DNA

Journal Pre-proof miRNA-21 Rapid Diagnosis by One-pot Synthesis of Highly Luminescent Red Emissive Silver Nanoclusters/DNA Vahid Nasirian, Mojtaba Shamsipur, Fatemeh Molaabasi, Kamran Mansouri, Morteza Sarparast, Vonny Salim, Ali Barati, Soheila Kashanian

PII:

S0925-4005(20)30020-4

DOI:

https://doi.org/10.1016/j.snb.2020.127673

Reference:

SNB 127673

To appear in:

Sensors and Actuators: B. Chemical

Received Date:

2 September 2019

Revised Date:

27 December 2019

Accepted Date:

4 January 2020

Please cite this article as: Nasirian V, Shamsipur M, Molaabasi F, Mansouri K, Sarparast M, Salim V, Barati A, Kashanian S, miRNA-21 Rapid Diagnosis by One-pot Synthesis of Highly Luminescent Red Emissive Silver Nanoclusters/DNA, Sensors and Actuators: B. Chemical (2020), doi: https://doi.org/10.1016/j.snb.2020.127673

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

miRNA-21 Rapid Diagnosis by One-pot Synthesis of Highly Luminescent Red Emissive Silver Nanoclusters/DNA

[email protected], Mojtaba Shamsipur a* [email protected], Fatemeh Molaabasi c,d, Kamran Mansouri e, Morteza Sarparast aɤ, Vonny Vahid Nasirian a, b

✉*

of

Salimf, Ali Barati a, Soheila Kashanian a a

) Department of Chemistry, Razi University, Kermanshah 6714967346, Iran ) Department of Chemistry and Physics, Louisiana State University in Shreveport, Shreveport, LA, 71115 USA c ) Department of Biomaterials and Tissue Engineering, Breast Cancer Research Center, Motamed Cancer Institute, ACECR, Tehran, Iran d ) Department of Chemistry, Tarbiat Modares University, Tehran, Iran e ) Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran ɤ Current address: Department of Chemistry, Michigan State University, East Lansing, Michigan 488241322, USA f ) Department of Department Of Biological Sciences, Louisiana State University in Shreveport, Shreveport, LA, 71115 USA

Corresponding Authors: Vahid Nasirian: ✉, and Mojtaba Shamsipur: ✉

Jo ur

na

*

lP

re

-p

ro

b



Highlights

The red-emitting DNA/AgNCs have been synthesized by a specific DNA scaffold containing a cytosine enriched fragment.

1

Quantitative determination of miRNA-21 was carried out by these nanoclusters and based on FRET processor.



The duplex miRNA-21/miRNA-21 probes structure formed can be utilized for successful transferring of the energy from DNA/AgNCs to Cy5.5 as a FRET acceptor.



The platform showed high selectivity, low detection limit (4.0×10-3 nM) with a wide dynamic ranges of 0.02‒100.0.

Jo ur

Abstract:

na

lP

re

-p

ro

of



microRNAs (miRNAs) are significant biomarkers either for probing cellular events or

disease diagnosis. Compared to regular RNA, miRNAs possess short length and low abundance with sequence homology, which results in major challenges on the determination of these biomarkers. Thus, developing a simple, rapid, and effective technique for qualitative and quantitative analysis of miRNAs is urgent in clinical diagnosis, pathogenesis, and various medical therapies. Herein, DNA-silver nanoclusters (DNA/AgNCs) have been synthesized by a specific

2

DNA scaffold containing a cytosine enriched fragment and a capitation agent with high selectivity probe, to design a Förster resonance energy transfer (FRET) sensing platform for miRNA-21 detection. A duplex miRNA-21/DNA probes structure is formed by introducing a red-emitting synthesized DNA/AgNCs, as a FRET donor, to miRNA-21 in the presence of a near-infrared (NIR)-emitting probe-modified Cy5.5, as a FRET acceptor. These sequences produced a duplex structure which could be utilized as a bridge for the successful transferring of the energy from DNA/AgNCs excited to Cy5.5 at steady state. This hybridized structure could result in the enhancement of Cy5.5 fluorescence intensity

of

in a linearly proportional manner toward miRNA-21 concentration as a target. We believe this as-designed FRET-based technique owning high selectivity, low detection limit

ro

(4.0×10-3 nM), and a wide dynamic ranges of 0.02‒100.0 nM, can be introduced as a new

re

-p

advanced method to develop specific miRNAs-based clinical diagnoses.

na

lP

Keywords: Red-emitting DNA/Ag nanocluster, MiRNA-21, FRET, Nano-bio probe

Jo ur

1. Introduction

MicroRNAs (miRNAs), which are considered as important small (18-25 nucleotides)

noncoding RNAs, play pivotal roles in the regulation of diverse gene expression in many biological processes such as early development [1], cell differentiation [2, 3], proliferation [4], hematopoiesis, segregation, apoptosis, and many other pathogenesis of either plants or animals. Furthermore, these short length nucleotide sequences are owknw nk function as both oncogenes and tumor suppressors in cancers development, metabolism, splicing, and localization of RNAs by binding to the 3′-untranslated region (3′-UTR) of target messenger

3

RNAs at the DNA posttranscriptional level [5]. The miRNA-21 is one of well-known miRNAs that is implicated in cell proliferation, apoptosis, invasion, metastasis [6], heart [7], phosphatase and tensin homologue (PTEN) [8], programmed cell death 4 (PDCD4) [6], RECK [9], maspin [10], Tropomyosin1 (TPM1) [11], Heterogeneous nuclear Ribonucleoprotein K (HNRPK) [12], development of non-small cell lung cancer (NSCLC) [13], and TAp63 [12]. Accordingly, miRNA-21 along with knmo totfo e kb nmo ehto bhtmaf biomarkers become versatile in various disease diagnostics and prognostics

of

methods in the past few decades [14]. Northern blotting [15], real-time quantitative PCR (RT-qPCR) [16] microarrays [17],

ro

rolling circle amplification (RCA) [18], and isothermal amplification [19], are known as

-p

the most conventional techniques for the miRNAs detection. However, these techniques are limited by their very complicated, labor-intensive, and time-consuming features. For

re

example, the northern blot technique as a standard miRNAs analysis method, suffers from

lP

its low sensitivity, time-consuming steps, and requirement of large amounts of sample for low-abundance miRNAs expression [20]. Likewise, RT-PCR amplification method [16] requires reverse transcriptions for multiplex large-scale experiments along with

na

nonspecific background amplification steps [19]. Besides, these methods employ some radioactive [20] and fluorescent [21, 22] probes, is always accompanied by some

Jo ur

problems such as photo-bleaching [23]. These issues bolster the need for the development of more efficient diagnostic assays with a high ability to determine low concentrations miRNAs which are found in complex mixtures containing other similar sequences [24-26]. Nanoclusters, as a new generation of luminescent nanoparticles, are composed of few

atoms (less than 20 atoms) that are known by their small size (approximately 2 nm), convenient preparation method, brightness, chemical and photochemical stability, high solubility in water, biocompatibility, and low toxicity. Hence, different optical methods

4

were developed in both determination of bio-analytes (e.g. protein and nucleic acid) and successful In-Vitro or In-Vivo biological imaging due to these remarkable optical properties of these nanostructures [27-29]. Furthermore, size-dependence emission behavior of nanocluster can be employed to design fluorescence resonance energy transfer (FRET)-based systems [30, 31] to further study the cleavage [32], nucleic acid detections [33], hybridization [34], structure, functioning, and interactions of proteins [35]. In this study, a miRNA-21 quantitative assay was developed through a non-toxic, rapid, one-step

of

process using Red-emitting DNA/Silver nanoclusters (DNA/AgNCs). This type of nanostructures have been utilized in different protocols based on photoinduced electron

ro

transfer (PET) [36], target-assisted isothermal exponential amplification (TAIEA) [27],

-p

and quenching methods [37]. We could synthesize Red-emitting DNA/AgNCs by nucleotide scaffolds enriched with cytosine to successfully anchor silver atoms during the

re

AgNCs formation, and a specific complementary DNA sequence against miRNA-21 as a

lP

target. This red-emitting DNA/AgNCs could form a sandwiched hybrid structure with miRNAs-21 in the presence of other miRNA-21 probe, Cyanine 5.5 (Cy5.5)-modified 11mer oligonucleotide. Therefore, the Cy5.5 modified probe as an acceptor FRET came into

na

close proximity of AgNCs as a donor FRET to effectively receive the energy of the excited AgNCs throught FRET procedure (Scheme 1). Due to this hybridation structure, the

Jo ur

intensity of Cy5.5 emission could be enhanced in respect of the added miRNA-21 concentration which can be employed for specific quantification of complementary miRNA-21 through a simple and rapid procedure without any need to any excess operation. The promising potential of this system in biological and clinical application was investigated by focusing on its operation against mismatch and non-complementary sequences, and tested with clinical serum samples.

5

of

Scheme 1. The design of the developed DNA/AgNCs nano-bioprobe based on FRET for the determination of miRNA-21.

ro

2. Experimental section

-p

2.1. Chemicals and Materials

re

Silver nitrate (AgNO3), Sodium tetraborohydride (NaBH4), NaOH, AgNO3, NaBH4,

lP

Na2HPO4, NaH2PO4, NaCl, and other chemicals were obtained from Merck (Darmstadt, Germany, https://www.emdgroup.com). Phosphate buffer (0.20 M, pH 7.4) along with all stock solutions, were prepared using ultrapure Milli-Q water (resistance=18 MΩ.cm).

na

Other chemicals were of analytical grade and used without further purification. The oligonucleotide sequences utilized in this study to develop this nano-bioprobe

Jo ur

were purchased from Faza Biotech Company (Iran, http://www.fazabiotech.com) which are based on previous articles [38-40] as follows: Scaffold oligonucleotide probe: 5′-CCTCCTTCCTCCGTTGTGGTCA Cy5.5-modified probe: 5′-GCTACCCGACA-3′(Cy5.5) Target complementary miRNA-21: 3′-CAACACCAGUCGAUGGGCUGU-5′ miRNA-16: UAGCAGCACGUAAAUAUUGGCG miRNA-136: ACUCCAUUUGUUUUGAUGAUGG

6

miRNA-206: ACAUGCUUCUUUAUAUCCUCAUA The human miRNeasy serum/plasma kit (Cat. no. 217184) was prepared from Qiagen (Valencia, CA).

2.2. Apparatus All fluorescence measurements were carried out using a Varian Cary Eclipse fluorimeter equipped with a micro quartz cell (1 cm×1 cm, 300 µL). For DNA/AgNCs, their emission

of

spectra were recorded over the wavelength range of 520-730 nm using a 1500 nm min-1 scan rate. The excitation and emission slits were set at 5 nm. UV-Vis spectra were

ro

recorded at the range of 220-800 nm by an Agilent 8453 diode array spectrophotometer.

-p

The background spectral were corrected with a phosphate buffer as blank solution for these

conditions.

lP

2.3. Synthesis of DNA/AgNCs

re

experiments. All optical measurements were repeated for three times and under ambient

The fluorescent DNA/AgNCs probes were synthesized based on the method developed

na

by Dickson and coworkers [41]. For this aim, the oligonucleotide solution (100 μM) was added to an AgNO3 solution under gentle stirring. After 15 minutes, the DNA/Ag+ mixture

Jo ur

was allowed to be reduced by adding an adequate amount of freshly prepared NaBH4 solution followed by vigorous stirring. At this optimal molar ratio of 1:18:18 DNA, AgNO3, NaBH4, the synthesis reaction was continued for 6 hours in a dark room. Finally, the synthesized DNA/AgNCs samples were kept at 4 ℃ in phosphate buffer (10 mM, pH 7.4).

2.4. Determination of miRNA-21 based on the occurred FRET between the DNA/AgNCs and Cy5.5 7

The determination procedure was carried out in hybridization buffer (10 mM Tris–HCl, 0.1 M NaCl, 5 mM MgCl2, 10 mM EDTA at pH=7.4) and through a combination of 100.0 µL of DNA/AgNCs (50.0 µM), 15.0 µM Cy5-DNA, and different concentrations of miRNA-21. The mixture sample was incubated for 20 min at room temperature in 1.5 mL Eppendorf microtubes, and then immediately cooled down to 4◦C. The as-prepared mixture was transferred into a quartz micro cuvette for irradiation of DNA/AgNCs as FRET donor under the excition wavelength of 526 nm. The intensity of Cy5.5 emission intensity was

of

measured at 705 nm and recorded to determine its correlation with miRNA-21 concentration. Each of these experiments was repeated in three repetitions apart under

ro

optimal working conditions to obtain the figures of merit and statistical analysis.

-p

2.5. Isolation of microRNA from clinical samples

re

The miRNA-21 purifying from some individuals serum samples, was carried out using the human miRNeasy serum/plasma kit (Cat No./ID: 217184) and according to the

lP

manufacturer's instructions (QIAGEN, Hilden, Germany, https://www.qiagen.com). In brief, the purification was accomplished by adding 20 U of RNase inhibitor along with 1

na

mL of Qiazol lysis reagent to 0.2 mL of serum. This mixture was shaken and then incubated at room temperature for 5 minutes. After dissociation of this nucleoprotein

Jo ur

complex, 0.2 mL chloroform was added to the mixture, vortexed for 15 seconds, and incubated for more than 3 minutes at 25 °C. To purify the miRNAs from other parts of the solution, the sample was centrifuged at 4 °C for 15 minutes and then performed by a spincolumn format. The concentration of the purified mRNA was measured 82.6 ng/µL by nanodrop eooen komknktono and through optical density measurement. Finally, two different volumes of this sample (1.0 and 1.5 µL) were eluted with distilled deionized water and stored at ‒20 ℃.

8

3. Results: 3.1. The Characterization of the Synthesized Fluorescent DNA/AgNCs: Generally, DNA-templated synthesis of metal nanoclusters entails the formation of metal ion heterocyclic adduct followed by reduction of the metal ions by a reducing agent such as NaBH4. The DNA/AgNCs were synthesized based on a facile strategy and through sequestering AgNO3 with the DNA and then Ag+ reduction to Ag0 clusters with NaBH4

na

lP

re

-p

ro

of

[42].

Jo ur

Fig. 1. DNA/AgNCs characterization. (a) Photoluminescence emission spectra of DNA/AgNCs (progressively longer excitation wavelengths from 520 nm to 575 nm with a 5 nm increment; (b) Absorption, excitation, and emission spectra of the synthesized DNA/AgNCs.

For Characterization of these Synthesized Fluorescent DNA/AgNCs, their emission

behavior was studied under different excitation wavelengths. As shown in Fig. 1 (a), the maximum emission intensity of synthesized DNA/AgNCs was observed at 316 nm in an emission spectrum with the full-width half-maximum (FWHM) of 95 nm when they were irradiated by 526 nm. Moreover, the photoluminescence stability of DNA/AgNCs was investigated under continuous illumination at 623 nm for 30 min. Also, The UV-Vis absorption spectrometry demonstrated an absorption maximum at 434 nm related to the Ag

9

nanocluster and a polycytosine spacer DNA template (Fig. 1 (b)(.

3.2. FRET parameters Fig. 2 shows the acceptable overlapping of spectral region between the absorption of Cy5.5 and the emission of the as-synthesized DNA/AgNCs, which is beneficial to have a FRET process with satisfactory efficiency. Besides, the broad absorption spectrum of the DNA/AgNCs provides flexible choices for their excitation wavelengths which can

of

minimize background interference and cross-talk between emission spectra of these

Jo ur

na

lP

re

-p

ro

nanoclusters as FRET donor and Cy5.5 as FRET acceptor.

Fig. 2. The overlapping between the emission spectrum of DNA/AgNCs as donor FRET and the absorption spectrum of Cy5.5 as FRET acceptor.

The FRET efficiency (E) obtained for this as-designed system was calculated to be

23.94% using Eq. 2.

𝐸 = 1−

𝐼𝐷𝐴 𝐼𝐷

Eq. 2

10

where IDA and ID are emission intensities of the DNA/AgNCs in the presence and the absence of Cy5.5 as an acceptor, respectively. The spectral overlapping (J) between the emission spectrum of the donor and the absorption spectrum of the acceptor as a function of the wavelength was also determined by Eq. 3 ∫ 𝐹𝐷 (𝜆)𝜀𝐴 (𝜆)𝜆4 𝑑𝜆 𝐽= ∫ 𝐹𝐷 (𝜆) 𝑑𝜆

Eq. 3

of

where FD() is the donor fluorescence intensity at the wavelength of , and εA() is the

ro

molar absorption coefficient of the acceptor at the wavelength of . J was obtained as

1.382×1016 nm4/(M.cm) through integration of Uv-Vis absorption of Cy5.5 (15.0 µM) and

-p

fluorescence emission spectrum of DNA/AgNCs (1.0 µM) at 0.5 nm increments

re

numerically [43].

By knowing E and J amounts, Eq. 4 can be employed to calculate Förster distance

lP

(R0), as the distance of donor and acceptor pair for energy transfer with 50% efficiency [43]:

na

𝑅06 = 8.79 × 10−28 mol × (𝑛−4 𝜅 2 𝛷𝐷 𝐽)

Eq. 4

Jo ur

where n is the refractive index of the surrounding medium, J is the integral of overlapped spectral, κ2 is relative orientation between donor emission and acceptor absorption dipoles and ΦD is the donor quantum yield. R0 was obtained as 5.039×10-9 m by considering n=1.34 and κ2=2/3 for the developed

DNA/AgNCs-Cy5.5 FRET system. Finally, the donor–acceptor separation, r, was calculated 6.11×10-9 m via Eq. 5 for one acceptor (n=1).

11

1 𝑟 6 = 𝑛 𝑅06 ( − 1) 𝐸

Eq. 5

3.3. The Optimization of Conditions for the developed miRNA-21 Assay: To obtain maximum FRET efficiency and a desirable limit of detection, some of the pivotal factors on FRET efficiency such as the relative number of DNA/AgNCs probes to Cy5.5-DNA concentration and the hybridization time, were optimized. The ratio of DNA/AgNCs probes to Cy5.5-DNA concentration as the main effective

of

factor to achieve desirable detection limit and FRET yield was optimized by evaluating the

ro

emission spectra of the employed nanocluster probes in the presence of various

concentrations of Cy5.5. As shown in Fig. 3a, the optimal FRET efficiency was achieved

-p

when 5.0 nmol DNA/AgNCs and 1.0 nM miRNA-21 were introduced to 15.0 µM Cy5.5

Jo ur

na

lP

re

within 30 min.

Fig. 3. Fluorescence intensity of Cy5.5 resulted from FRET between the DNA/AgNCs and Cy5.5 as a function of Cy5.5 concentration (a), and the effect of the hybridization time on FRET efficiency at constants DNA/AgNCs (5.0 nmol) and miRNA-21 concentration (1.0 nM).

In addition, the incubation time for adequate interaction between miRNA-21 target and

12

the designed probe was determined as 20 min, as the fluorescence intensity reaches its maximum and steady-state (Fig. 3b). Considering these, all experiments have been done under these optimized conditions unless otherwise indicated.

3.4. Performance of this Developed FRET-based method for miRNA-21 Detection: In this study, the recognition principle is based on RNA/DNA base pairing, which was

of

benefited from stacking among the miRNA-21as analyte and DNA sequences FRET probes, DNA/AgNCs, Cy5.5-DNA. [44]. As a result of this tendency, a specific

-p

FRET pairs for fluorescence-based detection of miRNA-21.

ro

miRNA/DNA double-stranded structure can be successfully formed with AgNCs-to-Cy5.5

For this aim, the orientation and the length of DNA sequences had to be carefully

re

designed to ensure the establishment of Cy5.5 within the DNA/AgNCs Förster radius and

lP

gain the maximum enhancement of Cy5.5 emission upon illumination of AgNCs at 526 nm in the FRET process. In such circumstances we can claim that the design method can determine the miRNA-21 at different concentration with high sensitivity and selectivity

na

due to the high emission intensity, and nucleobase pairing properties. In order to investigate the potential of as-fabricated biosensor for quantification of

Jo ur

miRNA-21, its analytical parameters were evaluated according to the method described in section 2.4 and under the optimal conditions mentioned in section 3.3. kaaknmwi nmme ekweoon, a linear relationship between the fluorescence intensity of the Cy5.5-DNA and

concentration of miRNA-21 has been achieved in two ranges of 0.02-10.0 nM (𝑅12 =0.9463) and 10.0-100.0 nM (𝑅22 =0.9945). The signal intensity for miRNA-21 concentrations above these ranges remains constant which might be due to the saturation of available position in the Cy5.5-DNA hybridization system for this higher amounts of analyte than

13

100.0 nM. The Limit of detection (LOD) of this developed nano-bioprobe was gained 4.0×10-12 M (S/N=3) based on DL = 3S0/K, where S0 is the standard deviation of intensity of Cy5.5 emission in the absence of miRNA-21 target (n=6), and K is the slope of the calibration curve. Note that the background signal was considered as a signal of the Cy5.5-DNA solution during irradiation under an excitation wavelength at 526 nm and in the absence of miRNA21. Under this condition and due to the lack of connectivity between Cy5.5 and the

of

DNA/AgNCs probes, only one detectable emission peak was exhibited at 613 nm that was

na

lP

re

-p

ro

related to AgNCs.

Jo ur

Fig. 4. Variation of photoluminescence spectra of developed FRET nano-bioprobe by synthesized DNA/AgNCs against increasing concentration of target miRNA-21: (I) 0.02 nM, (II) 0.5 nM, (III) 3.0nM, (IV) 5.0 nM, (V) 10.0 nM, (VI) 20.0 nM, (VII) 50.0 nM, (VIII) 90.0 nM, (IX) and 100.0 nM. Conditions: 111 µL the synthesized DNA/AgNCs with 3.0 nmol Cy5.5-labeled probe sequence at pH 7.4. Inset shows the resulting calibration curve.

The figures of the merits for this designed bio-nanoprobe are compared with some

previously reported fluorescence methods for the detection of miRNAs in Table 1. As seen, this comparison can clearly prove the promising potential of developed nanobioprobe in this study as an assay suitable for simple and specific real-time quantification of miRNA-21 in solution with no additional operations to remove the un-ligated and noncomplementary sequences.

14

f

Fluorescence (Quenching)

0‒10-7 M

605 nm, 655 nm, 705 nm Qdot

Red fluorescence of the DNA/AgNC probe (DNA-12ntRED-160)

Gold nanoplasmonic particles (GNPs)

Jo ur na l

Colorimetric

CdSe/ZnS QDs and telomerase

On-Off switching of Fluorescence

Fluorescent (Quenching)

Fluorescent (Quenching)

Fluorescent (FRET)

LOD

2‒10 nM

0‒1.5 μM

Nano Metal-Organic Framework (UiO-66)

DNA/AgNCs

1 pM‒10 µM

1×10-9 M

‒

‒

0‒1000 nM

10 pM

0.2‒30 nM

0.1 nM

DNA/AgNCs

0‒1.5 μM

DNA-AgNCs and Cy5.5

0.02 ‒10.0 & 10.0-100.0 nM

15

Comment

Ref.

Target=miR-141 as prostate cancer biomarker

[45]

Target=miR-20a, miR-20b, miR-21 Amount of QD-DNA=0.5 nM Amount of Tb-DNA 20 nM Temperature=22 ℃ sample volume=150 µL Time=30 min. Target=miR160 Amount of used DNA-12nt-RED-160 probe=1.5 μM Temperature=42℃ Target=miRNA-21 Amount of GNPs= 15×10-14 Temperature=25 ℃ Time= 60 min.

[46]

Target=miRNA-21, miR-96 and miR125b Reproducibility=8.2%, RSD=9.1%, Indicator: FAM PNA21, Cy5 PNA96 and ROXPNA125b Temperature=37℃ Time=2 h, 3 h and 1.5 h, respectively

[49]

Target=miRNA-155 Temperature=37 ℃ pH=7 Time=60 min Target=RNA-miR172 Amount of Tb-DNA 20 nM Temperature=25 ℃ sample volume=50 µL Time=20 min. Target=miRNA-21, Indicator: Cy5.5, time: 30 min, temperature: 25 °C, Real sample: blood contained spiked miRNA-21

[50]

2.8×10-13 M

pr

FRET between Lumi4-Tb and three different QDs

LR

e-

Fluorescence and chemiluminescence

Detection System

Pr

Method

oo

Table 1. A comparison between the Figures of merit of this study and different articles for miRNAs determination

‒

4.0×10-12 M

[47]

[48]

[51]

This work

3.5. Selectivity: Since small mutations (point mutations) in mature microRNAs (miRNAs) are infrequent, the selectivity of the sensing platform had to be investigated with a few different sequences such as miRNA-16, miRNA-136, and miRNA-206 as the negative control targets at an equal concentration (10 nM) [52]. As shown in Fig. 5, the designed

of

nano-bioprobe has preferred miRNA-21 compared to miRNA-16, miRNA-206 and miRNA-136 which can confirm the high selectivity of designed nano-bioprobe toward

ur na

lP

re

-p

ro

the miRNA-21 as a critical advantage for clinical application.

Jo

Fig. 5. Selectivity evaluation of the developed FRET for miRNA-21 versus different miRNA analogues (All concentrations were 10 nM). I0 is the fluorescence intensity in the absence of any target, and I is the intensity emission obtained from the Cy-5.5 probe in the presence of 10 nM miRNA-21 and each interfering substance.

3.6. Determination of purified miRNA-21 from serum as Real sample assay: Commercial available kits are known as facile and time-saving assays for the

16

determination of miRNAs in various cell samples. Thus, each suggested biosensor developed as an alternative to these kits, should also provide acceptable performance against real samples. To examine these properties, the as-designed nano-bioprobe response was investigated by quantification of purified miRNA-21 from a series of serum samples. The designed fluorescence probes interacted with these real samples in the same hybridization buffer which was used in the previous steps to form a DNA/RNA FRET

of

structure. The recovery amounts from this determination were calculated and reported in

ro

Table 2. As seen, the recovery of 97 to 105% (RSD= 0.81-2.06%) for the determination of the extracted real miRNA-21 was manifesting the feasibility and effectiveness of the

-p

proposed method as a sensitive detection model for real miRNA samples analyzing

re

without any degradation of miRNAs from endogenous ribonucleases. Table 2. Study of miRNA-21 recovery by the developed FRET-based DNA-AgNCs for spiked different concentrations of purified samples

Added Concentration (µmol)

1

1.0×10-3 5.0×10-3 10.0×10-3

ur na

0.00 ± 0.03

Detected Concentration(µmol) (SD*) by the developed method (0.97±0.02)×10-3 (5.25±0.05)×10-3 (9.92±0.08)×10-3

lP

Sample Primary miRNA-21 (µmol)

Recovery (%)

RSD (%)

97% 105% 99%

2.06 0.90 0.81

*: Standard deviation of three replicate **:Relative Standard Deviation

Jo

Conclusions:

Since the expression levels of miRNAs are correlated with metastatic potentials,

therapeutic responses, and clinical status in various types of cancer, we developed a FRET-based miRNA-21 assay based on the AgNCs stabilized in DNA template-based fluorescence for a rapid miRNA diagnostic. This designed system demonstrated high

17

sensitivity for miRNA-21 detection at the concentrations down to 100.0 nM with a LOD of 4.0×10-3 nM at room temperature with no further amplification process. It is noteworthy that the DNA-Cy5.5 NIR enhanced emission can successfully attenuate any false positive signal that usually occurred during clinical miRNAs analysis. In addition, this homogeneous method exhibited high selectively to detect purified miRNA-21 obtained from real serum samples. Based upon the satisfactory results obtained from this

of

FRET-based nano-biosystem developed for miRNA-21 analysis in both aqueous solution

ro

and real samples, we strongly believe that this probe has promising potentials to be

introduced as a multiplex miRNAs detection pathway, and alternative for conventional

-p

(e.g., Northern blot analysis) or other emerging nanotechnology-based diagnostic

lP

re

techniques.

ur na

Conflicts of Interest: The authors declare no conflict of interest.

Jo

Acknowledgment

The authors would like to acknowledge the support of this work by the Research

Councils of Razi University and Kermanshah University of Medical Sciences, Kermanshah, Iran, Iran.

18

19

of

ro

-p

re

lP

ur na

Jo

Refrences:

Jo

ur na

lP

re

-p

ro

of

[1] J. Brennecke, D.R. Hipfner, A. Stark, R.B. Russell, S.M. Cohen, bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila, Cell, 113(2003) 25-36. [2] M.V. Joglekar, V.M. Joglekar, A.A. Hardikar, Expression of islet-specific microRNAs during human pancreatic development, Gene Expr Patterns, 9(2009) 109-13. [3] C.-Z. Chen, L. Li, H.F. Lodish, D.P. Bartel, MicroRNAs modulate hematopoietic lineage differentiation, science, 303(2004) 83-6. [4] Y. Wang, D.N. Keys, J.K. Au‐ Young, C. Chen, MicroRNAs in embryonic stem cells, J Cell Physiol, 218(2009) 251-5. [5] W.C. Cho, MicroRNAs in cancer—from research to therapy, Biochim Biophys Acta Rev Cancer, 1805(2010) 209-17. [6] Y. Hiyoshi, H. Kamohara, R. Karashima, N. Sato, Y. Imamura, Y. Nagai, et al., MicroRNA-21 regulates the proliferation and invasion in esophageal squamous cell carcinoma, Clin Cancer Res, 15(2009) 1915-22. [7] T. Thum, C. Gross, J. Fiedler, T. Fischer, S. Kissler, M. Bussen, et al., MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts, Nature, 456(2008) 980-4. [8] F. Meng, R. Henson, H. Wehbe–Janek, K. Ghoshal, S.T. Jacob, T. Patel, MicroRNA21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer, Gastroenterology, 133(2007) 647-58. [9] G. Gabriely, T. Wurdinger, S. Kesari, C.C. Esau, J. Burchard, P.S. Linsley, et al., MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators, Mol Cell Biol, 28(2008) 5369-80. [10] G.-Y. Wang, M.R. Bergman, A.P. Nguyen, S. Turcato, P.M. Swigart, M.C. Rodrigo, et al., Cardiac transgenic matrix metalloproteinase-2 expression directly induces impaired contractility, Cardiovasc Res, 69(2006) 688-96. [11] S. Zhu, M.-L. Si, H. Wu, Y.-Y. Mo, MicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1), J Biol Chem, 282(2007) 14328-36. [12] T. Papagiannakopoulos, A. Shapiro, K.S. Kosik, MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells, Cancer Res, 68(2008) 8164-72. [13] A. Markou, E.G. Tsaroucha, L. Kaklamanis, M. Fotinou, V. Georgoulias, E.S. Lianidou, Prognostic value of mature microRNA-21 and microRNA-205 overexpression in non–small cell lung cancer by quantitative real-time RT-PCR, Clin Chem, 54(2008) 1696-704. [14] K. Ruan, X. Fang, G. Ouyang, MicroRNAs: novel regulators in the hallmarks of human cancer, Cancer Lett, 285(2009) 116-26. [15] S.W. Kim, Z. Li, P.S. Moore, A.P. Monaghan, Y. Chang, M. Nichols, et al., A

20

Jo

ur na

lP

re

-p

ro

of

sensitive non-radioactive northern blot method to detect small RNAs, Nucleic Acids Res, 38(2010) e98. [16] C. Chen, D.A. Ridzon, A.J. Broomer, Z. Zhou, D.H. Lee, J.T. Nguyen, et al., Realtime quantification of microRNAs by stem–loop RT–PCR, Nucleic Acids Res, 33(2005) e179-e. [17] J.Q. Yin, R.C. Zhao, K.V. Morris, Profiling microRNA expression with microarrays, Trends Biotechnol, 26(2008) 70-6. [18] Y. Cheng, X. Zhang, Z. Li, X. Jiao, Y. Wang, Y. Zhang, Highly sensitive determination of microRNA using target‐ primed and branched rolling‐ circle amplification, Angew Chem, 121(2009) 3318-22. [19] H. Jia, Z. Li, C. Liu, Y. Cheng, Ultrasensitive detection of microRNAs by exponential isothermal amplification, Angew Chem Int Ed, 49(2010) 5498-501. [20] L.F. Sempere, E.B. Dubrovsky, V.A. Dubrovskaya, E.M. Berger, V. Ambros, The expression of the let-7 small regulatory RNA is controlled by ecdysone during metamorphosis in Drosophila melanogaster, Dev Biol, 244(2002) 170-9. [21] W. Li, K. Ruan, MicroRNA detection by microarray, Anal Bioanal Chem, 394(2009) 1117-24. [22] T. Babak, W. Zhang, Q. Morris, B.J. Blencowe, T.R. Hughes, Probing microRNAs with microarrays: tissue specificity and functional inference, Rna, 10(2004) 1813-9. [23] P.A. Maroney, S. Chamnongpol, F. Souret, T.W. Nilsen, Direct detection of small RNAs using splinted ligation, Nat Protoc, 3(2008) 279-87. [24] H. Wang, H. Tang, C. Yang, Y. Li, Selective Single Molecule Nanopore Sensing of microRNA Using PNA Functionalized Magnetic Core-shell Fe3O4-Au Nanoparticles, Anal chem, 91(2019) 7965-70. [25] Q. Feng, M. Wang, X. Zhao, P. Wang, Construction of a cytosine-adjusted electrochemiluminescence resonance energy transfer system for microRNA detection, Langmuir, 34(2018) 10153-62. [26] H. Li, J. Chang, P. Gai, F. Li, Label-free and ultrasensitive biomolecule detection based on aggregation induced emission fluorogen via target-triggered hemin/Gquadruplex-catalyzed oxidation reaction, ACS Appl Mater Interfaces, 10(2018) 4561-8. [27] Y.Q. Liu, M. Zhang, B.C. Yin, B.C. Ye, Attomolar ultrasensitive microRNA detection by DNA-scaffolded silver-nanocluster probe based on isothermal amplification, Anal Chem, 84(2012) 5165-9. [28] J. Li, X. Zhong, H. Zhang, X.C. Le, J.J. Zhu, Binding-induced fluorescence turn-on assay using aptamer-functionalized silver nanocluster DNA probes, Anal Chem, 84(2012) 5170-4. [29] M. Shamsipur, F. Molaabasi, S. Hosseinkhani, F. Rahmati, Detection of Early Stage Apoptotic Cells Based on Label-Free Cytochrome c Assay Using Bioconjugated Metal Nanoclusters as Fluorescent Probes, Anal Chem, 88(2016) 2188-97. [30] S.A. Bogh, C. Cerretani, L. Kacenauskaite, M.R. Carro-Temboury, T. Vosch, Excited-State Relaxation and Förster Resonance Energy Transfer in an Organic Fluorophore/Silver Nanocluster Dyad, Acs Omega, 2(2017) 4657-64. [31] D. Schultz, S.M. Copp, N. Markeˇsevic, K. Gardner, S.S. Oemrawsingh, D. Bouwmeester, et al., Dual-color nanoscale assemblies of structurally stable, few-atom silver clusters, as reported by fluorescence resonance energy transfer, ACS nano, 7(2013) 9798-807.

21

Jo

ur na

lP

re

-p

ro

of

[32] R. Gill, I. Willner, I. Shweky, U. Banin, Fluorescence resonance energy transfer in CdSe/ZnS− DNA conjugates: probing hybridization and DNA cleavage, J Phys Chem B, 109(2005) 23715-9. [33] W. Lu, X. Qin, Y. Luo, G. Chang, X. Sun, CdS quantum dots as a fluorescent sensing platform for nucleic acid detection, Microchim Acta, 175(2011) 355-9. [34] P. Liu, X. Hun, H. Qing, Dendrimer-based biosensor for chemiluminescent detection of DNA hybridization, Microchim Acta, 175(2011) 201-7. [35] J. Xing, H.C. Cheung, Internal movement in myosin subfragment 1 detected by fluorescence resonance energy transfer, Biochemistry, 34(1995) 6475-87. [36] S. Lu, S. Wang, J. Zhao, J. Sun, X. Yang, Fluorescence Light-Up Biosensor for MicroRNA Based on the Distance-Dependent Photoinduced Electron Transfer, Anal Chem, 89(2017) 8429-36. [37] X. Miao, Z. Cheng, H. Ma, Z. Li, N. Xue, P. Wang, Label-free platform for microRNA detection based on the fluorescence quenching of positively charged gold nanoparticles to silver nanoclusters, Anal chem, 90(2017) 1098-103. [38] C. Cerretani, H. Kanazawa, T. Vosch, J. Kondo, Crystal structure of a NIR‐ emitting DNA‐ stabilized Ag16 nanocluster, Angew Chem Int Ed, 58(2019) 17153-7. [39] D.J. Huard, A. Demissie, D. Kim, D. Lewis, R.M. Dickson, J.T. Petty, et al., Atomic Structure of a Fluorescent Ag8 Cluster Templated by a Multistranded DNA Scaffold, J Am Chem Soc, 141(2018) 11465-70. [40] C.I. Richards, S. Choi, J.-C. Hsiang, Y. Antoku, T. Vosch, A. Bongiorno, et al., Oligonucleotide-stabilized Ag nanocluster fluorophores, J Am Chem Soc, 130(2008) 5038-9. [41] J.T. Petty, J. Zheng, N.V. Hud, R.M. Dickson, DNA-templated Ag nanocluster formation, J Am Chem Soc, 126(2004) 5207-12. [42] W. Wang, L. Zhan, Y.Q. Du, F. Leng, Y. Chang, M.X. Gao, et al., Label-free DNA detection on the basis of fluorescence resonance energy transfer from oligonucleotidetemplated silver nanoclusters to multi-walled carbon nanotubes, Anal Methods, 5(2013) 5555-9. [43] F. Samari, B. Hemmateenejad, Z. Rezaei, M. Shamsipur, A novel approach for rapid determination of vitamin B12 in pharmaceutical preparations using BSA-modified gold nanoclusters, Anal Methods, 4(2012) 4155-60. [44] P. Yakovchuk, E. Protozanova, M.D. Frank-Kamenetskii, Base-stacking and basepairing contributions into thermal stability of the DNA double helix, Nucleic Acids Res, 34(2006) 564-74. [45] A.F.-j. Jou, C.-H. Lu, Y.-C. Ou, S.-S. Wang, S.-L. Hsu, I. Willner, et al., Diagnosing the miR-141 prostate cancer biomarker using nucleic acid-functionalized CdSe/ZnS QDs and telomerase, Chem Sci, 6(2015) 659-65. [46] X. Qiu, N. Hildebrandt, Rapid and multiplexed microRNA diagnostic assay using quantum dot-based forster resonance energy transfer, ACS nano, 9(2015) 8449-57. [47] S.W. Yang, T. Vosch, Rapid detection of microRNA by a silver nanocluster DNA probe, Anal chem, 83(2011) 6935-9. [48] J. Park, J.-S. Yeo, Colorimetric detection of microRNA miR-21 based on nanoplasmonic core–satellite assembly, Chem Comm, 50(2014) 1366-8. [49] Y. Wu, J. Han, P. Xue, R. Xu, Y. Kang, Nano metal–organic framework (NMOF)based strategies for multiplexed microRNA detection in solution and living cancer cells,

22

Jo

ur na

lP

re

-p

ro

of

Nanoscale, 7(2015) 1753-9. [50] M. Hosseini, A. Akbari, M.R. Ganjali, M. Dadmehr, A.H. Rezayan, A novel labelfree microRNA-155 detection on the basis of fluorescent silver nanoclusters, J Fluoresc, 25(2015) 925-9. [51] P. Shah, A. Rørvig-Lund, S.B. Chaabane, P.W. Thulstrup, H.G. Kjaergaard, E. Fron, et al., Design aspects of bright red emissive silver nanoclusters/DNA probes for microRNA detection, ACS nano, 6(2012) 8803-14. [52] S.Q. Lv, Y.H. Kim, F. Giulio, T. Shalaby, S. Nobusawa, H. Yang, et al., Genetic alterations in microRNAs in medulloblastomas, Brain Pathol, 22(2012) 230-9.

23

Vahid Nasirian has completed his PhD in Analytical chemistry at Razi university, Kermanshah, Iran under supervision Prof. Mojtaba Shamsipur. His interests include synthesis and application of fluorescent nanoparticles particularly, and modification of them by biomolecules for development of optical nanoprobes. Now, he is working at Louisiana State University of Shreveport (LSUS) to study on new anti-cancer drugs.

ro

of

Mojtaba Shamsipur has a PhD in analytical chemistry obtained at Michigan State University in 1979. He is currently a professor of chemistry at Razi University, Kermanshah, Iran. His research work has been mainly focused on the thermodynamic and kinetic studies of macrocyclic ligand complexes, and their analytical applications in areas such as ion-transport through liquid membranes, solid-phase extraction, ion-selective-electrodes and, especially, optical sensors. He has published over 870 scientific papers in international journals.

re

-p

Fatemeh Molaabasi has received her PhD in Chemistry from Trabiat Modarres University in 2015 under the supervision of Prof. Shamsipur. She is currently a postdoctoral member of Shamsipur’s research group to study about synthesis and characterization of different protein capped noble metal nanocusters and their applications to develop new fluorescence biosensing and bio-imaging systems.

ur na

lP

Kamran Mansouri is Assistant Professor of Molecular Medicine, Kermanshah University of Medical Sciences. He has received his Ph.D. degree in Molecular Medicine from Tehran University of Medical Sciences (2016). His Research Areas are Angiogenesis, Cancer and Cellular Metabolism, Stem Cells and had published more than 112 articles in the international scientific journals and a book about Angiogenesis. Mansouri is currently Dean of Medical Biology Research Center of Kermanshah University of Medical Sciences, Kermanshah, Iran.

Jo

Morteza Sarparast received the B.Sc. degree in Chemistry from Isfahan University, Iran, in 2012, and M.S degree in Analy!cal Chemistry from Tarbiat Modares University, Tehran, Iran, in 2015. He is currently working toward the Ph.D. degree in chemistry at Michigan State University, MI, USA. His current research interest is applica!on of bio-nanomaterial in medical diagnos!cs and therapy,

Morteza Sarparast received the B.Sc. degree in Chemistry from Isfahan University, Iran, in 2012, and M.S degree in Analytical Chemistry from Tarbiat Modares University, Tehran, Iran, in 2015. He is currently working toward the Ph.D. degree in chemistry at

24

Michigan State University, MI, USA. His current research interest is applicaton of bionanomaterial in medical diagnostics and therapy.

of

Vonny Salim received her PhD in biotechnology at Brock University, Ontario, Canada in 2013. She held a postdoctoral appointment at Michigan State University. She is currently an assistant professor at Louisiana State University in Shreveport. Her research is focused on the functional genomics, biochemistry, and enzymology of natural product biosynthesis, such as plant alkaloids with anticancer properties, as well as understanding cellular machineries of plant specialized metabolism for pathway elucidation using molecular tools.

re

-p

ro

Ali Barati has PhD in analytical chemistry from Institute for Advanced Studies in Basic Sciences (IASBS) PhD under the supervision of Prof. Shamsipur and Prof. Abdollahi. His interest include synthesis and application of fluorescent nanoparticles particularly Carbon Dots and Quantum Dots, and also utilizing chemometrics methods in analytical applications of these fluorescent nanoparticles.

Jo

ur na

lP

Soheila Kashanian has a Ph.D in clinical biochemistry. She is currently a professor of chemistry at Razi University, Kermanshah, Iran and her current research interest is nanobiotechnology including nanobiosensor design and drug delivery especially anticancer drugs in combination targeted therapies to culminate the opportunity to move her research from in vitro to in vivo trials.

25