Knockdown of Notch1 reduced proliferation, migration/invasion of GSRCC cells, and overexpression Notch1's activated form (Notch intracellular domain) could rescue miR935's tumor suppressive effect on GSRCC. Expression of miR-935 was lower in gastric carcinoma tissue than in paired normal tissue samples, and lower in GSRCC than in non-GSRCC. Our results demonstrate the inverse correlation between the expression of miR-935 and Notch1 in gastric tissues. We conclude that miR-935 inhibits gastric carcinoma cell proliferation, migration and invasion by targeting Notch1, suggesting potential applications of the miR-935-Notch1 pathway in gastric cancer clinical diagnosis and therapeutics, especially in gastric signet ring cell carcinoma. © 2015 Elsevier Inc. All rights reserved.
Keywords: Gastric signet-ring cell carcinoma (GSRCC) MiR-935 Notch1
1. Introduction Gastric cancer is a common malignancy worldwide. Although combined treatment with surgery, chemotherapy and radiotherapy has improved outcomes in most advanced gastric cancers, these protocols have had little effect on advanced gastric signet-ring cell carcinoma (GSRCC). The early-stage prognosis of GSRCC is better than for other gastric cancer types (non-GSRCC) [1,2], but much worse in advanced disease because of aggressive invasiveness and poor response to treatment [3]. Thus, early diagnosis of GSRCC is particularly important. Invasive GSRCC growth progresses mainly within the gastric wall, which leads to lower diagnosis rates from endoscopic and pathological examination than for non-GSRCC. New biomarkers and therapeutic targets for GSRCC are needed to improve its early diagnosis rate and improve treatment outcomes. MicroRNA (miRNA) is a well-conserved class of endogenous
Abbreviations: GSRCC, Gastric signet ring cell carcinoma; miRNA, microRNA. * Corresponding author. E-mail address: [email protected] (J. Yu).
non-encoding RNA of about 20 nucleotides, which exist widely in the cells of eukaryotes [4]. MiRNAs can degrade target mRNAs or inhibit their translation by binding to the 30 UTRs. Abnormal expression of miRNAs has been closely related to the tumorigenesis of gastric cancer [5e7]. The tumorigenesis of gastric cancer is a process of multiple stages, caused by many factors, such as the activation of oncogenes, disabling of tumor suppressor genes, immune changes, epigenetic changes, and so on. MicroRNA play a broad and important role in this complex network. Abnormal expression of MicroRNA leads to gastric cancer by promoting cell proliferation [8]; expression of target genes can be regulated by some miRNAs, which may affect the development of gastric cancer [9,10]. Additionally, abnormal expression of miRNA is associated with malignant behavior, metastasis, and the clinical pathological characteristics of gastric cancer [11e13]. Therefore, miRNAs have great potential in early screening, diagnosis and treatment of gastric cancer. In this study, we screened expression of miRNAs in GSRCC cells using microRNA microarray, and found that miR-935 expression was lower in GSRCC cells than in GSRCC cells. Detection miR-935 expression in tissues, we found that miR-935 expression was
http://dx.doi.org/10.1016/j.bbrc.2015.12.116 0006-291X/© 2015 Elsevier Inc. All rights reserved.
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
2
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
lower in GSRCC tissues than in non-GSRCC tissues. It was found that miR-935 may play as a tumor suppressor gene by targeting Notch1 30 UTR in gastric cancer, which is more obvious in GSRCC. MiR-935 can be used as a potential diagnostic marker and therapeutic target for GSRCC. 2. Materials and methods 2.1. Cell culture, transfection, and clinical tissue and plasma samples We cultured human gastric epithelial cell line GES-1 and nine human gastric carcinoma cell-lines (MGC8-03, HGC-27, BGC-823, NCIeN87, AGS, SGC-7901, MKN28, MKN-45 and KATO-Ⅲ) in RPMI1640 medium supplemented with 10% fetal bovine serum (FBS) and antibiotics. All cells were maintained at 37 C in a fully-humidified incubator and an atmosphere of 5% CO2 in air. The miR-935 mimic and inhibitor were obtained from RiboBi (Guangzhou, China). MiRNA transfection was performed at a final concentration of 50 nmoL with Lipofectamine 2000 (Invitrogen, US) according to the manufacturer's instructions. Transfected cells were incubated at 37 C, an atmosphere of 5% CO2 in air for 48 h. The Notch intracellular domain (NICD) plasmid, pEGFP-N1-NICD (5 mg/well in 6-well plates) along with miR-935 mimic or control (50 nmol) was transfected into MKN-45 and KATO-Ⅲ cells with Lipofectamine 2000 (Invitrogen, US) according to the manufacturer's instructions. Transfected cells were incubated at 37 C, an atmosphere of 5% CO2 in air for 48 h. Sixty paired human gastric cancer Formalin-Fixed and ParrffinEmbedded (FFPE) tissues and the adjacent normal FFPE tissues were obtained from Beijing Raisedragon Co., Ltd (Beijing, China). The characteristics of the patients included in this study are described in Table 1. 2.2. RNA extraction, RT-PCR and quantitative real time PCR FFPE specimens' RNA was extracted with a kit (Tiangen Biotech, DP502, DP439, China). Total cell lines' RNA was extracted with Trizol reagent (Invitrogen). cDNAs were synthesized with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer's instructions. Quantitative real-time PCR (qPCR) was used
Table 1 Clinical characteristics of patients with gastric carcinoma according to their miR-935 levels. Characteristics
Age 60 <60
Total (n ¼ 60)
P
MiR-935 expression in tissues High
Low
17 13
9 21
0.135 26 34
Sex Male Female
0.216 45 15
21 9
24 6
Differentiation High Middle Low
3 25 32
3 13 14
0 12 18
Stage I II III
3 25 32
3 13 14
0 12 18
0.139
0.139
to detect hsa-miR-935 and Notch1 mRNA using the SYBR Premix Ex Taq II (TliRNaseH Plus) kit (TaKaRa) using the Bio-Rad machine, with the U6 small nuclear RNA and GAPDH as internal normalized references, respectively. hsa-miR-935's primer was obtained from RiboBi (Guangzhou, China). The following specific primers were used: U6 (forward: CTCGCTTCGGCAGCACA, reverse: AACGCTTCACGAATTTGCGT), Notch1 (forward: 50 -TGCCAGACCAACATCAAC30 , reverse: 50 -CTCATAGTCCTCGGATTGC-30 ), GAPDH (forward: 50 TATGACAACAGCCTCAAGAT-30 , reverse: 50 -AGTCCTTCCACGATACCA30 ). 2.3. MicroRNA array We use five gastric cancer cell lines to perform miRNA array, including three non-GSRCC cell lines (SGC-7901, MGC8-03, AGS), and two GSRCC cell lines (MKN-45 and KATO-Ⅲ), Affymetrix miRNA4.0 (CapitalBio). 2.4. Cell proliferation assay MKN-45 and KATO-Ⅲ cells that were previously transfected with miR-935 mimic or MGC8-03, and HGC-27 cells that were transfected with miR-935 inhibitor, and cells were seeded after transfecting for 24 h. Cell proliferation was monitored by xCELLigence Real-Time Cell Analyzer (RTCA)-MP system (Acea Biosciences/Roche Applied Science, USA). Culture medium (50 mL) was added to each well of a 96-well plate (Roche Applied Science) to obtain equilibrium. Transfected cells were incubated in 60-mm culture plates for 24 h; 3000 cells in 100 mL of culture medium were each subsequently seeded to a 96-well plate. Changes in electrical impedance were taken as the cell index, which directly reflect the cell proliferation on biocompatible microelectrode coated surfaces (Wittchen and Hartnett, 2011). The cell index was read automatically every 15 min; recorded curves was shown as cell index ± SD. 2.5. Transwell migration/invasion assays Transwell insert chambers with 8-mm pores (Neuro Probe, MD, USA) were used for the assay. Briefly, gastric carcinoma cells (at 3 105) were transfected with control or miR-935 mimic/inhibitor, and seeded to upper chambers in serum-free media without the Matrigel membrane, whereas the lower chambers were loaded with medium containing 20% FBS. After 24 h, cells in the lower surface of the membrane were removed using a cotton-tipped swab to quantify migrating cells, and the migrated cells were fixed in methanol for 10 min and stained with crystal violet for 5 min, then visualized under a phase-contrast microscope and photographed. Cells in nine random microscopic fields ( 100 magnification) were counted per well, and the mean determined. For the invasion assay, the upper chamber membrane was pre-coated with 100 mL of 2% Matrigel (BD Biosciences, CA, USA). 2.6. Plasmid construction and luciferase reporter assay The Notch1 30 UTR or mutant (Mut) without the predicted miR935 responsive element was inserted downstream of the firefly luciferase gene in the plasmid (Generay). The reporter plasmid pmiR-Notch1 Wt/-Mut (2.5 mg/well in 12-well plates) along with miR-935 mimic or control (50 nmol) was transfected into MKN-45 and KATO-Ⅲ cells. After transfection for 48 h, cell lysates were collected, and luciferase activities were measured by a DualLuciferase Reporter System (Promega, WI, USA) using an LB 960 Centro (Berthold Technologies, Bad Wildbad, Germany). The luminescence intensity of firefly luciferase was normalized to that
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
of Renilla luciferase. 2.7. Western blotting analysis Cells were harvested; protein extracts were obtained by lysing the cells with lysis buffer (1% NP-40, supplemented with a complete protease inhibitor tablet; Sigma, MO, USA). Equal amounts of protein were electrophoresed on 10% SDS-PAGE gels, then transferred to PVDF membrane. After blocking with 2% bovine serum albumin, the membranes were probed with anti-Notch1 (Santa Cruz Biotechnology, CA, USA), anti-b-actin (Santa Cruz Biotechnology), anti-E-cadherin, and anti-cyclin D1, VEGFA (Santa Cruz Biotechnology), followed by incubation with a horseradish peroxidaseeconjugated secondary antibody (goat-anti-mouse IgG [1:2000] and goat-anti-rabbit IgG [1:3000]). Proteins were visualized by Image Reader LAS-4000 (Fujifilm) and analyzed by the Multi Gauge V3.2 software. 2.8. Statistical analysis Data are presented as mean ± SD. Differences between groups were analyzed by Student's t-test (two-tailed), and analysis of variance (ANOVA) was used to find significant differences between groups. The qRT-PCR data was analyzed and visualized using GraphPad Prism v.5. Two-sided P < 0.05 was considered significant. Confidence intervals for differences in medians between two groups were computed by bias-corrected and accelerated bootstrapping methods. All experiments were performed at least three times. Data were analyzed with SPSS v.17.0 software. 3. Results 3.1. MiR-935 was downregulated in GSRCC To explore which miRNAs had dysregulated expression in GSRCC, we used microarrays in five cell lines, including three non-
3
GSRCC cell lines (SGC-7901, MGC8-03, AGS), and two GSRCC cell lines (MKN-45 and KATO-Ⅲ; Fig. 1A). Pick the fold change over 10 times in the microRNA array, this resulted in increased expression of miR-30a-5p, miR-30a-3p, miR-425-5p and miR-193b-3p, with miR-935 being the most downregulated. To validate microarray results, we assessed miR-935 expression in two normal gastric tissues, human gastric epithelial cell line GES-1, seven non-GSRCC cell lines, and two GSRCC cell lines. We found miR-935 was downregulated in GSRCC cell lines compared with non-GSRCC cell lines (Fig. 1B). To further investigate whether dysregulated miR-935 affected GSRCC, we assessed miR-935 expression in clinical gastric carcinoma tissue samples with adjacent normal tissue samples from the same patient. We used qRT-PCR to analyze relative levels of total RNA that were extracted from 60 matched sets of clinical gastric carcinoma tissue samples (including 30 non-GSRCC and 30 GSRCC tissue) and adjacent normal tissue samples from the same patient (Fig. 1C). Expression of miR-935 was significantly lower in tumor tissues than in normal tissues, (P ¼ 0.002; Fig. 1C). Expression of miR-935 was significantly lower in the GSRCC tissues than in the non-GSRCC tissues (P ¼ 0.0047; Fig. 1D). We collected and analyzed the patients' relevant clinicopathology information. No significant observation was found between miR-935 expression and any noted characteristics, including age, sex, differentiation grade or tumor stage (Table 1). 3.2. MiR-935 negatively regulated proliferation, migration and invasion of GSRCC cells We selected GSRCC cell lines MKN-45 and KATO-Ⅲ (with downregulated miR-935) to transfect the miR-935 mimic, and MGC8-03 and HGC-27 (with up-regulated miR-935) to transfect the miR-935 inhibitor (Fig. 2A). Transfection efficiency was evaluated by qRTPCR. To clarify the effect of miR-935 on the GSRCC malignant phenotype, we conducted cell proliferation, migration and invasion
Fig. 1. miR-935 was down-regulated in GSRCC. A. Heat maps generated using genes of greater than tenfold change. B. miR-935 expression in two normal tissues, human gastric epithelial cell line GES-1, seven non-GSRCC cell lines (BGC-823, HGC-27 SGC-7901, MGC8-03, AGS, MKN-28, NCIeN87), and two GSRCC cell lines (MKN-45 and KATO-Ⅲ) C. miR-935 was detected in 60 gastric carcinoma tissue samples (including 30 GSRCC and 30 non-GSRCC) with the adjacent normal controls by qRT-PCR assay. Data are presented as log2 of fold-changes in expression in gastric carcinoma tissues relative to adjacent normal regions. U6 was used as an internal normalized control. D. Comparison of miR-935 expression in GSRCC and non-GSRCC. U6 was used as an internal normalized control.
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
4
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
Fig. 2. Overexpression of miR-935 inhibited GSRCC cell proliferation, migration and invasion. A. Validation of miR-935 expression levels after transfection by qPCR analysis. B. Proliferation was assessed after transfection with miR-935 mimic or inhibitor for 24 h. C. Migration and invasion were assessed by transwell after transfection with miR-935 mimic or inhibitor for 48 h. Bars: mean of three independent experiments. Original magnification, 100.
assays. After transfection 24 h, cells were plated into 96-well plates. The proliferation was monitored by the xCELLigence Real-Time Cell Analyzer (RTCA)-MP system. Transwell migration and invasion assays were carried out 48 h after transfection. Over-expression of miR-935 markedly decreased proliferation, migration and invasion of MKN-45 and KATO-Ⅲ cells compared with the negative control. In contrast, the inhibitor that was transfected into MGC8-03 and HGC-27 cells significantly increased proliferation, migration and invasion compared the negative control (Fig. 2B, C). These results show that miR-935 negatively modulated the GSRCC phenotype. In all, these results indicate that ectopic miR-935 expression decreases GSRCC proliferation, migration and invasion in vitro, and acted as a tumor suppressor for GSRCC.
3.3. Expression of Notch1 is negatively regulated by miR-935 Although our results indicated that miR-935 was a tumor suppressor in GSRCC, the relevant mechanism was still unclear. As miRNAs function mainly through inhibition of target genes, we considered that the target of miR-935 might be an oncogene. TargetScan 7.0 predicted that Notch1 would have a single conserved binding sequence for miR-935 in the 30 UTR (Fig. 3A). Notch signaling is initiated by receptoreligand interaction, which leads to the activation of Notch intracellular cytoplasmic domain (NICD), which led to transcription of genes downstream in the Notch pathway. Activation of the Notch signaling pathway confers strong growth and motility advantage to cells, as Notch1 can directly control key regulators in cell proliferation and motility. We cloned part of the 30 UTR sequence of Notch1 containing the
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
5
Fig. 3. MiR-935 suppresses Notch1 expression by directly targeting the Notch1 30 UTR. A. Predicted miR-935 target sequence in the 30 UTR of Notch1 and positions of six mutated nucleotides (red) in the 30 UTR of Notch1. B. Luciferase reporter assay of MKN-45 and KATO-Ⅲ cells transfected with pmiR-Notch1-WT or pmiR-Notch1-MUT reporter plasmid and miR-935 mimic. C. Real-time PCR analysis of Notch1 mRNA expression after cells were transfected with miR-935 mimic. D. Western blot analysis of E-cadherin, cyclin D1, VEGFA, Notch1 after MKN-45 and KATO-Ⅲ were transfected with miR-935 mimic. b-actin was used as the loading control. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
binding site into the luciferase plasmid vector to create the plasmid pmiR-Report-Notch1-wt. The mutant reporter plasmid (pmiRReport-Notch1-mut) contained a mutation at the predicted binding sequence (Fig. 3A). These plasmids were transfected into different sets of MKN-45 cells, combined with transfecting the miR-935 mimic for 48 h. Using the 30 UTR luciferase reporter assays, we found that over-expression of miR-935 significantly inhibited luciferase activity in MKN-45 cells that expressed the wild type Notch1 30 UTR reporter rather than the wild-type Notch1 30 UTR reporter. Mutations in the miRNA binding sites rendered the constructs unresponsive to miR-935 induction (Fig. 3B). We had similar results in the GSRCC cell line KATO-Ⅲ. These results indicated that Notch1 is a target gene of miR-935, and the position of 1593e1599 in the 30 UTR of Notch1 is the miR-935 binding site. After transfection miR-935 mimic in MKN-45 and KATO-Ⅲ cells for 48 h, we found that Notch1 mRNA was expressed at lower levels than control (Fig. 3C). This result implies that miR-935 influences Notch1 mRNA by binding its 30 UTR. After transfection miR-935 mimic in MKN-45 and KATO-Ⅲ cells for 48 h, we collected and assessed the Notch1 protein level by western blot. As expected, Notch1 was expressed at lower levels in MKN-45 and KATO-Ⅲ cells that were transfected with the miR-935 mimic than in the controls. Simultaneously, we found that E-cadherin expression was increased, whereas cyclin D1 and VEGFA expression was decreased (Fig. 3D). 3.4. Knock-down Notch1 significantly inhibited GSRCC proliferation, migration and invasion and overexpression of Notch intracellular cytoplasmic domain(NICD) could rescue miR-935's tumor suppressive effect on GSRCC To clarify the effect of Notch1 in GSRCC malignancy, we conducted cell proliferation, migration and invasion assays. By performing proliferation and transwell assays, we found that Notch1 siRNA could negatively regulate proliferation, migration and
invasion of GSRCC cell-lines, as did miR-935 mimic (Fig. 4B, 4C). The activation of Notch results in the sequential proteolytic cleavage of the Notch receptor, which releases Notch intracellular domain (NICD) into the nucleus, which in turn activates downstream gene transcription including that of the Hes and Hey genes. NICD is Notch receptor's activated form. We transfected miR-935 mimic, at the same time, overexpression Notch intracellular cytoplasmic domain (NICD) in GSRCC cells, and found overexpression NICD could partly rescue miR-935's tumor suppressive effect on GSRCC cells' proliferation, migration and invasion (Fig. 4B, C). 3.5. Notch1's expression and relationship with miR-935 in gastric cancer tissues Quantitative PCR was used to examine levels of Notch1 mRNA in from the same 36 matched sets of gastric carcinoma/adjacent normal tissue samples (including 18 non-GSRCC and 18 GSRCC patients) from the same patient whose tissue was used to detect miR-935. By this approach, we confirmed that Notch1 mRNA was expressed at significantly higher levels in gastric carcinoma tissue than in adjacent tissues (P ¼ 0.0195; Fig. 4D). Moreover, we identified a significant inverse correlation between miR-935 and Notch1 in gastric carcinoma (Fig. 4E). 4. Discussion Compared with other types of gastric cancer, gastric signet-ring cell carcinoma is more aggressive, with greater malignancy, faster progression and lower sensitivity to anti-tumor treatment. Furthermore, the mechanism of the occurrence and development of GSRCC is still not clear. In this study, we screened miRNAs by microarray; we expanded the samples to verify the low expression of miR-935 in GSRCC, and found that miR-935 could inhibit proliferation, invasion and migration of GSRCC cells through its target gene, Notch1. Therefore, this study provides a new way for the
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
Fig. 4. Notch1's function on gastric cells' aggressive phenotype and relationship with miR-935 in gastric cancer tissues. A. Western blot analysis of Notch intracellular domain (NICD) in MKN45 and KATO-Ⅲ after transfecting pEGFP-N1-NICD plasmid. B. Proliferation was assessed after transfection with Notch1 siRNA or overexpression Notch intracellular domain (NICD) along with miR-935 mimic for 24 h. C. Migration and invasion abilities were assessed in Transwells after transfection with Notch1 siRNA or overexpression Notch intracellular domain (NICD) along with miR-935 mimic for 48 h. Bars: mean of three independent experiments. Original magnification, 100. D. shows that Notch1 mRNA expression was detected in 36 gastric carcinoma tissue samples with the adjacent normal controls by qRT-PCR. Data are presented as log2 of tfold-changes in expression in gastric carcinoma tissues relative to adjacent normal regions. GAPDH was used as an internal normalized control. E. Correlation analysis of Notch1 and miR-935 in gastric carcinoma.
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
research on the mechanism of the occurrence and development of GSRCC. In our study, we screened microRNAs by microarray and noticed the low expression of miR-935 in GSRCC cells, which was confirmed when we increased the number of cell lines. Expression of miR-935 in gastric cancer tissues (including both GSRCC and non-GSRCC) was shown to be lower than that of paired normal tissues, and its expression in GSRCC was significantly lower than in non-GSRCC. We also found no significant differences in age, sex, tumor differentiation and tumor grade with regard to miR-935 expression. These results suggest that miR-935 may act as a tumor suppressor gene in gastric cancer, especially in potential GSRCC cells. Our cell phenotype experiments showed that up-regulated miR935 in GSRCC cells can inhibit proliferation, invasion and migration, while its down-regulation can promote proliferation, invasion and migration in non-GSRCC cells. These results indicate that miR-935 functions as a tumor suppressor gene in GSRCC cells. At the same time, we demonstrated by dual luciferase report system that miR935 inhibits translation of Notch1 by binding to its 30 UTR, and decreases its mRNA and protein expression. Furthermore, knock down Notch1 could mimic miR-935's tumor suppressive effect on GSRCC, while overexpression Notch intracellular domain (NICD) could partly rescue miR-935 tumor suppressive effect on GSRCC. These results demonstrated that Notch1 is one of miR-935's target gene in GC. Notch-1 is a member of the Notch gene family, which is a highly conserved I type transmembrane glycoprotein [14]. The normal Notch1 pathway is touched off by ligand-induced hydrolytic protein cleavage, which releases intracellular region of Notch protein from the cell membrane. The intracellular region moves into the nucleus and uperegulates activity of the Su(H)/CBF1 transcription factor family [15]. Notch-1 plays important roles in cell proliferation, differentiation, survival and apoptosis. It is closely related to tumor occurrence and development. The function of Notch1 varies in different cancer types, but reportedly acts as an oncogene in gastric cancer [16,17]. In this study, we found that miR-935 inhibited translation of Notch1 by targeting its 30 UTR. We identified a significant inverse correlation between miR-935 and Notch1 in gastric cancer. Protein levels of vascular endothelial growth factor A (VEGFA), cyclin D1 remarkably decreased, whereas E-cadherin was up-regulated, after the cells were transfected with the miR-935 mimic. A previous study identified the functions of Notch1 signaling pathway in proliferation, migration and invasion [18]. Notch1 inhibited expression of E cadherin by up-regulating transcriptional factors of Snail family, resulting in inhibition of expression of b catenin and destabilization of adherens junctions [19]. E-cadherin is a marker of Epithelial mesenchymal transition (EMT). Notch1-induced angiogenesis is partly due to activation of VEGF pathway [20]. Cyclin D1 abundance correlated with Notch1 activity during embryogenesis and Notch1-induced cyclin D1 expression and transcription, requiring a CBF-binding site in the cyclin D1 promoter. These findings indicate that miR-935 regulates GSRCC metastasis, and may influence EMT and cell cycle by negatively regulating Notch1 expression. In conclusion, our results have clarified the function of miR-935 in GSRCC tumorigenesis, and also provided novel insights into the mechanism of miR-935, which modulated expression of Notch1. miR-935 was first identified as serving as a tumor suppressor in GSRCC cell proliferation and metastasis. MiR-935 could be a novel target in gastric signet-ring cell carcinoma detection and diagnosis.
7
Conflict of interest There is no conflict of interest.
Acknowledgment This work was supported by grants from Major Science and Technology Projects in Beijing City (No. D141100000414004).
References [1] H.L. Han, K.Y. Song, C.H. Park, H.M. Jeon, Undifferentiated-type gastric adenocarcinoma: prognostic impact of three histological types, World J. Surg. Oncol. 10 (2012) 232, 232. [2] J.H. Lee, I.J. Choi, M.C. Kook, B.H. Nam, Y.W. Kim, K.W. Ryu, Risk factors for lymph node metastasis in patients with early gastric cancer and signet ring cell histology, Br. J. Surg. 97 (2010), 732e736(735). [3] T. Sharven, S.N. Jayarajan, D. Adam, A.I. Willis, Prognostic significance of signet ring gastric cancer, J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 30 (2012) 3493e3498. [4] A.S. Flynt, E.C. Lai, Biological principles of microRNA-mediated regulation: shared themes amid diversity, Nat. Rev. Genet. 9 (2008) 831e842. [5] S.H. Chan, C.W. Wu, A.F. Li, C.W. Chi, W.C. Lin, miR-21 microRNA expression in human gastric carcinomas and its clinical association, Anticancer Res. 28 (2008) 907e911. [6] T.B. Kheir, E. Futoma-Kazmierczak, A. Jacobsen, A. Krogh, L. Bardram, C. Hother, K. Grønbæk, B. Federspiel, A.H. Lund, L. Friis-Hansen, miR-449 inhibits cell proliferation and is down-regulated in gastric cancer, Mol. Cancer 10 (2011) 29, 29. [7] J. Stenvang, A. Petri, M. Lindow, S. Obad, S. Kauppinen, Inhibition of microRNA function by antimiR oligonucleotides, Silence 3 (2012) 1. [8] L. Shuli, H. Lijie, Z. Xiaodi, M. Yu, G. Yong, G. Changcun, X. Zengfu, D. Weijia, H. Fengrong, W. Kaichun, MicroRNA Let-7f inhibits tumor invasion and metastasis by targeting MYH9 in human gastric cancer, PLoS One 6 (2011) e18409 e18409. [9] B. Brenner, M.B. Hoshen, O. Purim, M.B. David, K. Ashkenazi, G. Marshak, Y. Kundel, R. Brenner, S. Morgenstern, M. Halpern, MicroRNAs as a potential prognostic factor in gastric cancer, World J. Gastroenterol. 17 (2011) 3976e3985. [10] S.L. Guo, Z. Peng, X. Yang, K.J. Fan, H. Ye, Z.H. Li, Y. Wang, X.L. Xu, J. Li, Y.L. Wang, miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells, Int. J. Biol. Sci. 7 (2011) 567e574. [11] W.Y. Wu, X.Y. Xue, Z.J. Chen, S.L. Han, Y.P. Huang, L.F. Zhang, G.B. Zhu, S. Xian, Potentially predictive microRNAs of gastric cancer with metastasis to lymph node, World J. Gastroenterol. 17 (2011) 3645e3651. [12] L. Xiaohua, Z. Ying, Z. Yafei, D. Jie, W. Kaichun, F. Daiming, Survival prediction of gastric cancer by a seven-microRNA signature, Gut 59 (2010) 579e585. [13] L. Yu-Lun, H. Ling-Yueh, T. Kuo-Wang, W. Chew-Wun, C. Wen-Ching, L. SungChou, L. Chun-Hung, H. Meng-Ru, F. Wen-Liang, H. Kuo-Hung, Transcriptional regulation of miR-196b by ETS2 in gastric cancer cells, Carcinogenesis 33 (2012) 760e769. [14] B.W. Purow, M.W. Haque RMNoel, Q. Su, M.J. Burdick, J. Lee, T. Sundaresan, S. Pastorino, J.K. Park, I. Mikolaenko, D. Maric, Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation, Cancer Res. 65 (2005) 2353e2363. [15] W.R. Liao, R.H. Hsieh, K.W. Hsu, M.Z. Wu, M.J. Tseng, R.T. Mai, Y.H.W. Lee, T.S. Yeh, The CBF1-independent Notch1 signal pathway activates human cmyc expression partially via transcription factor YY1, Carcinogenesis 28 (2007) 1867e1876. [16] S. Stojnev, M. Krstic, A. Ristic-Petrovic, V. Stefanovic, T. Hattori, Gastric cancer stem cells: therapeutic targets, Gastric Cancer Off. J. Int. Gastric Cancer Assoc. Jpn. Gastric Cancer Assoc. 17 (2014) 13e25. [17] B. Yan, Y. Zhou, S. Feng, C. Lv, L. Xiu, Y. Zhang, J. Shi, Y. Li, P. Wei, Z. Qin, b -elemene-attenuated tumor angiogenesis by targeting Notch-1 in gastric cancer stem-like cells, evidence-based complementary and alternative medicine, eCAM 2013 (2013) 268468. [18] K. Muthusamy, T. Kelly, C. Herbert, Conservation of the Notch1 signaling pathway in gastrointestinal carcinoid cells, Am. J. Physiol. Gastrointest. Liver Physiol. 289 (2008) G636eG642. [19] C.C. Alves, E. Rosivatz, C. Schott, R. Hollweck, I. Becker, M. Sarbia, F. Carneiro, K.F. Becker, Slug is overexpressed in gastric carcinomas and may act synergistically with SIP1 and Snail in the down-regulation of E-cadherin, J. Pathol. 211 (2007) 507e515. [20] R.S. Kerbel, Tumor angiogenesis, N. Engl. J. Med. 358 (2008), 20e23(24).
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression Chao Yan a, Jianchun Yu a, *, Weiming Kang a, Yuqin Liu b, Zhiqiang Ma a, Li Zhou a a
Department of General Surgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730, China b Cell Culture Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, 100005, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 October 2015 Accepted 26 December 2015 Available online xxx
Gastric signet ring cell carcinoma (GSRCC) is a unique pathological type of gastric carcinoma that is extremely invasive and has a poor prognosis. Expression of microRNAs (miRNAs) has been closely linked to the carcinogenesis of gastric cancer and has been considered as a powerful prognostic marker. The function of miR-935 has never been reported in cancer before. We found, using microRNA array, that expression of miR-935 in GSRCC cell lines is lower than in non-GSRCC cell lines, and enhanced expression of miR-935 in GSRCC cell-lines inhibit cell proliferation, migration and invasion. We also identified Notch1 as a direct target of miR-935. Knockdown of Notch1 reduced proliferation, migration/invasion of GSRCC cells, and overexpression Notch1's activated form (Notch intracellular domain) could rescue miR935's tumor suppressive effect on GSRCC. Expression of miR-935 was lower in gastric carcinoma tissue than in paired normal tissue samples, and lower in GSRCC than in non-GSRCC. Our results demonstrate the inverse correlation between the expression of miR-935 and Notch1 in gastric tissues. We conclude that miR-935 inhibits gastric carcinoma cell proliferation, migration and invasion by targeting Notch1, suggesting potential applications of the miR-935-Notch1 pathway in gastric cancer clinical diagnosis and therapeutics, especially in gastric signet ring cell carcinoma. © 2015 Elsevier Inc. All rights reserved.
Keywords: Gastric signet-ring cell carcinoma (GSRCC) MiR-935 Notch1
1. Introduction Gastric cancer is a common malignancy worldwide. Although combined treatment with surgery, chemotherapy and radiotherapy has improved outcomes in most advanced gastric cancers, these protocols have had little effect on advanced gastric signet-ring cell carcinoma (GSRCC). The early-stage prognosis of GSRCC is better than for other gastric cancer types (non-GSRCC) [1,2], but much worse in advanced disease because of aggressive invasiveness and poor response to treatment [3]. Thus, early diagnosis of GSRCC is particularly important. Invasive GSRCC growth progresses mainly within the gastric wall, which leads to lower diagnosis rates from endoscopic and pathological examination than for non-GSRCC. New biomarkers and therapeutic targets for GSRCC are needed to improve its early diagnosis rate and improve treatment outcomes. MicroRNA (miRNA) is a well-conserved class of endogenous
Abbreviations: GSRCC, Gastric signet ring cell carcinoma; miRNA, microRNA. * Corresponding author. E-mail address: [email protected] (J. Yu).
non-encoding RNA of about 20 nucleotides, which exist widely in the cells of eukaryotes [4]. MiRNAs can degrade target mRNAs or inhibit their translation by binding to the 30 UTRs. Abnormal expression of miRNAs has been closely related to the tumorigenesis of gastric cancer [5e7]. The tumorigenesis of gastric cancer is a process of multiple stages, caused by many factors, such as the activation of oncogenes, disabling of tumor suppressor genes, immune changes, epigenetic changes, and so on. MicroRNA play a broad and important role in this complex network. Abnormal expression of MicroRNA leads to gastric cancer by promoting cell proliferation [8]; expression of target genes can be regulated by some miRNAs, which may affect the development of gastric cancer [9,10]. Additionally, abnormal expression of miRNA is associated with malignant behavior, metastasis, and the clinical pathological characteristics of gastric cancer [11e13]. Therefore, miRNAs have great potential in early screening, diagnosis and treatment of gastric cancer. In this study, we screened expression of miRNAs in GSRCC cells using microRNA microarray, and found that miR-935 expression was lower in GSRCC cells than in GSRCC cells. Detection miR-935 expression in tissues, we found that miR-935 expression was
http://dx.doi.org/10.1016/j.bbrc.2015.12.116 0006-291X/© 2015 Elsevier Inc. All rights reserved.
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
2
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
lower in GSRCC tissues than in non-GSRCC tissues. It was found that miR-935 may play as a tumor suppressor gene by targeting Notch1 30 UTR in gastric cancer, which is more obvious in GSRCC. MiR-935 can be used as a potential diagnostic marker and therapeutic target for GSRCC. 2. Materials and methods 2.1. Cell culture, transfection, and clinical tissue and plasma samples We cultured human gastric epithelial cell line GES-1 and nine human gastric carcinoma cell-lines (MGC8-03, HGC-27, BGC-823, NCIeN87, AGS, SGC-7901, MKN28, MKN-45 and KATO-Ⅲ) in RPMI1640 medium supplemented with 10% fetal bovine serum (FBS) and antibiotics. All cells were maintained at 37 C in a fully-humidified incubator and an atmosphere of 5% CO2 in air. The miR-935 mimic and inhibitor were obtained from RiboBi (Guangzhou, China). MiRNA transfection was performed at a final concentration of 50 nmoL with Lipofectamine 2000 (Invitrogen, US) according to the manufacturer's instructions. Transfected cells were incubated at 37 C, an atmosphere of 5% CO2 in air for 48 h. The Notch intracellular domain (NICD) plasmid, pEGFP-N1-NICD (5 mg/well in 6-well plates) along with miR-935 mimic or control (50 nmol) was transfected into MKN-45 and KATO-Ⅲ cells with Lipofectamine 2000 (Invitrogen, US) according to the manufacturer's instructions. Transfected cells were incubated at 37 C, an atmosphere of 5% CO2 in air for 48 h. Sixty paired human gastric cancer Formalin-Fixed and ParrffinEmbedded (FFPE) tissues and the adjacent normal FFPE tissues were obtained from Beijing Raisedragon Co., Ltd (Beijing, China). The characteristics of the patients included in this study are described in Table 1. 2.2. RNA extraction, RT-PCR and quantitative real time PCR FFPE specimens' RNA was extracted with a kit (Tiangen Biotech, DP502, DP439, China). Total cell lines' RNA was extracted with Trizol reagent (Invitrogen). cDNAs were synthesized with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer's instructions. Quantitative real-time PCR (qPCR) was used
Table 1 Clinical characteristics of patients with gastric carcinoma according to their miR-935 levels. Characteristics
Age 60 <60
Total (n ¼ 60)
P
MiR-935 expression in tissues High
Low
17 13
9 21
0.135 26 34
Sex Male Female
0.216 45 15
21 9
24 6
Differentiation High Middle Low
3 25 32
3 13 14
0 12 18
Stage I II III
3 25 32
3 13 14
0 12 18
0.139
0.139
to detect hsa-miR-935 and Notch1 mRNA using the SYBR Premix Ex Taq II (TliRNaseH Plus) kit (TaKaRa) using the Bio-Rad machine, with the U6 small nuclear RNA and GAPDH as internal normalized references, respectively. hsa-miR-935's primer was obtained from RiboBi (Guangzhou, China). The following specific primers were used: U6 (forward: CTCGCTTCGGCAGCACA, reverse: AACGCTTCACGAATTTGCGT), Notch1 (forward: 50 -TGCCAGACCAACATCAAC30 , reverse: 50 -CTCATAGTCCTCGGATTGC-30 ), GAPDH (forward: 50 TATGACAACAGCCTCAAGAT-30 , reverse: 50 -AGTCCTTCCACGATACCA30 ). 2.3. MicroRNA array We use five gastric cancer cell lines to perform miRNA array, including three non-GSRCC cell lines (SGC-7901, MGC8-03, AGS), and two GSRCC cell lines (MKN-45 and KATO-Ⅲ), Affymetrix miRNA4.0 (CapitalBio). 2.4. Cell proliferation assay MKN-45 and KATO-Ⅲ cells that were previously transfected with miR-935 mimic or MGC8-03, and HGC-27 cells that were transfected with miR-935 inhibitor, and cells were seeded after transfecting for 24 h. Cell proliferation was monitored by xCELLigence Real-Time Cell Analyzer (RTCA)-MP system (Acea Biosciences/Roche Applied Science, USA). Culture medium (50 mL) was added to each well of a 96-well plate (Roche Applied Science) to obtain equilibrium. Transfected cells were incubated in 60-mm culture plates for 24 h; 3000 cells in 100 mL of culture medium were each subsequently seeded to a 96-well plate. Changes in electrical impedance were taken as the cell index, which directly reflect the cell proliferation on biocompatible microelectrode coated surfaces (Wittchen and Hartnett, 2011). The cell index was read automatically every 15 min; recorded curves was shown as cell index ± SD. 2.5. Transwell migration/invasion assays Transwell insert chambers with 8-mm pores (Neuro Probe, MD, USA) were used for the assay. Briefly, gastric carcinoma cells (at 3 105) were transfected with control or miR-935 mimic/inhibitor, and seeded to upper chambers in serum-free media without the Matrigel membrane, whereas the lower chambers were loaded with medium containing 20% FBS. After 24 h, cells in the lower surface of the membrane were removed using a cotton-tipped swab to quantify migrating cells, and the migrated cells were fixed in methanol for 10 min and stained with crystal violet for 5 min, then visualized under a phase-contrast microscope and photographed. Cells in nine random microscopic fields ( 100 magnification) were counted per well, and the mean determined. For the invasion assay, the upper chamber membrane was pre-coated with 100 mL of 2% Matrigel (BD Biosciences, CA, USA). 2.6. Plasmid construction and luciferase reporter assay The Notch1 30 UTR or mutant (Mut) without the predicted miR935 responsive element was inserted downstream of the firefly luciferase gene in the plasmid (Generay). The reporter plasmid pmiR-Notch1 Wt/-Mut (2.5 mg/well in 12-well plates) along with miR-935 mimic or control (50 nmol) was transfected into MKN-45 and KATO-Ⅲ cells. After transfection for 48 h, cell lysates were collected, and luciferase activities were measured by a DualLuciferase Reporter System (Promega, WI, USA) using an LB 960 Centro (Berthold Technologies, Bad Wildbad, Germany). The luminescence intensity of firefly luciferase was normalized to that
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
of Renilla luciferase. 2.7. Western blotting analysis Cells were harvested; protein extracts were obtained by lysing the cells with lysis buffer (1% NP-40, supplemented with a complete protease inhibitor tablet; Sigma, MO, USA). Equal amounts of protein were electrophoresed on 10% SDS-PAGE gels, then transferred to PVDF membrane. After blocking with 2% bovine serum albumin, the membranes were probed with anti-Notch1 (Santa Cruz Biotechnology, CA, USA), anti-b-actin (Santa Cruz Biotechnology), anti-E-cadherin, and anti-cyclin D1, VEGFA (Santa Cruz Biotechnology), followed by incubation with a horseradish peroxidaseeconjugated secondary antibody (goat-anti-mouse IgG [1:2000] and goat-anti-rabbit IgG [1:3000]). Proteins were visualized by Image Reader LAS-4000 (Fujifilm) and analyzed by the Multi Gauge V3.2 software. 2.8. Statistical analysis Data are presented as mean ± SD. Differences between groups were analyzed by Student's t-test (two-tailed), and analysis of variance (ANOVA) was used to find significant differences between groups. The qRT-PCR data was analyzed and visualized using GraphPad Prism v.5. Two-sided P < 0.05 was considered significant. Confidence intervals for differences in medians between two groups were computed by bias-corrected and accelerated bootstrapping methods. All experiments were performed at least three times. Data were analyzed with SPSS v.17.0 software. 3. Results 3.1. MiR-935 was downregulated in GSRCC To explore which miRNAs had dysregulated expression in GSRCC, we used microarrays in five cell lines, including three non-
3
GSRCC cell lines (SGC-7901, MGC8-03, AGS), and two GSRCC cell lines (MKN-45 and KATO-Ⅲ; Fig. 1A). Pick the fold change over 10 times in the microRNA array, this resulted in increased expression of miR-30a-5p, miR-30a-3p, miR-425-5p and miR-193b-3p, with miR-935 being the most downregulated. To validate microarray results, we assessed miR-935 expression in two normal gastric tissues, human gastric epithelial cell line GES-1, seven non-GSRCC cell lines, and two GSRCC cell lines. We found miR-935 was downregulated in GSRCC cell lines compared with non-GSRCC cell lines (Fig. 1B). To further investigate whether dysregulated miR-935 affected GSRCC, we assessed miR-935 expression in clinical gastric carcinoma tissue samples with adjacent normal tissue samples from the same patient. We used qRT-PCR to analyze relative levels of total RNA that were extracted from 60 matched sets of clinical gastric carcinoma tissue samples (including 30 non-GSRCC and 30 GSRCC tissue) and adjacent normal tissue samples from the same patient (Fig. 1C). Expression of miR-935 was significantly lower in tumor tissues than in normal tissues, (P ¼ 0.002; Fig. 1C). Expression of miR-935 was significantly lower in the GSRCC tissues than in the non-GSRCC tissues (P ¼ 0.0047; Fig. 1D). We collected and analyzed the patients' relevant clinicopathology information. No significant observation was found between miR-935 expression and any noted characteristics, including age, sex, differentiation grade or tumor stage (Table 1). 3.2. MiR-935 negatively regulated proliferation, migration and invasion of GSRCC cells We selected GSRCC cell lines MKN-45 and KATO-Ⅲ (with downregulated miR-935) to transfect the miR-935 mimic, and MGC8-03 and HGC-27 (with up-regulated miR-935) to transfect the miR-935 inhibitor (Fig. 2A). Transfection efficiency was evaluated by qRTPCR. To clarify the effect of miR-935 on the GSRCC malignant phenotype, we conducted cell proliferation, migration and invasion
Fig. 1. miR-935 was down-regulated in GSRCC. A. Heat maps generated using genes of greater than tenfold change. B. miR-935 expression in two normal tissues, human gastric epithelial cell line GES-1, seven non-GSRCC cell lines (BGC-823, HGC-27 SGC-7901, MGC8-03, AGS, MKN-28, NCIeN87), and two GSRCC cell lines (MKN-45 and KATO-Ⅲ) C. miR-935 was detected in 60 gastric carcinoma tissue samples (including 30 GSRCC and 30 non-GSRCC) with the adjacent normal controls by qRT-PCR assay. Data are presented as log2 of fold-changes in expression in gastric carcinoma tissues relative to adjacent normal regions. U6 was used as an internal normalized control. D. Comparison of miR-935 expression in GSRCC and non-GSRCC. U6 was used as an internal normalized control.
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
4
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
Fig. 2. Overexpression of miR-935 inhibited GSRCC cell proliferation, migration and invasion. A. Validation of miR-935 expression levels after transfection by qPCR analysis. B. Proliferation was assessed after transfection with miR-935 mimic or inhibitor for 24 h. C. Migration and invasion were assessed by transwell after transfection with miR-935 mimic or inhibitor for 48 h. Bars: mean of three independent experiments. Original magnification, 100.
assays. After transfection 24 h, cells were plated into 96-well plates. The proliferation was monitored by the xCELLigence Real-Time Cell Analyzer (RTCA)-MP system. Transwell migration and invasion assays were carried out 48 h after transfection. Over-expression of miR-935 markedly decreased proliferation, migration and invasion of MKN-45 and KATO-Ⅲ cells compared with the negative control. In contrast, the inhibitor that was transfected into MGC8-03 and HGC-27 cells significantly increased proliferation, migration and invasion compared the negative control (Fig. 2B, C). These results show that miR-935 negatively modulated the GSRCC phenotype. In all, these results indicate that ectopic miR-935 expression decreases GSRCC proliferation, migration and invasion in vitro, and acted as a tumor suppressor for GSRCC.
3.3. Expression of Notch1 is negatively regulated by miR-935 Although our results indicated that miR-935 was a tumor suppressor in GSRCC, the relevant mechanism was still unclear. As miRNAs function mainly through inhibition of target genes, we considered that the target of miR-935 might be an oncogene. TargetScan 7.0 predicted that Notch1 would have a single conserved binding sequence for miR-935 in the 30 UTR (Fig. 3A). Notch signaling is initiated by receptoreligand interaction, which leads to the activation of Notch intracellular cytoplasmic domain (NICD), which led to transcription of genes downstream in the Notch pathway. Activation of the Notch signaling pathway confers strong growth and motility advantage to cells, as Notch1 can directly control key regulators in cell proliferation and motility. We cloned part of the 30 UTR sequence of Notch1 containing the
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
5
Fig. 3. MiR-935 suppresses Notch1 expression by directly targeting the Notch1 30 UTR. A. Predicted miR-935 target sequence in the 30 UTR of Notch1 and positions of six mutated nucleotides (red) in the 30 UTR of Notch1. B. Luciferase reporter assay of MKN-45 and KATO-Ⅲ cells transfected with pmiR-Notch1-WT or pmiR-Notch1-MUT reporter plasmid and miR-935 mimic. C. Real-time PCR analysis of Notch1 mRNA expression after cells were transfected with miR-935 mimic. D. Western blot analysis of E-cadherin, cyclin D1, VEGFA, Notch1 after MKN-45 and KATO-Ⅲ were transfected with miR-935 mimic. b-actin was used as the loading control. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
binding site into the luciferase plasmid vector to create the plasmid pmiR-Report-Notch1-wt. The mutant reporter plasmid (pmiRReport-Notch1-mut) contained a mutation at the predicted binding sequence (Fig. 3A). These plasmids were transfected into different sets of MKN-45 cells, combined with transfecting the miR-935 mimic for 48 h. Using the 30 UTR luciferase reporter assays, we found that over-expression of miR-935 significantly inhibited luciferase activity in MKN-45 cells that expressed the wild type Notch1 30 UTR reporter rather than the wild-type Notch1 30 UTR reporter. Mutations in the miRNA binding sites rendered the constructs unresponsive to miR-935 induction (Fig. 3B). We had similar results in the GSRCC cell line KATO-Ⅲ. These results indicated that Notch1 is a target gene of miR-935, and the position of 1593e1599 in the 30 UTR of Notch1 is the miR-935 binding site. After transfection miR-935 mimic in MKN-45 and KATO-Ⅲ cells for 48 h, we found that Notch1 mRNA was expressed at lower levels than control (Fig. 3C). This result implies that miR-935 influences Notch1 mRNA by binding its 30 UTR. After transfection miR-935 mimic in MKN-45 and KATO-Ⅲ cells for 48 h, we collected and assessed the Notch1 protein level by western blot. As expected, Notch1 was expressed at lower levels in MKN-45 and KATO-Ⅲ cells that were transfected with the miR-935 mimic than in the controls. Simultaneously, we found that E-cadherin expression was increased, whereas cyclin D1 and VEGFA expression was decreased (Fig. 3D). 3.4. Knock-down Notch1 significantly inhibited GSRCC proliferation, migration and invasion and overexpression of Notch intracellular cytoplasmic domain(NICD) could rescue miR-935's tumor suppressive effect on GSRCC To clarify the effect of Notch1 in GSRCC malignancy, we conducted cell proliferation, migration and invasion assays. By performing proliferation and transwell assays, we found that Notch1 siRNA could negatively regulate proliferation, migration and
invasion of GSRCC cell-lines, as did miR-935 mimic (Fig. 4B, 4C). The activation of Notch results in the sequential proteolytic cleavage of the Notch receptor, which releases Notch intracellular domain (NICD) into the nucleus, which in turn activates downstream gene transcription including that of the Hes and Hey genes. NICD is Notch receptor's activated form. We transfected miR-935 mimic, at the same time, overexpression Notch intracellular cytoplasmic domain (NICD) in GSRCC cells, and found overexpression NICD could partly rescue miR-935's tumor suppressive effect on GSRCC cells' proliferation, migration and invasion (Fig. 4B, C). 3.5. Notch1's expression and relationship with miR-935 in gastric cancer tissues Quantitative PCR was used to examine levels of Notch1 mRNA in from the same 36 matched sets of gastric carcinoma/adjacent normal tissue samples (including 18 non-GSRCC and 18 GSRCC patients) from the same patient whose tissue was used to detect miR-935. By this approach, we confirmed that Notch1 mRNA was expressed at significantly higher levels in gastric carcinoma tissue than in adjacent tissues (P ¼ 0.0195; Fig. 4D). Moreover, we identified a significant inverse correlation between miR-935 and Notch1 in gastric carcinoma (Fig. 4E). 4. Discussion Compared with other types of gastric cancer, gastric signet-ring cell carcinoma is more aggressive, with greater malignancy, faster progression and lower sensitivity to anti-tumor treatment. Furthermore, the mechanism of the occurrence and development of GSRCC is still not clear. In this study, we screened miRNAs by microarray; we expanded the samples to verify the low expression of miR-935 in GSRCC, and found that miR-935 could inhibit proliferation, invasion and migration of GSRCC cells through its target gene, Notch1. Therefore, this study provides a new way for the
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
Fig. 4. Notch1's function on gastric cells' aggressive phenotype and relationship with miR-935 in gastric cancer tissues. A. Western blot analysis of Notch intracellular domain (NICD) in MKN45 and KATO-Ⅲ after transfecting pEGFP-N1-NICD plasmid. B. Proliferation was assessed after transfection with Notch1 siRNA or overexpression Notch intracellular domain (NICD) along with miR-935 mimic for 24 h. C. Migration and invasion abilities were assessed in Transwells after transfection with Notch1 siRNA or overexpression Notch intracellular domain (NICD) along with miR-935 mimic for 48 h. Bars: mean of three independent experiments. Original magnification, 100. D. shows that Notch1 mRNA expression was detected in 36 gastric carcinoma tissue samples with the adjacent normal controls by qRT-PCR. Data are presented as log2 of tfold-changes in expression in gastric carcinoma tissues relative to adjacent normal regions. GAPDH was used as an internal normalized control. E. Correlation analysis of Notch1 and miR-935 in gastric carcinoma.
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116
C. Yan et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
research on the mechanism of the occurrence and development of GSRCC. In our study, we screened microRNAs by microarray and noticed the low expression of miR-935 in GSRCC cells, which was confirmed when we increased the number of cell lines. Expression of miR-935 in gastric cancer tissues (including both GSRCC and non-GSRCC) was shown to be lower than that of paired normal tissues, and its expression in GSRCC was significantly lower than in non-GSRCC. We also found no significant differences in age, sex, tumor differentiation and tumor grade with regard to miR-935 expression. These results suggest that miR-935 may act as a tumor suppressor gene in gastric cancer, especially in potential GSRCC cells. Our cell phenotype experiments showed that up-regulated miR935 in GSRCC cells can inhibit proliferation, invasion and migration, while its down-regulation can promote proliferation, invasion and migration in non-GSRCC cells. These results indicate that miR-935 functions as a tumor suppressor gene in GSRCC cells. At the same time, we demonstrated by dual luciferase report system that miR935 inhibits translation of Notch1 by binding to its 30 UTR, and decreases its mRNA and protein expression. Furthermore, knock down Notch1 could mimic miR-935's tumor suppressive effect on GSRCC, while overexpression Notch intracellular domain (NICD) could partly rescue miR-935 tumor suppressive effect on GSRCC. These results demonstrated that Notch1 is one of miR-935's target gene in GC. Notch-1 is a member of the Notch gene family, which is a highly conserved I type transmembrane glycoprotein [14]. The normal Notch1 pathway is touched off by ligand-induced hydrolytic protein cleavage, which releases intracellular region of Notch protein from the cell membrane. The intracellular region moves into the nucleus and uperegulates activity of the Su(H)/CBF1 transcription factor family [15]. Notch-1 plays important roles in cell proliferation, differentiation, survival and apoptosis. It is closely related to tumor occurrence and development. The function of Notch1 varies in different cancer types, but reportedly acts as an oncogene in gastric cancer [16,17]. In this study, we found that miR-935 inhibited translation of Notch1 by targeting its 30 UTR. We identified a significant inverse correlation between miR-935 and Notch1 in gastric cancer. Protein levels of vascular endothelial growth factor A (VEGFA), cyclin D1 remarkably decreased, whereas E-cadherin was up-regulated, after the cells were transfected with the miR-935 mimic. A previous study identified the functions of Notch1 signaling pathway in proliferation, migration and invasion [18]. Notch1 inhibited expression of E cadherin by up-regulating transcriptional factors of Snail family, resulting in inhibition of expression of b catenin and destabilization of adherens junctions [19]. E-cadherin is a marker of Epithelial mesenchymal transition (EMT). Notch1-induced angiogenesis is partly due to activation of VEGF pathway [20]. Cyclin D1 abundance correlated with Notch1 activity during embryogenesis and Notch1-induced cyclin D1 expression and transcription, requiring a CBF-binding site in the cyclin D1 promoter. These findings indicate that miR-935 regulates GSRCC metastasis, and may influence EMT and cell cycle by negatively regulating Notch1 expression. In conclusion, our results have clarified the function of miR-935 in GSRCC tumorigenesis, and also provided novel insights into the mechanism of miR-935, which modulated expression of Notch1. miR-935 was first identified as serving as a tumor suppressor in GSRCC cell proliferation and metastasis. MiR-935 could be a novel target in gastric signet-ring cell carcinoma detection and diagnosis.
7
Conflict of interest There is no conflict of interest.
Acknowledgment This work was supported by grants from Major Science and Technology Projects in Beijing City (No. D141100000414004).
References [1] H.L. Han, K.Y. Song, C.H. Park, H.M. Jeon, Undifferentiated-type gastric adenocarcinoma: prognostic impact of three histological types, World J. Surg. Oncol. 10 (2012) 232, 232. [2] J.H. Lee, I.J. Choi, M.C. Kook, B.H. Nam, Y.W. Kim, K.W. Ryu, Risk factors for lymph node metastasis in patients with early gastric cancer and signet ring cell histology, Br. J. Surg. 97 (2010), 732e736(735). [3] T. Sharven, S.N. Jayarajan, D. Adam, A.I. Willis, Prognostic significance of signet ring gastric cancer, J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 30 (2012) 3493e3498. [4] A.S. Flynt, E.C. Lai, Biological principles of microRNA-mediated regulation: shared themes amid diversity, Nat. Rev. Genet. 9 (2008) 831e842. [5] S.H. Chan, C.W. Wu, A.F. Li, C.W. Chi, W.C. Lin, miR-21 microRNA expression in human gastric carcinomas and its clinical association, Anticancer Res. 28 (2008) 907e911. [6] T.B. Kheir, E. Futoma-Kazmierczak, A. Jacobsen, A. Krogh, L. Bardram, C. Hother, K. Grønbæk, B. Federspiel, A.H. Lund, L. Friis-Hansen, miR-449 inhibits cell proliferation and is down-regulated in gastric cancer, Mol. Cancer 10 (2011) 29, 29. [7] J. Stenvang, A. Petri, M. Lindow, S. Obad, S. Kauppinen, Inhibition of microRNA function by antimiR oligonucleotides, Silence 3 (2012) 1. [8] L. Shuli, H. Lijie, Z. Xiaodi, M. Yu, G. Yong, G. Changcun, X. Zengfu, D. Weijia, H. Fengrong, W. Kaichun, MicroRNA Let-7f inhibits tumor invasion and metastasis by targeting MYH9 in human gastric cancer, PLoS One 6 (2011) e18409 e18409. [9] B. Brenner, M.B. Hoshen, O. Purim, M.B. David, K. Ashkenazi, G. Marshak, Y. Kundel, R. Brenner, S. Morgenstern, M. Halpern, MicroRNAs as a potential prognostic factor in gastric cancer, World J. Gastroenterol. 17 (2011) 3976e3985. [10] S.L. Guo, Z. Peng, X. Yang, K.J. Fan, H. Ye, Z.H. Li, Y. Wang, X.L. Xu, J. Li, Y.L. Wang, miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells, Int. J. Biol. Sci. 7 (2011) 567e574. [11] W.Y. Wu, X.Y. Xue, Z.J. Chen, S.L. Han, Y.P. Huang, L.F. Zhang, G.B. Zhu, S. Xian, Potentially predictive microRNAs of gastric cancer with metastasis to lymph node, World J. Gastroenterol. 17 (2011) 3645e3651. [12] L. Xiaohua, Z. Ying, Z. Yafei, D. Jie, W. Kaichun, F. Daiming, Survival prediction of gastric cancer by a seven-microRNA signature, Gut 59 (2010) 579e585. [13] L. Yu-Lun, H. Ling-Yueh, T. Kuo-Wang, W. Chew-Wun, C. Wen-Ching, L. SungChou, L. Chun-Hung, H. Meng-Ru, F. Wen-Liang, H. Kuo-Hung, Transcriptional regulation of miR-196b by ETS2 in gastric cancer cells, Carcinogenesis 33 (2012) 760e769. [14] B.W. Purow, M.W. Haque RMNoel, Q. Su, M.J. Burdick, J. Lee, T. Sundaresan, S. Pastorino, J.K. Park, I. Mikolaenko, D. Maric, Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation, Cancer Res. 65 (2005) 2353e2363. [15] W.R. Liao, R.H. Hsieh, K.W. Hsu, M.Z. Wu, M.J. Tseng, R.T. Mai, Y.H.W. Lee, T.S. Yeh, The CBF1-independent Notch1 signal pathway activates human cmyc expression partially via transcription factor YY1, Carcinogenesis 28 (2007) 1867e1876. [16] S. Stojnev, M. Krstic, A. Ristic-Petrovic, V. Stefanovic, T. Hattori, Gastric cancer stem cells: therapeutic targets, Gastric Cancer Off. J. Int. Gastric Cancer Assoc. Jpn. Gastric Cancer Assoc. 17 (2014) 13e25. [17] B. Yan, Y. Zhou, S. Feng, C. Lv, L. Xiu, Y. Zhang, J. Shi, Y. Li, P. Wei, Z. Qin, b -elemene-attenuated tumor angiogenesis by targeting Notch-1 in gastric cancer stem-like cells, evidence-based complementary and alternative medicine, eCAM 2013 (2013) 268468. [18] K. Muthusamy, T. Kelly, C. Herbert, Conservation of the Notch1 signaling pathway in gastrointestinal carcinoid cells, Am. J. Physiol. Gastrointest. Liver Physiol. 289 (2008) G636eG642. [19] C.C. Alves, E. Rosivatz, C. Schott, R. Hollweck, I. Becker, M. Sarbia, F. Carneiro, K.F. Becker, Slug is overexpressed in gastric carcinomas and may act synergistically with SIP1 and Snail in the down-regulation of E-cadherin, J. Pathol. 211 (2007) 507e515. [20] R.S. Kerbel, Tumor angiogenesis, N. Engl. J. Med. 358 (2008), 20e23(24).
Please cite this article in press as: C. Yan, et al., miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression, Biochemical and Biophysical Research Communications (2015), http://dx.doi.org/10.1016/j.bbrc.2015.12.116